WO2021170035A1 - Rna virus nucleic acid test reference standard and use thereof - Google Patents

Abstract

A reference standard for RNA virus nucleic acid test (RT-PCR and NGS), and a preparation method therefor and use thereof. The reference standard is "simulated virus particles"; a lentivirus vector contains an RNA virus nucleic acid test targeted RNA sequence fragment and a fluorescent protein for tracing.

Description

RNA virus nucleic acid detection reference standard and its use Technical field

The invention belongs to the field of biology. Specifically, it relates to the reference standards involved in the detection of RNA viruses (such as coronaviruses, preferably SARS virus, MERS virus and coronavirus SARS-CoV-2) and their uses.

Background technique

Coronavirus infection of the human body can cause pneumonia, such as COVID-19. The rapid nucleic acid detection of the coronavirus has become one of the important technologies for controlling the spread of the virus, patient diagnosis, treatment and prevention. Since December 2019, by the new virus 2019-nCoV (the International Committee for Classification of Viruses named the new coronavirus "SARS-CoV-2" on February 12, 2020), infection of the human body has caused a new type of coronavirus pneumonia epidemic (the World Health Organization will The new type of coronavirus-infected pneumonia is named "COVID-19"), and the discovery of 2019-nCoV carriers, susceptible populations, morbidity, cure rate and mortality have become a very sensitive and sensitive issue for governments and people at home and abroad. The rapid nucleic acid detection of 2019-nCoV has become one of the important technologies for controlling the spread of the virus, patient diagnosis, treatment and prevention. At present, there are more than 80 domestic companies (7 with national approval) producing 2019-nCoV nucleic acid detection kits, which are quickly launched for use (generally, the sensitivity of the kit is 100-1000 copies/ml). However, due to the lack of reference standards similar to 2019-nCoV that can be used for 2019-nCoV nucleic acid detection kits and related equipment, the accuracy of the test results (positive and negative) cannot be obtained for these nucleic acid detection kits and related equipment that have been launched. ) Make a good judgment, let alone calculate the number of virus particles per unit volume of the sample to be tested (for example, 500 virus particles/ml). Therefore, a reference standard that can accurately reflect the detection accuracy and quantify 2019-nCoV is urgently needed.

RNA virus (RNA virus) refers to a type of virus whose genome is composed only of RNA, and their genetic material is ribonucleic acid (RNA). RNA viruses have two replication methods: self-replication and reverse transcription. Compared with DNA viruses, RNA viruses are more likely to cause disease, more lethal to the host, and more likely to mutate. Therefore, there are more types and it is more difficult to develop effective vaccines and difficult to prevent. There are many types of common RNA viruses related to human diseases (Table 1), and coronavirus is one of them.

Coronaviruses are linear single-stranded RNA viruses. They are a large group of viruses that exist widely in nature, with a diameter of about 80-120 nm. It is currently the virus with the largest genome among known RNA viruses. The coronavirus was first isolated from chickens in 1937. In 1965, the first human coronavirus was isolated. Because of the obvious protrusions of rod-shaped particles on the outer membrane that can be observed under an electron microscope, it looks like the crown of a medieval European emperor, so it is named "coronavirus."

Coronavirus infection of the human body can cause pneumonia, such as pneumonia (COVID-19) infected by the new coronavirus (ie SARS-CoV-2). The rapid detection of the nucleic acid of SARS-CoV-2 has become one of the important technologies for controlling the spread of the virus, performing precise disease diagnosis, precise treatment and prevention. The existing reverse transcription PCR nucleic acid amplification detection technology (RT-PCR) and next-generation sequencing technology (NGS) can be used for rapid detection of coronavirus.

Because the coronavirus is highly infectious and pathogenic, it cannot be directly used as a reference standard for nucleic acid detection. In addition, accurate detection of coronavirus is also restricted by many factors.

In clinical sampling, the sampling time, sampling location, sampling method, sampling tube (and its collection temperature) selection, and sample storage method are different, resulting in sampling errors, and it is impossible to accurately calculate the virus particle copies per unit volume of the sample to be tested. number.

Errors between experimenters, different experimenters due to their own experience and operating habits, often lead to differences in results.

In the process of viral nucleic acid detection, there is a lack of reference standards similar to the structure of the coronavirus, and the accuracy, specificity and sensitivity (positive and negative) of the detection results of the coronavirus detection kits and related equipment produced by different manufacturers cannot be obtained. Make a good judgment; the test results of different manufacturers or different batches of kits from the same manufacturer are also different, and the application of the test results to clinical diagnosis and treatment is limited.

In terms of laboratory environmental conditions, laboratories that do not comply with national GMP standards and standardized operating procedures will inevitably encounter interference caused by non-sample contents.

The lentivirus containing the SARS-CoV-2 detection target sequence used in the present invention is transfected into human 293T cells or other human cell strains to prepare lentiviral particles, which are defined as "simulated viruses" and can be used as SARS-CoV-2 nucleic acid detection Reference standard for the kit. The biological safety of its preparation materials and methods has been proven. The "simulated virus" has a shell similar to SARS-CoV-2 and RNA with the sequence targeted for nucleic acid detection. It is the research and development of SARS-CoV-2 nucleic acid detection reagents The positive reference standard for virus detection provides a safe and efficient method. The schematic diagrams of three “reference standards” used for the production of new coronavirus nucleic acid detection (RT-PCR) kits and the quality analysis and quality control of sample detection are shown in Figure 5, for example.

Summary of the invention:

The purpose of the present invention is to provide a safe, simple and efficient reference standard for coronavirus (such as coronavirus SARS-CoV-2) nucleic acid detection reference standard when purified coronavirus is not available. As a reference standard for quality analysis and quality control of 2019-nCoV such as "NGS and RT-PCR testing equipment."

In order to achieve the above objectives, the present invention adopts the following technical solutions:

1. Recombinant lentiviral vector, characterized in that the lentiviral vector contains RNA sequence fragments targeted for RNA viral nucleic acid detection and fluorescent protein for tracking,

Preferably, the RNA viruses include coronaviruses, such as SARS virus, MERS virus and SARS-CoV-2 virus,

More preferably, the recombinant lentiviral vector contains at least the following elements:

(1) Detection of the target sequence 1, which is derived from the ORF1ab encoding gene of the coronavirus SARS-CoV-2 or a fragment thereof,

(2) The detection target sequence 2 is derived from the coding gene of the S protein of the coronavirus SARS-CoV-2 or a fragment thereof,

(3) Detection of targeting sequence 3, said detection targeting sequence 3 is derived from the coding gene or fragments of the E protein of white coronavirus SARS-CoV-2,

(4) Detecting targeting sequence 4, which is derived from the coding gene of the N protein fragment of coronavirus SARS-CoV-2 or a fragment thereof,

Wherein the recombinant lentiviral vector does not contain the complete genome sequence of the complete coronavirus SARS-CoV-2. Preferably, the detection target sequence 1 and the detection target sequence 4 are each connected by a linker, more preferably, The length of the linker is 6-200bp.

2. The recombinant lentiviral vector according to item 1, characterized in that the recombinant lentiviral vector further comprises a gene encoding a tracer protein.

3. The recombinant lentiviral vector according to any one of items 1-2, wherein the length of the detection target sequence 1-4 is 80bp-1.5kb, and the detection target sequence 1-4 and detection The total length of the linker sequence between the targeting sequence 1-4 does not exceed 7 kb.

4. The recombinant lentiviral vector according to any one of items 1-3, characterized in that the lentivirus vector is a lentivirus virus vector (preferably pEZ-Lv201) or a FIV virus vector, preferably detecting the sequence of the targeting sequence 2 It includes at least the SEQ ID NO: 2 sequence, or consists of the SEQ ID NO: 2 sequence. 5. The recombinant lentiviral vector according to any one of items 1-4, characterized in that:

The sequence of the detection target sequence 1 includes or consists of the Chinese CDC detection sequence cCDC-1ab) and the detection sequence of Roche 2019-nCoV (RdRP);

The S gene detection sequence shown in SEQ ID NO: 2 of the detection target sequence 2 or consists of it;

The sequence of the detection target sequence 3 includes or consists of the E gene detection sequence of Roche 2019-nCoV(E);

The sequence of the detection target sequence 4 includes or consists of one N gene fragment of the Chinese CDC and three N gene fragments of the American CDC;

Preferably, the sequence of the detection target sequence 1 includes the SEQ ID NO: 1 sequence or consists of the SEQ ID NO: 1 sequence;

The sequence of the detection target sequence 2 includes the SEQ ID NO: 2 sequence or consists of the SEQ ID NO: 2 sequence;

The sequence of the detection target sequence 3 includes the SEQ ID NO: 3 sequence or consists of the SEQ ID NO: 3 sequence;

The sequence of the detection target sequence 4 includes the SEQ ID NO: 4 sequence or consists of the SEQ ID NO: 4 sequence.

6. The recombinant lentiviral vector according to any one of items 1 to 5, characterized in that the tracer protein is selected from fluorescent proteins, such as green fluorescent protein (GFP) or red fluorescent protein (RFP).

7. The recombinant lentiviral vector of any one of items 1-6, wherein the lentivirus vector is a lentivirus virus vector (preferably pEZ-Lv201) or a FIV virus vector.

8. The recombinant lentiviral vector of any one of items 1-7, wherein the lentiviral vector includes, but is not limited to, second- and third-generation lentiviral vectors.

9. The recombinant lentiviral particles prepared by using any of the recombinant lentiviral vectors of items 1-8, preferably the recombinant lentiviral vector is transfected into a human 293T cell line to prepare the recombinant lentiviral particles.

10. Application of the recombinant lentiviral vector according to any one of items 1-8 or the recombinant lentiviral particle according to claim 9 in the following applications:

1) Application as a reference standard (qualitative: judgment of positive and negative) for detecting COVID-19 patients, SARS-CoV-2 carriers, suspected COVID-19 patients or SARS-CoV-2 in samples, for example, Quality analysis and quality control during sample collection, sample preservation and sample RNA extraction;

2) Application in preparation of reagents or kits for detecting SARS-CoV-2;

3) Application of SARS-CoV-2 in quantitative samples;

4) The application of SARS-CoV-2 quantitative reference standard that can be incorporated into the sample to be tested for the evaluation of the treatment effect of COVID-19 patients and the recovery and discharge of the hospital.

11. Reference standard RNA, which is RNA prepared by extracting the recombinant lentiviral particles described in item 9.

12. The reference standard RNA described in item 11, which is used as a reference standard in the process of reverse transcription from RNA to cDNA involved in the process of detecting SARS-CoV-2, for example, for reverse transcription using RNA as a sample Record the quality analysis and quality control in the reaction system.

13. With reference to the standard cDNA, cDNA is prepared by reverse transcription of the lentiviral RNA described in Project 11.

14. The reference standard cDNA according to item 13, which is used for the DNA amplification process involved in the detection of SARS-CoV-2 in terms of amplification efficiency and fluorescence signal quality molecules and quality control.

15. The polynucleotide sequence, whose sequence is SEQ ID NO: 2.

16. The application of the polynucleotide sequence described in item 15 in the detection and quantification of the coronavirus SARS-CoV-2, and the construction of a reference standard for the detection of the coronavirus SARS-CoV-2.

17. A method for detecting or quantifying the coronavirus SARS-CoV-2 (preferably RT-PCR, NGS or a combination of RT-PCR and NGS), including the use of the recombinant lentiviral vector described in any one of items 1-8 Or the recombinant lentiviral particle described in item 9 is used as a reference standard. Among them, NGS is the second and third generation sequencing methods.

18. A method for preparing a recombinant lentiviral vector, comprising inserting detection targeting sequences 1-4 into the lentiviral vector, preferably, further inserting the coding sequence of the tracer protein into the lentiviral vector, more preferably, the slow The viral vector is a lentivirus viral vector (preferably pEZ-Lv201) or a FIV viral vector.

19. The recombinant lentiviral vector of any one of items 1-8, the recombinant lentiviral particle of item 9, the reference standard RNA of item 11, and the reference standard cDNA of item 13 for optimization The application in the process of detecting the SARS-CoV-2RNA nucleic acid detection kit preferably includes, but is not limited to, reference standards for optimizing the components of the reaction solution and the steps of the reaction conditions.

In some embodiments, the present invention provides a recombinant lentiviral vector for preparing a reference standard for coronavirus nucleic acid detection, the recombinant lentiviral vector comprising lentivirus 5'LTR, 3'LTR element, coronavirus such as SARS-CoV -2 RNA sequences and fluorescent protein genes targeted by nucleic acid detection; the RNA sequences targeted by nucleic acid detection include specific sequences in the SARS-CoV-2 genome that can be used for identification and detection (for example, detection target sequences 1-4) . In a preferred embodiment of the invention, the sequence of the detection target sequence 2 includes the S gene detection sequence shown in SEQ ID NO: 2 designed by Guangzhou Feneng Gene Co., Ltd. and Guangzhou Yijin Biotechnology Co., Ltd., or is composed of composition.

A method for preparing recombinant lentiviral particles is provided. The lentiviral particles obtained after co-transfection of the above-mentioned recombinant lentiviral vector and helper plasmid into host cells (such as human 293T cells) are provided. There are RNA targeting sequences for coronavirus nucleic acid detection.

definition

In order to promote the understanding of the present invention, an explanation of terms is given below:

As used herein, the term "reference product" is also called "reference standard", which means that it has one or more biological measurements such as sufficiently uniform and well-determined content, sequence, activity, structure, or typing A characteristic (quantity) value, a substance used to calibrate an instrument, evaluate a biological measurement method, or assign a value to a material.

As used herein, the term "lentiviral vector" refers to the ability to effectively integrate exogenous genes or exogenous shRNA into the host chromosome, so as to achieve the effect of persistent expression of the target sequence. In terms of infection ability, lentiviral vectors can effectively infect neuronal cells, liver cells, cardiomyocytes, tumor cells, endothelial cells, stem cells and other types of cells, so as to achieve good gene therapy effects. For some difficult-to-transfect cells, such as primary cells, stem cells, undifferentiated cells, etc., the use of lentiviral vectors can greatly improve the transduction efficiency of the target gene or target shRNA, and the target gene or target shRNA can be integrated into the host cell The probability of the genome is greatly increased, and the long-term and stable expression of the target gene or target shRNA can be achieved more conveniently and quickly. In view of this, in the research of in vitro and in vivo experiments, lentiviral vectors have been widely used in scientific experiments and CAR-T cell therapy, and their biological safety has been proven. The “simulated virus” prepared therefrom is non-infectious and Pathogenicity.

In the present invention, lentiviral vectors that can be used are conventionally used in the field, including lentivirus vector (Gene delivery by lentivirus vector, Cockrell, Adam S., et al., Molecular Biotechnology 36(3), 184-204; Lentiviral Vector System for Gene Transfer, Gilbert, JamesR., et al., 2003, https://books.goole.com/books?) or FIV virus vector (Feline Immunodeficiency Virus(FIV) as a Model for Study of Lentvirus Infections: Parallels with HIV, John, H. Elder et al., CurrHIV Res 2010, January, 8(1): 73-80; Effective transmission of nondividing human cells by feline immunodeficiency virusPolentiviralM.vectors, Eric et al., Nature Medicine, volume 4, No. 3, March 1998; FIV: from lentvirus to lentivector, Dyna T. Saenz et al., J. Gene Med 2004, 6, S95-S104). In a specific embodiment, the lentiviral vector is pEZ-Lv201.

The beneficial effects of the present invention:

The reference standard for detection of lentiviral nucleic acid provided by the present invention is to construct an RNA sequence fragment containing the target of coronavirus nucleic acid detection and a fluorescent protein for tracking in a lentiviral vector, and then package it in cultured cells. The "simulated virus" of the coronavirus formed by the envelope (consisting of glycoprotein and liposome) encapsulating RNA, after purification and quantification, the "simulated virus" can be used as a reference standard for the detection of coronavirus nucleic acid. The beneficial effects of the present invention are:

(1) Safe preparation of standards for coronavirus nucleic acid detection. Coronavirus infects the human body can cause pneumonia. Due to the high contagiousness and pathogenicity of the coronavirus, it is difficult to obtain and cultivate the circulating virus strain, so it is difficult to obtain purified coronavirus. The lentiviral vector used in the present invention has been widely used in scientific experiments and CAR-T cell therapy, and its biological safety has been proven. The "simulated virus" prepared therefrom is non-infectious and pathogenic.

(2) Simple and efficient preparation of standards for coronavirus nucleic acid detection. After years of development and optimization of lentivirus technology, its virus packaging efficiency and purification technology, so the preparation and operation of the "simulated virus" of the coronavirus based on lentivirus is simple and efficient.

(3) The accuracy of quantification. As a standard for detection, the quantification of itself must be very accurate. The "simulated virus" provided by the present invention has a clear and stable backbone sequence, which can be accurately determined by digital PCR (ddPCR) technology, and can also be passed through the fluorescent protein carried by it. Perform the measurement.

Description of the drawings

Figure 1. is a schematic diagram of the recombinant lentiviral particles of the present invention, where Figure a is a schematic diagram of the genome structure of the lentivirus, where ORF indicates that the lentiviral vector has n open reading frames; Figure b is a schematic diagram of the coronavirus SARS-CoV-2 genome; Figure c is a schematic diagram of a "simulated virus" containing a targeting sequence fragment and a tracer protein; Figure d is a schematic diagram showing the structure of a detection target sequence inserted into a lentiviral vector; in Figures 1a-1d, "ORF1ab" or "ORF1abfragments" is Contains the Chinese CDC detection sequence (represented as cCDC-1ab in Fig. 1d) and the Roche 2019-nCoV (RdRP) detection sequence", "S" or "Sfragment" is the S( of the coronavirus SARS-CoV-2 designed by the present invention spike) Protein gene detection sequence, "E" or "Efragment" is the E gene detection sequence containing Roche 2019-nCoV, "N" or "Nfragments" is 1 containing Chinese CDC (shown as cCDC-N in Fig1d) N Genes and the detection sequences of the three N genes of the American CDC (shown as CDC-N1, CDC-N2 and CDC-N3 in Fig. 1d); "EGFP" is the tracer protein, that is, the lentiviral vector pEZ-Lv201 in Figure 2 "EGFP" in the backbone.

Figure 2. A schematic diagram of the backbone of the lentiviral vector pEZ-Lv201.

Figure 3. The structure of the detection target sequence inserted into the recombinant lentiviral vector and the related primer sequences.

Figure 4. A schematic diagram of the preparation process of recombinant lentiviral particles.

Figure 5. A schematic diagram of three "reference standards" used for the production of new coronavirus nucleic acid detection (RT-PCR) kits and the quality analysis and quality control of sample detection.

Figure 6. Electrophoresis of synthetic fragments. Lane M: Marker 6000; Lane 1: PCR synthesis product L (1362bp).

Figure 7. Electrophoresis diagram of colony PCR detection results. Lane M: Marker 6000; Lane 1: Colony PCR product (1602bp); Lane 2: Colony PCR product (1602bp); Lane 3: Colony PCR product (1602bp); Lane 4: Colony PCR product (1602bp); Lane 5: Colony PCR product (1602bp); Lane 6: Colony PCR product (1602bp); Lane 7: Colony PCR product (1602bp); Lane 8: Colony PCR product (1602bp).

Figure 8. The blast result graph of 2019-nCoV-TargetSequence and G118842.

Figure 9. The standard curve of the log (starting copy number) corresponding to the Ct value of the serially diluted reference product. Legend: Perform qPCR reaction on all gradient dilutions of the reference standard to obtain the Ct value (amplification threshold cycle number) of each sample. Log (initial copy number) is the abscissa X and the Ct value is the ordinate Y. Obtain the standard curve, and obtain the curve formula and the correlation coefficient R ² .

Figure 10. Fluorescence image of H1299 cells after infection with lentivirus. Legend: Count all the green fluorescent bright spots in the figure, and the arrow in the figure indicates one of the fluorescent spots.

Figure 11. Data graph analyzed by flow cytometry of cells with eGFP fluorescence. Legend: Flow cytometry measures cells with eGFP fluorescence to obtain the percentage of cells with labeled fluorescence. Y-coordinate: SSC-A refers to relative granularity or internal complexity; abscissa: FITC-A refers to relative particle size; P1-1, P1-2, P1-3: refers to target cells that are not fluorescent; P1-4 refers to The sorted target cells with fluorescence had a positive rate of 2.23%.

Figure 12. The ddPCR one-dimensional droplet distribution map and copy number concentration quantitative curve (Figure d-f) of the ORF1ab target (Figure a), N gene target (Figure b) and S gene target (Figure c) in gradient dilution cDNA samples.

Figure 13. Schematic diagram of different sample preparation and testing procedures when quality control products are used to test the release efficiency of sample collection materials.

Figure 14. Schematic diagram of sample extraction and detection process when quality control products are used to test the efficiency of different RNA extraction reagents and methods.

Figure 15. The standard curve of the concentration gradient of CCDC-N quality control product.

Detailed ways

In order to make the above-mentioned objects, features and advantages of the present invention more simple and understandable, the specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. In the following description, many specific details are explained in order to fully understand the present invention. However, the present invention can be implemented in many other ways different from those described here, and those skilled in the art can make similar improvements without departing from the connotation of the present invention. Therefore, the scope of protection of the present invention is subject to the claims. The specific implementation limitations disclosed below.

Example 1: Construction method of recombinant plasmid

1. Experimental materials

Reagents: DNA Polymerase (Gencopoeia, C0103A); Primer Oligo (Invitrogen); Cloning vector pEZ-Lv201 (Genecopoeia); Fast-Fusion ^TM Cloning Kit (Gencopoeia, FFPC-C020); Gel Recovery Kit (Omega); 2T1 Competent (Genecopoeia, U0104A); STBL3 Competent (Genecopoeia, U0103A); Restriction endonuclease (Fermentas); DNA Ladder (Genecopoeia);

Gel Extraction Kit (OMEGA); UltraPF ^TM DNA Polymerase Kit (Genecopoeia, C0103A);

Plasmid Mini Kit I (OMEGA); Endotoxin-free plasmid small/medium extraction kit (Omega).

Equipment: PCR amplification instrument (Takara); Tianneng gel imaging system (Shanghai Tianneng); electric heating constant temperature water bath (Shanghai Heheng Instrument Equipment Co., Ltd.); centrifuge (Thermo).

2. Experimental steps

In this embodiment, the coronavirus nucleic acid detection target sequence and the fluorescent protein gene sequence are inserted into the lentiviral vector, and the specific steps are as follows:

A. Vector design

1). The carrier skeleton is shown in Figure 2

2).Express cloning information

The specific targeting sequence fragment of SARS-CoV-2 was cloned into a lentiviral cloning vector using cloning technology.

The following targets are the list of detection sequences:

The SARS-CoV-2 specific targeting sequence is shown in SEQ ID NO: 5.

Detection target sequence 1 (orf1ab, 1ab-RdRP in Figure 1b): For the detection sequence containing the Chinese CDC detection sequence (Figure 1d, cCDC-1ab) and Roche 2019-nCoV (RdRP), see SEQ ID NO:1.

Detection target sequence 2 (S Fragment in Figure 1b): See SEQ ID NO: 2 containing the S (spike) protein gene detection sequence designed by our company.

Detection target sequence 3 (E Fragment in Figure 1b): The detection sequence of the new coronavirus gene E containing Roche 2019-nCoV(E) is shown in SEQ ID NO: 3.

Detection target sequence 4 (N Fragment in Figure 1b): includes 1 Chinese CDC (cCDC-N in Figure 1d) and 3 American CDC (CDC-N1-N3 in Figure 1d) for the detection sequence of N genes, see SEQ ID NO: 4.

The structure of the detection target sequence inserted into the recombinant lentiviral vector and the primer sequence involved are shown in Figure 3, and the primer information in the figure is shown in Table 1.

Table 1 Primer sequence and related information

Note: "cCDC" is the abbreviation of China CDC.

Among them, the combination of Ro-F/Ro-E-R/Ro-E and the combination of Ro-F2/Ro-R2/RO-TMR-P2 can be used to amplify the E fragment of nCoV.

3). Construction steps

(1) Synthesis of SARS-CoV-2 specific targeting sequence fragments

Design and synthesize the fragment synthesis primers in Table 2 according to the inserted sequence.

Table 2 Synthetic primers for inserts

Dilute the primers in Table 2 to 50pmol/μl, take 1μl of each and mix well, and set aside;

The insert sequence was amplified by synthetic PCR: the primer mixture in Table 2 was used as a template, WHF-PF1+WHF-PF40 was used as primers, the reaction system in Table 3 and the reaction program in Table 4 were used to amplify insert M, and electrophoresis detection The result is shown in Figure 6, the product L fragment is about 1362bp, and then OMEGA

Cycle Pure Kit purifies PCR products and synthetic fragments.

Synthesize the targeting sequence insert M, which is used for the detection of the 2019-nCov reference standard by NGS and RT-PCR methods. The sequence is shown in SEQ ID NO: 6.

Table 3 PCR reaction system

Reagent name	1×volume
5×UltraPF TM Buffer	5μl
dNTP (25mM)	0.2μl
Mg 2+ (50mM)	0.75μl
UltraPF TM DNA Polymerase(5U/μl)	0.2μl
Table 1 Primer Mix	1μl
Primer (5pmol/L)	2μl
ddH 2 O	Add to 25μl

Table 4 PCR reaction program

B. Clone the synthetic insert M into the target vector

1). Enzyme digestion of the vector

According to Table 5, establish an enzyme digestion system. With OMEGA

The Gel Extraction Kit recovers the digested products of the vector.

Table 5 Enzyme digestion system

Reagent	Dosage
pEZ-Lv201		3μg
10×NEB buffer	4μl
EcoRI(NEB)	0.4μl (10μ/μl)
XhoI(NEB)	0.4μl (10μ/μl)
ddH 2 O	Add to 40μl

2). Connection of synthetic insert M and plasmid vector

Use Fast-Fusion Cloning Kit for In-fusion reaction. After the reaction, take 5μl to transform E. coli competent cells 2T1.

3). Screening of gene recombination clones by PCR

Each PCR reaction system is divided into 16μl ddH ₂ O and 1μl vector primer (5pmol/μl, T7-PF: acgactcactatagacctacaacttgtgc; SV40-PR: ctggaatagctcagaggc). The PCR reaction program is shown in Table 6; the PCR products are detected by electrophoresis, and the detection results are shown in Figure 7. , Control the Marker to estimate the size of the DNA fragments, and select the positive clones containing the target DNA fragments. With OMEGA

Plasmid Mini Kit I extracts the plasmid DNA and sends the plasmid for sequencing. The comparison result in Figure 8 shows that the sequencing plasmid G118842 is the expected correct clone, and the RNA sequence is expressed from 5'LTR to 3'LTR (insert 2019-nCov" mimic virus The "RNA sequence" is segment N, and the entire plasmid sequence (the entire sequence of the "simulated virus" vector) is segment W.

See SEQ ID NO: 7 for the sequence of fragment N (that is, the RNA sequence inserted into the 2019-nCov "virtual simulation"). See SEQ ID NO: 8 for the sequence of fragment W (that is, the full sequence of the "simulated virus" vector).

Table 6 PCR reaction program

Example 2: Preparation of lentivirus

After obtaining the recombinant lentiviral vector, recombinant lentiviral particles can be prepared. The process detection is shown in Figure 4.

1. Experimental materials

Reagents: culture medium (CORNING, 10-013-CV), fetal bovine serum (Excell Bio, FSP500), Lenti-Pac ^TM HIV lentivirus packaging kit (GeneCopoeia, LT003)

Equipment: Biological safety cabinet (Su Jing Antai), carbon dioxide incubator (Li Kang). 2. Experimental steps

The lentivirus preparation steps are as follows:

1).293T(

CRL-3216 ^TM ) cells were cultured in DMEM medium with 10% fetal bovine serum at 5% CO ₂ at 37°C, and the recombinant prepared in Example 1 was used according to the recommended procedure of the ^{Lenti-Pac TM HIV Lentivirus Packaging Kit} The plasmid and the helper plasmid containing Gag-pol and Rev are co-transfected into cells);

2). After 12 hours of transfection, replace with fresh medium and continue culturing for 24 hours;

3). Collect the supernatant of the cultured cells, the supernatant contains lentiviral particles (named LPP-WH-Fragment3-Lv201).

Example 3: Concentration of lentivirus

1. Experimental materials

Reagents: Lentivirus Concentration Solution (6X) (GeneCopoeia, LT007), PBS (GeneCopoeia, PE002).

Equipment: refrigerated centrifuge (Thermo), biological safety cabinet (Su Jing Antai).

2. Experimental steps

1). Collect the supernatant from the tool cell culture plate or culture flask, the supernatant contains the lentiviral particles. The supernatant can be centrifuged at 2000g at 4°C for 10 minutes to remove cell debris.

2). The concentrated reagent was purchased from GeneCopoeia (Lenti-Pac ^TM lentivirus concentration reagent, LT007). Mix the lentiviral supernatant and the concentrated reagent according to the ratio of lentiviral liquid volume: concentrated reagent volume = 5:1 (directly add the lentiviral concentrated reagent 6X stock solution), and incubate at 0～4℃ for 2h or more (also Can be incubated overnight). During the stable storage period of the lentivirus, an appropriate extension of the incubation time can increase the recovery rate of the lentivirus. Note: Lentivirus can be stored stably for about 3 days at 0～4℃.

3). After the incubation is completed, the mixed solution is centrifuged at 3500g for 25min at 4°C.

4). After centrifugation, carefully aspirate and discard the supernatant, leaving the precipitate as lentiviral particles.

Note: Please avoid sucking off the centrifugal sediment, which is a lentiviral particle (in some cases, the sediment may not be visible to the naked eye).

5). According to the volume of the lentiviral supernatant collected in step 1 and used for concentration, measure 1/10-1/100 of the volume of DMEM or PBS, and re-pipette to suspend the lentiviral pellet (for example: as collected in step 1 There is 10 mL of the clear solution, then the amount of DMEM or PBS measured in this step is 0.1 mL-1 mL).

Note: When resuspending the lentivirus pellet, the pipetting operation should be gentle.

6). The resuspended lentivirus solution has been concentrated and can be stored at -80°C after aliquoting. At the same time, a small amount is taken to determine the titer of the concentrated lentivirus.

Example 4: Lentivirus quantification

1. Experimental materials

Reagents: culture medium (CORNING, 10-013-CV), fetal bovine serum (Excell Bio, FSP500), PBS (GeneCopoeia, PE002), Trypsin (CORNING, 25-053-CI), Lenti-Pac ^TM lentivirus titer Detection kit (GeneCopoeia, LT006), penicillin-streptomycin double antibody solution (HyClone), RNaseLock ^TM RNase inhibitor.

Equipment: real-time fluorescent quantitative PCR instrument (Bio-rad), inverted fluorescent microscope (Nikon Ti-S), flow cytometer (BD FACSMelody), refrigerated centrifuge (Thermo).

2. Experimental steps

We can use four methods to determine the titer of lentivirus:

Method 1: Use a real-time fluorescent quantitative PCR instrument to detect the physical titer of lentivirus.

Method 2: Use fluorescence microscope cell counting method to determine the copy number (titer) of lentivirus organisms.

Method 3: Use flow cytometry to determine the biological titer of lentivirus.

Method 4: ddPCR method to detect the copy number of lentiviral RNA.

The results obtained by the four methods are shown in Table 7.

Table 7 Four methods for determination of lentivirus titer results

Specific method 1: real-time fluorescent quantitative PCR instrument to detect the physical titer of lentivirus

1. RNA extraction

1) Add 0.25mL to a 1.5mL centrifuge tube containing 50μL or 100μL of clarified lentivirus solution (or 10μL of purified and concentrated lentivirus solution)

RT RNA extraction reagent, invert the centrifuge tube 10 times to mix the solution (to lyse the virus particles and dissolve the protein), and let it stand at room temperature for at least 15 minutes.

2) After a brief centrifugation, add 50μL of pure water to the tube containing 50μL of lentivirus solution (or add 90μL of pure water to the tube containing 10μL of purified concentrated virus solution), so that the sum of the volume of lentivirus solution and pure water is 100μL.

3) Centrifuge the homogenate at 18,000g for 10 min at 20°C.

4) Carefully transfer the supernatant to a new 1.5 mL centrifuge tube, and add linear polyacrylamide to a final concentration of about 15 μg/mL. For example, 1.0 μL of linear polyacrylamide with a concentration of 1.5 mg/mL is added to 100 μL of supernatant.

Note: Linear polyacrylamide as a co-precipitant can improve the recovery of RNA during ethanol precipitation and also help the appearance of RNA precipitation, but it will not affect subsequent enzymatic digestion, reverse transcription and qPCR reactions.

5) Add the same volume of 100% isopropanol (or 3 times the volume of 100% ethanol) of the above solution, and mix the solution by inverting the centrifuge tube repeatedly. The mixed solution is best stored at -20°C for more than 4 hours or overnight.

6) Centrifuge the solution at 18,000g for 20 minutes at 10°C, and discard the supernatant.

7) Wash the RNA pellet with 0.5 mL 75% ethanol, centrifuge the solution at 18,000 g at 10°C for 5 min, and discard the supernatant. Repeat the washing process one more time.

8) Remove residual ethanol as much as possible. Dry the RNA pellet at room temperature for 3 minutes, and do not over dry it. Finally, 50 μL of TE buffer was used to dissolve the RNA precipitation (here, the TE buffer is DEPC-treated water to prepare 100 μM TE buffer, which is used in the present invention to dissolve the RNA precipitation in this TE buffer).

2. Treat with DNase I (remove free cell genome and plasmid)

DNase I reaction. Using a 1.5 mL tube, perform the following reactions according to Table 8 (total volume 25 μL).

Table 8 DNase I reaction system

Reagent	Dosage
DEPC water	1.5μL
Lentiviral RNA	20.0μL
DNase I buffer(10×)	2.5μL
DNase I	1.0μL
Total	25.0μL

Incubation:

1) 37℃, 30-60min

2) 75℃, 10min (inactivate DNase I)

Note: If the DNase I digestion step is omitted, a qPCR reaction using an unreverse-transcribed RNA sample as a template must be added to the qPCR reaction step as a control. Plasmid DNA copy number, the copy number determined by the qPCR reaction using the reverse transcription product as a template minus the plasmid DNA copy number determined by the control, is the RNA copy number in the sample.

3. Reverse transcription

Prepare RNA-Primer Mix in a 0.2mL or 0.5mL centrifuge tube according to Table 9, mix RNA-Primer Mix, incubate at 70°C for 5 minutes, and immediately place the centrifuge tube on ice to cool.

Table 9 RNA and cDNA Synthesis Primer binding reaction system

Note: The random primer in the kit (the final concentration in the reverse transcription reaction solution is 10μM) can be used to replace HIV cDNA Synthesis Primer. There is no need to use cDNA Synthesis Primer and random primers at the same time. 1) Prepare the reverse transcription reaction system according to Table 10, continue to add other components (total volume 20μL), briefly centrifuge (mix the reaction solution and enrich it at the bottom of the centrifuge tube), and incubate at 37°C for 60 minutes.

Table 10 Reverse transcription reaction system

Reagent	Dosage
Reverse Transcription Buffer(10×)	2.0μL
25mM dNTP	1.0μL
RNaseLock TM RNase inhibitor	1.0μL
Reverse Transcription Enzyme	1.0μL
Total	20.0μL

2) 90°C, 10min. The product can be used as a sample to be tested directly for qPCR detection experiments, or stored at -20°C.

4. qPCR reaction

1) Prepare to make a standard curve sample

Dilute the positive reference standard (from the kit Lenti-Pac ^TM Lentiviral Titer Detection Kit (GeneCopoeia, LT006), the copy number is 1 x 10 ⁹ copies/μL).

Make a standard curve (subsequently take 2 μL of each dilution gradient as a template for qPCR reaction).

①Starting copy number: 1 x 10 ⁸ copies/μL (Operation method: 5μL qPCR standard(DNA)+45μL ddH ₂ O)

②Initial copy number: 1 x 10 ⁷ copies/μL (Operation method: 5μL①+45μL ddH ₂ O)

③Starting copy number: 1 x 10 ⁶ copies/μL (Operation method: 5μL②+45μL ddH ₂ O)

④Starting copy number: 1 x 10 ⁵ copies/μL (Operation method: 5μL③+45μL ddH ₂ O)

⑤ Initial copy number: 1 x 10 ⁴ copies/μL (Operation method: 5μL④+45μL ddH ₂ O)

⑥Starting copy number: 1 x 10 ³ copies/μL (Operation method: 5μL⑤+45μL ddH ₂ O)

2) Prepare the qPCR reaction system according to Table 11 (total volume 20μL):

Table 11 qPCR reaction system

Notice:

①Premix each component in the reaction system (except for the positive reference standard and sample) before dividing.

②The no template (NTC) group should be set in the qPCR reaction.

③Sampling the reference product, take 2μL from each dilution tube:

3) qPCR reaction program

The reaction procedure in Table 12 is applicable to the Bio-Rad iQ5 real-time PCR detection system. Those skilled in the art can perform routine fine-tuning according to the detection system used. Table 13 shows the melting curve program.

Table 12 qPCR reaction program

Table 13 Dissolution curve program

temperature	Interval temperature	duration
72-95℃	0.5℃	6sec/each

4) Data analysis

① After the qPCR reaction, read the Ct value (amplification threshold cycle number) of each reference product, and draw the standard curve with log (initial copy number) as the abscissa and Ct value as the ordinate, as shown in Figure 9 (reference for gradient dilution Product log (initial copy number) corresponds to the standard curve of Ct value), and obtain the curve formula. The correlation coefficient of the standard curve should be higher than 0.99.

②Read the Ct value of the sample to be tested, and substitute it into the formula (y=-3.4363x+35.451) of the standard curve in ① (shown in Figure 9), and calculate its corresponding log (initial copy number) and its starting point Number of copies.

③Multiply the above-mentioned initial copy number by the dilution factor (the following is the calculation formula of the dilution factor) to obtain the copy number of the original sample (copies/ml).

Notice:

(A) RNA volume: 50μL (according to this experimental procedure)

(B) Original sample volume: 10μl of lentiviral particle solution used for RNA extraction

(C) DNase reaction volume: 25μL (according to this experimental procedure)

(D) RNA volume in DNase reaction: 20μL (according to this experimental procedure)

(E) RT reaction volume: 20μL (according to this experimental procedure)

(F) RNA volume in RT reaction: 10μL (according to this experimental procedure)

(G) cDNA volume in PCR reaction: 2μL (according to this experimental procedure)

④ Since each lentiviral particle contains two single-stranded positive-stranded RNA genomes, the number of lentiviral particles obtained should be 1/2 of the copy number. Therefore, the physical titer of the number of lentiviral particles (copies/ml) is the number of copies of the original sample divided by 2. Table 14 is a data table of the calculation process of the physical titer of lentiviral particles.

Table 14 Data table of the calculation process of the physical titer of lentiviral particles

Specific method 2: Use fluorescence microscope cell counting method to determine the copy number (titer) of lentivirus

Day 1: Culture H1299 cells (

CRL-5803 ^TM )

1. Use a 24-well culture plate to plate and culture the cells, add 5×10 ⁴ cells and 0.5 mL of DMEM complete medium to each well (add 10% heat-inactivated fetal bovine serum, penicillin-streptomycin double antibody). Incubate overnight (about 24h) under the condition of %CO _{2 and 37°C.}

Day 2: Infect H1299 cells

2. After cell culture for 24 hours, remove the cell culture medium, first add 250μl of DMEM medium (add 10% heat-inactivated fetal bovine serum, penicillin-streptomycin double antibody solution), and then add the slow dilution shown in step 3 below Virus. Each lentivirus corresponds to 3 wells of the cell culture plate.

3. The lentivirus is fluorescently labeled, and the detection titer can be determined by the fluorescence microscope cell counting method. First, inoculate lentivirus in a gradient, add 0.03μL, 0.3μL, 0.3μL lentivirus stock solution to each well (three replicate wells each). Add appropriate DMEM medium (add 10% heat-inactivated fetal bovine serum, penicillin-streptomycin double antibody solution) to each well to a final volume of 0.5 mL per well. The blank control well serves as a reference.

Day 3: Change the medium

4. Remove the old medium and incubate for 24 hours in DMEM medium (addition of 5% heat-inactivated fetal bovine serum, penicillin-streptomycin double antibody solution).

5. Use an inverted fluorescence microscope to measure the titer of lentivirus by fluorescence microscope cell counting method

Select the wells whose number of fluorescent cells can be calculated under the microscope, randomly select 5 fields of view under the microscope to take pictures, and calculate the number of fluorescence in the well plate.

In the well with 0.03μl virus, the number of fluorescent cells can be calculated if the number of fluorescent cells is moderate. The average number of fluorescent cells in 5 fields of view in the hole is X, which is calculated according to the following formula:

Lentiviral liquid titer (TU/mL)=X (average number of fluorescent cells) x 63.3 (24-well plate area/microscopic observation field area)/0.03 l (actually added lentiviral liquid volume).

Obtain Table 15 Lentiviral biotiters measured by fluorescence microscopy cell counting method.

Table 15 Lentiviral titers measured by fluorescence microscopy cell counting method

Remarks: 1TU/ml is approximately equal to 100copies/ml

After the lentivirus infects H1299 cells, an inverted fluorescence microscope is used to obtain a fluorescence picture as shown in Figure 10. (Using an inverted fluorescence microscope, 100 times the field of view, using GFP fluorescence to take pictures and count, count all the fluorescent bright spots in the figure, the arrow in the figure indicates one of the fluorescent spots). Figure 10 Note: Count all the fluorescent bright spots in the figure, and the arrow in the figure indicates one of the fluorescent spots.

Specific method three: determination of lentivirus biological titer by flow cytometry

Steps 1 to 4 are the same as steps 1-4 in Method 2.

Day 4: Determine the titer of lentivirus by flow cytometry

5. Measure the titer of lentivirus by flow cytometry fluorescence counting method (flow cytometer model: BD FACSMelody)

Cells with eGFP fluorescence can be counted by FACS (Flow Cytometry). Use a fluorescence microscope to observe eGFP fluorescence. After observing the fluorescence status, the cells were trypsinized, and the digestion was terminated with DMEM complete medium, and then centrifuged at 500g for 10min. The cells were suspended in 1ml PBS, and the total number of cells in each well was measured with a hemocytometer. Then perform analysis on the flow cytometer to obtain the percentage of fluorescent cells, and obtain Figure 11 (data diagram of flow cytometer analysis of cells with eGFP fluorescence), and calculate according to the following formula:

Lentiviral fluid titer (TU/mL) = percentage of fluorescent cells × total number of cells in the well ÷ actual volume of lentiviral fluid added (unit: mL).

Obtain Table 16, the biotiter of the lentivirus.

Table 16 The biological titer of lentivirus

Remarks: 1TU/ml is approximately equal to 100copies/ml

Specific method 4: ddPCR method to detect the copy number of lentiviral RNA

1. Experimental materials

Reagents: Bio-Rad ddPCR ^TM Supermix for Probes (No dUTP)

Equipment: Bio-Rad QX200 droplet digital PCR System

2. Experimental steps

1) Dilute the cDNA obtained from the reverse transcription of the lentiviral particle RNA with ddH ₂ O (DNase free) by a 10-fold gradient to obtain 4 ddPCR test samples;

2) Thaw ddPCR ^TM Supermix for Probes (No dUTP) at room temperature, mix upside down and centrifuge briefly;

3) Prepare ddPCR Reaction Mix according to Table 17 (FAM/HEX dual channel)

Table 17 ddPCR reaction system

4) After the prepared system is shaken, mixed and centrifuged, carefully transfer it to the sample wells in the middle row of the droplet generator card, and add 70μL of droplet generator oil to the bottom row of wells, and then place it in the droplet generator Generate droplets.

5) Transfer the sample (40 μL) with the generated droplets from the upper row of the droplet generating card to the ddPCR special 96-well plate, cover the 96-well plate with aluminum film and use the PX1 heat sealer to seal the 96-well plate.

6) After sealing the membrane, the PCR reaction should be carried out within 30 minutes, or the PCR reaction should be carried out within 4 hours in the refrigerator at 4°C. The PCR reaction should be carried out according to Table 18, and the temperature rise and fall rate should be set to 2°C/sec.

Table 18 PCR reaction

7) After PCR, the 96-well plate is taken out, and the droplet is read on the droplet reader.

8) After the droplet reading is completed, analyze the data results on the Bio-radQuantaSoft software, and calculate the copy number concentration of ORF1ab and N genes in the "simulated virus" cDNA according to Figure 12.

Example 5: Extraction of RNA

1. Experimental materials

Reagents: GeneCopoeiaRNAzolTM RT RNA Isolation Reagent, isopropanol, 75% ethanol, ddH ₂ O (RNase and DNase free).

Equipment: vortex oscillator.

2. Experimental steps

1). Sample processing

Take about 400μl of the virus suspension into a 1.5-2ml centrifuge tube containing 1ml RNAzol RT, shake and mix, and then stand at room temperature for about 5 minutes;

2). Phase separation

_{Add 400μl ddH 2} O (RNase and DNase free) per 1ml RNAzol RT _{, or add ddH 2} O (RNase and DNase free) to 1.4ml, close the lid, shake and mix for about 15sec, and let it stand at room temperature for 5-15 minutes. Centrifuge at 10000rpm for 15min;

3). Precipitation

Transfer the supernatant to a new 1.5-2ml centrifuge tube, add an equal volume of isopropanol, and let it stand at room temperature for 10 minutes. Centrifuge at 10000g for 10min.

4). Washing

Discard the supernatant, add 400μl 75% ethanol to the remaining pellet, and centrifuge at 7500g for 1~3min after mixing. Repeat this step once.

5). Dissolve

Discard the supernatant, air-dry the pellet naturally, add 50μl TE (RNase and DNase free) to dissolve it, which is the total RNA.

Example 6: cDNA preparation

1. Experimental materials

Reagents: GeneCopoeiaSureScript ^TM First-Strand cDNA Synthesis Kit, lentiviral RNA, DEPC water.

Equipment: ordinary PCR machine.

2. Experimental steps

1). Preparation of reverse transcription system

According to the GeneCopoeia ^TM SureScript ^TM First-Strand cDNA Synthesis Kit instructions, the reverse transcription system was prepared according to Table 19:

Table 19 Reverse transcription system for cDNA preparation

2). Reverse transcription reaction

Perform the reverse transcription program on an ordinary PCR machine according to Table 20.

Table 20 Reverse transcription program for cDNA preparation

temperature reflex		duration
25℃		5min
50℃	60min
85°C	5min

Store the reverse transcribed cDNA at -20°C.

Example 7: Using RNA quality control products to screen the optimal reverse transcriptase concentration of the reaction system

1. Experimental materials

Reagents: reverse transcriptase SW2050 ^TM , RNA quality control with a copy number of 50 copies/rxn, nucleic acid detection kit (fluorescent RT-qPCR method).

Equipment: fluorescence quantitative PCR instrument.

2. Experimental steps

1). Preparation of different concentrations of reverse transcriptase

^{Reverse transcriptase SW2050 TM} with concentrations of 11.5U/rxn, 9.2U/rxn, 6.9U/rxn, 4.6U/rxn, 2.3U/rxn and 0U/rxn were prepared.

2). Design of primer probe

See Table 21 and Table 22 for probe and primer information.

21 Probe sequence and fluorescent labeling information

Table 22 Primer sequence and related information

3). Use nucleic acid detection kits, respectively use different primer probes for detection and quantification.

3. Experimental results The Ct values obtained by using different primer probes to detect the reverse transcriptase system with different concentrations are shown in Table 23.

Table 23 Ct values detected by different primer probes in different concentrations of reverse transcriptase systems

The results showed: 9.2U/rxn is the best working concentration ^{of reverse transcriptase SW2050 TM.}

Example 8: Using quality control products to test the release efficiency of sample collection materials

1. Experimental materials

Reagents: lentiviral particles, sample preservation solution, QIAGEN kit, throat swab A, throat swab B, nucleic acid detection kit (fluorescent RT-qPCR method).

Equipment: fluorescence quantitative PCR instrument.

2. Experimental steps

1). Sample preparation

Add 3×10 ⁵ /ml lentiviral particles to the throat swab A, and then release them in the sample preservation solution to obtain RNA sample 1.

Add 3×10 ⁵ /ml molecular number lentiviral particles to throat swab B, and then release them in the sample preservation solution to obtain RNA sample 2.

3×10 ⁵ /ml molecular number lentiviral particles were directly added to the sample preservation solution to obtain RNA sample 3.

2). Use QIAGEN kit to extract RNA from the above three samples.

3). Use a nucleic acid detection kit for detection.

The sample preparation and testing process is shown in Figure 13.

3. Experimental results

See Table 24 for the Ct values detected by different samples and different fluorescence channels.

Table 24 Ct values detected by different samples and different fluorescence channels

The detected Ct value shows that the release efficiency of the two throat swabs we used is basically the same. Compared with the direct release of the sample in the sample preservation solution, the Ct value is delayed, but the Ct value is not significantly delayed.

Example 9: Using quality control products to test the efficiency of different RNA extraction reagents and methods

1. Experimental materials

Reagents: inactivated preservation solution, QIAGENE kit, Kangwei magnetic beads, nucleic acid detection kit (fluorescent RT-qPCR method).

Equipment: fluorescence quantitative PCR instrument.

2. Experimental steps

1). Sample preparation

Add 3×10 ⁵ /ml molecular number simulation virus to the inactivated preservation solution, and then use the QIAGENE kit for RNA extraction to obtain sample 1#.

Add 3×10 ⁵ /ml molecular number simulation virus to the inactivated storage solution, and then use Kangwei magnetic beads for RNA extraction to obtain sample 2#.

2). Use the nucleic acid kit to detect the above sample 1# and sample 2#.

The sample extraction and testing process is shown in Figure 14.

3. Experimental results

The Ct values obtained by different extraction methods and different fluorescence channels are shown in Table 25.

Table 25 Ct values detected by different extraction methods and different fluorescence channels

Sample extraction method		QIAGEN extraction 1#	Magnetic bead extraction 2#	NTC
FL-S	21.3	26.5	34.2
N-Hex	23.5	27.8	35.8

The obtained RNA fluorescence quantitative PCR detection results show that the Ct value is about 6 ahead, and the extraction effect of QIAGENE is better than that of magnetic beads.

Example 10: Establishing a nucleic acid detection model using quality control products

1. Experimental materials

Reagents: nucleic acid detection kit (fluorescence RT-qPCR method)

Instrument: Fluorescence quantitative PCR instrument

2. Experimental steps

1). Preparation of standard curve samples:

The reaction concentration of the positive standard is fixed and mixed, and the positive quality control RNA is serially diluted to prepare a standard curve. The dilution method is as follows:

For example: the initial RNA reaction concentration is 200copies/μL, and it can be diluted two-fold, three-fold, or other gradients. See Table 26 for the number of molecular copies obtained by three-fold dilution of the positive quality control RNA.

Table 26 Copy number table of three-fold dilution positive quality control RNA molecules

Sample serial number	Dilution method-three-fold serial dilution	RNA copy number-copies/μL
S1	75μL positive quality control product+75μL RNA diluent	100
S2	50μL S1+100μL RNA diluent	33.3
S3	50μL S2+100μL RNA diluent	11.1
S4	50μL S3+100μL RNA diluent	3.7
S5	50μL S4+100μL RNA diluent	1.2
S6	50μL S5+100μL RNA diluent	0.4
S7	50μL S6+100μL RNA diluent	0.13

2).qPCR reaction

Use nucleic acid detection kit for detection. Prepare the qPCR reaction system according to Table 27, and perform the qPCR reaction according to the procedure of Table 28.

Table 27 qPCR reaction system

Reagent	volume
Mix A(Mg 2+ , dNTP, dUTP)	5.0μL
Mix B (RTase, UDG, Taq, RNase inhibitor)	2.5μL
Mix C2 (Primers, Probes)	5.0μL
DNase&RNase free H 2 O	6.5μL
SPRS (200copies/rxn recommended)	1.0μL
Clinical samples to be tested/quality control products	5.0μL
Total	25.0μL

Table 28 qPCR reaction program

3). Production of standard curve

Perform qPCR reaction on all the reference samples with gradient dilutions to obtain the Ct value (amplification threshold cycle number) of each sample, and use log (initial copy number) as the abscissa X and the Ct value as the ordinate Y to obtain the standard curve. The result is shown in Figure 15, and the curve formula and the correlation coefficient R ^{2 are obtained} .

4). Quantification of sample molecular copy number

Read the Ct value of the sample to be tested and substitute it into the standard curve formula to calculate its corresponding log

(Initial copy number) and its initial copy number.

Example: Different concentrations can be incorporated into the positive standard and quality control product parameter model qPCR determination results of the sample to be tested, see Table 29.

Table 29 The qPCR measurement results of the positive standard and quality control product parameter models that can be incorporated into the sample to be tested at different concentrations

Note: The N gene detection concentration of the fixed standard is 50Copies/rxn, 25Copies/rxn, 12.5Copies/rxn and 2.5Copies/rxn; NA means: no Ct value is detected.

3. Analysis of experimental results

If the Ct value of the clinical sample is within the linear curve (Ct value) of the standard/quality control product, the standard curve can be quantified based on the molecular copy number concentration of the standard product (the curve formula obtained from the gradient dilution result in the above table is an example) Ct =-3.2527log(x)+35.575, (R2＝0.9889) Calculate the corresponding target molecule copy number concentration c(copies/rxn) of the sample to be tested in the qPCR reaction, and then according to the sample volume V(μL) of the sample to be tested, The molecular copy number concentration C (copies/mL) of the target to be tested in the clinical sample can be calculated: C=c×(1/V)×1000.

Claims (19)

1. The recombinant lentiviral vector is characterized in that the lentiviral vector contains an RNA sequence fragment targeted for RNA virus nucleic acid detection and a fluorescent protein for tracking,

   Preferably, the RNA viruses include coronaviruses, such as SARS virus, MERS virus and SARS-CoV-2 virus,

   More preferably, the recombinant lentiviral vector contains at least the following elements:

   (1) Detection of the target sequence 1, which is derived from the ORF1ab encoding gene of the coronavirus SARS-CoV-2 or a fragment thereof,

   (2) The detection target sequence 2 is derived from the coding gene of the S protein of the coronavirus SARS-CoV-2 or a fragment thereof,

   (3) Detecting target sequence 3, which is derived from the coding gene of the E protein of coronavirus SARS-CoV-2 or a fragment thereof,

   (4) Detecting targeting sequence 4, which is derived from the coding gene of the N protein fragment of coronavirus SARS-CoV-2 or a fragment thereof,

   Wherein the recombinant lentiviral vector does not contain the complete genome sequence of the complete coronavirus SARS-CoV-2. Preferably, the detection target sequence 1 and the detection target sequence 4 are each connected by a linker, more preferably, The length of the linker is 6-200bp.
2. The recombinant lentiviral vector of claim 1, wherein the recombinant lentiviral vector further comprises a gene encoding a tracer protein.
3. The recombinant lentiviral vector of any one of claims 1-2, wherein the length of the detection target sequence 1-4 is 80bp-1.5kb, and the detection target sequence 1-4 and the detection target The total length of the linker sequence between sequence 1-4 does not exceed 7 kb.
4. The recombinant lentiviral vector of any one of claims 1 to 3, wherein the lentivirus vector is a lentivirus virus vector (preferably pEZ-Lv201) or a FIV virus vector, preferably, the sequence of the target sequence 2 is detected At least include SEQ ID NO: 2 sequence.
5. The recombinant lentiviral vector of any one of claims 1 to 4, wherein the recombinant lentiviral vector includes but is not limited to second-generation and third-generation lentiviral vectors,

   Preferably, the sequence of the detection target sequence 1 includes or consists of the Chinese CDC detection sequence (cCDC-1ab) and the Roche 2019-nCoV (RdRP) detection sequence;

   The sequence of the detection target sequence 2 includes or consists of the S gene detection sequence shown in SEQ ID NO: 2;

   The sequence of the detection target sequence 3 includes or consists of the E gene detection sequence of Roche 2019-nCoV(E);

   The sequence of the detection target sequence 4 includes or consists of one N gene fragment of the Chinese CDC and three N gene fragments of the American CDC;

   Preferably, the sequence of the detection target sequence 1 includes the SEQ ID NO:1 sequence or consists of the SEQ ID NO:1 sequence. The sequence of the detection target sequence 2 includes the SEQ ID NO: 2 sequence or consists of the SEQ ID NO: 2 sequence.

   The sequence of the detection target sequence 3 includes the SEQ ID NO: 3 sequence or consists of the SEQ ID NO: 3 sequence.

   The sequence of the detection target sequence 4 includes the SEQ ID NO: 4 sequence or consists of the SEQ ID NO: 4 sequence.
6. The recombinant lentiviral vector of any one of claims 1-5, wherein the tracer protein is selected from fluorescent proteins, such as green fluorescent protein (GFP) or red fluorescent protein (RFP).
7. The recombinant lentiviral vector of any one of claims 1-6, wherein the lentivirus vector is a lentivirus virus vector (preferably pEZ-Lv201) or a FIV virus vector.
8. The recombinant lentiviral vector of any one of claims 1-7, wherein the lentiviral vector includes, but is not limited to, second- and third-generation lentiviral vectors.
9. The recombinant lentiviral particles prepared by using any one of the recombinant lentiviral vectors of claims 1-8, preferably the recombinant lentiviral vector is transfected into a human 293T cell line to prepare the recombinant lentiviral particles.
10. Application of the recombinant lentiviral vector of any one of claims 1-8 or the recombinant lentiviral particle of claim 9 in the following applications:

    1) Application as a reference standard (qualitative: judgment of positive and negative) for detecting COVID-19 patients, SARS-CoV-2 carriers, suspected COVID-19 patients or SARS-CoV-2 in samples, for example, Quality analysis and quality control during sample collection, sample preservation and sample RNA extraction;

    2) Application in preparation of reagents or kits for detecting SARS-CoV-2;

    3) Quantify the application of SARS-CoV-2 in samples; or

    4) The application of SARS-CoV-2 quantitative reference standard that can be incorporated into the sample to be tested for the evaluation of the treatment effect of COVID-19 patients and the recovery and discharge of the hospital.
11. Refer to the standard RNA, which is prepared by extracting the recombinant lentiviral particle of claim 9.
12. The reference standard RNA of claim 11, which is used as a reference standard in the process of reverse transcription from RNA to cDNA involved in the process of detecting SARS-CoV-2, for example, for reverse transcription using RNA as a sample Quality analysis and quality control in the reaction system.
13. With reference to the standard cDNA, cDNA is prepared by reverse transcribing the lentiviral RNA of claim 11.
14. The reference standard cDNA according to claim 13, which is used for the DNA amplification process involved in the detection of SARS-CoV-2, the amplification efficiency and the quality molecule and quality control of the fluorescence signal.
15. The polynucleotide sequence is SEQ ID NO: 2 sequence.
16. The use of the polynucleotide sequence of claim 15 in detecting and quantifying the coronavirus SARS-CoV-2, and constructing a reference standard for detecting the coronavirus SARS-CoV-2.
17. A method for detecting or quantifying the coronavirus SARS-CoV-2 (preferably RT-PCR, NGS or a method using RT-PCR and NGS in combination), including the use of the recombinant lentiviral vector according to any one of claims 1-8 or The recombinant lentiviral particle of claim 9 is used as a reference standard.
18. The method for preparing a recombinant lentiviral vector includes inserting detection targeting sequences 1-4 into the lentiviral vector, preferably, further inserting the coding sequence of the tracer protein into the lentiviral vector, more preferably, the lentiviral vector It is a lentivirus virus vector (preferably pEZ-Lv201) or FIV virus vector.
19. The recombinant lentiviral vector according to any one of claims 1-8, the recombinant lentiviral particle according to claim 9, the reference standard RNA according to claim 11, and the reference standard cDNA according to claim 13 are used in The application in the process of optimizing the detection of SARS-CoV-2 RNA nucleic acid detection kit preferably includes, but is not limited to, reference standards for optimizing the components of the reaction solution and the steps of the reaction conditions.

Images