WO2021180906A1 - Aptamers for detecting plasmodium-infected red blood cells - Google Patents

Abstract

A nucleic acid aptamer that binds to Plasmodium-infected cells and does not bind to Plasmodium-free cells, having a length between 30 and 200 nucleotides, and comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-25 is provided. The aptamers can be applied in malaria diagnostic devices as components of RDT to e.g. detect the presence of, measure the amount of Plasmodium species, identify or diagnose subjects with a Plasmodium infection and in need of treatment, to monitor the progress of a Plasmodium infection, to monitor the progress or effectiveness of treatment of a Plasmodium infection.

Description

TITLE: Aptamers for detecting Plasmodium-infected red blood cells

This application claims the benefit of European Patent Application EP20382190.5 filed on March 13, 2020.

FIELD OF THE INVENTION

The present invention refers to the field of medicine and diagnostics and particularly to nucleic acid aptamers with the capability of binding specifically to Plasmodium-infected red blood cells and methods and uses thereof.

BACKGROUND ART

Malaria, a parasitic disease caused by different species of Plasmodium, is one of the main causes of mortality in the tropical and subtropical world population. Although five species cause illness in humans, the most virulent and fatal is Plasmodium falciparum, especially when the infection occurs in young children and pregnant women.

The World Health Organization (WHO) Global Technical Strategy for Malaria 2016-2030 lists the universal access to malaria diagnosis as an essential part of the strategic framework that should eventually lead to eradicating the disease, since knowing parasitemia and parasite species is crucial in order to select the most appropriate drug treatment.

Currently, national malaria programs rely on light microscopy and rapid diagnostic tests (RDTs), which are not sensitive enough to detect low parasite density infections (sub-microscopic malaria in which patients are usually asymptomatic) that are crucial in the transmission dynamics. Molecular techniques can detect sub-microscopic malaria, but are inadequate for massive use because of elevated costs or need for highly trained staff. Therefore, new diagnostic methods are needed if the objective is to advance towards malaria eradication.

Although the parasite synthesizes a vast array of molecules to remodel its host red blood cell (RBC), those exported to the cell surface undergo rapid antigenic variation. This fast turnover of exposed antigens counsels a constant search for new therapeutic agents and diagnosis targets. Most current strategies for the identification of specific molecular tags in the malaria parasite or in Plasmodium- infected RBCs (pRBCs) rely on a detailed knowledge of the pathogen’s physiology and of the pRBC biochemistry or the use of time-consuming and expensive immunological methods such as antibody generation. Antibody production often involves the use of laboratory animals and is time-consuming and costly, especially when the target is Plasmodium, whose variable antigen expression complicates the development of long-lived biomarkers. Alternatively, binding specificities and affinities comparable to those of monoclonal antibodies can be obtained with aptamers, short single-stranded (ss) oligonucleotides capable of specific ligand recognition, much faster and cheaper to produce without having to resort to the use of laboratory animals.

P. falciparum histidine-rich protein II (PfHRP-ll) is widely used as target antigen for specific detection of this species of the parasite, although some reports have claimed variable results on the use of PfHRP-ll-based RDTs. PfHRP-ll is secreted by the parasite and it could be present in the plasma after the parasite has been eliminated, which could lead to false positives in diagnostic tests. In addition, evidences of mutation and deletion of the PfHRP-ll gene counsels caution on the use of this biomarker for falciparum malaria, which led the WHO to recommend researching alternative targets and methods for detection of P. falciparum.

In this regard, Plasmodium glutamate dehydrogenase (PGDH) and lactate dehydrogenase (PLDH) have received increased attention as specific biomarkers for which aptamers have been developed. Human-infecting plasmodia produce GDH and LDH, whose blood concentration correlates with parasitemia and decreases along patient therapeutic treatment. All Plasmodium species infecting humans produce both enzymes, but these are sufficiently variable to allow species-specific recognition. Accordingly, PLDH has been proposed as a biomarker for parasitemia estimation, species identification, and treatment response monitoring, and aptamers raised against falciparum PLDH exhibited a Kd around 40 nM [Cheung et al., 2013]; however, this good Kd was obtained using the purified protein, which is a very different scenario from the complex matrix that will be encountered in RDT detection of clinical samples.

Aptamers against PLDH are described e.g. in US9000137B2, WO201911382A1 and EP2532749B1 . Aptamers against PGDH are described e.g. in IN201631025722A. These aptamers (i.e. PGDH and PLDH) have been developed against individual purified proteins, and therefore incurthe risk of a loss in antigen binding efficacy if the molecular targets mutate or exhibit variant expression.

In spite of these developments, all commercially available malaria diagnostic kits rely on the use of antibodies against the targets mentioned above (e.g. OptiMAL-IT, Paracheck Pf, BinaxNOW®) and are not based on the use of aptamers against Plasmodium. As said before, antibody production involves the use of laboratory animals and is time-consuming and costly, while aptamers are cheaper and faster to produce and are far more stable in dry storage conditions. In malaria endemic countries, stability of the diagnostic kits is a key issue as antibodies are more sensitive than aptamers to high temperatures and humidity.

In spite of the World Health Organization objective of achieving malaria eradication, the available diagnostic tools fail to meet the requirements for an eradication strategy: rapidity, cost-efficiency, submicroscopic parasite detection, field reliability and ease of use. Therefore, new bioreceptors will have to be developed in order to increase the sensitivity of current antigen-based malaria rapid diagnosis.

SUMMARY OF THE INVENTION

One problem to be solved by the present invention may be seen as related to the provision of new markers and methods for malaria diagnosis.

The solution is based on the provision of DNA aptamers against red blood cells infected by Plasmodium, that provide a method for malaria diagnosis/prognosis and monitoring of treatment.

To circumvent the obstacles of the art, the inventors have applied the Systematic Evolution of Ligands by Exponential (SELEX) enrichment method to the rapid identification of DNA aptamers against Plasmodium falciparum- infected red blood cells (pRBCs). Particularly, they have applied a cell- SELEX approach, which, in addition to individual proteins, might also produce aptamers targeting (i) molecular landscapes present in several parasite molecules or (ii) non-proteinaceous antigens, such as lipids, nucleic acids or polysaccharides. The high sensitivity of the SELEX process required the development of special protocols to avoid the selection of aptamers against unwanted epitopes, e.g. those present on red blood cells and specific of particular blood groups. In addition, due to the high antigen variability that Plasmodium has, the strategy for this selection was optimized to have the most homogeneous samples along the rounds of selection, to avoid loss of potential target antigens with culturing time. The PCR-amplified original aptamer library exhibited binding to pRBCs relative to uninfected erythrocytes, thus the number of selection rounds was chosen to provide an increased binding to pRBCs compared to these oligonucleotides.

Five 70 b-long ssDNA sequences, and their shorter forms without the flanking PCR primer-binding regions, have been identified having a highly specific binding of pRBCs (ranging from 84.5 to 95.2% of labeling) versus non-infected erythrocytes (from 0.06 to 0.00% of labeling). Structural analysis revealed G-enriched sequences compatible with the formation of G-quadruplexes.

The working examples herein provided demonstrate that the selected aptamers recognized intracellular epitopes with apparent Kds in the pM range in both fixed and non-fixed saponin-permeabilized pRBCs, indicating that the recognized epitope is not an artifact from the fixation process and can be identified with fresh cell extracts. Remarkably, the apparent Kd range from 0.46 ± 0.08 to 1 .77 ± 0.15 pM for both full-length and shortened aptamers raised against pRBCs is comparable to values reported for aptamers generated against Salmonella typhimurium.

To the best of inventors’ knowledge, all available Kd values in the nM range reported for PLDH aptamers were obtained with techniques that used the purified enzyme: isothermal titration calorimetry, electrophoretic mobility shift assay and surface plasmon resonance spectroscopy [Cheung et al., 2013] When exposed to whole cells in vitro, all the aptamers provided herein bound P. falciparum-infected erythrocytes >30-fold better than the aptamers raised against Plasmodium LDH (PLDH 2008s aptamer).

The obtained aptamers against P. falciparum target late blood stages, mostly trophozoites and schi- zonts. This might limit diagnostic applications, since a clinical P. falciparum infection mainly has early blood stages in the blood circulation. However, according to dot blot assays of in vitro cultures and fluorescence microscopy analysis of clinical samples, the selected aptamers target ring stages as well. Late stages can also be found in circulation as result of an apparent reduction or delay in sequestration, usually in high parasitemia P. falciparum infections, but occasionally also in asymptomatic cases.

Thus, in thin blood smears of clinical samples the aptamers specifically bound all P. falciparum stages vs. non-infected erythrocytes, and also detected early and late stages of the human malaria parasites Plasmodium vivax, Plasmodium ovale and Plasmodium malariae. The observation that the herein provided aptamers bind also erythrocytes infected by P. vivax, P. malariae and P. ovale indicates that their potential applications will be in pan-malaria diagnosis. Further, as opposed to using the purified molecular target, selection of aptamers against whole target cells allows the detection of the most abundant Plasmodium antigens.

Accordingly, a first aspect of the invention relates to a nucleic acid aptamerthat binds to Plasmodium- infected cells and does not bind to Plasmodium-free cells, having a length between 30 and 200 nucleotides, comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1- 25.

In a second aspect, the invention provides a nucleic acid aptamerthat binds to Plasmodium-infected cells and does not bind to Plasmodium-free cells, having a length between 30 and 200 nucleotides, comprising a nucleotide sequence having at least a 70% identity with a sequence selected from the group consisting of SEQ ID NO: 1-25, wherein the nucleic acid aptamer sequence has a G-score higher than 20.

The aptamers of the invention can be applied in malaria diagnostic devices as components of future RDT devices. Diagnostic platforms with the aptamers herein provided are simple, stable and easy- to-use, since only require a cell permeabilization agent included in the corresponding buffers.

For detection and diagnostics purposes, the aptamer can be conjugated with e.g. a detectable label and/ adsorbed onto a solid matrix. In this sense, another aspect of the invention relates to an in vitro method for detecting the presence of Plasmodium in a sample, comprising: (i) contacting the sample with an aptamer as defined, (ii) detecting the presence of a complex between the aptamer and Plasmodium or Plasmodium antigens, wherein the presence of the complex indicates the presence of Plasmodium in the sample. Another aspect relates to an in vitro method for the diagnosis of a Plasmodium infection in a subject, comprising: (i) contacting a biological sample from the subject with an aptamer as defined, (ii) detecting the presence of a complex between the aptamer and Plasmodium-infected cells, wherein the presence of the complex indicates that the subject has a Plasmodium infection.

Another aspect relates to an in vitro method for the prognosis of a Plasmodium infection in a subject, comprising: (i) contacting a biological sample from the subject with an aptamer as defined, (ii) detecting the presence of a complex between the aptamer and Plasmodium-infected cells; (iii) determining the concentration or amount of the complex; wherein a reduction in the concentration or amount of the complex relative to an earlier determination indicates a good prognosis, and an increase in the concentration or amount of the complex relative to an earlier determination indicates a bad prognosis.

Other aspects of embodiments of the invention are explained in the detailed description of the invention.

DESCRIPTION OF THE DRAWINGS

FIG. 1 shows a scheme of the SELEX process used to obtain DNA aptamers against late-stage pRBCs.

FIG. 2 shows the progressive selection of pRBC-binding aptamers along the SELEX cycles. Flow cytometry analysis of in vitro P. falciparum cultures treated with 6-Carboxyfluorescein (6-FAM)-la- beled aptamer pools selected after SELEX rounds 3, 6, 9 and 10. pRBCs were identified with Hoechst 33342 as nuclear staining, and the oligonucleotides were labeled with 6-FAM for the analysis of the binding. The cells used here belonged to a new fixed cell batch different from that used for the SELEX cycles a.u.: arbitrary units.

FIG. 3 shows the sequences of the five oligonucleotides whose PCR amplifications using 6-FAM- labeled forward primers showed pRBC binding specificity vs. non-infected RBCs. The PCR primerbinding sequences are indicated in bold; non-bold sequences correspond to the aptamers 19s, 24s, 30s, 77s and 78s. Shadowed in grey are the bases predicted to form G-quadruplexes.

FIG. 4 shows pRBC vs. non-infected RBC binding specificity analysis in fixed P. falciparum cultures of the chemically synthesized aptamers labeled with 6-FAM at the 5’ end. Quantitative flow cytometry analysis of aptamer targeting. Late-stage pRBCs are represented in the upper quadrants, identified with the nuclear stain Hoechst 33342, and 6-FAM-aptamer-bound cells are located in the right-hand quadrants. The cells used here belonged to a new fixed cell batch different from that used during the SELEX cycles a.u.: arbitrary units. HI: Hoechst intensity; FI: Fluorescence intensity. Un: unstained sample; Ho: sample stained only with Hoechst.

FIG. 5 shows the dot-blot test of the presence in P. falciparum extracts of the epitope recognized by 6-FAM-labeled aptamer 19. Saponin, Triton X-100, and RIPA buffer extracts were obtained at different hours post-invasion (hpi) from a P. falciparum in vitro culture initially synchronized at ring stages. Each dot contains 0.4 pg of protein in 2 pi of complete PBS, containing 1 x Mini Protease Inhibitor Cocktail (complete™, Roche; one tablet in 10.5 ml for 1 x concentration). The controls include 2.4 pmol of biotin-labeled aptamer 19 and 0.4 pg of BSA, both in 2 mI of PBS complete™, plus the same volume of plain buffer.

FIG. 6 shows pRBC vs. non-infected RBC binding specificity analysis in non-fixed, saponin-perme- abilized P. falciparum cultures of the chemically synthesized aptamers labeled with 6-FAM at the 5’ end. (C) Quantitative flow cytometry analysis of aptamer targeting. The cells used here belonged to a new fixed cell batch different from that used during the SELEX cycles a.u.: arbitrary units. HI: Hoechst intensity; FI: Fluorescence intensity. Un: unstained sample; Ho: sample stained only with Hoechst.

FIG. 7 shows SDS-PAGE and Western blot analysis of aptamer binding. (A) Western blot of late- stage P. falciparum cultures probed with the selected 6-FAM-labeled aptamers. Since the band pattern was identical for all aptamers, some of them are not shown. (B) 12.5% SDS-PAGE lane where the same late-stage extract was loaded but not blotted; instead, it was directly probed with 6-FAM- labeled aptamer 30s. The three bands indicated were separately excised and subjected to LC- MS/MS analysis.

FIG. 8 shows the fluorescence microscopy analysis of falciparum malaria clinical samples. Thin blood smears of a P. falciparum infection probed with 6-FAM-labeled aptamer 24. (A) Ring stages. (B) Late blood stage.

FIG. 9 shows the fluorescence microscopy analysis of malariae, ovale, and vivax malaria clinical samples. Thin blood smears of P. malariae, P. ovale and P. vivax infections probed with 6-FAM- labeled aptamers. (A) Ring stages. (B) Late blood stages.

FIG. 10 shows the 2-D structure analysis of the five selected aptamers.

FIG. 11 shows the quantitative flow cytometry analysis of 6-FAM-aptamer targeting to live, non-per- meabilized RBCs (lower quadrants) and pRBCs (upper quadrants) a.u.: arbitrary units. HI: Hoechst intensity; FI: Fluorescence intensity. Un: unstained sample; Ho: sample stained only with Hoechst.

FIG. 12 shows the curves representing aptamer recognition of different protein concentrations from pRBC and RBC extracts, used in a direct ELONA. The aptamer used for recognition was 30s- biotinylated, and the signal was provided by streptavidin-HRP conjugate recognition of the aptamer and luminescence production with HRP substrate a.u.: arbitrary units.

FIG. 13 shows the curves representing aptamer recognition of different protein concentrations from pRBC extracts, used in a sandwich-style ELONA. The upper panel shows the results using signaling aptamer 30s-biotinylated, and the lower panel shows the results using signaling aptamer 19-biotinyl- ated. The signal was provided by streptavidin-HRP conjugate recognition of the aptamer and luminescence production with HRP substrate. Different capture aptamers (78, 78s, 19, 19s, 30 and 30s) were used btn: biotinylated a.u.: arbitrary units.

DEFINITIONS

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art. Methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. Throughout the description and claims the word "comprise" and its variations such as "comprising" are not intended to exclude other technical features, additives, components, or steps. In order that the present description can be more readily understood, certain terms are defined. Additional definitions are set forth throughout the detailed description.

Aptamer: As used herein, the term "aptamer" refers to a single-stranded nucleic acid chain adopting a specific tertiary structure that allows it to bind to a molecular target with high specificity and affinity, comparable to that of a monoclonal antibody, through interactions other than conventional Watson- Crick base pairing. Once folded under physiological conditions, aptamers acquire unique three-dimensional structures based on their nucleotide sequence, being the tertiary structure of aptamers that confers the selectivity and affinity for their targets.

Nucleic acid: "Nucleic acid," "nucleic acid molecule," "nucleotide sequence," "polynucleotide," and grammatical variants thereof are used interchangeably and refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribo- nucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix.

Single stranded nucleic acid sequences refer to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences can be described herein according to the normal convention of giving only the sequence in the 5’ to 3’ direction along the non-transcribed strand of DNA (i.e. , the strand having a sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. A "nucleic acid composition" of the disclosure can comprise one or more nucleic acids (e.g., nucleic acid ap- tamers) as described herein.

Aptamer binding site: The term "aptamer binding site" refers to a region in Plasmodium comprising a continuous or discontinuous site (i.e., an epitope) to which a complementary aptamer specifically binds. Thus, the aptamer binding site can contain additional areas in the Plasmodium antigen/s sequence which are beyond the epitope and which can determine properties such as binding affinity and/or stability, or affect properties such as antigen enzymatic activity or dimerization. Accordingly, even if two aptamers bind to the same epitope within Plasmodium, if the aptamers establish distinct intermolecular contacts with amino acids outside of the epitope, such aptamers are considered to bind to distinct aptamer binding sites.

Binding: The term "binding" refers to a physical interaction between at least two entities, e.g., an aptamer and its target epitope, an aptamer and a target protein, or an aptamer and a target cell.

Binding affinity: "Binding affinity" generally refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an aptamer of the present disclosure) and its binding partner (e.g., Plasmodium antigen/s). Unless indicated otherwise, as used herein, "binding affinity" refers to intrinsic binding affinity which reflects a 1 :1 interaction between members of a binding pair (e.g., aptamer and Plasmodium antigen/s). The affinity of a molecule X for its partner Y can generally be represented by its Ka (association constant) or its dissociation constant (Kd), which is the inverse of the association constant. Affinity can be measured by common methods known in the art, including those described herein. Low-affinity binding molecules, e.g., low-affinity aptamers, generally bind slowly to the target epitope and tend to dissociate readily, whereas high- affinity molecules, e.g., high-affinity aptamers, generally bind to the target epitope faster and tend to remain bound longer. A variety of methods of measuring binding affinity are known in the art, any of which can be used for purposes of the present disclosure.

Binding specificity: The terms "specificity" or "binding specificity" refer to the ability of a binding molecule, e.g., an aptamer of the present disclosure, to bind preferentially to an epitope versus a different epitope and does not necessarily imply high affinity. The terms "binding specificity" and "specificity" are used interchangeably and can refer both to (i) a specific portion of a binding molecule (e.g., an aptamer), and (ii) the ability of the binding molecule to specifically bind to a particular epitope. A binding molecule, e.g., an aptamer, "specifically binds" when there is a specific interaction between the aptamer and its target epitope. The term "specifically binds" means that the aptamer has been generated to bind to its target epitope. The term "non-specific binding" means that an aptamer has not been generated to specifically bind to a target epitope but does somehow bind to the epitope through non-specific means.

Variant/derivative/derived from: The terms "variant," "derived from," "derivative" (e.g., "nucleic acid derivative" or "aptamer derivative"), or any grammatical variant thereof, as used herein, refer to a component that is isolated from or made using a specified molecule (e.g., a nucleic acid aptamer of the present disclosure). For example, a nucleic acid sequence (e.g., aptamer) that is derived from a first nucleic acid sequence (e.g., a parent aptamer) can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the first nucleic acid sequence. In the case of nucleotides, the derived species can be obtained by, e.g., naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis. The mutagenesis used to derive nucleotides can be intentionally directed or intentionally random, or a mixture of each. The mutagenesis of a nucleotide to create a different nucleotide derived from the first can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived nucleotide can be made by appropriate screening methods. In some embodiments, the derived nucleotide sequences of the present disclosure can be generated, e.g., using combinatorial chemistry, chemically modifying nucleotide units at specific positions, substituting nucleotide units at specific positions with nucleotide analogs, modifying backbone chemical linkages, fusing or conjugating the nucleotide sequence with biologically active molecules, or any combination thereof. Modifications to aptamers include, without limitation, substitution, deletion, insertion or chemical modifications such as modified nucleic acid backbones, substitution bonds, modified nucleotides, and ribose or deoxyribose analogues.

Identity: As used herein, the term "identity" refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules). The term "identical" without any additional qualifiers, e.g., nucleic acid A is identical to nucleic acid B, implies the sequences are 100% identical (100% sequence identity). Describing two sequences as, e.g., "70% identical," is equivalent to describing them as having, e.g., "70% sequence identity."

Calculation of the percent identity of e.g., polynucleotide sequences, can be performed, e.g., by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the length of the reference sequence. The bases at corresponding base positions, in the case of polynucleotides, are then compared. When a position in the first sequence is occupied by the same base as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.

Suitable software programs are available from various sources, and for alignment of both protein and nucleotide sequences. One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov). BI2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences. Other suitable programs are, e.g., Needle, Stretcher, Water, or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk/Tools/psa. Sequence alignments can be conducted using methods known in the art such as MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc.

Different regions within a single polynucleotide target sequence that align with a polynucleotide or reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11 , 80.12, 80.13, and 80.14 are rounded down to 80.1 , while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.

In certain embodiments, the percentage identity (%ID) or of a first nucleic acid sequence to a second nucleic acid sequence is calculated as %ID = 100 ^c (Y/Z), where Y is the number of amino acid residues or nucleobases scored as identical matches in the alignment of the first and second sequences (e.g., as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence. Identity can exist over the whole length of the first sequence or over a region of the sequences that is at least about 10, about 20, about 40-60 residues in length or any integral value therebetween, and can be over a longer region than 60-80 residues, e.g., at least about 90-100 residues, and in some embodiments, the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a nucleotide sequence for example.

G-quadruplex (G4): It refers to structures formed in nucleic acids by sequences that are rich in guanine. They are helical structures containing guanine tetrads that can form from one, two or four strands. Four guanine bases can associate through Hoogsteen hydrogen bonding to form a square planar structure called a guanine tetrad (G-tetrad or G-quartet), and two or more guanine tetrads (from G-tracts, continuous runs of guanine) can stack on top of each other to form a G-quadruplex. The placement and bonding to form G-quadruplexes are not random and serve very unusual functional purposes. The quadruplex structure is further stabilized by the presence of a cation, especially potassium, which sits in a central channel between each pair of tetrads. They can be formed of DNA, RNA, locked nucleic acid (LNA), and peptide nucleic acid (PNA), and may be intramolecular, bimo- lecular, or tetramolecular. Depending on the direction of the strands or parts of a strand that form the tetrads, structures may be described as parallel or antiparallel. G-quadruplex structures can be computationally predicted from DNA or RNA sequence motifs, but their actual structures can be quite varied within and between the motifs, which can number over 100,000 per genome. One prediction software that can be used is Quadruplex forming G-Rich Sequences (QGRS) Mapper (httpV/bioin- formatics.ramapo.edu/QGRS/index.php). The user can define the minimum number of tetrads, maximum length of the G-quadruplex motif, and size, as well as composition of the loops. The program can map unimolecular QGRS in the entire nucleotide sequence provided by the user in the *.raw or FASTA format. The sequence must contain at least two G tetrads, although structures with three or more G-tetrads are considered to be more stable. The gaps or loops between the G-groups may be arbitrary in composition or length (within the overall restrictions on the length of QGRS).

G-score: The scoring system that evaluates a QGRS for its likelihood to form a stable G-quadruplex. Higher scoring sequences will make better candidates for G-quadruplexes. The scoring method uses the following principles: shorter loops are more common than longer loops; G-quadruplexes tend to have loops roughly equal in size; the greater the number of guanine tetrads, the more stable the quadruplex. The computed G-scores are dependent on the user selected maximum QGRS length. The highest possible G-score, using the default maximum QGRS length of 30, is 105.

Subject: The terms "subject," "patient," "individual," and "host," and variants thereof are used interchangeably herein and refer to any mammalian subject, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like), and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans.

For the sake of clarity, in this description, "complex" refers to the association or binding between an aptamer and the P/asmocf/um-infected cells; and "conjugate" refers to an aptamer linked to a functional group.

DETAILED DESCRIPTION OF THE INVENTION

Aptamer sequences

The aptamers provided herein have the capability of binding to P/asmocf/um-infected cells and not binding to Plasmodium-ftee cells, have a length between 30 and 200 nucleotides, and have the functional properties explained hereinafter. Particular embodiments of aptamers of the present disclosure are presented in TABLE 1 . In some embodiments, the aptamer of the present disclosure is as disclosed in TABLE 1 .

TABLE 1 :

In a particular embodiment, the aptamer has a length between 30 and 100 nucleotides. In another embodiment, the aptamer is a DNA sequence. In some embodiments, the aptamer comprises a sequence selected from the group consisting of SEQ ID NO: 1-5. In other embodiments, the aptamer comprises a sequence selected from the group consisting of SEQ ID NO: 6-10. In some embodiments, the aptamer comprises a sequence selected from the group consisting of SEQ ID NO: 11-15. In some embodiments, the aptamer comprises a sequence selected from the group consisting of SEQ ID NO: 16-20. In other embodiments, the ap- tamer comprises a sequence selected from the group consisting of SEQ ID NO: 21-25.

In a particular embodiment, the aptamer comprises the sequence SEQ ID NO: 8 (30s). In another embodiment, the aptamer comprises the sequence SEQ ID NO: 1 (19). In another embodiment, the aptamer comprises the sequence SEQ ID NO: 5 (78). In another embodiment, the aptamer com- prises the sequence SEQ ID NO: 11 . In another embodiment, the aptamer comprises the sequence SEQ ID NO: 15. In another embodiment, the aptamer comprises the sequence SEQ ID NO: 14. In another embodiment, the aptamer comprises the sequence SEQ ID NO: 17. In a particular embodiment, the aptamer consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-25.

Aptamer modifications

It is believed that the herein discussed positive experimental results for the aptamer sequences SEQ ID NO: 1-10 (as shown in the Examples), make it plausible that similar positive results would also be obtainable by very similar aptamer sequences derived from the identified aptamers SEQ ID NO: 1- 10. Said other aptamer sequences can have modifications in their sequences in respect to the SEQ

ID NO: 1-25 but maintain the structural pattern and the functional properties of the identified aptamer sequences, as will be explained hereinafter.

In some embodiments, the aptamer of the present disclosure comprises a nucleic acid sequence with at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity to a sequence disclosed in TABLE 1 , wherein the aptamer is capable of binding to Plasmodium-mfected cells and not binding to Plasmodium-ftee cells. In a particular embodiment, the nucleic acid aptamer comprises a nucleotide sequence having at least a 70% identity with a sequence selected from the group consisting of SEQ ID NO: 1 -25. In a particular embodiment, the nucleic acid aptamer comprises a nucleotide sequence having at least a 75% identity with a sequence selected from the group consisting of SEQ ID NO: 1-25.

In some embodiments, the aptamer comprises a nucleotide sequence from SEQ ID NO: 1-25, wherein some nucleotides are substituted, deleted, inserted or chemically modified, wherein the aptamer is capable of binding to Plasmodium-mfected cells and not binding to Plasmodium-ftee cells. The number of nucleotides substituted, deleted, inserted or modified is not particularly limited as long as the aptamer is capable of binding to Plasmodium-mfected cells and not binding to Plasmodium- free cells. In some particular embodiments, from 1 to 10 nucleotides are substituted, deleted, inserted or chemically modified; more particularly at least 1 , 2, 3, 4, 5, 6, 7, 8 9, 10 nucleotides are substituted, deleted, inserted or chemically modified. Particularly, the aptamer comprises a sequence selected from the group consisting of SEQ ID NO: 1-20 with a deletion of one or two nucleotides in one end or in both ends.

In a particular embodiment, the nucleic acid aptamer that binds to Plasmodium-mfected cells and does not bind to Plasmodium-ftee cells, has a length between 30 and 200 nucleotides, and comprises a nucleotide sequence having a at least a 70% identity with a sequence selected from the group consisting of SEQ ID NO: 1-25.

In a particular embodiment, the nucleic acid aptamer that binds to Plasmodium-mfected cells and does not bind to Plasmodium-ftee cells, has a length between 30 and 200 nucleotides, and comprises a nucleotide sequence having a at least a 75% identity with a sequence selected from the group consisting of SEQ ID NO: 1-25.

In a particular embodiment, the nucleic acid aptamer that binds to Plasmodium-mfected cells and does not bind to Plasmodium-ftee cells, has a length between 30 and 200 nucleotides, and comprises a nucleotide sequence having a at least a 75% identity with a sequence selected from the group consisting of SEQ ID NO: 1-25, wherein the nucleic acid aptamer sequence has a G-score higher than 20.

In a particular embodiment, the aptamer comprises more than one of the sequences selected from the group consisting of SEQ ID NO: 1-25, forming e.g. a tandem of sequences. The sequences forming an aptamer can be equal or different. The inventors have observed that the aptamers of the invention are rich in guanines (G) with a distribution of Gs along the sequence that enable the formation of a G-quadruplex structure. Thus, in some embodiments, the aptamers of the present disclosure have a sequence able to form at least a G-quadruplex; i.e. the aptamer sequence has a G-score higher than 20. Particularly, the G-score is between 20 and 41. For instance, SEQ ID NO: 1-3, 5-8,10-13, 15-18, 20-23 and 25 have 1 G-quad- ruplex, and SEQ ID NO: 4, 9, 14, 19 and 24 have 2 G-quadruplexes. Working EXAMPLE 2 provides a description of an assay suitable to calculate G-score.

Aptamer chemical modifications

Aptamers of the present disclosure (e.g. SEQ ID NO: 1-25) can be chemically modified to become more stable or can be further truncated to eliminate oligonucleotide sequences that are not important for the interaction with the target or for the correct three-dimensional aptamer structure. The aptamers of the present disclosure can be in the form of unmodified single-stranded DNA (ssDNA) aptamers. The aptamers can undergo modifications aimed to increase, e.g., their resistance to degradation by nucleases and/or their half-life in circulation for diagnostics or other purposes.

In some embodiments, an aptamer of the present disclosure comprises at least one chemically modified nucleoside and/or nucleotide. A "nucleoside" refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). A "nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, e.g., chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Chemical modifications include modifications with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof.

Aptamers of the present disclosure can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages. In some embodiments, the phosphodiester linkages of the deoxyribose-phosphate backbone of the aptamer can also be modified to e.g. improve stability.

A modified aptamer disclosed herein can comprise various distinct modifications. In some embodiments, the modified aptamer contains one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified aptamer can exhibit one or more desirable properties, e.g., improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to the Plasmodium antigen/s, reduced non-specific binding to other molecules, as compared to the corresponding unmodified aptamer. 1. Base Modifications

Degradation of the aptamers can also be reduced by the inclusion of modified nucleotide bases. The pyrimidine nucleotide bases, cytosine, thymine and uracil can be replaced with alkylated pyrimidines. Examples of alkylated pyrimidines include pseudoisocytosine; N4, N4-ethanocytosine; 4-acetylcyto- sine, 5- (carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil; 5-carboxymethylaminomethyl- 2-thiouracil; 5-carboxymethylaminomethyl uracil; dihydrouracil; 1-methylpseudouracil; 3-methylcyto- sine; 5-methylcytosine; 5-methylaminomethyl uracil; 5-methoxy amino methyl-2-thiouracil; 5-meth- oxycarbonylmethyluracil; 5-methoxyuracil; uracil-5-oxyacetic acid methyl ester; pseudouracil; 2-thio- cytosine; 5-methyl-2 thiouracil, 2-thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic acid methylester; uracil 5-oxyacetic acid; 2-thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil; 5- ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; methylpseudouracil; and 1-methylcyto- sine. The purine nucleotide bases, adenine and guanine, can be replaced by alkylated purines. Examples of alkylated purines include 8-hydroxy-N6-methyladenine; inosine; N6-isopentyl-adenine; 1- methyladenine; 1-methylguanine; 2, 2-dimethylguanine; 2-methyladenine; 2-methylguanine; N6- methyladenine; 7-methylguanine; 2-methylthio-N6-isopentenyladenine; and 1-methylguanine.

In some embodiments, at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine (y), 2-thiouridine (s2U), 1 -methyl-pseudouridine (hi1 y), 1 -ethyl-pseudouridine (b1 y), or 5- methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methyl-cytidine (m5C)), a modified adenosine (e.g., 1 -methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl-guanosine (m7G) or 1-methyl-guanosine (m1G)), or a combination thereof.

In some embodiments, the polynucleotides of the present disclosure are uniformly modified (e.g., fully modified, modified throughout the entire sequence) with a particular modification. For example, a polynucleotide can be uniformly modified with the same type of base modification, e.g., 5-methyl- cytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methyl-cytidine (m5C). Similarly, a polynucleotide can be uniformly modified with any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above.

2. Backbone modifications

In some embodiments, the polynucleotides of the present disclosure include any useful modification to the linkages between the nucleosides. Such linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to, the following: 3'- alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoal- kylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH2-0-N(CH3)-CH2-, -Chh- N(CH3)-N(CH3)-CH2-, -CH2-NH-CH2-, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH3)-CH₂- CH2-, oligonucleosides with heteroatom internucleoside linkage, phosphinates, phosphoramidates, phosphorodithioates, phosphorothioate internucleoside linkages, phosphorothioates, phos- photriesters, PNA, siloxane backbones, sulfamate backbones, sulfide sulfoxide and sulfone backbones, sulfonate and sulfonamide backbones, thionoalkylphosphonates, thionoal- kylphosphotriesters, and thionophosphoramidates.

In some embodiments, the presence of a backbone linkage disclosed above increases the stability (e.g., thermal stability) and/or resistance to degradation (e.g., enzyme degradation) of a polynucleotide of the present disclosure.

In some embodiments, the backbone comprises linkages selected from the group consisting of phos- phodiester linkage, phosphotriesters linkage, methylphosphonate linkage, phosphoramidate linkage, phosphorothioate linkage, and combinations thereof.

3. Sugar Modifications

The modified nucleosides and nucleotides which can be incorporated into a polynucleotide of the present disclosure can be modified on the sugar of the nucleic acid. Thus, in some embodiments, the aptamer of the present disclosure comprises at least one nucleoside analog (e.g., a nucleoside with a sugar modification).

In some embodiments, at least one deoxyribose or ribose of the nucleic acid aptamer is replaced with a morpholine ring. The nucleotides that can be substituted for natural nucleotides of DNA have a base moiety such as inosine, 5-fluorouracil, 5-bromouracil, hypoxanthine, 1-methylguanine, 5- methylcytosine, or tritylated bases. The sugar moiety of the nucleotide in a sequence can also be modified with a group such as arabinose, xylulose, or hexose. In addition, the adenine, cytosine, guanine, thymine, and uracil bases of the nucleotides can be modified with acetyl, methyl, hydroxyl, and thio groups.

In some embodiments, the sugar modification increases the affinity of the binding of a polynucleotide of the present disclosure to its target epitope. Incorporating affinity-enhancing nucleotide analogues in the polynucleotides of the present disclosure, such as LNA or 2’-substituted sugars can allow the length of the polynucleotides of the present disclosure to be reduced, and also can reduce the upper limit of the size a polynucleotide of the present disclosure before non-specific or aberrant binding takes place.

In some embodiments, modifications include ribose or deoxyribose analogue forms which are well- known in the art, including without limitation sugars substituted at 2’, such as 2'-0-methyl-ribose, 2'- fluoro-ribose or 2'-azido-ribose, carbocyclic analogues of sugars, a-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars and sedoheptuloses. Analogue forms of purines and pyrimidines are well-known in the art and include, without limitation, aziridinylcytosine, 4-acetylcytosine, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2- thiouracil, 5-carboxymethylaminomethyluracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1- methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methyl- aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosine, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, pseudouracil, keosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid, and 2,6-diaminopurine. In addition to the preceding modified nucleotides, nucleotide residues lacking a purine or a pyrimidine also can be included in the present invention.

In some embodiments, nucleoside analogues present in a polynucleotide of the present disclosure comprise, e.g., 2’-0-alkyl-RNA units, 2’-OMe-RNA units, 2’-0-alkyl-SNA, 2’-amino-DNA units, 2’- fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2’-fluoro-ANA units, hexitol nucleic acid (HNA) units, intercalating nucleic acid (INA) units, 2’MOE units, or any combination thereof. In some embodiments, the LNA is, e.g., oxy-LNA (such as beta-D-oxy-LNA, or alpha-L-oxy-LNA), amino-LNA (such as beta-D-amino-LNA or alpha-L-amino-LNA), thio-LNA (such as beta-D-thio-LNA or alpha-L-thio-LNA), 2'-0,4'-C-ethylene-bridged nucleic acid (ENA, such a beta-D-ENA or alpha-L- ENA), or any combination thereof.

In some embodiments, nucleoside analogs present in a polynucleotide of the present disclosure comprise LNA; 2'-0-alkyl-RNA; 2'-amino-DNA; 2'-fluoro-DNA; ANA; 2'-fluoro-ANA, HNA, INA, constrained ethyl nucleoside (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0- methoxyethyl nucleic acid (2'-MOE), or any combination thereof.

Particularly, aptamers with SEQ ID NO: 1-25 can be chemically modified by phosphodiester backbone modifications, sugar ring modification and/or 3' end capping, to avoid nuclease degradation. In other embodiments, aptamers with SEQ ID NO: 1-25 can be conjugated with polyethylene glycol (PEG), biotin-streptavidin, streptavidin-HRP, or with small molecules such as 2'-NH₂, 2'-deoxy-2'- F,2'-deoxy-2'-NH₂-uridine or 2'-deoxy-2'-NH₂-cytidine, which provide resistance to renal clearance, increasing aptamer solubility, melting temperature and stability.

Aptamer functional properties

In some embodiments, the aptamer binds to Plasmodium-mfected red blood cells with an affinity (Kd) of less than 1 .8 pM, when the Kd is determined e.g. with Percoll purified fixed late-stage Plasmodium- infected red blood cells, the aptamer being labeled with 6-carboxyfluorescein on the 5' end, fluorescence being measured by flow cytometry with 488 nm laser set at 100 mV, selecting a single-cell population on a forward-side scatter scattergram, and selecting only the Plasmodium-mfected red blood cells population in a FCS-A and SSC-A plot comparing with a control with Plasmodium-ftee cells to avoid aggregates. Kd is a well-known parameter for binding affinity. Thus, the skilled in the art would easily know how to verify that a given aptamer meets the indicated Kd, i.e. a Kd less than 1 .8 pM, and particularly less than 1.77 pM. The inventors have measured the Kd of different aptamers of the invention (e.g. SEQ ID NO: 1-10) as shown in TABLE 7. Kd is testable by well-established and reproducible assays. Working EXAMPLE 5 herein provides a detailed description of an assay suitable to measure and calculate Kd. Accordingly, based on the detailed assay described herein the skilled person is routinely able to repeat this assay to objectively determine whether a given aptamer sequence complies with the indicated Kd.

In some embodiments, the aptamer binds to Plasmodium-infected red blood cells with a Bmax of more than 1860 a.u., when the Bmax is determined e.g. with Percoll purified fixed late-stage Plasmodium-infected red blood cells, the aptamer being labeled with 6-carboxyfluorescein on the 5' end, fluorescence being measured by flow cytometry with 488 nm laser set at 100 mV, selecting a singlecell population on a forward-side scatter scattergram, and selecting only the Plasmodium-infected red blood cells population in a FCS-A and SSC-A plot comparing with a control with Plasmodium- free cells to avoid aggregates.

Bmax refers to density of receptors, and it is obtained e.g. by fitting the dependence of intensity (measured by flow cytometry) of specific binding on the concentration of the aptamers to the equation Y = Bmax X/(Kd + X). Specific binding is corrected e.g. using a random sequence of ssDNA of the same length as SEQ ID NO: 1-5 and with the same labeling as control of unspecific binding. Bmax is testable by well-established and reproducible assays. Working EXAMPLE 5 herein provides a detailed description of an assay suitable to measure and calculate Bmax. Accordingly, based on the detailed assay described herein the skilled person is routinely able to repeat this assay to objectively determine whether a given aptamer sequence complies with the indicated Bmax.

In some embodiments, the aptamer binds to at least 58% of Plasmodium-infected late-stage red blood cells, when the % binding is determined e.g. with fixed late-stage Plasmodium-infected red blood cells, the aptamer being labeled with 6-carboxyfluorescein on the 5' end, fluorescence being measured by flow cytometry with 488 nm laser set at 100 mV and 350 nm laser set at 59.8 mV, selecting a single-cell population on a forward-side scatter scattergram with the 488 nm laser set at 100 mV and selecting only the Plasmodium-infected red blood cells population in a FCS-A and SSC- A plot comparing with a control with Plasmodium-free cells to avoid aggregates, and selecting the nucleus stained Plasmodium- infected red blood cells with the 350 nm laser set at 59.8 mV from the previous selected population.

The cells are considered Plasmodium-infected late-stage when the emitted signal is above 8.5x10² a.u. and positive to 6-FAM when the emitted signal is above 4.5x10³ a.u. Particularly, the aptamer binds to at least 93% (SEQ ID NO: 1), 94% (SEQ ID NO: 2), 95% (SEQ ID NO: 3), 96% (SEQ ID NO: 8), 88% (SEQ ID NO: 4) and 84% (SEQ ID NO: 5).

% binding is testable by well-established and reproducible assays. Working EXAMPLE 3 herein provides a detailed description of an assay suitable to measure and calculate % binding. Accordingly, based on the detailed assay described herein the skilled person is routinely able to repeat this assay to objectively determine whether a given aptamer sequence complies with the indicated % binding. The cells are considered Plasmodium-mfected late-stage when the emitted signal is above 8.5x10² a.u. and positive to 6-FAM when the emitted signal is above 4.5x10³ a.u.

In some embodiments, the aptamer is capable of binding red blood cells infected with P. falciparum, P. malariae, P. ovale, and P. vivax i.e. the aptamer is able to detect any of the above-mentioned Plasmodium species in clinical samples (as shown in EXAMPLE 7), which is highly significant in diagnostic practice.

In some embodiments, when using the aptamer to develop a Western blot of a RIPA protein extract of late-stage Plasmodium-mfected red blood cells 40-48 hpi, a fingerprint band pattern of at least a double band between 25 and 35 kDa and a triple band between 15 and 10 kDa is observed.

In this sense, inventors have seen that all the tested aptamers (SEQ ID NO: 1-10) have a common fingerprint band pattern in a Western blot. It is believed that the herein discussed band pattern for the aptamer sequences SEQ ID NO: 1-10, make it plausible that a similar band pattern would also be obtainable by similar aptamer sequences derived from the identified aptamers SEQ ID NO: 1-10. The skilled in the art knows how to perform a Western blot, but working EXAMPLE 6 herein provides a detailed description of an assay suitable to determine a fingerprint band pattern. Accordingly, based on the detailed assay described herein the skilled person is routinely able to repeat this assay to objectively determine whether a given aptamer sequence complies with the band pattern.

In a more particular embodiment, the nucleic acid aptamer binds to Plasmodium-mfected cells and does not bind to Plasmodium-free cells, having a length between 30 and 200 nucleotides, comprising a nucleotide sequence having at least a 70% identity with a sequence selected from the group consisting of SEQ ID NO: 1-25, wherein the nucleic acid aptamer sequence has a G-score higher than 20; and wherein the aptamer binds to Plasmodium-mfected red blood cells with an affinity (Kd) of less than 1.8 pM, when the Kd is determined with Percoll purified fixed late-stage Plasmodium-m- fected red blood cells, the aptamer being labeled with 6-carboxyfluorescein on the 5' end, fluorescence being measured by flow cytometry with 488 nm laser set at 100 mV, selecting a single-cell population on a forward-side scatter scattergram, and selecting only the Plasmodium-mfected red blood cells population in a FCS-A and SSC-A plot comparing with a control with Plasmodium-free cells.

Conjugation of aptamers In some embodiments, the aptamer is conjugated with one or more functional groups. Alternatively said, the invention refers to a conjugate comprising an aptamer of the invention and a functional group. Particularly, the functional group will aid in detection of the aptamer (and therefore the detection of Plasmodium) ore.g. is useful to target the aptamer to the site of function or to target a molecule to the vicinity of the site of action of the aptamer (such as a malaria drug).

The conjugate of the present invention can be one wherein the aptamer of the present invention and one or more (e.g., 2 or 3) functional groups of the same kind or different kinds are bound together. The functional group is not particularly limited, as far as it confers a certain function to an aptamer of the present invention, or is capable of changing (e.g., improving) a certain characteristic which an aptamer of the present invention can possess. In some embodiments, the aptamer is conjugated to a functional group which is e.g.:

(i) a drug;

(ii) a moiety that facilitates targeting (e.g., a ligand, binding moiety, or moiety that directs the aptamer to a certain cell or tissue);

(iii) a moiety that modulates, i.e., increases or decreases, plasma half-life (e.g., by modulating resistance to nucleases or altering kidney or liver clearance);

(iv) a delivery moiety (e.g., a biopolymer such as PEG or a lipid, peptide, or carbohydrate that would facilitate transport across the blood-brain barrier); or,

(v) any combination thereof.

In some embodiments, the functional group includes small molecules, proteins, peptides, amino acids, lipids, sugars, monosaccharides, polynucleotides, and nucleotides.

In some embodiments, the aptamer is conjugated with one or more functional group selected from the group consisting of a detectable label, a nanoparticle, a drug and a stabilizer moiety.

To aid in detection of Plasmodium, detectable labels can be conjugated to the disclosed aptamers. As used herein, a detectable label is any molecule that can be conjugated with an aptamer, directly or indirectly, and which results in a measurable, detectable signal, either directly or indirectly. Many such labels are known to those of skill in the art. Examples of suitable detection labels include radioisotopes (e.g., <3>H, <14>C, <35>S, <125>l , <131 >l), fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors), luminescent labels such as luminol; enzymatic labels (e.g., horseradish peroxidase (HRP), beta-galactosidase, luciferase, alkaline phosphatase, acetylcholinesterase), biotinyl groups (which can be detected by marked avidin, e.g., streptavidin containing a fluorescent marker or enzymatic activity that can be detected by optical or colorimetric methods), predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags).

Thus, in a particular embodiment, the functional group is a detectable label. The terms “detectable label," "detectable reagent,” "detectable tag,” “imaging agent,” "detection element" and “contrast agent” are used as synonyms and refer to a biocompatible compound, the use of which facilitates the differentiation of different parts of the image, by increasing the "contrast" between those different regions of the image. Suitable contrast agents include, without limitation, contrast agents for radionuclide imaging, for computerized tomography (CT), for Raman spectroscopy, for Magnetic resonance imaging (MRI) and for optical imaging.

Methods for detecting and measuring signals generated by detectable labels are known to those of skill in the art. For example, radioactive isotopes can be detected by scintillation counting; fluorescent molecules can be detected with fluorescence spectrophotometers or fluorescence microscopes; enzymes can be detected by detection or visualization of the product of a reaction catalyzed by the enzyme; antibodies can be detected by detecting a secondary detection element coupled to the antibody. Such methods can be used directly in the disclosed method of amplification and detection. As used herein, detectable labels are molecules which interact with amplified nucleic acid and to which one or more detectable labels are coupled.

Detectable labels can be subsequently detected using sensitive methods well-known in the art. For example, biotin can be detected using streptavidin-alkaline phosphatase conjugate (Tropix, Inc.), which is bound to the biotin and subsequently detected by chemiluminescence of suitable substrates (e.g., chemiluminescent substrate CSPD: disodium 3-(4-methoxyspiro-{1 ,2,-dioxetane-3-2'-(5'- chloro)tricyclo [3.3.1 1]decan}-4-yl) phenyl phosphate; Tropix, Inc.).

In a particular embodiment, the functional group is a detectable label for optical imaging. More particularly, the detectable label is a fluorescent label or fluorophore. A fluorophore (also known as flu- orochrome or chromophore) is a fluorescent chemical compound that can re-emit light upon light excitation. Fluorophores are commonly covalently bonded to a macromolecule, serving as a marker (or dye, or tag, or reporter). Fluorophores are notably used to stain tissues, cells, or materials in a variety of analytical methods, i.e. , fluorescent imaging and spectroscopy. Fluorophore molecules can be generally classified into four categories: proteins and peptides, small organic compounds, synthetic oligomers and polymers, and multi-component systems. Fluorescent proteins, e.g. GFP (green), YFP (yellow), and RFP (red), are described below.

In some embodiments, the fluorophore is a non-protein organic fluorophore belonging to the following major chemical families:

- Xanthene derivatives: fluorescein, rhodamine, Oregon green, eosin, and Texas red

- Cyanine derivatives: cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, and merocy- anine

- Squaraine derivatives and ring-substituted squaraines, including Seta and Square dyes

- Squaraine Rotaxane derivatives: SeTau dyes

- Naphthalene derivatives (dansyl and prodan derivatives) - Coumarin derivatives

- Oxadiazole derivatives: pyridyloxazole, nitrobenzoxadiazole and benzoxadiazole

- Anthracene derivatives: anthraquinones, including DRAQ5, DRAQ7 and CyTRAK Orange

- Pyrene derivatives: cascade blue, etc.

- Oxazine derivatives: Nile red, Nile blue, cresyl violet, oxazine 170, etc.

- Acridine derivatives: proflavin, acridine orange, acridine yellow, etc.

- Arylmethine derivatives: auramine, crystal violet, malachite green

- Tetrapyrrole derivatives: porphin, phthalocyanine, bilirubin.

Examples of suitable fluorescent labels include carboxyfluorescein (FAM) and fluorescein isothiocyanate (FITC), indocyanine green, Texas red, a derivative of Texas red, 7-nitrobenz-2-oxa-1 , 3-dia- zole-4-yl (NBD), coumarin, dansyl chloride, rhodamine green, a derivative of rhodamine green, eosin, an erythrosin 4'-6-diamidino-2-phenylinodole (DAPI), Oregon green, a derivative of Oregon green derivative, malachite green, nanogold sulfosuccinimidyl ester, cascade blue, a coumarin derivative, a naphthalene, a pyridyloxazole derivative, cascade yellow dye, dapoxyl dye and the cyanine dyes Cy2, Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. Particular fluorescent labels are fluorescein (5-carboxyfluo- rescein-N-hydroxysuccinimide ester) and tetramethyl rhodamine. Particular fluorescent labels for combinatorial multicolor coding are FITC and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. The absorption and emission maxima, respectively, for these fluorophores are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous detection. The fluorescent labels can be obtained from a variety of commercial sources, including Molecular Probes (Eugene, Oregon, USA) and Research Organics (Cleveland, Ohio, USA). Other green dyes include Oregon green, Tokyo green, SNAFL, and carboxynaphthofluorescein. These dyes, along with newer fluorophores such as Alexa 488, FluoProbes 488 and DyLight 488, have been tailored for various chemical and biological applications where higher photostability, different spectral characteristics, or different attachment groups are needed.

In a more particular embodiment, the functional group is a fluorescent label that is a xanthene derivative, more particularly, a fluorescein or a fluorescein derivative. Examples of fluorescein derivatives are:

- fluorescein isothiocyanate 1 (FITC), which features an isothiocyanate group (-N=C=S) substituent. FITC reacts with the amine groups of many biologically relevant compounds including intracellular proteins to form a thiourea linkage.

- succinimidyl ester modified fluorescein, i.e. NHS-fluorescein, is another common amine-reactive derivative, yielding amide adducts that are more stable than the aforementioned thioureas.

- Others: 6-carboxyfluorescein (6-FAM), carboxyfluorescein succinimidyl ester, pentafluorophenyl esters (PFP), tetrafluorophenyl esters (TFP).

In oligonucleotide synthesis, several phosphoramidite reagents containing protected fluorescein, e.g. 6-FAM phosphoramidite are used for the preparation of fluorescein-labeled oligonucleotides.

In a more particular embodiment, the fluorescent label is FITC or 6-FAM. In another embodiment, the functional group is a fluorescent label that is a rhodamine derivative, more particularly, carboxy- tetramethylrhodamine (TAMRA). In some embodiments, the fluorescent label is attached to the 5' end of the aptamer.

In another embodiment, the functional group is a detectable label for radionuclide imaging. Aptamers can be labeled e.g. with positron-emitters such as ¹¹C, ¹³N, ¹⁵0, ¹⁸F, ⁸²Rb, ⁶²Cu, ⁶⁴Cu, and ⁶⁸Ga⁸⁶Y, ¹²⁴l, ²¹³Bi and ²¹¹At, ⁹⁴mTc, ²⁰¹TI and ⁶⁷Ga. In certain embodiments of the invention, a conjugate according to the invention is used for positron emission tomography (PET) or single photon emission computed tomography imaging (SPECT). Other non-limiting examples of radionuclides include gamma emission isotopes, such as ^99mTc, ¹²³l and ¹¹¹ In, which can be used in radioscintigraphy using gamma cameras or computerized single photon emission tomography, as well as beta emitters, such as ¹³¹1, ⁹⁰Y, ^99mT c, ¹⁷⁷Lu and ⁶⁷Cu”.

In another embodiment, the functional group is a detectable label for computerized tomography (CT) imaging. Examples of these agents include iothalamate, iohexyl, diatrizoate, iopamidol, ethiodol and iopanoate. Gadolinium agents have also been reported to be of use as a CT contrast agent.

In another embodiment, the detectable label is a protein. Non-limiting examples of proteins suitable for the purposes of the present invention include, without limitation, enzymes, fluorescent proteins, luminescent proteins and antigens.

Particularly, the protein is an enzyme. Non-limiting examples of enzymes suitable for the invention include, without limitation, horseradish peroxidase (HRP) and alkaline phosphatase. As the person skilled in the art will understand, the enzymes suitable for use in the present invention are indirectly detectable as a result of their capability of catalyzing modifying a substrate in a compound detectable by colorimetry, chemiluminescence or fluorimetry. Examples of suitable substrates include, without limitation, p-nitrophenyl phosphate (PNPP), 2,2'-azinobis[3-ethylbenzothiazolin-6-sulfonic acid] (ABTS), o-phenylenediamine (OPD), and 3,3',5,5'-tetramethylbenzidine (TMB).

Thus, the disclosed detectable labels can be part of, and detectable with, enzyme-linked detection systems. Enzyme-linked detection generally involves an enzyme as a label or tag on a component where the presence of the enzyme (and thus of the analyte with which the enzyme is associated) is detected by having the enzyme convert an enzymatic substrate into a form that produces a detectable signal. For example, analytes labeled or associated with alkaline phosphatase can be detected by adding the chemiluminescent substrate CSPD (Tropix, Inc.). The fluorescent reaction product can then be detected. Particular forms of detection elements are enzymes, such as alkaline phosphatases and peroxidases, for use in an enzyme-linked detection system. In other embodiments, the enzyme is a bioluminescent protein or photoprotein, which is a particular case of oxidative enzymes capable of carrying out a chemical reaction of their specific prosthetic groups, resulting in light emission without requiring prior excitation. Non-limiting examples of bioluminescent proteins include firefly luciferase, Renilla luciferase and aequorin.

In another embodiment, the protein is a fluorescent protein. The term “fluorescent protein,” in the context of the present invention, refers to a protein with the capability of emitting light when it is excited at a wavelength suitable for excitation. Non-limiting examples of fluorescent proteins that can be used in the conjugate of the invention include, without limitation, GFP, GFPuv, BFP, CFP, YFP, EBFP2, mCerulean, mCerulean3, mVenus, mTurquoise, T-Sapphire, citrine, amFP486, zFP506, zFP538, drFP, DsRed, mCherry, dTomate, mTFP1 , TagRFP-T, mK02, mRuby, mKate, mAmetrine, REACh, R-phycoerythrin (R-PE) and allophycocyanin (APC).

In another even more particular embodiment, the protein is a luminescent protein. The term “luminescent protein”, in the context of the present invention, refers to a protein capable of emitting light when it is excited at a wavelength suitable for excitation.

In another embodiment, the functional group is a nanoparticle. The term “nanoparticle,” in the context of the present invention, refers to colloidal systems of the spherical type, rod type, polyhedron type, etc., or similar shapes, having a size less than 1 micrometer (pm), which are individually found or are found forming organized structures (dimers, trimers, tetrahedrons, etc.), dispersed in a fluid (aqueous solution). In a particular embodiment, the nanoparticles have a size less than 1 pm, generally comprised between 1 and 999 nanometers (nm), typically between 5 and 500 nm, particularly between about 10 and 150 nm. Nanoparticles suitable for use in the present invention include polymeric nanoparticles, lipid nanoparticles and metal nanoparticles.

Polymeric nanoparticles are formed by a polymeric matrix which is attached to the aptamer. Nonlimiting examples of biocompatible polymers that may be useful in the polymeric nanoparticles according to the present invention include polyethylenes, polycarbonates, polyanhydrides, polyhydrox- yacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, or polyamines, polyglutamate, dextran, polyanhydrides, polyurethanes, polymethacrylates, polyacrylates or polycyanoacrylates. polydioxanone (PDO), polyhydroxyalkanoate, polyhydroxybutyrate, poly(glycerol sebacate), polyglycolide, polylactide, PLGA, polycaprolactone or combinations thereof.

Alternatively, the nanoparticles of the invention may be lipid nanoparticles such as a liposome or a micelle. There are a variety of synthetic vesicle-forming lipids and naturally-occurring vesicle-forming lipids including phospholipids e.g. phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, or phosphatidylinositol, sphingolipids, glycolipids, and sterols, e.g. cholesterol. The term "liposome" refers to vesicles comprised of one or more concentrically ordered lipid bilayers, which encapsulate an aqueous phase.

Alternatively, the nanoparticles of the invention may be a metal nanoparticle. The term “metal nanoparticle” refers to a nanoparticle comprising a metal and showing the optical property known as the surface plasmon phenomenon, i.e., a plasmonic metal. This phenomenon consists of the collective vibration of the electrons of the metal surface, producing an absorption band located in the ultraviolet- visible spectrum (typical of the metal and of the size of the nanoparticles) at the wavelength where the resonance condition occurs in said electrons. The surface plasmon of a metal can be determined by means of any spectroscopic technique known in the art, e.g. surface plasmon resonance (SPR) spectroscopy, whereby the metal atoms are subjected to an electromagnetic beam or surface plasmon resonance fluorescence spectroscopy (SPFS) based on the detection of the variation of the refractive index of the metal atoms when they are subjected to a photon beam. As defined herein, a “plasmonic metal” is a metal characterized by showing the property of optics known as the surface plasmon phenomenon. The variation of the plasmonic response is particularly evident when several nanoparticles are located close to one another, given that this causes the coupling of their respective near fields, generating a new surface plasmon. In a particular embodiment, said metal is selected from the group consisting of gold, silver, copper, aluminum, platinum, iron, cobalt, palladium and combinations thereof. In a more particular embodiment, the nanoparticles are from gold.

A particular embodiment of metal nanoparticles is a core-shell nanoparticle, which contains a metal core and a porous shell. Examples of core-shell metal nanoparticles include magnetic mesoporous silica nanoparticles, which are well-known in the art. Thus, in a particular embodiment, the nanoparticle is a magnetic mesoporous silica nanoparticle. Nanoparticles may be functionalized by adding a coating on their surface. For biological applications, the surface coating should be polar to give high aqueous solubility and prevent nanoparticle aggregation. In serum or on the cell surface, highly charged coatings promote non-specific binding, whereas polyethylene glycol linked to terminal hydroxyl or methoxy groups repel non-specific interactions.

Aptamers can be linked to nanoparticles ideally by a covalent link, particularly on the nanoparticle surface. Particularly, aptamers should be present in a controlled number per nanoparticle.

In another embodiment, the detectable label is a haptene. The term “haptene” in the context of the present invention, refers to a group of chemical compounds having a small molecular size (< 10,000 Da) that are antigenic but unable to induce by themselves a specific immune reaction. Non-limiting examples of haptenes include biotin (vitamin B7), digoxigenin, dinitrophenol (DNP) and nitro-iodo- phenol (NIP). In a more particular embodiment, the haptene is biotin. In some embodiments, the detectable label is biotin. The term “biotin” refers to a water- and alcohol-soluble heat-stable vitamin, also referred to as vitamin H and vitamin B7, characterized by specifically binding to avidin with the highest affinity described to date of Kd = 10^-15 M. As the person skilled in the art will understand, biotin is indirectly detectable as a result of its capability of being specifically recognized by avidin or variants thereof, such as streptavidin and neutravidin. Streptavidin and avidin are both tetrameric biotin-binding proteins, and can be easily modified and available commercially with a wide range of tags, e.g. fluorescent labels, such as FITC, TAMRA or AlexaFluor compounds of which AlexaFluor⁶⁴⁷ has been tested, or horseradish peroxidase for quimioluminescence detection.

In another particular embodiment, the functional group is a drug. The term “drug,” in the context of the present invention, refers to a chemical substance used in the treatment, cure or prevention of a disease or condition, such as e.g. malaria.

In some embodiments, the functional group is a stabilizer moiety, and particularly aptamer is modified at the 3' end with inverted thymidine, deoxythymidine nucleotide, or polyethylene glycol (PEG), which can reduce degradation of the aptamer and increases its stability. In some embodiments, PEG has an average molecular weight from about 20 to 80 kDa.

Binding between an aptamer of the invention and a functional group for generating the conjugate of the invention can be carried out by means of conjugation techniques that are well-known by the person skilled in the art. The result is a covalent or non-covalent bond between the aptamer of the invention and the functional group. The conjugation can involve binding of primary amines of the 3’ or 5’ ends of the aptamer of the invention to the functional group during chemical synthesis of the aptamer.

Alternatively, conjugation can be done by means of conventional cross-linking reactions, having the advantage of the much greater chemical reactivity of primary alkyl-amine labels with respect to the aryl amines of the nucleotides themselves. Methods of conjugation are well-known in the art and are based on the use of cross-linking reagents. The cross-linking reagents contain at least two reactive groups which target groups such as primary amines, sulfhydryls, aldehydes, carboxyls, hydroxyls, azides and so on and so forth, in the molecule to be conjugated. The cross-linking agents differ in their chemical specificity, spacer arm length, spacer arm composition, cleavage of spacer arm, and structure. For example, conjugation according to the invention can be carried out directly or through a linking moiety, through one or more non-functional groups in the aptamer and/or the functional group, such as amine, carboxyl, phenyl, thiol or hydroxyl groups. More selective bonds can be achieved by means of the use of a heterobifunctional linker. It is possible to use conventional linkers, such as diisocyanates, diisothiocyanates, bis (hydroxysuccinimide) esters, carbodiimides, malei- mide-hydroxysuccinimide esters, glutaraldehyde and the like, or hydrazines and hydrazides, such as 4-(4-N-maleimidophenyl) butyric acid hydrazide (MPBH).

In some embodiments, conjugation can take place subsequently to the generation of the aptamer of the present disclosure by recombinant or enzymatic methods. Another approach consists of labeling the aptamers during synthesis by means of PCR using primers labeled, e.g., with a fluorophore. To that end, there are various commercial establishments available for the person skilled in the art.

Additionally, in the particular embodiment in which the functional group is a radionuclide, binding between an aptamer according to the invention and the radionuclide can be carried out by means of chemical coordination, wherein the atoms of the aptamer involved in the binding donate electrons to the radionuclide. Coordination reactions are well-known in the art and will depend on the radionuclide and the reactive group involved in the aptamer.

In some embodiments, the aptamer and/or the conjugate of the present invention are immobilized or adsorbed onto a solid matrix. As used herein, the terms solid "matrix," "support," "substrate," and "surface" refer to a solid phase which is a porous or non-porous water insoluble material that can have any of a number of shapes, such as strip, rod, particle, beads, or multi-welled plate. In some embodiments, the support has a fixed organizational support matrix that particularly functions as an organization matrix, such as a microtiter tray. Solid support materials include, but are not limited to, cellulose, polysaccharide such as Sephadex, glass, polyacryloylmorpholide, silica, controlled pore glass (CPG), polystyrene, polystyrene/latex, polyethylene such as ultrahigh molecular weight polyethylene (UPE), polyamide, polyvinylidene fluoride (PVDF), polytetrafluoroethylene (PTFE; TEFLON), carboxyl modified teflon, nylon, nitrocellulose, and metals and alloys such as gold, platinum and palladium. The solid support can be biological, non-biological, organic, inorganic, or a combination of any of these, existing as particles, strands, precipitates, gels, sheets, pads, cards, strips, dipsticks, test strips, tubing, spheres, containers, capillaries, pads, slices, films, plates, slides, etc., depending upon the particular application. Particularly, the solid support is planar in shape, to facilitate contact with a biological sample such as urine, whole blood, plasma, serum, peritoneal fluid, or ascites fluid. Other suitable solid support materials will be readily apparent to those of skill in the art. The solid support can be a membrane, with or without a backing (e.g., polystyrene or polyester card backing), such as those available from Millipore Corp. (Bedford, Mass.), e.g., Hi-Flow™ Plus membrane cards. The surface of the solid support may contain reactive groups, such as carboxyl, amino, hydroxyl, thiol, or the like for the attachment of nucleic acids, proteins, etc. Surfaces on the solid support will sometimes, though not always, be composed of the same material as the support. Thus, the surface can be composed of any of a wide variety of materials, such as polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, membranes, or any of the aforementioned support materials (e.g., as a layer or coating).

In a particular embodiment, the aptamer is adsorbed or immobilized onto a polymeric solid matrix, particularly onto agarose or cellulose, or onto a metallic matrix.

Methods of manufacture and formulation The production of the aptamers of the present disclosure can be carried out following conventional methods in the art. Non-limiting examples of techniques for the production of aptamers include enzymatic techniques, such as transcription, recombinant expression systems and standard solid phase (or solution phase) chemical synthesis, all commercially available. When appropriate, e.g., in the event that the aptamer of the present disclosure comprises nucleic acid variants such as those described above, nucleotide analogues such as analogues having chemically modified bases or sugars, backbone modifications, etc., the aptamer of the invention can be produced by means of chemical synthesis. Alternatively, recombinant expression can be the technique particular for the production of aptamers of the present disclosure when the aptamers have, e.g., a length of 200 nucleotides. The aptamers produced by any of the preceding techniques can optionally be purified through methods that are well known in the art.

As used herein, the term "synthesizing" refers to assembling the aptamer using polynucleotide synthesis methods known in the art. The term synthesizing also encompasses the assembly of conjugates that comprise an aptamer of the present disclosure and at least one biological active molecule (e.g., an enzyme-detectable label covalently or non-covalently attached to the aptamer). For example, peptide or small molecule components can be prepared recombinantly, chemically, or enzymatically and subsequently conjugated to the aptamer in one or more synthesis steps (e.g., conjugation of a linker to an aptamer of the present disclosure followed by conjugation of a small molecule to the linker). In some embodiments, each one of the components of a conjugate comprising at least one aptamer of present disclosure can be prepared using methods known in the art, e.g., recombinant protein production, solid phase peptide or nucleic acid synthesis, chemical synthesis, enzymatic synthesis, or any combination thereof, and the resulting components can be conjugated using chemical and/or enzymatic methods known in the art.

The aptamers of the present disclosure can be purified, e.g., to remove contaminants and/or to generate a uniform population of aptamers. In some embodiments, the manufacture of the aptamers of the present disclosure comprises lyophilization or any other form of dry storage suitable for reconstitution.

The present disclosure also provides formulations comprising aptamers of the present disclosure. In some embodiments, the aptamer is combined with a solution comprising previously filtered excipients. After a structuration stage, the solution comprising aptamer and excipients is subject to two filtration steps, transferred to vials, and lyophilized. The structuration step is a critical step in the preparation of the aptamer. The structuration process comprises dissolving the aptamer in an appropriate solvent. In some embodiments, the solvent comprises a divalent ion. In some embodiments, the divalent ion is Mg²⁺. In some embodiments, the solvent is phosphate buffered saline (PBS) comprising MgC . After the aptamer has been dissolved, it is heated up to a denaturing temperature (e.g., 95 °C) for a short period of time (e.g., approximately 10 minutes) followed by rapid cooling (e.g., by transfer to ice, e.g., during approximately 5 minutes). After synthesis, aptamers of the present disclosure are linear. Increasing the temperature fully linearizes the aptamer, whereas the subsequent cooling down correctly folds the aptamer, resulting in a functional aptamer.

In some embodiments, the aptamer of the present disclosure can be formulated, e.g., in nanoparticles such as polymeric nanoparticles, lipid nanoparticles (e.g., liposomes or micelles), or metal nanoparticles, comprising the aptamers of the present disclosure covalently or non-covalently attached to the nanoparticle (e.g., encapsulated in the nanoparticle).

Methods of using the aptamers

The aptamers of the invention can be used for various purposes related to their binding to Plasmo- cf/um-infected cells. In some embodiments, the aptamers are used to detect the presence of, measure the amount of Plasmodium species. In some embodiments, the aptamers are used as research tools to detect the presence of, measure the amount of, and remove from a sample, Plasmodium species. In some embodiments the aptamers are also used as part of a method of treating a Plasmodium infection, i.e. to identify or diagnose subjects with a Plasmodium infection and in need of treatment, to monitor the progress of a Plasmodium infection, and to monitor the progress or effectiveness of treatment of a Plasmodium infection.

Diagnostic and other in vitro detection methods

The invention relates to an in vitro method for detecting the presence of Plasmodium in a sample, comprising: i) contacting the sample with an aptamer conjugated as defined above, ii) detecting the presence of a complex between the aptamer and Plasmodium (or Plasmodium antigens), wherein the presence of the complex indicates the presence of Plasmodium in the sample.

In an embodiment, the method is used for the detection of Plasmodium-^'mtected cells in a sample. Therefore, the invention provides an in vitro use of an aptamer or a conjugate according to the invention for detecting Plasmodium-^'mtected red blood cells. In another embodiment, the detection of the presence of the complex present in the sample is indicative that the subject is suffering from malaria or has been infected with Plasmodium.

In some embodiments, the sample is a biological sample from a subject. Thus, the aptamers of the invention can be used in an in vitro method for the diagnosis of a Plasmodium infection in a subject, comprising: i) contacting a biological sample from the subject with an aptamer conjugated as defined above, ii) detecting the presence of a complex between the aptamer and Plasmodium-^'mtected cells, wherein the presence of the complex indicates that the subject has a Plasmodium infection.

In some embodiments, the method can further comprise a step of determining the concentration or amount of the complex formed between the aptamer and Plasmodium or Plasmodium antigens. Such concentration can be determined e.g. by colorimetric, fluorescent or quimioluminescent detection; an increase in the parameter chosen indicates increase of the complex concentration.

The aptamers are also useful in an in vitro method for the prognosis or progression of a Plasmodium infection in a subject, comprising: i) contacting a biological sample from the subject with an aptamer conjugated as defined above, ii) detecting the presence of a complex between the aptamer and Plasmodium-infected cells, iii) determining the concentration or amount of the complex; wherein a reduction in the concentration or amount of the complex relative to an earlier determination indicates a good prognosis, and an increase in the concentration or amount of the complex relative to an earlier determination indicates a bad prognosis.

Said in other words, the amount or concentration of the complex in samples taken at different time points indicates the evolution of the Plasmodium infection: when the concentration of the complex is decreasing along time, is indicative of a good prognosis of the Plasmodium infection; and when the concentration of the complex is increasing along time, is indicative of a bad prognosis of the Plasmodium infection.

The term "prognosis" refers to predict the likely or expected development of a disease, including whether the signs and symptoms will improve or worsen (and how quickly) or remain stable over time; expectations of quality of life, such as the ability to carry out daily activities; the potential for complications and associated health issues; and the likelihood of survival (including life expectancy. P. falciparum infection carries a poor prognosis with a high mortality rate if untreated. However, if the infection is diagnosed early and treated appropriately, the prognosis improves. Most patients with uncomplicated malaria exhibit marked improvement within 48 hours after the initiation of treatment and are fever free after 96 hours. As used herein, the term “prognosis” refers to a prediction of disease progression or of treatment outcome. As could be appreciated, “prognosis” does not refer to the ability to predict the course or outcome of a condition with 100% accuracy. A "favorable," "good" or "positive" prognosis includes a prediction of good treatment outcome or disease amelioration/stabilization (e.g., decreasing the levels of Plasmodium-^'mfected cells), while an "unfavorable," "bad" or "negative" prognosis includes a prediction of poor treatment outcome or disease progression.

Also provided are methods to monitor the treatment in order to adapt the treatment according to the results obtained. In some embodiments of the method, a reduction in the concentration or amount of the complex relative to an earlier determination indicates a positive course of the treatment in the subject. In some embodiments of the method, an increase in the concentration or amount of the first aptamer complex relative to an earlier determination indicates a negative course of the treatment in the subject. In some embodiments of the methods, the contacting and determining steps are repeated one or more times on third and subsequent biological samples from the subject. Also provided are methods of grading the severity of malaria in a subject. In some embodiments, a determined concentration or amount of the complex higher than a threshold concentration or amount indicates a negative grade of malaria in the subject. In some embodiments, a determined concentration or amount of the complex lower than the threshold concentration or amount indicates a positive grade of malaria in the subject. A blood parasite density of about 50/pl is usually associated with mild symptoms of the disease in malaria-naive individuals, while densities over 10,000/pl are associated with severe malaria.

In some embodiments, the method can further comprise treating the subject indicated as having a Plasmodium infection with malaria therapeutic or change the dose/regimen of the treatment depending on the prognosis of the infection.

In a particular embodiment, the methods mentioned above further comprise a step previous to step of detection (i.e. a sample pretreatment step) of lysing or permeabilizing the cells in order to expose the Plasmodium antigen/s. The lysis/permeabilization requires a buffer that contains e.g. a detergent (e.g. saponin, Triton X-100 or SDS).

In other embodiments, the methods comprise a further step of separating the aptamer not bound to Plasmodium-infected cells. This step can be performed, e.g., by washing steps or by immobilization of the antigen in a chromatography-like/lateral flow paper, allowing unbound sequences to move further in such material.

In some embodiments, the aptamers of the inventor can detect Plasmodium-infected cells, wherein the Plasmodium is from species Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, or Plasmodium vivax (as demonstrated in clinical samples, EXAMPLE 7). In other embodiments, and based on the experimental results, it is plausible that the aptamers of the invention can be used also to detect cells infected with other species of Plasmodium including, but not limited to, Plasmodium yoelii, Plasmodium knowlesi, Plasmodium brasilaneum, Plasmodium chaboudi, Plasmodium berghei, Plasmodium reichenowi, and Plasmodium gallinaceum.

In a particular embodiment, Plasmodium infection is malaria.

The aptamer according to the invention is applied on the sample in a buffer suitable for allowing the binding of the aptamer to e.g. the Plasmodium-mfected cells that may be present in the sample. Nonlimiting examples of buffers suitable for allowing the binding include PBS, TBS, phosphate buffer and citrate buffer. Particularly, these buffers contain 1-10 mM MgCL, and particularly 5 mM. The amount of aptamer required for detecting the Plasmodium-mfected cells present in the sample will depend on both the size of the sample and on the number of cells present therein, and it could be readily determined by optimization methods commonly used in the art. By way of indication, the aptamer concentration is at least 1 fM, at least 10 fM, at least 100 fM, at least 1 pM, at least 10 pM, at least 100 pM, at least 1 nM, at least 10 nM, at least 100 nM, at least 1 pM, at least 10 pM, at least 100 pM or more. Particularly, the aptamer concentration is between 100 fM and 1 pM, more particularly between 1 pM and 100 nM, even more particularly between 100 pM and 1 nM.

The aptamer is incubated with the sample at a suitable temperature and for a time sufficient for allowing the binding of the aptamer to the Plasmodium-mtected cells that may be present in the sample. The temperature is particularly between 20 °C and 37 °C. By way of indication, the aptamer will be incubated with the sample for at least 5 min, at least 10 min, at least 15 min, at least 20 min, at least 30 min, at least 60 min, at least 120 min or more.

Once the aptamer has bound to the Plasmodium-mtected cells that may be present in the sample, in a second step the sample is washed to remove the aptamer molecules that have not bound to Plas- mocf/um-infected cells.

In a third step, the presence of the aptamer bound to the Plasmodium-mtected cells in the sample is detected. Since the aptamer of the invention is not by itself a detectable molecule, the step of detection is a step of indirect detection through a second detectable label that binds specifically to the aptamer.

As explained before, the aptamers can be labeled with a detectable label to be able to perform the detection of Plasmodium- infected cells. Suitable detectable labels are described in this description. The technique used for detection will then depend on the type of detectable label, being able to be techniques based, e.g., on fluorimetry, colorimetry or radioactivity. The skilled in the art will recognize a suitable detection technique, as mentioned in a previous section.

The ability of an aptamer of the present disclosure to specifically bind to Plasmodium antigen/s can be determined, e.g., by in vitro binding assays, such as the enzyme-linked oligonucleotide assay (ELONA), the enzyme-linked aptamer sorbent assay (ELASA), precipitation and quantitative PCR (qPCR), or by fluorescence techniques such as aptahistochemistry, aptacytochemistry, fluorescence microscopy or flow cytometry. In flow cytometry, the detection of fluorescence is performed with flow cytofluori meters (known as “cytometers” or “FACS” (fluorescence-activated cell sorter). Likewise, both the capability of specific binding to Plasmodium antigen/s and the affinity of the aptamer for Plasmodium antigen/s can be determined by techniques well-known by the person skilled in the art, such as gel mobility shift assay, surface plasmon resonance (SPR), kinetic capillary electrophoresis and fluorescence binding assay. Briefly, the fluorescence binding assay consists of the incubation of the sample with the aptamer of the invention labeled (e.g., with carboxyfluorescein, FAM), and the subsequent elution and detection of the bound aptamers. Aggregation of nanoparticles bound to or adsorbed on the aptamers can also provide detection by changes in their light absorption properties in presence of the target. In particular forms, detection of complexes of aptamers and their targets can be by detecting a label on or associated with the aptamer. For example, assays where a labeled aptamer is contacted with an immobilized target resulting in the gathering or retention of the labeled aptamer at the target’s location, assays where a labeled aptamer is contacted with a sample, the target in the sample is captured on a substrate, and the labeled aptamer, which has bound the target, is retained with the captured target. Lateral flow assays are a useful form of such assays.

In some embodiments, detection is performed by means of a technique selected from the group consisting of fluorescence microscopy, ELONA, aptacytochemistry, aptahistochemistry, flow cytometry, pull-down assay, dot blot assay, colorimetric detection, PCR assay and sandwich assay.

In some embodiments, detection is performed by fluorescence microscopy or flow cytometry. In some embodiments, detection is performed by colorimetric detection using e.g. gold nanoparticles superparamagnetic nano- or microparticles or silica nanoparticles as detectable labels.

The terms "detecting" or "detect" include assaying or otherwise establishing the presence or absence of the Plasmodium-infected cells.

Particularly, the sample is a fluid (such as a biological fluid). Samples particularly include human samples. The sample may be contained within a test tube, culture vessel, multi-well plate, or any other container or supporting substrate. The sample can be, e.g., a cell culture or human tissue. The sample can also be an environmental sample. The term "biological sample”, as used herein, includes but is not limited to a sample containing tissues, cells, and/or biological fluids isolated from a subject. Examples of biological samples include, but are not limited to, tissues, cells, biopsies, blood, lymph, serum, plasma, saliva, and tears. In some embodiments, biological samples are obtained from, or derived from, blood, including plasma, serum, and blood cells.

Particularly, the sample is a biological sample comprising cells. Plasmodium infects red blood cells and also e.g. hepatocytes. In some embodiments, the biological sample is from a subject, the subject being a human. For diagnostic purposes, the most common type of sample is blood. Thus, in one embodiment the biological sample is blood. In another embodiment the biological sample is a liver biopsy sample. In some embodiments, Plasmodium-infected red blood cells can be in any stage of development of the parasite, i.e. in ring, trophozoite, schizont and gametocyte stages.

An aspect of the invention is the aptamers for use in medicine. Particularly, the aptamers are used in the treatment and/or prevention of Plasmodium infections, e.g. malaria. This aspect can be alternatively formulated as the use of the aptamers as defined for the manufacture of a pharmaceutical product, a medicament or a veterinary product, for the prevention and/or treatment of Plasmodium infections. This may be also alternatively formulated as a method for the prevention and/or treatment of a Plasmodium infection in a mammal, including a human, comprising administering to said mammal in need thereof an effective amount of the aptamer as defined. In some embodiments, the ap- tamers are included in a carrier such as a liposome, or a polymeric nanoparticle. In other embodiments, the aptamers are conjugated with a functional group as explained before, such as drug for the treatment of malaria. Another aspect of the invention relates to a pharmaceutical composition comprising at least one aptamer or at least one, optionally in combination with one or more pharmaceutically acceptable carriers, excipients or solvents.

Kits

The present disclosure also provides kits, or products of manufacture, comprising one or more aptamers of the present disclosure, conjugated with functional groups, e.g. detectable labels, and optionally instructions for use according to the methods of the present disclosure. One skilled in the art will readily recognize that an aptamer of the present disclosure can be readily incorporated into one of the established kit formats which are well known in the art. For instance, several biosensing protocols have been developed employing aptamers against Plasmodium LDH, such as colorimetric sensing, impedance measurements by electrode functionalization, or enzyme capture and colorimetric catalysis. Such platforms can be easily adapted to the aptamers provided herein, which would only require a cell permeabilization agent included in the corresponding buffers.

Other components of the kit can include, e.g., containers and components for collecting biological samples, a solid support such as microtiter multi-well plates, buffers, preservatives, standards, assay diluent, wash buffer, adhesive plate covers, and/or instructions for carrying out a method of the invention using the kit. In some embodiments, the kit includes a buffer for cell lysis or permeabilization to use as pretreatment to the biological sample before detection. The kit can also include one or several protease inhibitors (e.g., a protease inhibitor cocktail) to be applied to the biological sample to be assayed (such as blood or urine).

In some embodiments, the aptamer or the conjugate is in dry form in a container (e.g., a glass vial), and the kit further comprises a vial with a solvent suitable to hydrate the aptamer, and optionally instructions for use of the reconstituted product according to the methods disclosed herein. In some embodiments, the kit comprises reagents to conjugate a functional group to an aptamer of the present disclosure, instructions to conduct the conjugation, and instructions to use the conjugate according to the methods of the present disclosure. In a particular embodiment, the kit comprises aptamers conjugated to a detectable label as explained above; e.g. a fluorophore, biotin or gold nanoparticles.

In some embodiments, the kit is in form of a malaria rapid diagnostic test (RDTs), permitting a reliable in situ detection of malaria infections particularly in remote areas with limited access to good quality microscopy services. In a particular embodiment the kit is for carrying out a colorimetric or optical detection method, with no need of laser detection. Thus, the aptamer/s are conjugated with detectable labels according to the method of detection; e.g. biotin/streptavidin system, streptavi- din/HRP system or gold nanoparticles. Particularly, the aptamer/s are in liquid form or immobilized onto a solid matrix such as cellulose strip. pRBCs can be retained by use of the aptamer or in combination with antibodies. The strip can have a microfluidic pattern to sort out RBCs.

In some embodiments, the kit is implemented as a disposable microfluidic device or microfluidic lab- on-a-chip system. In other embodiments, the kit is on a form to be used in a hospital/laboratory with facilities that permit detection with e.g. light microscopy (including fluorescence confocal microscopy), flow cytometry, transmission electron microscopy, and spectrofluorimetry.

In some embodiments, the kit of the invention comprises at least one aptamer selected from the group consisting of sequences SEQ ID NO: 1-25. In a particular embodiment, at least one aptamer comprises SEQ ID NO: 1 (19). In another embodiment, at least one aptamer comprises SEQ ID NO: 8 (30s). In another embodiment, the kit comprises more than one aptamer (e.g. two aptamers). In a particular embodiment, the kit comprises a first aptamer comprising SEQ ID NO: 1 (19) and a second aptamer selected from the group consisting of sequences SEQ ID NO: 5 (78) and SEQ ID NO: 10 (78s). In another embodiment, the kit comprises a first aptamer comprising SEQ ID NO: 8 (30s) and a second aptamer selected from the group consisting of sequences SEQ ID NO: 5 (78) and SEQ ID NO: 10 (78s).

Methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein. The following examples and drawings are provided herein for illustrative purposes, and without intending to be limiting to the present invention.

EXAMPLES

EXAMPLE 1 : Generation of pRBC-specific DNA aptamers using the SELEX technique

Aptamers were developed by SELEX using fixed late stages of pRBC targets.

1.1. SELEX technique

SELEX uses iterative in vitro selection of combinatorial RNA or DNA pools against a molecular target for the identification of high-affinity oligonucleotide ligands. The method starts by exposing the molecule of interest to a randomly generated ssDNA or RNA library, retrieving the aptamer/target complexes. The binding oligonucleotides are subsequently amplified in a thermal cycler and the resulting PCR products are dissociated in their complementary single strands, which enter again an affinity selection cycle for as many times as it takes to obtain a pool of oligonucleotides specifically binding the selected target. The variant called cell-SELEX uses as targets whole cells or cell membranes. Using whole cells as targets, aptamers can be selected to bind biomarkers differing between two given cell types or between healthy and diseased cells.

1.2. Preparation of target cells

Unless otherwise indicated, oligonucleotides and other reagents were purchased from Sigma-AI- drich. The P. falciparum 3D7 strain (BEI resources; https://www.beiresources.org/Catalog/BEIPara- siticProtozoa/MRA-102.aspx) was grown in vitro in group B human erythrocytes using previously described conditions [Cranmer et al., 1997] Parasites (thawed from glycerol stocks) were cultured at 37 °C in T-25 or T-175 flasks (Thermo Fisher Scientific, Rochester, NY, USA) containing human erythrocytes at 3% hematocrit in Roswell Park Memorial Institute (RPMI) complete medium containing Albumax II (RPMI-A, Invitrogen), supplemented with 2 mM L-glutamine, under a gas mixture of 92.5% N2, 5.5% CO2, and 2% O2. RBCs parasitized with late-form trophozoite and schizont parasite stages corresponding to 24-36 h and 36-48 hpi, respectively, were purified in 70% Percoll (GE Healthcare, Chicago, USA) [Lambros et al., 1979, Radfar et al., 2009] Parasitemia was determined by microscopic counting of blood smears fixed briefly with methanol and stained for 10 min with Giemsa (Merck Chemicals) diluted 1 :10 in Sorenson’s buffer, pH 7.2. For culture maintenance, parasitemia was kept below 5% late forms and 10% early forms by dilution with freshly washed RBCs and the medium was changed every 1-2 days. Percoll-purified late stages were pelleted (800x g, 6 min) and subjected to fixation in 4% paraformaldehyde followed by cryopreservation at -80 °C in 44% glycerol, 20 g/l sodium lactate, 230 mg/I KCI, and 12 g/l sodium phosphate, pH 6.8. Non-para- sitized RBCs from the same blood batch were also cryopreserved and, when required after thawing, fixed as above for their use in counter-SELEX cycles (see below).

1.3. SELEX cycles

For the generation of pRBC-specific DNA aptamers using the SELEX technique (FIG. 1), a singlestrand nucleic acid library with invariant PCR primer-binding flanking regions on each end and a randomized central sequence of 40 nucleotides (ATACCAGCTTATTCAATT- NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATAGTAAGTGCAATCT (SEQ ID NO: 26), 1 pmol) was purchased from DNA Technology A/S (Denmark). 10 nmol of this DNA library was dissolved in 1 ml of RPMI supplemented with 25 mM HEPES, pH 7.4, 5 mM MgCL and 1 mg/ml BSA (binding buffer) and subjected to a first counter-SELEX negative selection process, whereby it was incubated with ca. (approximately) 10⁶ fixed RBCs that had been previously washed three times in washing medium (binding buffer without BSA). Prior to addition to the cells, the library was incubated at 95 °C for 5 min followed by a 10-min incubation in ice. The cells and library mixture were incubated in ice for 1 h under constant stirring (50 rpm), spun down (500x g, 3 min) to remove RBC-binding sequences, and the supernatant containing the free oligonucleotides that did not bind RBCs was added to fixed pRBCs for the next positive selection cycle. This counter-selection step with non-parasitized erythrocytes was repeated again before rounds 4, 7 and 10. After incubation and pull-down steps as above, the pelleted cells were rinsed 3 times with washing medium, taken up in 200 pi of double deionized water (ddH2Q; MilliQ system, Millipore) and heated up to 95 °C for 10 min before proceeding to thermal cycler amplification. pRBC-binding sequences were PCR amplified following the procedures described by Sambrook and Russell (commonly used in the laboratory), using Taq DNA polymerase (PCR Master Mix 2x, Thermo Fisher Scientific). As a rule, 20 cycles were programmed in a DNA 2720 Thermal Cycler (Applied Biosystems) 94 °C/56 °C/72 °C, 30 s each, with a 1-min 94 °C extra incubation before the first cycle. The 5’ ends of forward (5’-ATACCAGCTTATTCAATT-3’ SEQ ID NO: 27) and reverse (5’- AGATTGCACTTACTATCT-3’ SEQ ID NO: 28) primers were derivatized with 6-carboxyfluorescein (6-FAM) and tri-biotin, respectively. The PCR mix was distributed in 30 tubes containing 50 pi of reaction each. The resulting amplification products were precipitated by addition of 0.1 vol of 3 M sodium acetate, pH 5, and 2.5 vol of absolute ethanol, thoroughly mixed, and stored overnight at -20 °C. After centrifugation (20,100x g, 45 min, 4 °C), the DNA pellet was washed with 70% ethanol, spun down for 15 min in the same conditions as above, and dried by solvent evaporation for 35 min in a SpeedVac concentrator (SPD 1010, Savant). Finally, the dry pellet was taken up in washing buffer (30 mM HEPES, 500 mM NaCI, 5 mM EDTA, pH 7).

To purify the forward strand, the PCR-amplified DNA (carrying a tri-biotin tag in the reverse strand) was loaded into a streptavidin column (NeutrAdivinTM High-Capacity Agarose Resin, Thermo Fisher Scientific) and placed inside a Micro Bio-Spin chromatography Colum (Bio-Rad). Columns were washed 16 times with washing buffer before DNA addition, and 10 times afterwards. To elute the forward strand (carrying a 6-FAM tag), 400 pi of 0.1 M NaOH were added to the column, which was subsequently vortexed (30 s) and centrifuged (500x g, 30 s). Three elutions were performed and immediately neutralized with 0.1 vol of 1 M HCI. The eluted ssDNA was precipitated as above and taken up in binding buffer. This 6-FAM-labeled oligonucleotide entered a second identical SELEX cycle and this process was repeated for 10 such rounds of binding and selection, until a set of ap- tamers was identified that bound pRBCs with the desired specificity and affinity as assessed by fluorescence microscopy and flow cytometry. Finally, the selected sequences were subcloned and synthesized in sufficiently large amounts for the characterization of their binding to pRBCs (EXAMPLE 3).

1.4. Fluorescence microscopy and flow cytometry analysis

P. falciparum 3D7 cultures (fixed) were incubated in the presence of 120 pmol of oligonucleotides labeled in their 5’ ends with 6-FAM (Aex/em: 488/525 nm) for 60 min in binding buffer at 4 °C with gentle stirring. Aptamers had been previously pretreated by incubating them for 5 min at 95 °C in washing medium at 10x their initial concentration, followed by a 10-min incubation on ice. After rinsing with washing medium, cells were stained for 30 min with 4 pg/ml of the DNA dye Hoechst 33342 (Aex/em: 350/461 nm), rinsed with washing medium and placed in a 8-well LabTek chamber slide system (Lab-Tek®ll, catalog number 155409).

Fluorescence microscopy analysis was done with an Olympus 1X51 fluorescence microscope or with a Leica TCS SP5 laser scanning confocal microscope equipped with a DM16000 inverted microscope, blue diode (405 nm), Argon (458/476/488/496/514 nm), diode pumped solid state (561 nm) and HeNe (594/633 nm) lasers and PLAN APO 63x oil (NA 1 .4) immersion objective lens. Non-fixed pRBC cultures were permeabilized with 0.1% w/v saponin in phosphate buffered saline (PBS) for 15 min, rinsed 3 times with washing medium, and treated as above.

For flow cytometry analysis, pRBCs were diluted in PBS to a final concentration of 1 -10 ^c 10⁶ cells/ml, and samples were analyzed using a LSRFortessa™ flow cytometer (BD Biosciences) set up with the 5 lasers, 20 parameters standard configuration. The single-cell population was selected on a forward- side scatter scattergram. The fluorochromes Hoechst 33342, 6-FAM, TAMRA, and Alexa Fluor 647 (streptavidin label for detection of biotinylated aptamers) were excited using 350, 488, 561 and 640 nm lasers, and their respective emissions collected with 450/40, 525/40, 582/15 and 730/45 nm filters.

Results

1.5. Design of a SELEX protocol for the identification of Plasmodium- specific aptamers

During its initial development for the search of pRBC-specific targets the SELEX process was expected to present itself with a number of problems whose solutions might require the re-examination of standard protocols or the need for controls to be done months after the research started. In this scenario, the intrinsic variant expression of Plasmodium antigens presented a significant obstacle if different parasite cultures were to be used throughout the selection, since their changing proteins would be a movable target precluding the enrichment of aptamers recognizing a particular epitope. In addition, if Plasmodium cultures had to be prepared weeks apart, different blood batches would need to be used; in preliminary assays where blood from different donors was employed, the SELEX protocol ended up with the unwilling selection of aptamers targeted to blood donor-specific RBC surface antigens. To minimize these risks, it was decided to grow a large pRBC batch cultured with erythrocytes from a single donor, fix it with paraformaldehyde, and store it in frozen aliquots in order to preserve a constant antigen collection throughout the protocol. Because the fixation method used does permeabilize the cells, the potential antigens to be identified could be intracellular pRBC molecules.

Fluorescence microscopy and flow cytometry analysis were used to follow the enrichment in 6-FAM- labeled pRBC-binding aptamers after each SELEX cycle (FIG. 2). Fluorescence microscopy images revealed an increase in the pRBC-associated 6-FAM signal with each successive SELEX round, although the intensity of fluorescence in the first cycles was very low and is barely appreciated, where the microscope settings applied to all the SELEX rounds were those selected for a correct exposure of round 10. The higher sensitivity of flow cytometry, however, revealed an unexpected finding since even the PCR-amplified original aptamer library exhibited a significant binding to pRBCs relative to uninfected erythrocytes (FIG. 2). With each cycle, the fluorescence signal associated to pRBCs increased whereas non-parasitized RBCs remained aptamer-free. The SELEX cycles were stopped at round 10, when the observed pRBC-associated fluorescence was not significantly different from that detected in round 9. Because the P. falciparum culture used in these fluorescence microscopy and flow cytometry analyses was prepared from a different blood batch and parasite stock, we concluded that the aptamers obtained recognized epitopes that are not exclusive of the original pRBC population used for SELEX selection.

1.6. Conclusions

The 10^th SELEX round was enriched with specific pRBC-binding aptamers. Such enrichment is progressive along the selection rounds (FIG. 2), indicating that the selection process is working as expected and only very specific and high affinity sequences are obtained at the end.

EXAMPLE 2: Characterization of the obtained individual pRBC-specific aptamers

The fluorescence microscopy and flow cytometry data presented above (EXAMPLE 1) suggested that SELEX round 10 was enriched in highly specific pRBC-binding aptamers. In consequence, we proceeded to subclone the round 10 oligonucleotide pool in order to obtain plasmids containing individual aptamers.

2.1. Subcloning and sequencing of candidate oligonucleotides

After 10 rounds of selection, the enriched oligonucleotide pool was PCR-amplified using unlabeled forward and reverse primers and Pfu DNA polymerase (Biotools). The resulting products were cloned into the pBluescript SK+ plasmid after its linearization with Smal (New England Biolabs) using T4 DNA Ligase (New England Biolabs) and the ligation product was used for the transformation of heat- shock competent TOP10 Escherichia coli cells (Thermo Fisher Scientific). The transformed cells were grown overnight at 37 °C in Luria Broth agar plates and the recombinant colonies were differentiated with the blue/white screening method after the induction of lacZ expression in the presence of X-gal and IPTG. White clones were randomly chosen from the plates and their plasmids were isolated with the GeneJET Plasmid Miniprep Kit (Thermo Fischer Scientific). The successful insertion of sequences from the original library was validated by PCR with the specific forward and reverse primers and by digestion with the restriction enzymes Notl and Sail (New England Biolabs); in both approaches, DNA bands with the expected lengths were detected in agarose gels. The positive clones were finally sequenced using T7P universal primers (Sanger sequencing service, GENEWIZ GmbH, Leipzig, Germany; https://www.genewiz.com/en-GB/Public/Services/Sanger-Sequencing).

2.2. 2-D structure analysis and G-score

2-D structure analysis was done using the mfold web server (http://unafold.rna.albany.edu/) [Zuker 2003], completing the DNA folding form and selecting ion and temperature conditions present in our incubations (140 mM Na⁺ and 5.4 mM Mg²⁺, 4 °C).

The potential presence of G-quadruplexes was analyzed using the Quadruplex forming G-Rich Sequences (QGRS) Mapper (http://bioinformatics.ramapo.edu/QGRS/index.php) [Kikin et al., 2006], which was applied for predicting the position and the G-score (likelihood to form a stable G-quadru- plex).

Results:

2.3. Identification of individual pRBC-specific aptamers

The round 10 oligonucleotide pool was subcloned in order to obtain plasmids containing individual aptamers. Five such cloned sequences (aptamers 19, 24, 30, 77 and 78) were PCR-amplified using the 6-FAM-labeled forward primer, and when added to fixed pRBC/RBC cocultures they exhibited a complete specificity of binding for pRBCs vs. RBCs (FIG. 2).

2.4. The aptamers show a G-quadruplex structure

After sequencing the five selected oligonucleotides, it was observed that the originally randomized central sequence of 40 nucleotides was in these 5 oligomers largely G-enriched (FIG. 3). Among different architectures, several aptamers have been described to adopt the G-quadruplex structure, which consists of planar arrays of four guanines, each one of them pairing with two neighbors by Hoogsteen bonding [Gatto et al., 2009] At least four GG pairs in close vicinity on an oligonucleotide sequence are required for G-quadruplex formation, and this feature is present in all the five pRBC- binding aptamers that had been randomly subcloned from SELEX round 10 (FIG. 3 and 10 and TABLE 2).

TABLE 2: G-scores or likelihood of G-quadruplex presence obtained with the QGRS mapper tool.

* For aptamer 77, two different G-quadruplexes have been predicted.

EXAMPLE 3: Targeting performance of the aptamers

3.1. Methods

The targeting performance of the obtained aptamers was evaluated by fluorescence microscopy and flow cytometry as described in the previous EXAMPLE 1 (section 1.4). Besides P. falciparum 3D7 cultures (either fixed, permeabilized non-fixed, or live), fixed P. falciparum NF54 gexp02-tdTomato transgenic gametocytes were also used in this study, which were selected by choline depletion and addition of N-acetyl-D-glucosamine for asexual form removal (kindly provided by Harvie Portugaliza and Alfred Cortes [Portugaliza et al. 2019]

A negative control aptamer (700) was designed by means of an in-house Python script that printed a random 40-base oligonucleotide with the following relative frequencies: A = 17.5%; T = 55%; C = 10% and G = 17.5%. These selected frequencies were obtained by analyzing the relative base frequency of aptamers 19, 24, 30, 77 and 78 (A = 11.22%, T = 17.85%, C = 16.32% and G = 54.59%), and by substituting the frequency of A for C, T for G, G for T and C for A). Frequencies were rounded to obtain an aptamerwith a natural number of bases and the unmodified primer-binding sequences were finally added at both ends, obtaining the following oligomer: ATACCAGCTTATTCAATTAGTT- GTGGTTGCAACTTTTTATTATTTGTTCGTATCTTTAAGATAGTAAGTGCAATCT (SEQ ID NO: 29).

Results:

3.2. Fluorophore-labeled aptamers specifically bind to Plasmodium- infected RBCs and not to non-infected RBCs

According to fluorescence microscopy imaging, the chemically synthesized 6-FAM-labeled aptamers of these five selected sequences specifically bound pRBCs vs. RBCs (FIG. 4) of cell batches different from those used during the SELEX process, indicating that the cellular structures being detected are truly characteristic of P. falciparum- infected erythrocytes. The pRBC subcellular distributions of the aptamers were not identical; although cytosolic localization was evident for all of them, the sequences 19, 24 and 30 clearly labeled the host erythrocyte plasma membrane, whereas 77 and 78 colocalized with vesicular structures. pRBC vs. RBC specific binding was quantitatively characterized by flow cytometry (FIG. 4), which confirmed that the five selected aptamers bound >84.5% of late-stage pRBCs and <0.06% of non- parasitized RBCs (TABLE 3). Aptamer 30 exhibited the most efficient pRBC recognition, binding 95.2% of late stages. A control aptamer (700), which was randomly synthesized but designed to contain a base composition well differentiated from that of the five selected sequences, bound ca. 19.6% of pRBCs.

Removal of the PCR primer-binding flanking sequences had different effects on the targeting specificity of the variable 40-base oligonucleotides which were selected (TABLE 3). This had as objective exploring the limits of modification and checking if the primer-binding flanking region had influence on the aptamer binding to target cells. For aptamers 30 and 78, not only the flanking regions did not influence binding, but their removal increased the fluorescence intensity, indicating that more aptamer molecules are binding to target cells.

When 6-FAM was substituted by the reporter group TAMRA, binding specificity decreased significantly for aptamer 30 (TABLE 3), suggesting an effect on oligonucleotide folding of the 6-FAM group present on the aptamer 5’ end during the SELEX cycles.

TABLE 3: Percentage of fixed late stage pRBC/non-parasitized RBC binding of the different aptamers determined from flow cytometry data.

Gametocytes, the sole Plasmodium stage that can be transmitted from the human to the mosquito vector, were occasionally observed to be also targeted by some aptamers, which led us to perform a detailed flow cytometry study of P. falciparum gametocyte targeting (TABLE 4).

TABLE 4: Percentage of fixed P. falciparum gametocyte/non-nucleated cell binding of the different aptamers determined from flow cytometry data.

3.3. Targeting assays with non-fixed, saponin-permeabilized cells Targeting assays with non-fixed, saponin-permeabilized cells revealed also a pRBC-specific binding of all 5 aptamers (FIG. 6 and TABLE 5), indicating that the observed specificity was not derived from a fixation artifact. RBCs burst at the saponin concentration used, and most cellular structures remaining in the sample were P. falciparum parasites bounded by their parasitophorous vacuole membrane (PVM), exhibiting characteristic rounded shapes slightly smaller than erythrocytes. RBC plasma membrane remains and other erythrocyte debris were still visible around some PVM-en- closed parasites. Since all aptamers stained both the PVM and the pRBC plasma membrane, the targeted epitope(s) likely correspond to parasite molecules that are exported to both cell membranes. This is in agreement with dot blot data (FIG. 5) indicating the presence of the sought-after antigen(s) in Triton X-100 and, especially, in RIPA buffer extracts, which contain cell membrane-bound compo- nents. However, targeting assays with live cells did not show binding of the aptamers to pRBCs (FIG. 11), which clearly suggested that the location of the epitope(s) being detected is intracellular and that the selected oligonucleotides are not able to cross plasma membranes in intact cells.

TABLE 5: Percentage of saponin-permeabilized, non-fixed pRBC binding of the different 6-FAM- labeled aptamers determined from flow cytometry data.

3.4. Conclusions

Flow cytometry and fluorescence microscopy assays allowed a deep characterization of binding percentages of the aptamers, showing that they have high specificity (84-95% of pRBCs were bound and only 0.06-0.00% of healthy RBCs were detected binding the aptamers) and that some of them can be modified by shortening the sequence or changing the labeling molecule without losing activity. In addition, their use with saponin-permeabilized non-fixed cells proves that they can bind unmodified antigens, thus their target is not an artifact from fixation, allowing their application as diagnostic tool. EXAMPLE 4: Cell labeling improves with the obtained aptamers vs LDH aptamer

The aptamer 2008s, developed against P. falciparum LDH, has been postulated as an ideal biosensor for malaria diagnostic devices [Cheung et al., 2013] In this example, the targeting performance of this LDH aptamer is compared to the aptamers herein provided. 4.1. Methods

The targeting performance of the aptamers was evaluated by flow cytometry as described in the previous EXAMPLE 1 (section 1.4).

2008s biotinylated in its 5’ end has been used in targeting analysis assays performed with purified LDH or with cell extracts [Cheung et al., 2018; Frith et al., 2018] The targeting performance of biotin- 2008s was compared on fixed cells with that of the aptamers described herein, all of them 5’-bioti- nylated (TABLE 6).

TABLE 6: Percentage of fixed late-stage pRBC binding of 5’-biotinylated aptamers determined from flow cytometry data.

4.2. Results

The flow cytometry results obtained showed a >30-fold improvement in the detection of fixed pRBCs with any of the five aptamers provided herein relative to 2008s LDH aptamer.

EXAMPLE 5: Apparent Kd, apparent Bmax

The apparent affinity for target cells of the selected 6-FAM-labeled aptamers was measured by incubating serial dilutions of them with fixed 3D7 P. falciparum trophozoites, using a random sequence as nonspecific binding control.

5.1. Determination of apparent Kd and Bmax

1 x10⁶ fixed P. falciparum 3D7 Percoll-purified trophozoites were incubated in the presence of 6- FAM-labeled oligonucleotides (10 different dilutions in triplicates, from 4000 to 7.13 nM, in a final volume of 40 pi) for 60 min in binding buffer at 4 °C. After rinsing twice with washing medium, cells were diluted 1 :10 in PBS immediately prior to analysis with a LSRFortessa™ flow cytometer set up with the 4 lasers, 18 parameters standard configuration. The single-cell population was selected on a forward-side scatter scattergram. 6-FAM was excited using a blue laser (488 nm), and its fluorescence collected through a 525/40 nm filter; mean fluorescence intensity was obtained using Flowing Software 2.5.1 (www.btk.fi/cell-imaging; Cell Imaging Core, Turku Centre for Biotechnology, Finland). The equilibrium dissociation constant (Kd) and density of receptors (Bmax) [Mintun et al., 1984] of the aptamer-cell interaction was obtained by fitting the dependence of intensity of specific binding on the concentration of the aptamers to the equation Y = BmaxX/(Kd + X) [Shangguan et al., 2006] GraphPad Prism 6 (GraphPad Software, San Diego, USA) was used to plot the saturation curve, selecting analysis of binding by non-linear regression fit, considering one site and comparing total and non-specific (aptamer 700 used as reference) binding data.

5.2. Results

Results are shown in TABLE 7. The selected sequences show differences in apparent Kd and Bmax, indicating that they have different affinities for the targeted cells, where they possibly encounter different densities of binding sites.

TABLE 7: Apparent Kd, Bmax, and binding potential (BP = Bmax/Kd ratio) for the selected aptamers.

Although the apparent Kd between different aptamers might be influenced by the concentration of their respective antigens in the cells if the aptamers are targeting different molecules, the disparities between the full-length aptamers and the same sequences afterthe removal of the primer sequences are expected to be mostly influenced by the change in affinity of the oligonucleotides for their corresponding antigens as the primer-binding regions of their sequences are eliminated.

Four out of the five short aptamers (with exception of 19s) improved in Bmax relative to the full-length sequences, suggesting that they were able to bind more target sites inside cells, since these short- ened sequences likely encounter less steric impediments due to their smaller size. Therefore, a decrease in antigen affinity can be compensated by more available ligands. As a preliminary evaluation of aptamer performance, a ratio can be established between the apparent Bmax and the apparent Kd (binding potential, BP = Bmax/Kd). The higher this relation, the better cell labeling by the corresponding oligonucleotide, since it will have either a lower Kd (and higher affinity) or a higher Bmax (and more binding sites), or both. The aptamer ranking according to BP was 30s > 19 > 78 > 24s > 77s > 30 > 78s > 24 > 77 > 19s. No correlation was observed between the efficacy of aptamer target detection and the presence or absence of the PCR primer-binding sequences.

TABLE 8: Variation in Kd, Bmax and BP for full length vs. flanking region-lacking aptamers.

EXAMPLE 6: The aptamers can detect antigens in pRBC protein extracts.

Detecting in which extracts and in which stages the antigen is more abundant is key for its identification. Besides, working with protein extracts is a possible scenario for diagnostic application. 6.1. Antigen pattern by dot blots and Western blots

6.1.1. Protein extract

Protein extracts from 8 to 48 hpi parasites were sequentially obtained from a P. falciparum 3D7 culture tightly synchronized at ring stages (0 hpi) using a series of sorbitol lysis (7 vol of 5% sorbitol in ddhhO was added to pelleted cultures and incubated at 37 °C for 7 min, then spun down and washed with washing medium before being placed again in culture conditions) combined with Percoll purification of late stages during the previous week. Briefly, 2 sorbitol lysis were performed 36 hours apart, followed by a Percoll treatment 36 h after the second sorbitol, and then a final sorbitol was used to select ring stage parasites with a 8-h window after Percoll. Immediately after this last synchronization, cell samples were collected every 8 h, pulled down by centrifugation and washed twice with PBS supplemented with complete™, and then incubated with a 7-fold cell pellet volume of 0.15% saponin in PBS and complete™ at 4 °C for 15 min. Afterwards, samples were centrifuged at 10,OOO^c g for 15 min and the supernatant was recovered (saponin extract fraction). The pellet was further washed 4-5 times, until there was no hemoglobin visible, and then resuspended in 1-fold cell pellet volume of 1% Triton X-100 in PBS supplemented with 1 x complete™ and incubated for 30 min at 4 °C. Then samples were centrifuged at 20,000x g for 30 min and the supernatant was recovered (Triton X-100 extract fraction). The remaining pellet was washed 2 times and taken up in 1-fold cell pellet volume of RIPA buffer (150 mM NaCI, 10% glycerol, 2 mM EDTA, 0.5% sodium deoxycho- late, 0.2% SDS, 0.1 % Triton X-100, 40 mM tris-HCI, pH 7.6) supplemented with complete™. After 15 min incubation, the sample was vortexed for 1 min and sonicated for 30 s, and after a brief incubation (4 °C, 10 min), it was centrifuged (20,000x g, 4 °C, 15 min) and the supernatant was recovered (RIPA buffer extract fraction).

6.1.2. Dot blots

After determining protein concentration using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific) following the manufacturer’s indications, cell extracts were diluted to 0.2 pg protein/mI and 2 pi of them were placed on top of a preactivated polyvinylidene difluoride (PVDF) membrane (Bio- Rad). When the dots dried, the membrane was blocked under orbital stirring (50 rpm) at RT for 1 h with 5% (w/v) skim milk in tris-buffered saline (TBS, 150 mM NaCI, 50 mM tris-HCI, pH 7.6) containing 0.05% Tween 20 (TBStoos), washed again (3x, 5 min) in TBStoos, and incubated with 600 nM biotin- labeled pretreated aptamer in TBStoos containing 0.1% (w/v) skim milk (1 h, RT). After 3 washes with TBStoos for 5 min each, it was incubated with 1.5 pg/ml of streptavidin-Alexa Fluor 647 in TBStoos containing 0.1% (w/v) milk powder (30 min, RT). After 3 final washes with TBStoos for 5 min each, fluorescence images of the membrane strips were obtained with an ImageQuant™ LAS 4000 CCD camera system (GE Healthcare Life Sciences) using red epi-illumination and a R670 Cy5 filter.

6.1.3. Western blots

For Western blots, 300 pg protein of RIPA fraction extracts from 40 to 48 hpi were loaded into a single-well 12.5% polyacrylamide gel and run for 45 min at 120 V. Then they were transferred overnight to a preactivated PVDF membrane (BioRad) at 4 °C and 180 V. Membrane strips were washed (2^c, 5 min) with TBS and processed as for dot blots but substituting the biotinylated aptamer plus fluorescent streptavidin step by a 1-h incubation with 600 nM 6-FAM-labeled aptamer, and detecting fluorescence with a Y515 filter.

6.1.4. Results

RIPA buffer extracts of all stages were positive for all five aptamers (see FIG. 5 for aptamer 19; data not shown for the other aptamers), indicating the presence from early rings to mature schizonts of the targeted epitope(s), whose presence dramatically increased along the intraerythrocytic parasite cycle.

According to flow cytometry data of whole cells, and consistently with the use of late-stage pRBCs for the SELEX cycles, early ring stages were not bound by any of the selected sequences. However, RIPA buffer extracts of all stages were positive for all five aptamers (see FIG. 5 for aptamer 19; data not shown for the other aptamers), indicating the presence from early rings to mature schizonts of the targeted epitope(s), whose presence dramatically increased along the intraerythrocytic parasite cycle.

6.2. Protein identification

6.2.1. Pull down assays

0.2 mg of streptavidin-coated magnetic beads (Dynabeads™ MyOne™ Streptavidin C1 , Thermo Fisher Scientific) were washed 3 times by magnetic separation with 5 mM tris-HCI, 1 M NaCI, 0.5 mM EDTA, 5 mM MgCL, pH 7.5. After that, beads were resuspended in 200 pi of the same buffer containing 200 pmol of the biotinylated aptamers, and incubated for 1 h under rotation. Supernatant was removed and unspecific binding sites were blocked by incubation with 0.1% BSA (w/v) in PBS for 1 h. After 5 washes with PBS containing 0.1% Tween 20 (v/v), aptamer-coated beads were incubated overnight in 200 pi PBS with a Triton X-100 protein extract of a P. falciparum late stage culture containing 12 pg protein. Then the beads were washed 10 times in PBS supplemented with 145 mM NaCI. To elute bound material, beads were resuspended with Laemmli buffer (60 mM tris-HCI, 2% SDS (w/v), 10% glycerol (v/v), 5% 2-mercaptoethanol (v/v) and 0.002% bromophenol blue (w/v), pH 6.8) and heated up to 95 °C; the supernatants were recovered, loaded into a 12.5% polyacrylamide gel and run for 45 min at 120 V. After silver staining, gel slabs were cut for LC-MS/MS analysis.

6.2.2. SDS gel and aptamer labeling for protein identification

Electrophoresed extracts (RIPA fraction extracts from 40 to 48 hpi as in section 6.1.1) were in-gel fixed for 10 min with acetic acid/methanol/H₂0 1 :4:5 (v/v/v) and washed (3^c H2O plus 3x washing buffer). The gel was then placed in binding buffer to which pretreated 6-FAM-labeled aptamers were added at a final concentration of 600 nM, incubated overnight and washed (3x, washing buffer) before visualizing the gel in an ImageQuant™ LAS 4000 transilluminator, where the fluorescent bands were excised and processed for liquid chromatography with tandem mass spectrometry (LC-MS/MS) analysis. 6.2.3. In-gel tryptic digestion of proteins and LC-MS/MS analysis

After cleaning gel slabs with 50 mM NH4HCO3, pH 8.0 (cleaning buffer, CB) and acetonitrile (ACN), the proteins were reduced with 20 mM DTT in CB (60 °C, 60 min) and alkylated in the same buffer supplemented with 50 mM iodoacetamide (RT, 30 min). Gel slices were covered in CB containing 0.1 pg trypsin (sequencing grade modified, Promega), and digested for 16 h at 37 °C. Tryptic peptides were extracted from the gel matrix with 10% formic acid (FA) and ACN washes, and finally dried in a vacuum centrifuge.

The dry peptide mixtures were analyzed by LC-MS/MS in a nanoACQUITY liquid chromatographer (Waters) coupled to a linear trap quadrupole-Orbitrap Velos (Thermo Scientific) mass spectrometer. The tryptic digests were resuspended in 1 % FA solution, and an aliquot (2 pi) was injected for chromatographic separation. Peptides were trapped in a Symmetry C18™ trap column (5 pm; 180 pm by 20 mm; Waters) and separated using a C18 reverse-phase capillary column (75 pm 0i, 25 cm, nanoACQUITY, 1 .7 pm BEH column, Waters). The gradient used for the elution of the peptides was 1 to 40 % B in 30 min, followed by a gradient from 40% to 60% B in 5 min (A: 0.1% FA in water; B: 0.1 % FA in ACN), with a 250 nl/min flow rate. Eluted peptides were subjected to electrospray ionization in an emitter needle (PicoTip™, New Objective) with an applied voltage of 2000 V. Peptide masses (m/z 300-1600) were analyzed in a data-dependent mode where a full Scan MS was acquired in the Orbitrap with a resolution of 60,000 FWHM at 400 m/z. Up to the 15th most abundant peptides (minimum intensity of 500 counts) were selected from each MS scan and then fragmented in the linear ion trap using collisionally induced dissociation (38% normalized collision energy) with helium as the collision gas. The scan time settings were: full MS: 250 ms (1 Microscan) and MSN: 120 ms. Generated *.raw data files were collected with Thermo Xcalibur (v.2.2). A database was created by merging all human protein entries present in the Swiss Prot public database (v.7/3/2019) with all entries for P. falciparum isolate 3D7 present in the public database Uniprot (v. 12/12/19). A small database with common laboratory protein contaminants was also added and *.raw data files obtained in the LC-MS/MS analyses were used to search with the SequestHT search engine using Thermo Proteome Discoverer (v. 1 .4.1 .14) against the aforementioned database. Both target and a decoy database were searched to obtain a false discovery rate (FDR), and thus estimate the number of incorrect peptide-spectrum matches that exceeded a given threshold, applying preestablished search parameters (enzyme: trypsin; missed cleavage: 2; fixed modifications: carbamidomethyl of cysteine; variable modifications: oxidation of methionine; peptide tolerance: 10 ppm and 0.6 Da for MS and MS/MS spectra, respectively). To improve the sensitivity of the database search, the semi- supervised learning machine Percolator was used to discriminate correct from incorrect peptide spectrum matches. Percolator assigns a q-value to each spectrum, which is defined as the minimal FDR at which the identification is deemed correct (0.01 , strict; 0.05, relaxed). These q values are estimated using the distribution of scores from decoy database search. The results were exported as Excel files and only proteins identified with at least two high confidence peptides (FDR <0.01) were considered. Gene Ontology term enrichment analysis of RBC-EV and pRBC-EV proteomes at cellular component, molecular function, and biological process level were performed with Database for Annotation, Visualization and Integrated Discovery (David 6.8) (https://david.ncifcrf.gov/).

6.2.4. Results Pull-down assays using the aptamers bound to magnetic beads resulted in the detection of several pRBC proteins identified by LC-MS/MS (TABLE 9). Western blots of late-stage P. falciparum cultures probed with the 6-FAM-labeled selected aptamers revealed for all of them dominant bands around 15 and 30 kDa (FIG. 7A). The aptamer 30s, which had the higher predicted BP (TABLE 8), provided the strongest signal. This aptamer was used to directly probe a SDS-PAGE lane loaded with the same sample extract that had been analyzed in the Western blot.

The main fluorescent band cluster at ca. 15-kDa (FIG. 7B) could be excised and subjected to LC- MS/MS analysis. Again, several P. falciparum proteins were identified (TABLE 10), being the pro- teasome subunit beta type the sole protein that was also detected in pull-down assays with biotinyl- ated aptamer 19. This result is however not conclusive and although, taken together, these data strongly suggest that all the selected aptamers recognize a single epitope that might be present in multiple parasite proteins, the efforts done to identify this antigen have been unsuccessful so far.

TABLE 9. Proteins identified by LC-MS/MS in a pull-down assay performed with biotinylated aptamer 19.

L-lactate dehydrogenase

Triosephosphate isomerase

Elongation factor 1-alpha

Thioredoxin peroxidase 1

60S ribosomal protein L6, putative

40S ribosomal protein S8

60S ribosomal protein L6-2, putative

Cytochrome b-d complex subunit 7, putative

Conserved Plasmodium protein

Protein DJ-1

HVA22/TB2/DP1 family protein, putative Ras-related protein RAB7 Early transcribed membrane protein 10.2 60S ribosomal protein L24, putative Proteasome subunit beta type

TABLE 10. Proteins identified by LC-MS/MS in the bands 1-3 excised from a SDS-PAGE gel probed with 6-FAM-labeled aptamer 30s.

40S ribosomal protein S17, putative

40S ribosomal protein S10, putative

60S acidic ribosomal protein P2

60S acidic ribosomal protein P1 , putative

40S ribosomal protein S16, putative

40S ribosomal protein S18, putative

40S ribosomal protein S24

Ubiquitin-conjugating enzyme E2 N, putative

Ubiquitin-conjugating enzyme E2, putative

Small exported membrane protein 1

40S ribosomal protein S20e, putative

60S ribosomal protein L31

Protein kinase c inhibitor-like protein, putative

Mago nashi protein homologue, putative

Ribonucloprotein

60S ribosomal protein L27a, putative Histone H2B

Bis(5'-nucleosyl)-tetraphosphatase [asymmetrical]

Thioredoxin 2 Histone H4

Peptidyl-prolyl cis-trans isomerase

Sexual stage-specific protein

Uncharacterized protein

Pre-mRNA-splicing factor BUD31 , putative

Inner membrane complex sub-compartment protein 3

Ubiquitin-conjugating enzyme E2, putative

40S ribosomal protein S15

Uncharacterized protein

60S ribosomal protein L36

60S ribosomal protein L28

60S ribosomal protein L26, putative

Glutathione reductase

60S ribosomal protein L44

Mitochondrial import inner membrane translocase subunit TIM17, putative Nucleoside diphosphate kinase U6 snRNA-associated Sm-like protein LSm1 60S ribosomal protein L27

Mitochondrial import inner membrane translocase subunit TIM23, putative

N-terminal acetyltransferase A complex catalytic subunit ARD1 , putative

40S ribosomal protein S23, putative

Activator of Hsp90 ATPase, putative

60S ribosomal protein L32

Ubiquitin-conjugating enzyme E2

40S ribosomal protein S26 Proteasome subunit beta HVA22-like protein, putative Ubiquitin-conjugating enzyme, putative Ring-exported protein 2 Aminopeptidase P Probable cathepsin C CHCH domain-containing protein Peptidyl-prolyl cis-trans isomerase U6 snRNA-associated Sm-like protein LSm4 Macrophage migration inhibitory factor Ribosomal protein L37 Replication factor A protein 3, putative Succinate dehydrogenase subunit 4, putative 60S ribosomal protein L35, putative Cofilin/actin-depolymerizing factor homolog 1 60S ribosomal protein L38 Multiprotein bridging factortype 1 , putative Small ubiquitin-related modifier 60S ribosomal protein L23, putative 40S ribosomal protein S15A, putative Transcription elongation factor 1 homolog 14-3-3 protein Band 2 Histone H2B Histone H2A

60S acidic ribosomal protein P2 40S ribosomal protein S17, putative 60S ribosomal protein L23, putative DNA/RNA-binding protein Alba 3 Nucleoside diphosphate kinase 40S ribosomal protein S15A, putative 40S ribosomal protein S11

Inner membrane complex sub-compartment protein 3 Histone H4

Protein kinase c inhibitor-like protein, putative

DNA-directed RNA polymerases I, II, and III subunit RPABC3

40S ribosomal protein S10, putative

60S ribosomal protein L36

60S ribosomal protein L30e, putative

Ubiquitin-conjugating enzyme E2

Ring-exported protein 2

40S ribosomal protein S16, putative

60S ribosomal protein L38

Antigen UB05

U6 snRNA-associated Sm-like protein LSm4 Cofilin/actin-depolymerizing factor homolog 1

EFP domain-containing protein

Uncharacterized protein

Small nuclear ribonucleoprotein Sm D2

Small exported membrane protein 1

40S ribosomal protein S26

60S ribosomal protein L28

60S ribosomal protein L37a

Ubiquitin-conjugating enzyme E2, putative

Trafficking protein particle complex subunit 2, putative

Proteasome subunit beta

Cytochrome c, putative

U6 snRNA-associated Sm-like protein LSm1

Aminopeptidase P

Transcription elongation factor SPT4, putative Histone H3

Activator of Hsp90 ATPase, putative 60S ribosomal protein L2 Glyceraldehyde-3-phosphate dehydrogenase Autophagy-related protein Small nuclear ribonucleoprotein Sm D1 40S ribosomal protein S20e, putative

N-terminal acetyltransferase A complex catalytic subunit ARD1 , putative

Macrophage migration inhibitory factor

U6 snRNA-associated Sm-like protein LSm7, putative

Sexual stage-specific protein

60S ribosomal protein L31

Inner membrane complex sub-compartment protein 1

Mitochondrial import inner membrane translocase subunit TIM17, putative

Ribosomal protein L37

AP complex subunit sigma

Copper transporter, putative

CS domain protein, putative

Ribosome associated membrane protein RAMP4, putative

Mitochondrial import inner membrane translocase subunit TIM23, putative

Probable DNA-directed RNA polymerase II subunit RPB11

60S acidic ribosomal protein P1 , putative

Ubiquitin-conjugating enzyme E2 N, putative

Pre-mRNA-splicing factor BUD31 , putative

40S ribosomal protein S18, putative

BSD-domain protein, putative

Thioredoxin 2

High mobility group protein B2 1-cys-glutaredoxin-like protein-1 HVA22-like protein, putative

60S ribosomal protein L24, putative

Parasite-infected erythrocyte surface protein

Ubiquitin-40S ribosomal protein S27a, putative

Trafficking protein particle complex subunit 2-like protein, putative

Cytochrome c oxidase subunit 2, putative

Succinate dehydrogenase subunit 4, putative

60S ribosomal protein L44

14-3-3 protein

Prefoldin subunit 4

Mitochondrial ATP synthase delta subunit, putative AP complex subunit sigma 60S ribosomal protein L39 Mitochondrial pyruvate carrier Band 3 Histone H4

Cofilin/actin-depolymerizing factor homolog 1 Histone H2B

60S ribosomal protein L23, putative

40S ribosomal protein S15A, putative

Nuclear transport factor 2, putative

40S ribosomal protein S25

60S ribosomal protein L30e, putative

V-type proton ATPase subunit F

Small nuclear ribonucleoprotein Sm D3

Macrophage migration inhibitory factor

60S ribosomal protein L37a

60S ribosomal protein L38

Membrane magnesium transporter, putative

Thioredoxin

Uncharacterized protein DNA/RNA-binding protein Alba 3 Small nuclear ribonucleoprotein Sm D2 Thioredoxin 2

Parasitophorous vacuolar protein 1 Rab5-interacting protein, putative Ubiquitin-related modifier 1 homolog Histone H3

Parasite-infected erythrocyte surface protein Trafficking protein particle complex subunit 4, putative Ubiquitin-40S ribosomal protein S27a, putative E3 ubiquitin-protein ligase RBX1 , putative Ribosome associated membrane protein RAMP4, putative 60S ribosomal protein L39 Ubiquitin-conjugating enzyme E2

EXAMPLE 7: Targeting assay in clinical samples

To assess the potential use for the future development of diagnostic devices of the selected ap- tamers, these were tested on clinical samples of malaria-infected blood.

7.1. Methods

Clinical samples had been previously characterized by Giemsa staining. For clinical sample testing, blood was obtained by venous puncture with a syringe and was placed in a tube with 6 mM EDTA as anticoagulant. A drop of blood (3 to 5 pi) was deposited on one end of a microscope slide and gently extended with another slide. Informed consent was obtained from all blood donors. The preparations were allowed to dry for at least 3 hours before fixing them in methanol:acetone 1 :9 prior to incubating with the aptamers (as in Section 1 .4).

7.2. Results

Despite having been evolved against in vitro cultured trophozoite and schizont stages, all aptamers targeted ring-stage P. falciparum parasites (aptamer 24 targeting shown in FIG. 8; data not shown for the rest of aptamers), which are the main form present in thin blood smears of malaria patients. Whenever present, late stages were always efficiently targeted. Targeting of early and late blood stages was also observed for Plasmodium vivax, Plasmodium ovale and Plasmodium malariae clinical samples (FIG. 9).

EXAMPLE 8: Targeting performance of the aptamers of SEQ ID NO: 21-25

8.1. Methods

The targeting performance of the aptamers was evaluated by flow cytometry as described in the previous EXAMPLE 1 (section 1 .4). Control aptamer 700 was used as in the previous EXAMPLE 3 (section 3.1). 8.2. Results pRBC vs. RBC specific binding was quantitatively characterized by flow cytometry, which confirmed that the sequences containing the G-quadruplexes only (SEQ ID NO: 21-25) were sufficient to bind specifically to pRBC and did not bind to RBC.

Compared to sequence 19, with ca. 93% binding towards late stage pRBCs, the reduced aptamer 19sc decreased its binding to pRBC to ca. 66%, but it was similar or even higher binding than compared to 19s, ca. 58%, previously analyzed in EXAMPLE 3. Aptamer 30sc also had slightly lower binding activity (86% compared to 95% of sequence 30). In contrast aptamers 77sc and 78sc exhibited an increase in binding to pRBC compared to sequences 77 and 78 (ca. 98% and 94% compared to 88% and 84%, respectively) (TABLE 11).

In conclusion, the G-quadruplex predicted structure of the sequences maintains the binding activity to late stages pRBCs and are still specific despite lacking the rest of the sequence.

TABLE 11 . Percentage of fixed late stage pRBC/non-parasitized RBC binding of the different ap- tamers determined from flow cytometry data.

EXAMPLE 9: Targeting performance of modified aptamers (SEQ ID NO: 30-33)

9.1. Methods

The targeting performance of modified aptamers was evaluated by flow cytometry as described in the previous EXAMPLE 1 (section 1 .4). Control aptamer 700 was used as in the previous EXAMPLE 3 (section 3.1). Modified aptamers were designed by modifying ca. 25% of the bases following two strategies: (1) leave the G-quadruplex predicted structure intact (19a75, 30sa75), or (2) change bases until G-quadruplex cannot be predicted (19g75, 30sg75) (TABLE 13). Two different aptamers, one original (19) and one short version of aptamers (30s) were selected for this analysis. Modified aptamers are shown in TABLE 12:

TABLE 12. Modified aptamer sequences:

9.2. Results

When the aptamers were modified until G-quadruplexes could not be predicted, binding activity is markedly decreased, reaching lower percentages of pRBC binding than the 700 control. If the se- quence was modified in bases that did not affect the G-quadruplex prediction, aptamers remained more active than 700 control. The modified aptamer 19a75 had similar levels of binding such as aptamers 19s or 19sc, while the modified aptamer 30sa75 shows reduced binding activity, but was still higher than the 700 control. TABLE 13. Percentage of fixed late stage pRBC/non-parasitized RBC binding of the different ap- tamer modifications determined from flow cytometry data.

In conclusion, modifying the bases that allow the prediction of G-quadruplex markedly reduce aptamer binding activity. Thus, G-quadruplex is a key structural element for the interaction with the pRBC. However, modifying other bases that do not interfere in the prediction of the G-quadruplex may result in a reduction in aptamer binding activity but still show a higher binding activity than the control.

EXAMPLE 10: ELONA detection of pRBC protein extracts using aptamers or combinations thereof

In this example, different combinations of two aptamers are tested in detecting pRBC protein extracts. In each combination, one aptamer acts as capture aptamer and the other as signaling ap- tamer. 10.1. Methods

ELONAs (Enzyme-linked oligonucleotide assays) were used in direct or sandwich style.

Direct ELONA was performed by incubating 100 pL of pRBC and RBCRIPA protein extracts (obtained as described in EXAMPLE 6, section 6.1 .1) in a serial dilution (5, 2.5, 1 .25, 0.6 and 0.3 pg/mL) plated in triplicates in a MaxiSorp plate (NUNC). These RIPA protein extracts were incubated overnight at 4° C to allow absorption into the wells. Then, the liquid was discarded and wells washed three times with 200 pL of PBS containing 0.05% Tween 20 (v/v). 200 pl_ of PBS containing 5% BSA (w/v) and 0.05% Tween 20 (v/v) were added into the wells and incubated for 1.5 hours in orbital agitation (100 rpm). The liquid was discarded and wells were washed as before. 50 mI_ of 0.6 mM biotinylated aptamer 30s solved in PBS containing 1% BSA (w/v) and 0.05% Tween 20 (v/v) were incubated in the wells for 1 .5 hours in orbital agitation (100 rpm). The liquid was discarded and wells were washed as before. Streptavidin-HRP conjugate (Sigma-Aldrich) was diluted 1 :20000 in PBS containing 1% BSA (w/v) and 0.05% Tween 20 (v/v) and added into the wells, being incubated for 1.5 hours in orbital agitation (100 rpm). After discarding the liquid and washing as before, HRP substrate (Amersham ECL Prime Western Blotting Detection Reagent, GE Healthcare) was prepared following manufacturer instructions and diluted 1 :10 in PBS, then added into the wells and the luminescence was immediately read in a SYNERGY plate reader (BioTek) with sensitivity adjusted to 135.

Sandwich ELONA was prepared by incubating 50 pl_ of 1 mM capture aptamers diluted in PBS supplemented with 5 mM MgCL previously treated with the heating-cooling procedure described in EXAMPLE 1 (section 1.1). They were incubated overnight at 4° C in a MaxiSorp plate. The next day the liquid was discarded and wells washed 3 times with 200 pL of PBS containing 0.05% Tween 20 (v/v). 200 pL of PBS containing 5% BSA (w/v) and 0.05% Tween 20 (v/v) were added into the wells and incubated for 1.5 hours in orbital agitation (100 rpm). The liquid was discarded and wells were washed as before. 50 pL of RIPA pRBC protein extracts at different concentrations (5, 2.5, 1 .25, 0.6 and 0.3 pg/mL) and RIPA RBC protein extracts at 5 pg/mL were added in triplicates and incubated overnight at 4° C. Then 0.6 mM of biotinylated aptamer, which will work as signaling aptamer, was added and the same steps as those for direct ELONA were followed from this point. Control wells with blocking, protein extracts and streptavidin-HRP incubations were used as blanks and subtracted from their equivalent wells.

Luminescence reading was plotted with GraphPad Prism 8.

10.2. Results of direct ELONA for pRBC protein quantification using HRP as reporter

Direct ELONA with aptamer 30s-biotinylated allowed to distinguish pRBC and RBC protein extracts (FIG. 12). The difference between the two types of sample was significant from 1 .25 pg/mL of protein and higher concentrations (p < 0.01), when t-tests were used for analysis.

10.3. Results of sandwich ELONA for pRBC protein quantification

Different combinations of capture and signaling aptamers were tested (FIG. 13). With the range of protein concentration that was selected, aptamer 19-biotinylated provided curves correctly adjusted for quantification tests. In contrast, aptamer 30s-biotinylated seemed to have already reached a plateau at these concentrations. Therefore, concentrations in this range did not adjust correctly for quantification tests. Aptamer 30s-biotinylated in combination with other aptamers provided higher signal at lower concentrations, potentially indicating higher sensitivity. Among capture aptamers, aptamer 78 provided the highest signal, though differences between capture aptamers were not statistically significant (except for aptamer 19s when combined with signaling aptamer 30s).

A control with 5 pg/mL of RBC protein was prepared for all the combinations, to evaluate the noise level (TABLE 14).

TABLE 14: Noise level of the sandwich ELONA

Taking into consideration both noise level and differences with the signal obtained at the lowest protein concentration, the preferred combinations of aptamers would be aptamers 78 or 78s as capture aptamers, with either one of the tested biotinylated aptamers (19 or 30s) as signaling aptamers. Furthermore, aptamer 19-btn seemed more suitable for quantification assays at this concentration range, while aptamer 30s-btn seemed more sensitive as it showed high levels of luminescence at low protein concentrations. Therefore, aptamer 30s-btn in combination with other capture aptamers might be suitable for yes/no outcomes that do not require quantification.

REFERENCES

Non-patent literature:

- Y.W. Cheung et al., "Structural basis for discriminatory recognition of Plasmodium lactate dehydrogenase by a DNA aptamer", Proc. Natl. Acad. Sci. U. S. A., 110 (2013) 15967-15972.

- S.L. Cranmer, et al., "An alternative to serum for cultivation of Plasmodium falciparum in vitro", Trans. R. Soc. Trap. Med. Hyg., 91 (1997) 363-365.

- C. Lambros et al., "Synchronization of Plasmodium falciparum erythrocytic stages in culture", J. Parasitol., 65 (1979) 418-420.

- A. Radfar, et al., "Synchronous culture of Plasmodium falciparum at high parasitemia levels", Nat. Protoc., 4 (2009) 1899-1915.

- M. Zuker, "Mfold web server for nucleic acid folding and hybridization prediction", Nucleic Acids Res., 31 (2003) 3406-3415.

- O. Kikin, et al., "QGRS Mapper: a web-based server for predicting G-quadruplexes in nucleotide sequences", Nucleic Acids Res., 34 (2006) W676-W682.

- B. Gatto, et al., "Nucleic acid aptamers based on the G-quadruplex structure: therapeutic and diagnostic potential", Curr. Med. Chem., 16 (2009) 1248-1265.

- H.P. Portugaliza, et al., "Reporter lines based on the gexp02 promoter enable early quantification of sexual conversion rates in the malaria parasite Plasmodium falciparum", Sci. Rep., 9 (2019) 14595.

- Y.W. Cheung, et al., "Aptamer-mediated Plasmodium-spec\f\c diagnosis of malaria", Biochimie, 145 (2018) 131-136.

- K.A. Frith, et al., "Towards development of aptamers that specifically bind to lactate dehydrogenase of Plasmodium falciparum through epitopic targeting, Malar. J., 17 (2018) 191.

- M.A. Mintun, et al., "A quantitative model for the in vivo assessment of drug binding sites with positron emission tomography", Ann. Neurol., 15 (1984) 217-227.

- D. Shangguan, et al., "Aptamers evolved from live cells as effective molecular probes for cancer study", Proc. Natl. Acad. Sci. U. S. A., 103 (2006) 11838-11843.

Patent literature:

US9000137B2 WO201911382A1 EP2532749B1 IN201631025722A

Claims

1 . A nucleic acid aptamer that binds to Plasmodium-infected red blood cells and does not bind to Plasmodium-free red blood cells, having a length between 30 and 200 nucleotides, comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-25.

2. A nucleic acid aptamer that binds to Plasmodium-infected red blood cells and does not bind to Plasmodium-free red blood cells, having a length between 30 and 200 nucleotides, comprising a nucleotide sequence having at least a 75% identity with a sequence selected from the group consisting of SEQ ID NO: 1-25, wherein the nucleic acid aptamer sequence has a G-score higher than 20.

3. The nucleic acid aptamer according to claim 2, wherein the aptamer binds to Plasmodium-infected red blood cells with an affinity (Kd) of less than 1.8 pM, when the Kd is determined with Percoll purified fixed late-stage Plasmodium-infected red blood cells, the aptamer being labeled with 6-car- boxyfluorescein on the 5' end, fluorescence being measured by flow cytometry with 488 nm laser set at 100 mV, selecting a single-cell population on a forward-side scatter scattergram, and selecting only the Plasmodium-infected red blood cells population in a FCS-A and SSC-A plot comparing with a control with Plasmodium-free cells.

4. The nucleic acid aptamer according to any of claims 2-3, wherein the aptamer binds to Plasmodium-infected red blood cells with a Bmax of more than 1860 a.u., when the Bmax is determined with Percoll purified fixed late-stage Plasmodium-infected red blood cells, the aptamer being labeled with 6-carboxyfluorescein on the 5' end, fluorescence being measured by flow cytometry with 488 nm laser set at 100 mV, selecting a single-cell population on a forward-side scatter scattergram, and selecting only the Plasmodium-infected red blood cells population in a FCS-A and SSC-A plot comparing with a control with Plasmodium-free cells.

5. The nucleic acid aptamer according to any of claims claim 2-4, wherein the aptamer binds to at least 58% of Plasmodium-infected late-stage red blood cells, when the % binding is determined with fixed late-stage Plasmodium-infected red blood cells, the aptamer being labeled with 6-carboxyfluo- rescein on the 5' end, fluorescence being measured by flow cytometry with 488 nm laser set at 100 mV and 350 nm laser set at 59.8 mV, selecting a single-cell population on a forward-side scatter scattergram with the 488 nm laser set at 100 mV and selecting only the Plasmodium-infected red blood cells population in a FCS-A and SSC-A plot comparing with a control with Plasmodium-free cells, and selecting the nucleus stained Plasmodium-infected red blood cells with the 350 nm laser set at 59.8 mV from the previous selected population.

6. The nucleic acid aptamer according to any of claims 2-5, wherein the aptamer is capable of binding red blood cells infected with P. falciparum, P. malariae, P. ovale, and P. vivax.

7. The nucleic acid aptamer according to any of claims 2-6, wherein when using the aptamer to develop a Western blot of a RIPA protein extract of late-stage Plasmodium-mtected red blood cells 40-48 hours post invasion, a fingerprint band pattern of at least a doble band between 25 and 35 kDa and a triple band between 15 and 10 kDa is observed.

8. The nucleic acid aptamer according to any of claims 1 -7, wherein the nucleic acid is DNA.

9. The nucleic acid aptamer according to any of claims 1-8, wherein the aptamer is conjugated with one or more functional group selected from the group consisting of a detectable label, a nanoparticle, a drug and a stabilizer moiety.

10. The nucleic acid aptamer according to claim 9, wherein the detectable label is biotin/streptavidin system, streptavidin/HRP system or gold nanoparticles.

11. A nucleic acid aptamer according to any of claims 1-10, wherein the aptamer is adsorbed or immobilized onto a solid matrix.

12. A nucleic acid aptamer according to any of claims 1-11 , wherein the aptamer is selected from the group consisting of sequences SEQ ID NO: 1 , SEQ ID NO: 5 and SEQ ID NO: 8.

13. An in vitro method for detecting the presence of Plasmodium in a sample, comprising: i) contacting the sample with an aptamer as defined in any of claims 1-12, ii) detecting the presence of a complex between the aptamer and Plasmodium or Plasmodium antigens, wherein the presence of the complex indicates the presence of Plasmodium in the sample.

14. An in vitro method for the diagnosis of a Plasmodium infection in a subject, comprising: i) contacting a biological sample from the subject with an aptamer as defined in any of claims 1-12, ii) detecting the presence of a complex between the aptamer and Plasmodium-mtected red blood cells, wherein the presence of the complex indicates that the subject has a Plasmodium infection.

15. An in vitro method for the prognosis of a Plasmodium infection in a subject, comprising: i) contacting a biological sample from the subject with an aptamer as defined in any of claims 1-12, ii) detecting the presence of a complex between the aptamer and Plasmodium-mtected red blood cells, iii) determining the concentration or amount of the complex, wherein a reduction in the concentration or amount of the complex relative to an earlier determination indicates a good prognosis, and an increase in the concentration or amount of the complex relative to an earlier determination indicates a bad prognosis.

16. The method according to any of claims 13-15, the method further comprising a step previous to step (i) of lysing or permeabilizing the cells, and a further step of separating the aptamer not bound to Plasmodium-infected red blood cells.

17. The method according to any of claims 13-16, wherein detection is performed by means of a technique selected from the group consisting of fluorescence, ELONA, aptacytochemistry, aptahi- stochemistry, flow cytometry, pull-down assay, dot blot assay, colorimetric detection, PCR assay and sandwich assay.