WO2021163980A1 - Substance targeting masp-2 and n protein or binding thereof for preventing and/or treating coronavirus infection - Google Patents

Abstract

Provided is an application of a substance targeting MASP-2 and coronavirus N protein or binding thereof in preparation of a drug for preventing and/or treating diseases caused by coronavirus or coronavirus infection or an application of the substance in preparation of a coronavirus inhibitor. Also provided is a medicinal reagent, comprising the substance targeting MASP-2 and coronavirus N protein or the binding thereof. Also provided are methods for inhibiting infecting animals by coronavirus and treating and/or preventing diseases caused by the coronavirus.

Description

Targeting MASP-2, N protein or their combination to prevent and/or treat coronavirus infections Technical field

The present invention relates to the prevention and/or treatment of coronavirus infection by targeting MASP-2, N protein or their combination.

Background technique

Coronavirus is a positive-stranded RNA virus with a genome length of about 30,000 bases belonging to the nested virus order. Among them, SARS coronavirus (SARS-CoV) that causes severe acute respiratory syndrome (SARS), MERS coronavirus that causes Middle East respiratory syndrome (MERS-CoV), and pneumonia caused by the 2019 new coronavirus that broke out in 2019 ( COVID-19) and its pathogen, the new coronavirus (SARS-CoV-2), can cause severe acute respiratory infections. Although SARS-CoV has disappeared for many years, due to the existence of the SARS-like coronavirus library in bats, and the RNA virus itself is more susceptible to mutation, there is a possibility that similar viruses may undergo host changes and infect humans. According to genome sequencing analysis, the homology between SARS-CoV-2 and SARS-CoV is about 80%, and it may be derived from the same bat coronavirus. Coupled with the characteristics of SARS and similar coronavirus droplets transmission, and lack of specific drugs, once an outbreak is difficult to control, it threatens human health. It is of great significance to improve the ability to prevent and control the infection of this virus and similar viruses, and to develop and reserve drugs for the prevention and treatment of SARS coronavirus.

SARS-CoV, MERS-CoV, and SARS-CoV-2 all belong to the genus of Coronaviridae β-coronavirus. They are single-stranded positive-stranded RNA viruses with an outer envelope. They are named because the spinous protein presents a crown shape. Its genome size is about 29 kb, and it expresses 4 structural proteins and several non-structural proteins. Its structural proteins include surface spinous process (S) protein, envelope (E) protein, membrane (M) protein, and nucleocapsid (N) protein. Among them, the N protein wraps around the viral genome RNA to form a nucleocapsid, which protects the viral RNA from host attack and assists in the replication of the viral genome during viral replication. At the same time, it plays various roles such as promoting cell apoptosis and inhibiting interferon production. This protein is more conserved than the envelope protein because it is located inside the virus.

Mannose-binding lectin binding-related serine protease-2 (MASP-2) is a key enzyme in the activation pathway of complement lectin, composed of 686 amino acid residues (Wang Qian et al. Study on mannose-binding lectin binding to related serine protease 2 Progress. Journal of Cellular and Molecular Immunology 2015,31(1)). MASP-2 is encoded by the MASP2 gene, and its main function is to combine with the substrate C4 to hydrolyze it into two fragments, C4a and C4b, and combine with C2 under the condition of binding C4b, and hydrolyze it into C2a and C2b, and finally form C4b2a, which is C3 transformation. Enzymes initiate a series of cascade activation processes of the downstream complement system and stimulate the natural immune response.

Gao Ting confirmed the interaction between SARS-CoV N protein and human MASP-2 through immunoprecipitation experiments, and confirmed that the two binding domains are the RNA binding domain of SARS-CoV N protein and CUB1 of MASP-2 -EGF-CUB2 domain; it was discovered that SARS-CoV N protein promotes MASP-2 dimerization, promotes its self-activation and the efficiency of substrate hydrolysis, significantly enhances the binding and activation of MBL and MASP-2, and significantly promotes complement Component C3 is activated, C5b-9 is produced, and partly explains the structural basis and response mechanism of SARS-induced excessive inflammation, especially systemic inflammation including lung injury, from the molecular level, in order to study the pathogenic mechanism of SARS and the natural immune system. The interaction of viruses provides a basis (Gao Ting, The interaction between SARS-CoV N protein and MASP2 and its biological significance, 2011). Fu Yangbo also conducted a pathogenicity study on the MERS-Co V N protein, and found that the MERS-Co V N protein interacts with MASP-2 in the host serum to activate the complement system, which in turn adds to the verification response during the virus invasion process , Especially can exacerbate lung inflammation (Fu Yangbo, MERS-CoV N protein and host protein interaction and pathogenic mechanism research, 2016).

Invention Disclosure

The technical problem to be solved by the present invention is how to target MASP-2, N protein or their combination to prepare drugs for preventing and/or treating diseases or coronavirus infections caused by coronavirus, and/or how to prepare coronavirus inhibitors, and/or Or how to suppress the coronavirus infection, and/or how to prevent and treat the disease caused by the coronavirus.

The present invention provides substances that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2 in the preparation of substances for the prevention and/or treatment of diseases caused by coronaviruses or coronavirus infections. Application in medicine.

The present invention also provides the use of substances that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2 in the preparation of coronavirus inhibitors.

In the above application, the coronavirus is a β-coronavirus virus whose N protein and SARS-CoV N protein 107-125 amino acid residues have an amino acid homology of more than 75%, specifically SARS-CoV and/or MERS -CoV and/or SARS-CoV-2.

In the above application, the disease caused by the coronavirus may be a respiratory system infection and/or a digestive system infection. The respiratory infection is a respiratory infection and/or a lung infection, and the respiratory infection may be nasopharyngitis, rhinitis, pharyngitis, tracheitis and/or bronchitis, and the lung infection may be pneumonia. The digestive system infection may be diarrhea. Coronavirus-infected patients show symptoms of atypical viral pneumonia, characterized by high fever, dyspnea, lymphopenia, lung shadows on chest radiographs that progress rapidly, the virus can cause cytokine storms and cause acute lung injury, and severe patients have acute breathing Distress syndrome and even respiratory failure.

In the above application, the substance may be a reagent.

In the above-mentioned applications, the reagents may only be the following 1) and/or 2) and/or 3), and may also contain carriers or excipients:

1) Organic molecules that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2, such as C1INH (Complement C1-Esterase Inhibitor);

2) Antibodies or antigen-binding fragments thereof that inhibit the activity of MASP-2 and/or reduce the expression level of MASP-2 genes and/or reduce the content of MASP-2;

3) A polynucleotide targeting the gene of MASP-2.

The carrier materials here include, but are not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), enteric carriers Materials (such as cellulose acetate phthalate and carboxymethyl cellulose, etc.). Specific among them are water-soluble carrier materials. The use of these materials can be made into a variety of dosage forms, including but not limited to tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, Buccal tablets, suppositories, freeze-dried powder injections, etc. It can be general preparations, sustained-release preparations, controlled-release preparations, and various particulate drug delivery systems. In order to make a unit dosage form into a tablet, various carriers known in the art can be widely used. Examples of carriers are, for example, diluents and absorbents, such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, silicic acid Aluminum, etc.; wetting agents and binders, such as water, glycerin, polyethylene glycol, ethanol, propanol, starch syrup, dextrin, syrup, honey, glucose solution, acacia syrup, gelatin syrup, sodium carboxymethyl cellulose , Shellac, methylcellulose, potassium phosphate, polyvinylpyrrolidone, etc.; disintegrants, such as dried starch, alginate, agar powder, algal starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, Sorbitol fatty acid esters, sodium lauryl sulfonate, methyl cellulose, ethyl cellulose, etc.; disintegration inhibitors, such as sucrose, glyceryl tristearate, cocoa butter, hydrogenated oil, etc.; absorption promotion Agents, such as quaternary ammonium salt, sodium lauryl sulfate, etc.; lubricants, such as talc, silicon dioxide, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, and the like. The tablets can also be further made into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or double-layer tablets and multi-layer tablets. In order to make the unit dosage form into a pill, various carriers known in the art can be widely used. Examples of carriers are, for example, diluents and absorbents, such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, Gelucire, kaolin, talc, etc.; binders such as acacia, tragacanth, gelatin , Ethanol, honey, liquid sugar, rice paste or batter, etc.; disintegrants, such as agar powder, dried starch, alginate, sodium lauryl sulfonate, methyl cellulose, ethyl cellulose, etc. In order to prepare a unit dosage form as a suppository, various carriers known in the art can be widely used. Examples of carriers are, for example, polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, semi-synthetic glycerides and the like. In order to prepare the unit dosage form into injection preparations, such as solutions, emulsions, lyophilized powder injections and suspensions, all diluents commonly used in the art can be used, for example, water, ethanol, polyethylene glycol, 1, 3-Propylene glycol, ethoxylated isostearyl alcohol, polyoxylated isostearyl alcohol, polyoxyethylene sorbitol fatty acid ester, etc. In addition, in order to prepare an isotonic injection, an appropriate amount of sodium chloride, glucose or glycerin can be added to the injection preparation, and in addition, conventional solubilizers, buffers, pH adjusters, etc. can also be added. In addition, if necessary, coloring agents, preservatives, flavors, flavors, sweeteners, or other materials can also be added to the pharmaceutical preparations. The above dosage forms can be administered by injection, including subcutaneous injection, intravenous injection, intramuscular injection and intracavity injection, etc.; cavity administration, such as rectum and vagina; respiratory administration, such as nasal cavity; mucosal administration.

The present invention also provides the application of a substance that inhibits the binding of MASP-2 and the N protein of the coronavirus in a medicine for preventing and/or treating a disease or infection caused by a coronavirus.

The invention also provides the application of a substance that inhibits the binding of MASP-2 and the N protein of the coronavirus in the preparation of a coronavirus inhibitor.

In the above application, the coronavirus is a β-coronavirus virus whose N protein and SARS-CoV N protein 107-125 amino acid residues have an amino acid homology of more than 75%, specifically SARS-CoV and/or MERS -CoV and/or SARS-CoV-2.

In the above application, the substance is a reagent.

In the above application, the reagent includes the following A and/or B and/or C:

A. Organic molecules that inhibit the binding of MASP-2 and the N protein of coronavirus;

B. Antibodies or antigen-binding fragments thereof that inhibit the binding of MASP-2 and the N protein of coronavirus;

C targets the polynucleotides bound to the N protein of MASP-2 and the coronavirus.

The present invention provides a substance that inhibits the activity of the N protein of the coronavirus and/or reduces the expression of the gene of the N protein of the coronavirus and/or reduces the content of the N protein of the coronavirus in the preparation of substances that prevent and/or treat the coronavirus caused by Application of drugs for diseases or coronavirus infections.

The present invention provides the application of a substance that inhibits the activity of the N protein of the coronavirus and/or reduces the expression of the N protein of the coronavirus and/or reduces the content of the N protein of the coronavirus in the preparation of a coronavirus inhibitor.

In the above application, the coronavirus is a β-coronavirus virus whose N protein and SARS-CoV N protein 107-125 amino acid residues have an amino acid homology of more than 75%, specifically SARS-CoV and/or MERS -CoV and/or SARS-CoV-2.

In the above application, the substance is a reagent.

In the above application, the reagent includes the following I and/or II and/or III:

I. Organic molecules that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus;

II Antibodies or antigen-binding fragments thereof that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus;

III A polynucleotide targeting the gene of the N protein of the coronavirus.

The present invention provides medicinal reagents, wherein the medicinal reagents comprise at least one of the following (1)-(9):

(1) Organic molecules that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2;

(2) Antibodies or antigen-binding fragments thereof that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2;

(3) A polynucleotide targeting the gene of MASP-2;

(4) Organic molecules that inhibit the binding of MASP-2 and the N protein of coronavirus;

(5) Antibodies or antigen-binding fragments thereof that inhibit the binding of MASP-2 and the N protein of coronavirus;

(6) A polynucleotide that targets the binding of MASP-2 and the N protein of coronavirus;

(7) Organic molecules that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus;

(8) Antibodies or antigen-binding fragments thereof that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus;

(9) A polynucleotide targeting the gene of the N protein of the coronavirus.

The medicinal reagent is used to inhibit coronavirus infection in animals.

Among the above-mentioned medicinal reagents, the coronavirus is a β-coronavirus virus whose N protein and SARS-CoV N protein 107-125 amino acid residues have more than 75% amino acid homology. Specifically, it can be SARS-CoV and SARS-CoV. / Or MERS-CoV and/or SARS-CoV-2.

The present invention provides a method for inhibiting coronavirus infection in animals, which comprises administering the above-mentioned medicinal agent to recipient animals to inhibit coronavirus infection in animals.

The present invention also provides a method for treating or/and preventing diseases caused by coronavirus, which includes administering the pharmaceutical agent to recipient animals to treat or/and prevent diseases caused by coronavirus.

In the above method, the coronavirus is a β-coronavirus virus whose N protein and SARS-CoV N protein 107-125 amino acid residues have an amino acid homology of more than 75%, specifically SARS-CoV and/or MERS-CoV and/or SARS-CoV-2.

In the above method, the disease caused by the coronavirus may be a respiratory system infection and/or a digestive system infection. The respiratory infection is a respiratory infection and/or a lung infection, and the respiratory infection may be nasopharyngitis, rhinitis, pharyngitis, tracheitis and/or bronchitis, and the lung infection may be pneumonia. The digestive system infection may be diarrhea. Coronavirus-infected patients show symptoms of atypical viral pneumonia, characterized by high fever, dyspnea, lymphopenia, lung shadows on chest radiographs that progress rapidly, the virus can cause cytokine storms and cause acute lung injury, and severe patients have acute breathing Distress syndrome and even respiratory failure.

In the above method, the recipient animal may be a human, such as a person infected with a coronavirus or a person who will be prevented from being infected by a coronavirus.

In this application, the MASP-2 is human mannose-binding lectin-binding related serine protease-2, or MASP-2 derived from other animals that has more than 70% homology with human MASP-2.

The above-mentioned homology refers to the homology of amino acid sequence. The homology search site on the Internet can be used to determine the homology of the amino acid sequence, such as the BLAST page of the NCBI homepage. For example, in advanced BLAST2.1, by using blastp as the program, the Expect value is set to 10, all Filters are set to OFF, BLOSUM62 is used as the Matrix, and Gap existence cost, Per resistance gap cost and Lambda ratio are respectively set to 11, 1 and 0.85 (default value) and perform a search for the homology of a pair of amino acid sequences to calculate, and then the value (%) of the identities (identities) can be obtained. The homology of 70% or more may be at least 70%, 80%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% homology.

Description of the drawings

Figure 1 is a broken line graph of the survival rate and body weight recovery of Masp2 knockout mice infected with SARS-CoV ^{MA in Example 1.} A in Fig. 1 is the survival rate of mice, B in Fig. 1 is the proportion of surviving mice’s body weight to the original body weight, KO is a Masp2 knockout mouse, and WT is a litter-negative mouse.

Figure 2 is a broken line chart of the survival rate and weight recovery of mice after different infections and treatments in Example 2. In Figure 2, A is the survival rate of mice. The left picture is injection treatment on the day of infection, and the right picture is injection treatment 2 days after infection; B in Fig. 2 is the proportion of surviving mice’s body weight to the original body weight, and the left picture is Injection treatment on the day of infection, the picture on the right shows injection treatment 2 days after infection; ns in the picture means the difference is not significant (P≥0.05), * means the difference is significant (P<0.05), ** means the difference is extremely significant (P<0.01).

Figure 3 shows the result of immunoblotting in mechanism experiment 1. In Figure 3, A is the immunoblot after immunoprecipitation of SARS-CoV N protein and MASP-2, and B in Figure 3 is the immunoblotting after MERS-CoV N protein and MASP-2 immunoprecipitation. The "+" in the table on each strip in the figure indicates that the substance is added, and "-" indicates that the substance is not added.

Figure 4 is a schematic diagram of the homology comparison between SARS-CoV N protein, MERS-CoV N protein, SARS-CoV-2 N protein and MASP-2 interaction core regions.

Figure 5 is a broken line graph of SARS-CoV N protein complement deposition. The left picture in Fig. 5 is the result of C4b deposition, the middle picture in Fig. 5 is the result of activated C3 deposition, and the right picture in Fig. 5 is the result of C5b-9 deposition. SARS N in the picture shows the treatment of adding SARS-CoV N protein , Control means control without SARS-CoV N protein, 229E N means human coronavirus 229E N protein treatment.

The best way to implement the invention

The present invention will be further described in detail below in conjunction with specific embodiments, and the examples given are only to illustrate the present invention, not to limit the scope of the present invention. The examples provided below can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute a limitation to the present invention in any way.

The experimental methods in the following examples, unless otherwise specified, are all conventional methods. The materials, reagents, etc. used in the following examples, unless otherwise specified, are all conventional biochemical reagents and can be obtained from commercial sources.

1 cell line and plasmid, gene

HEK293 cells (human embryonic kidney cells 293, ATCC CRL-1573), Vero E6 cells (African green monkey kidney cells, ATCC CRL-1586) The public can obtain the biological material from the Academy of Military Medicine of the Chinese Academy of Military Sciences. It is only used for repeating related experiments of the present invention, and cannot be used for other purposes.

pEGFPC1-NP is a product of Beijing Yiqiao Shenzhou Technology Co., Ltd., the article number is VG40143-ACGLN. pCDNA3.0 is a product of Invitrogen.

The full-length gene of MASP2 gene (HG18035-UT), SARS-CoV N protein, SARS-CoV N protein (40143-V08B), and MERS-CoV N protein can be purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd.

All primer synthesis and sequencing in the following examples were completed by Beijing Aoke Dingsheng Company.

2Molecular biology reagents and antibodies

C1INH (product number SRP3318) is a product of Merck; transfection reagent Lipofectamine 3000 Transfection Kit is a product of Invitrogen company, product number L3000-015; complement C4 (product number 80295-48-3), complement C4b (product number 204897), and C1q missing serum ( Catalog No. 234401) is a product of Sigma; Complement Deposition Kit (Human MBL/MASP-2 assay kit, Hycult, HK327-02) is a product of HBT; Protease inhibitor Cocktail (EDTA-free, Catalog No. 04693132001) is a product of Roche ; DMEM medium (product number 11965-092), Opti-MEM ^TM medium (product number 31985088), pancreatin (product number 25200072), 1×PBS (product number 10010023) are all products of GIBCO; ECL chemiluminescence color developing solution (product number 45-002-401) is a product of GE.

HRP-labeled anti-Flag antibody (Cat. No. A8592) and HRP-labeled anti-GFP antibody (Cat. No. AB16901) are products of Sigma; anti-MASP-2 antibody (Cat. No. sc-17905, a goat polyclonal antibody, can be used in humans and mice Rat MASP-2 detection), anti-NP antibody (product number sc-52906, mouse monoclonal antibody, can be used for human SARS coronavirus N protein detection), anti-C4b antibody (product number sc-25815, rabbit polyclonal antibody, can be used for human small Mouse C4 detection) and anti-activated C3 antibody (sc-47687) are all products of Santa Cruz; anti-Flag agarose beads (Cat. No. F2426) are products of Sigma.

4 mice

The wild-type SPF grade BALB/c mice are the standard strains, purchased from Weitong Lihua and Sibefu Company.

All data in the following examples are analyzed using IBM SPSS 22 for significance.

The quantitative experiments in the following examples, unless otherwise specified, are set to repeat the experiment three times, and the results are averaged.

Example 1 SARS-CoV virus infects mice with knockout Masp2 gene

1Materials and methods

The following experiments were carried out in the BSL-3 and ABSL-3 laboratories.

1.1 Virus

The virus species is SARS-CoV mouse adapted strain, SARS-CoV (strain v2163) (CWDay et al., Virology 395,210 (Dec 20, 2009)), hereinafter referred to as SARS-CoV ^MA . Passage three times in Vero E6 cells. The passaging medium is high-sugar DMEM medium containing 2% fetal bovine serum. When the SARS-CoV ^MA titer reaches 10 ⁷ PFU/mL, collect the culture supernatant, centrifuge at 3000 rpm for 2 min, and collect it. To obtain the cell culture supernatant containing SARS-CoV ^MA.

1.2 Mice

Masp2 knockout C57 mice (MASP-2 ^-/- Mice) and their littermate-negative mice (WJSchwaeble et al., Proc Natl Acad Sci USA 108,7523 (May 3,2011)) were divided into two groups, respectively For the KO group and WT group. The KO group consisted of C57 mice with knockout of Masp2 gene, 10 mice, 8-12 weeks old, each weighing 25±3g. The WT group is homozygous offspring of littermate negative mice of C57 mice with knockout of Masp2 gene (ie Masp2 gene is not knocked out, MASP-2 ^+/+ Mice), 10 mice, 8-12 weeks old, each body weight 25±3g.

1.3 Methods of infection

Both groups were inoculated with SARS-CoV ^MA -containing cell culture supernatant by intranasal drip, specifically 100 μL per intranasal drip (ie 10 ⁶ PFU/mouse) after ether anesthesia. After that, observe the survival of the mice and monitor their body weight every 1-2 days.

2 results

The specific results are shown in Fig. 1, where A in Fig. 1 is the survival rate of mice, and B in Fig. 1 is the proportion of the body weight of the surviving mice to the original body weight. It can be seen from Figure 1 that mice with knockout Masp2 gene have a significantly lower mortality rate and recover faster than litter-negative mice.

Example 2 SARS-CoV virus infection in mice and treatment

1Materials and methods

1.1 Laboratory

The following experiments were carried out in the BSL-3 and ABSL-3 laboratories.

1.2 Virus

The virus species is SARS-CoV mouse-adapted strain, SARS-CoV (strain v2163) (CWDay et al., Virology 395,210 (Dec 20, 2009)), hereinafter referred to as SARS-CoV ^MA . Passage three times in Vero E6 cells. The passaging medium is high-sugar DMEM medium containing 2% fetal bovine serum. When the SARS-CoV ^MA titer reaches 10 ⁷ PFU/mL, collect the culture supernatant, centrifuge at 3000 rpm for 2 min, and collect it. To obtain the cell culture supernatant containing SARS-CoV ^MA.

1.3 Inhibitors and antibodies

C1INH, anti-MASP-2 antibody, anti-NP antibody.

1.4 Mice

The mice used were wild-type SPF BALB/c mice from Weitong Lihua and Sibefu Company. The experiment was carried out in two batches.

1.4.1 Evaluation of efficacy of treatment on the day of infection (initial treatment of infection):

Female mice aged 10-12 weeks old and weighing about 20g were randomly divided into 4 groups, 8-10 mice in each group: Medium+saline infection day treatment group (healthy control), SARS-CoV ^MA +saline infection day treatment group (Infected control), SARS-CoV ^MA + C1INH treatment group on the day of infection, SARS-CoV ^MA + anti-MASP-2 treatment group on the day of infection.

1.4.2 Evaluation of the efficacy of the two-day treatment for infection (treatment in the acute attack period after infection):

Female mice aged 10-12 weeks and weighing about 20g were selected and randomly divided into 5 groups, 8-10 mice in each group: Treatment group (healthy control) on the second day after Medium+saline infection, SARS-CoV ^MA +saline infection Treatment group on the second day after infection (infected control), treatment group on the second day after SARS-CoV ^MA + C1INH infection, treatment group on the second day after SARS-CoV ^MA + anti-MASP-2 infection, SARS-CoV ^MA + anti- Treatment group on day 2 after N infection.

1.5 Infection and treatment

1.5.1 Treatment time

There are 5 kinds of infection and treatment methods and 2 kinds of treatment time for 9 groups of mice. Except for SARS-CoV ^MA + anti-N, only one treatment time is set for treatment on the second day after infection, other treatments are set for treatment on the day of infection and two treatment times on the second day after infection.

1.5.2 Infection and treatment

Treatment group on the day of Medium+saline infection: After the mouse was anesthetized with ether, 100 μL of Vero E6 cell culture supernatant not inoculated with virus was injected into the nose of each mouse. ), 30 minutes later, each mouse was injected with 100 μL of saline.

Treatment group on the second day after Medium+saline infection: 100μL of Vero E6 cell culture supernatant not inoculated with virus per mouse after ether anesthesia DMEM medium). After 2 days, each mouse was injected with 100 μL of normal saline.

Treatment group on the day of SARS-CoV ^{MA +saline infection: After anesthesia with ether, 100μL of the cell culture supernatant containing SARS-CoV MA} virus (infectious dose of 10 ⁶ PFU/mouse) of the above 1.2 was instilled into the nose of each mouse. 30 minutes after SARS-CoV ^MA inoculation, each mouse was injected with 100 μL of normal saline.

Treatment group on the second day after SARS-CoV ^MA +saline infection: After anesthesia with ether, each mouse received 100 μL of the above 1.2 SARS-CoV ^MA -containing cell culture supernatant (that is, the infection dose was 10 ⁶ PFU/mouse). Two days after intranasal inoculation of SARS-CoV ^MA , each mouse was injected with 100 μL of normal saline.

Treatment group on the day of SARS-CoV ^MA + C1INH infection: After the mice were anesthetized with ether, 100 μL ^{of the cell culture supernatant containing SARS-CoV MA} of 1.2 above (that is, the infection dose was 10 ⁶ PFU/mouse) was inoculated by intranasal infusion. 30 minutes after SARS-CoV ^MA , each mouse was injected with 100 μL of C1INH liquid, and the injection dose of C1INH was 4 mg/kg body weight. The C1INH-containing liquid is a liquid obtained by dissolving C1INH in physiological saline.

Treatment group on the second day after SARS-CoV ^MA + C1INH infection: After the mouse was anesthetized with ether, 100 μL of the above 1.2 SARS-CoV ^MA -containing cell culture supernatant (that is, the infection dose was 10 ⁶ PFU/mouse) was instilled into the nose of each mouse. Two days after intranasal inoculation of SARS-CoV ^MA , each mouse was injected with 100 μL of the above-mentioned C1INH liquid, and the injection dose of C1INH was 4 mg/kg body weight.

SARS-CoV ^MA + anti-MASP-2 on the day of infection Treatment group: After anesthesia with ether, 100 μL of the above 1.2 SARS-CoV ^MA -containing cell culture supernatant (that is, the infection dose is 10 ⁶ PFU/mouse) 30 minutes after SARS-CoV ^MA was inoculated intranasally, each mouse was injected with 100μL of anti-MASP-2 antibody liquid, and the injection dose of anti-MASP-2 antibody was 200μg/kg body weight. The anti-MASP-2 antibody-containing liquid is a liquid obtained by dissolving anti-MASP-2 antibody in physiological saline.

On the second day after SARS-CoV ^MA + anti-MASP-2 infection, treatment group: mice were anesthetized with ether and 100 μL of the above 1.2 SARS-CoV ^MA -containing cell culture supernatant (that is, the infection dose was 10 ⁶ PFU). 2 days after SARS-CoV ^MA inoculated intranasally, each mouse was injected with 100 μL of the above-mentioned anti-MASP-2 antibody liquid, and the injection dose of anti-MASP-2 antibody was 200 μg/kg body weight.

Treatment group on day 2 after SARS-CoV ^MA +anti-N infection: After anesthesia with ether, each mouse received 100 μL of the above 1.2 SARS-CoV ^MA -containing cell culture supernatant (that is, the infection dose was 10 ⁶ PFU/mouse). ), 2 days after SARS-CoV ^{MA was} inoculated intranasally, each mouse was injected with 100 μL of anti-NP antibody liquid, and the injection dose of anti-NP antibody was 200 μg/kg body weight. The anti-NP antibody-containing liquid is a liquid obtained by dissolving anti-NP antibody in physiological saline.

The SARS-CoV ^MA virus nasal drip method is the same as in Example 1.

The injection was made by tail vein injection, diluted with normal saline and injected, each injection of 100μL, a total of once. After that, observe the survival of the mice and monitor their body weight every 1-2 days.

2 results

The specific results are shown in Figure 2. A in Figure 2 is the survival rate of mice. The left side is the treatment on the day of infection, and the right side is the treatment on the second day after infection; B in Figure 2 is the proportion of surviving mice's body weight to the original body weight , The left side is the treatment on the day of infection, and the right side is the treatment on the second day after infection. It can be seen from Figure 2:

①Mice injected with anti-MASP-2 antibody or C1INH on the day of infection significantly reduced the fatality rate and recovered good weight compared with the infected control. Among them, the mice injected with anti-MASP-2 antibody had the first time after infection. After 8 days, the body weight recovered to no significant difference with the healthy control. Specifically, in the experiment of the treatment group on the same day, the survival rate (survival rate) of the treatment group on the day of Medium+saline infection was 100%, and the survival rate of the treatment group on the day of ^{SARS-CoV MA+saline infection was 13%. The survival rate of the treatment group on the day of MA} + C1INH infection was 88%, and the survival rate of the treatment group on the day of SARS-CoV ^MA + anti-MASP-2 infection was 75%.

② Mice injected with any of anti-MASP-2 antibody, anti-NP antibody, and C1INH 2 days after infection (acute onset period), compared with the infected control, the mice died in a concentrated period of time (mice within 1 day) The number of deaths reached more than 50% of the total number of deaths in the group) was delayed for 1-4 days, and effectively reduced the mortality of infected mice, and the weight of mice injected with anti-NP antibody or C1INH recovered well. Specifically, the survival rate of the treatment group on the second day after Medium+saline infection is 100%, the survival rate of the treatment group on the second day after SARS-CoV ^MA +saline infection is 20%, and 50% of the dead mice are on the third day. Death on the second day after SARS-CoV ^MA + C1INH infection, the survival rate of the treatment group was 40%, and 50% of the dead mice died on the seventh day (postponed by 4 days); SARS-CoV ^MA +anti-MASP-2 The survival rate of the treatment group was 30% on the 2nd day after infection, and 50% of the dead mice died on the 7th day (postponed by 4 days). The survival rate of the treatment group on the 2nd day after SARS-CoV ^MA +anti-N infection was 60%, and 50% of the dead mice died on the 4th day (postponed by 1 day).

Mechanism experiment 1 Immunoprecipitation and immunoblotting to detect the interaction between MASP-2 and N protein

1Materials and methods

1.1 Reagent

Cell lysate: 50mmol/L Tris-HCl _{pH7.4, 150mmol/L NaCl, 2mmol/L CaCl 2} , protease inhibitor Cocktail (EDTA-free, catalog number 04693132001) 1 tablet/50ml, 1% NP40.

Cell lysate without protease inhibitor: 50mmol/L Tris-HCl pH7.4, 150mmol/L NaCl, 2mmol/L CaCl ₂ , 1% NP40.

1×Transfer Membrane Buffer: Tris-HCl 24mM, Glycine 5mM, 20%(v/v) methanol.

1.2 Plasmid

pcDNA3.0-MASP-2-Flag is an expression vector for expressing the protein MASP-2-Flag, and MASP-2-Flag is a fusion protein of human MASP-2 and Flag.

The expression plasmids of the coronavirus N protein and its mutants are specifically: pcDNA3.0-Flag-SARS N (WT), pcDNA3.0-Flag-SARS N (Δ321-323), pcDNA3.0-Flag-SARS N (Δ116- 124), pcDNA3.0-Flag-MERS N (WT), pcDNA3.0-Flag-MERS N (Δ104-112), 5 types. Among them, pcDNA3.0-Flag-SARS N (WT) is an expression vector for the expression of the protein Flag-SARS N (WT), Flag-SARS N (WT) is a fusion protein of SARS N (WT) and Flag, and the rest of the expression vectors are And so on. SARS N (WT) is the full length of SARS-CoV N protein, Flag is the protein tag; SARS N (Δ321-323) is a mutant protein that lacks amino acid residues 321-323 of SARS-CoV N (WT) protein, SARS N(Δ116-124) is a mutant protein lacking amino acid residues 116-124 of SARS-CoV N(WT) protein, MERS N(WT) is the full length of MERS-CoV N protein, MERS N(Δ104-112) It is a mutant protein deleted from amino acid residues 104-112 of the MERS-CoV N(WT) protein.

1.2.1 Plasmid pcDNA3.0-MASP-2-Flag

Connect the Flag gene fragment (gattacaaggacgacgatgacaag) before the 3'stop codon of the gene encoding human MASP-2 protein (ie MASP2 gene) to obtain the DNA named MASP-2-Flag gene, and replace pCDNA3.0( Invitrogen) vector restriction endonuclease HindIII and KpnI recognition site fragment (including HindIII recognition site and KpnI recognition site including small fragments), keep the other sequences of pCDNA3.0 vector unchanged, get The recombinant expression vector of MASP-2-Flag protein was named pcDNA3.0-MASP-2-Flag.

1.2.2 Plasmid pcDNA3.0-Flag-SARS N (WT)

Insert the Flag gene fragment (gattacaaggacgacgatgacaag) after the start codon at the 5'end of the full-length gene of SARS-CoV N protein to obtain the DNA named Flag-SARS N (WT) gene, and replace the pCDNA3.0 (Invitrogen) vector with this DNA The fragments between the recognition sites of the restriction endonucleases BamHI and EcoRI (small fragments including the recognition sites of BamHI and EcoRI), keep the other sequences of pCDNA3.0 unchanged, and obtain Flag-SARS N The recombinant expression vector of protein (also known as SARS N (WT)), named pcDNA3.0-Flag-SARS N (WT).

1.2.3 Plasmid pcDNA3.0-Flag-SARS N (Δ321-323)

Insert the Flag gene fragment (gattacaaggacgacgatgacaag) after the start codon at the 5'end of the SARS N (Δ321-323) gene to obtain the DNA named Flag-SARS N (Δ321-323), and replace pCDNA3.0 (Invitrogen) with this DNA The fragments between the vector’s restriction endonucleases BamHI and EcoRI recognition sites (small fragments including the recognition sites of BamHI and EcoRI), keep the other sequences of pCDNA3.0 unchanged, and obtain the SARS N protein The recombinant expression vector of the deletion mutant (also known as SARS N (Δ321-323)) with the deletion of amino acids 321-323 was named pcDNA3.0-Flag-SARS N (Δ321-323).

1.2.4 Plasmid pcDNA3.0-Flag-SARS N (Δ116-124)

Insert the Flag gene fragment (gattacaaggacgacgatgacaag) after the start codon at the 5'end of the SARS N (Δ116-124) gene to obtain the DNA named Flag-SARS N (Δ116-124), and replace pCDNA3.0 (Invitrogen) with this DNA The fragments between the vector’s restriction endonucleases BamHI and EcoRI recognition sites (small fragments including the recognition sites of BamHI and EcoRI), keep the other sequences of pCDNA3.0 unchanged, and obtain the SARS N protein The recombinant expression vector of the deletion mutant (also known as SARS N (Δ116-124)) that deletes the 116-124 amino acids is named pcDNA3.0-Flag-SARS N (Δ116-124).

1.2.5 Plasmid pcDNA3.0-Flag-MERS N (WT)

Insert the Flag gene fragment (gattacaaggacgacgatgacaag) after the start codon at the 5'end of the full-length gene of the MERS-CoV N protein to obtain the DNA named Flag-MERS N (WT) gene, and replace the pCDNA3.0 (Invitrogen) vector with this DNA The fragments between the recognition sites of the restriction endonucleases BamHI and EcoRI (the small fragments including the recognition sites of BamHI and EcoRI), keep the other sequences of pCDNA3.0 unchanged, and obtain the MERS N protein Recombinant expression vector, named pcDNA3.0-Flag-MERS N (WT).

1.2.6 Plasmid pcDNA3.0-Flag-MERS N (Δ104-112)

Insert the Flag gene fragment (gattacaaggacgacgatgacaag) after the start codon at the 5'end of the MERS N (Δ104-112) gene to obtain the DNA named Flag-MERS N (Δ104-112), and replace pCDNA3.0 (Invitrogen) with this DNA The fragments between the vector’s restriction endonucleases BamHI and EcoRI recognition sites (including the BamHI recognition sites and EcoRI recognition sites), keep the other sequences of pCDNA3.0 unchanged to obtain the MERS N protein The recombinant expression vector of the deletion mutant (also known as MERS N (Δ104-112)) with the deletion of amino acids 104-112 was named pcDNA3.0-Flag-MERS N (Δ104-112).

1.3 Transfection

1.3.1 Preparation of HEK293/pcDNA3.0-MASP-2-Flag cells

HEK293 cells were cultured to 70-90% confluence for transfection. Use Thermo Company’s Lipofectamine ^TM 3000 transfection reagent to carry out plasmid transfection according to the instructions: add 5 μg pcDNA3.0-MASP-2-Flag plasmid and 10 μL P3000 ^TM to 250 μL Opti-MEM ^TM medium for dilution to prepare a DNA master mix; According to the ratio of plasmid: Lipofectamine ^TM 3000 transfection reagent = 1:3, add 15 ^{μL of Lipofectamine TM} 3000 transfection reagent to 250 μL of Opti-MEM ^TM medium for dilution. After dilution, add the above-mentioned DNA premix, mix and incubate at room temperature Get DNA-lipid complex in 10-15min, then add DNA-lipid complex to HEK293 cells, discard the culture supernatant after 36-48h of transfection, wash the cells twice with 5mL of pre-chilled 1×PBS , Add 5mL 1×PBS to each dish, scrape the cells with a cell scraper, pipette evenly and transfer to a 15mL centrifuge tube, collect the cells after centrifugation at 4°C and 2000×g for 3min to obtain HEK293/pcDNA3.0-MASP-2- Flag cells.

1.3.2 Preparation of HEK293/pcDNA3.0-Flag-MERS N (WT) cells

Replace the pcDNA3.0-MASP-2-Flag plasmid in 1.3.1 with pcDNA3.0-Flag-MERS N(WT) plasmid, and transfect according to the same steps as above to obtain HEK293/pcDNA3.0-Flag-MERS N( WT) Cells.

1.3.3 Preparation of HEK293/pcDNA3.0-Flag-SARS N (Δ321-323) cells

Replace the pcDNA3.0-MASP-2-Flag plasmid in 1.3.1 with pcDNA3.0-Flag-SARS N(Δ321-323) plasmid, and transfect according to the same steps as above to obtain HEK293/pcDNA3.0-Flag-SARS N (Δ321-323) cells.

1.3.4 Preparation of HEK293/pcDNA3.0-Flag-SARS N (Δ116-124) cells

Replace the pcDNA3.0-MASP-2-Flag plasmid in 1.3.1 with pcDNA3.0-Flag-SARS N(Δ116-124) plasmid, and transfect according to the same steps as above to obtain HEK293/pcDNA3.0-Flag-SARS N (Δ116-124) cells.

1.3.5 Preparation of HEK293/pcDNA3.0-Flag-MERS N (WT) cells

Replace the pcDNA3.0-MASP-2-Flag plasmid in 1.3.1 with pcDNA3.0-Flag-MERS N(WT) plasmid, and transfect according to the same steps as above to obtain HEK293/pcDNA3.0-Flag-MERS N( WT) Cells.

1.3.6 Preparation of HEK293/pcDNA3.0-Flag-MERS N (Δ104-112) cells

Replace the pcDNA3.0-MASP-2-Flag plasmid in 1.3.1 with pcDNA3.0-Flag-MERS N(Δ104-112) plasmid, and transfect according to the same steps as above to obtain HEK293/pcDNA3.0-Flag-MERS N (Δ104-112) cells.

1.4 Cracking

Add the obtained HEK293/pcDNA3.0-MASP-2-Flag cells to 500μL of cell lysate and lyse on ice for 10min, then centrifuge at 4℃ and 16000rpm for 10min; transfer the supernatant to a new 1.5mL centrifuge tube to obtain HEK293/pcDNA3 .0-MASP-2-Flag cell lysate.

According to the same method as above, respectively lyse 5 kinds of cells containing coronavirus N protein (ie HEK293/pcDNA3.0-Flag-SARS N (WT) cells, HEK293/pcDNA3.0-Flag-SARS N (Δ321-323) cells, HEK293 /pcDNA3.0-Flag-SARS N (Δ116-124) cells, HEK293/pcDNA3.0-Flag-MERS N (WT) cells, HEK293/pcDNA3.0-Flag-MERS N (Δ104-112) cells), 5 kinds of lysates of cells containing coronavirus N protein (ie HEK293/pcDNA3.0-Flag-SARS N (WT) cell lysate, HEK293/pcDNA3.0-Flag-SARS N (Δ321-323) cell lysate , HEK293/pcDNA3.0-Flag-SARS N (Δ116-124) cell lysate, HEK293/pcDNA3.0-Flag-MERS N (WT) cell lysate, HEK293/pcDNA3.0-Flag-MERS N( Δ104-112) Cell lysate.

1.5 Co-immunoprecipitation

Add 20μL of anti-Flag agarose beads to the lysate of HEK293/pcDNA3.0-MASP-2-Flag cells, spin-incubate at 4°C for 2h for immunoprecipitation, then centrifuge at 4°C, 3000rpm for 5min, use 1mL without protease inhibition Wash the beads 3 times with the cell lysate of the reagent, centrifuge to remove the supernatant and store in aliquots at -70°C for later use to obtain MASP-2-bound agarose beads.

To the lysate of cells containing coronavirus N protein (the lysate of HEK293/pcDNA3.0-Flag-SARS N (WT) cells mentioned above, the lysate of HEK293/pcDNA3.0-Flag-SARS N (Δ321-323) cells, HEK293/pcDNA3.0-Flag-SARS N (Δ116-124) cell lysate, HEK293/pcDNA3.0-Flag-MERS N (WT) cell lysate, HEK293/pcDNA3.0-Flag-MERS N (Δ104 -112) Any one of the cell lysates) is added to agarose beads conjugated with MASP-2 and incubated at 4°C with rotation for 2 hours for co-immunoprecipitation. Then centrifuge at 4°C and 3000rpm for 5min, collect the precipitate, wash the beads 3 times with 1mL cell lysate without protease inhibitor, centrifuge to remove the supernatant, add 40-60μL 1×SDS sample buffer, and cook the sample at 100°C for 5min. Centrifuge at 16000×g for 10 min at 4°C, and finally take an appropriate amount of supernatant sample for SDS-PAGE electrophoresis and immunoblotting.

Take 10 μL of the supernatant sample and add it to the SDS-PAGE gel well for electrophoresis. When the bromophenol blue migrates to the bottom of the separation gel, stop the electrophoresis and prepare for the transfer operation. The PVDF membrane was activated with methanol for 30 seconds, and then the PVDF membrane and filter paper were soaked in 1× transfer buffer for 30 minutes. After the electrophoresis is over, place it on the semi-dry film transfer machine in the order of filter paper-PVDF membrane-SDS gel-filter paper from bottom to top, and transfer the membrane at 20V for about 1.5 hours. After the transfer is completed, the PVDF membrane is blocked with 1×TBST blocking solution containing 5% (mass percentage) skimmed milk powder for 1 hour at room temperature, and then washed with 1×TBST blocking solution 3 times, each time for 5 minutes; add HRP-labeled anti -Flag antibody and HRP-labeled anti-GFP antibody incubate the PVDF membrane for 1 hour at room temperature, wash it three times, and perform ECL development analysis with ECL chemiluminescence coloring solution.

2 results

The results are shown in Figure 3. SARS-CoV N protein (ie SARS N (WT), SARS N (Δ321-323), SARS N (Δ116-124)) and MERS-CoV N protein (Figure 3 A in Figure 3) and MERS-CoV N protein (Figure 3) Both MERS N and MERS N (Δ104-112)) in Figure B of 3 interact with MASP-2.

The SARS-CoV-2N protein is highly homologous to the SARS-CoV N protein, and the MERS-CoV N protein is highly homologous to the MASP-2 interaction zone, as shown in Figure 4, and the SARS-CoV-2N protein interacts with MASP-2.

Mechanism experiment 2 SARS-CoV N protein promotes complement deposition experiment

1Materials and methods

1.1 Reagent

High salt binding buffer: 10mM Tris-HCl pH 7.4, 1M NaCl, 0.5mM MgCl ₂ , 0.05% (v/v) Tween-20, and 0.1% (w/v) gelatin, 2mM CaCl ₂ .

Binding buffer: 10 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5 mM MgCl ₂ , 0.05% (v/v) Tween-20, and 0.1% (w/v) gelatin, 2 mM CaCl ₂ .

1.2 Complement deposition

The C4b deposition experiment was carried out using HBT's complement deposition kit. Use human C1q-deficient serum with high-salt binding buffer (10mM Tris-HCl pH 7.4, 1M NaCl, 0.5mM MgCl ₂ , 0.05% (v/v) Tween-20, and 0.1% (w/v) gelatin ), 2mM CaCl ₂ ) was diluted and added to an ELISA plate (10 μg/well) pre-coated with mannan, and incubated overnight at 4°C. After washing the plate three times with 1×PBST, add the binding buffer and purified complement C4b (Sigma, 204897) and SARS-CoV N protein (Yiqiao Shenzhou, 40143-V08B) (set the control without SARS-CoV N protein, also Set up a control treatment with human coronavirus 229EN), and incubate at 37°C for 1.5h. After washing the plate three times, add anti-C4b antibody and incubate for 1 hour. After washing the plate three times, add HRP secondary antibody and incubate for 1 hour. After washing the plate three times, add TMB color developing solution. After 15-30 minutes, add 2M H ₂ SO _{4 to} stop the reaction. Read the OD at 450 nm value.

In the C3 deposition experiment, the human C1q-deficient serum was diluted with binding buffer and added to a pre-coated ELISA plate with mannan. After incubating for 1 hour at 4°C, the plate was not washed and incubated at 37°C for 1.5 hours. After washing the plate three times, add anti-activated C3 antibody (Santa Cruz, sc-47687) and the corresponding HRP secondary antibody and incubate for 1h. After washing the plate three times, add TMB color developing solution. After 15-30 minutes, add 2M H ₂ SO _{4 to} stop the reaction. Read the OD value at 450nm.

The C5b-9 deposition experiment was carried out with reference to the method of the above-mentioned C3 deposition experiment, and only the anti-C3 antibody was replaced with the anti-C5b-9 antibody.

2 results

The specific results are shown in Figure 5. It was found through complement deposition experiments that SARS-CoV N protein can promote the activation of the lectin pathway and lead to intensified downstream complement activation.

The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention has given specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principles of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes that deviate from the scope disclosed in this application and use conventional techniques known in the art. According to the scope of the appended claims below, some basic features can be applied.

Industrial application

The present invention has discovered the molecular mechanism by which the N protein causes the host's excessive immune response through the study of the interaction between the N protein of the coronavirus and MASP-2 and related molecular mechanisms: the immunoprecipitation and immunoblotting experiments confirm that the SARS-CoV N protein and MASP- 2 There is an interaction, and it is found that the interaction region is highly homologous with the MERS-CoV N protein and SARS-CoV-2N protein, and the MERS-CoV N protein also has the same effect; the complement deposition experiment found that the SARS-CoV N protein and The MERS-CoV N protein can promote the activation of the lectin pathway and increase the activation of downstream complement; the mortality of Masp2 gene knockout mice after infection with the virus significantly decreases and recovers faster; the in vivo infection experiment confirms that the MASP-2 drug is targeted, For example, the application of MASP-2 inhibitor C1INH or antibody, or targeting the N protein such as the application of N protein monoclonal antibody, can effectively reduce the mortality of mice infected with the SARS-CoV mouse-adapted strain. It proves that inhibitors against MASP-2, N protein or the binding of MASP-2 and N protein have the value of being applied as a candidate drug for the prevention and treatment of SARS-CoV-like virus infection.

Claims (20)

1. The application of a substance that inhibits the activity of MASP-2 and/or reduces the expression of MASP-2 genes and/or reduces the content of MASP-2, the application is any of the following:

   U1, substances that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2 are used in the preparation of drugs for the prevention and/or treatment of diseases caused by coronaviruses or coronavirus infections Applications;

   U2, use of a substance that inhibits the activity of MASP-2 and/or reduces the expression amount of MASP-2 gene and/or reduces the content of MASP-2 in the preparation of a coronavirus inhibitor.
2. The application according to claim 1, wherein: the coronavirus is a β-coronavirus virus whose N protein and SARS-CoV N protein 107-125 amino acid residues have an amino acid homology of more than 75%.
3. The application according to claim 2, wherein: the coronavirus is SARS-CoV and/or MERS-CoV and/or SARS-CoV-2.
4. The application according to claim 1, wherein: the substance is a reagent, and the reagent may only be the following 1) and/or 2) and/or 3), and may also contain a carrier or excipient:

   1) Organic molecules that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2;

   2) Antibodies or antigen-binding fragments thereof that inhibit the activity of MASP-2 and/or reduce the expression level of MASP-2 genes and/or reduce the content of MASP-2;

   3) A polynucleotide targeting the gene of MASP-2.
5. The application according to claim 4, wherein: the organic molecule is C1INH.
6. The application of a substance that inhibits the binding of MASP-2 and the N protein of coronavirus, the application is any of the following:

   M1, the application of substances that inhibit the binding of MASP-2 and the N protein of coronavirus in drugs for preventing and/or treating diseases caused by coronavirus or infection by coronavirus;

   M2. Application of substances that inhibit the binding of MASP-2 and the N protein of coronavirus in the preparation of coronavirus inhibitors.
7. The application according to claim 6, wherein: the coronavirus is a β-coronavirus virus whose N protein and SARS-CoV N protein 107-125 amino acid residues have an amino acid homology of more than 75%.
8. The application according to claim 7, wherein: the coronavirus is SARS-CoV and/or MERS-CoV and/or SARS-CoV-2.
9. The application according to claim 6, wherein: the substance is a reagent, and the reagent comprises the following A and/or B and/or C:

   A. Organic molecules that inhibit the binding of MASP-2 and the N protein of coronavirus;

   B. Antibodies or antigen-binding fragments thereof that inhibit the binding of MASP-2 and the N protein of coronavirus;

   C targets the polynucleotides bound to the N protein of MASP-2 and the coronavirus.
10. The application of a substance that inhibits the activity of the N protein of the coronavirus and/or reduces the expression of the gene of the N protein of the coronavirus and/or reduces the content of the N protein of the coronavirus, the application is any of the following:

    S1. Substances that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus are used in the preparation of the prevention and/or treatment of diseases caused by the coronavirus or Application of drugs for coronavirus infection;

    S2. Application of a substance that inhibits the activity of the N protein of the coronavirus and/or reduces the expression of the N protein of the coronavirus and/or reduces the content of the N protein of the coronavirus in the preparation of a coronavirus inhibitor.
11. The application according to claim 10, wherein: the coronavirus is a β-coronavirus virus whose N protein and SARS-CoV N protein 107-125 amino acid residues have an amino acid homology of more than 75%.
12. The application according to claim 11, wherein: the coronavirus is SARS-CoV and/or MERS-CoV and/or SARS-CoV-2.
13. The application according to claim 10, wherein: the substance is a reagent, and the reagent comprises the following I and/or II and/or III:

    I. Organic molecules that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus;

    II Antibodies or antigen-binding fragments thereof that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus;

    III A polynucleotide targeting the gene of the N protein of the coronavirus.
14. The medicinal reagent, wherein the medicinal reagent comprises at least one of the following (1)-(9):

    (1) Organic molecules that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2;

    (2) Antibodies or antigen-binding fragments thereof that inhibit the activity of MASP-2 and/or reduce the expression of MASP-2 genes and/or reduce the content of MASP-2;

    (3) A polynucleotide targeting the gene of MASP-2;

    (4) Organic molecules that inhibit the binding of MASP-2 and the N protein of coronavirus;

    (5) Antibodies or antigen-binding fragments thereof that inhibit the binding of MASP-2 and the N protein of coronavirus;

    (6) A polynucleotide that targets the binding of MASP-2 and the N protein of coronavirus;

    (7) Organic molecules that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus;

    (8) Antibodies or antigen-binding fragments thereof that inhibit the activity of the N protein of the coronavirus and/or reduce the expression of the gene of the N protein of the coronavirus and/or reduce the content of the N protein of the coronavirus;

    (9) A polynucleotide targeting the gene of the N protein of the coronavirus.
15. The medicinal reagent according to claim 14, wherein: the medicinal reagent is used to inhibit coronavirus infection in animals; the N protein of the coronavirus is homologous to the amino acid residues 107-125 of the SARS-CoV N protein Beta-coronaviruses with a sex ratio of more than 75% are viruses.
16. The pharmaceutical agent according to claim 15, wherein: the coronavirus is SARS-CoV and/or MERS-CoV and/or SARS-CoV-2.
17. The method for inhibiting coronavirus infection in animals comprises administering the medicinal agent according to claim 14 to the recipient animal to inhibit coronavirus infection in the animal, and the coronavirus is its N protein and SARS-CoV N protein 107-125 amino acid residues. Β-coronavirus is a virus with a base amino acid homology of more than 75%.
18. The method according to claim 17, wherein: the coronavirus is SARS-CoV and/or MERS-CoV and/or SARS-CoV-2.
19. A method for treating or/and preventing a disease caused by a coronavirus, comprising administering the pharmaceutical agent according to claim 14 to a recipient animal to treat or/and prevent a disease caused by a coronavirus, and the coronavirus is its N protein and SARS -CoV N protein 107-125 amino acid residues with amino acid homology of more than 75% of the beta coronavirus is a virus, the disease caused by the coronavirus is respiratory system infection and/or digestive system infection.
20. The method according to claim 19, wherein: the coronavirus is SARS-CoV and/or MERS-CoV and/or SARS-CoV-2; and the respiratory infection is nasopharyngitis and/or rhinitis and/or pharyngitis And/or bronchitis and/or bronchitis; the lung infection is pneumonia; the digestive system infection is diarrhea.

Images