WO2021163555A1 - Perte de protéines tet dans des lymphocytes t régulateurs libérant une fonction effectrice - Google Patents

Perte de protéines tet dans des lymphocytes t régulateurs libérant une fonction effectrice Download PDF

Info

Publication number
WO2021163555A1
WO2021163555A1 PCT/US2021/017949 US2021017949W WO2021163555A1 WO 2021163555 A1 WO2021163555 A1 WO 2021163555A1 US 2021017949 W US2021017949 W US 2021017949W WO 2021163555 A1 WO2021163555 A1 WO 2021163555A1
Authority
WO
WIPO (PCT)
Prior art keywords
tregs
cells
expression
treg
tet
Prior art date
Application number
PCT/US2021/017949
Other languages
English (en)
Inventor
Anjana Rao
Patrick Hogan
Xiaojing YUE
Jyungseok SEI
Original Assignee
La Jolla Institute For Immunology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by La Jolla Institute For Immunology filed Critical La Jolla Institute For Immunology
Publication of WO2021163555A1 publication Critical patent/WO2021163555A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464411—Immunoglobulin superfamily
    • A61K39/464412—CD19 or B4
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C12N5/0637—Immunosuppressive T lymphocytes, e.g. regulatory T cells or Treg
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/57—Skin; melanoma

Definitions

  • the present invention relates in general to the field of immune cell regulation, and more particularly, to the conversion of regulatory T cells into effector T cells by reducing the activity of TET proteins.
  • These inventors are said to teach a transduced T cell precursor prepared by introducing a gene construct comprising a polynucleotide encoding C/EBP (CCAAT/enhancer binding protein) to a T cell precursor and overexpressing the C/EBP thereby, wherein the transduced T cell precursor is capable of differentiating into a regulatory T cell and an induced regulatory T cell differentiated therefrom.
  • the transduced T cell precursor and the induced regulatory T cell are said to be useful for preventing and treating autoimmune diseases, inflammatory diseases and graft rejections caused by the malfunction of immune response.
  • U.S. Patent No. 9,867,832 issued to Cho, et al., entitled “Pharmaceutical composition for inhibiting immune response through inducing differentiation into regulator T cells and promoting proliferation of regulator T cells”.
  • These inventors are said to teach a new medical use for (tetrahydropyran-4-yl)-[2-phenyl-5-(l,l-dioxo-thiomorpholine-4-yl)methyl— lH-indol-7-yl]amine, which is used for inhibiting an immune response, and/or for inducing differentiation into regulator T cells from undifferentiated T cells and/or promoting proliferation of regulator T cells.
  • the present invention includes a method of converting regulatory T cells (Tregs) into Ten-Eleven Translocation (TET) deficient Treg cells (ex-Treg) in vitro comprising: isolating bulk CD4 + T cells from a subject; and culturing the bulk CD4 + T cells with an agent that inhibits an activity or expression of one or more TET enzymes in the bulk CD4 + T cells, wherein loss of TET enzyme function converts Tregs in the bulk CD4 + T cells into ex-Tregs.
  • the bulk CD4 + T cells were isolated from the lymphocytes of the subject.
  • the ex-Tregs have decreased foxp3 expression and a decrease in pro-tumorigenic activity.
  • the ex-Tregs have an increased expression of at least one of: Fnl, Eomes, Ccl4, Itgam or Ac//. In another aspect, the ex-Tregs have a decreased expression of at least one of: Nrpl, Ikzf4, Ikzf2, Ccr6, Rnase4, or Xdh. In another aspect, the agent transiently or permanently reduces the activity or expression of the one or more TET enzymes. In another aspect, the agent that inhibits expression of the one or more TET enzymes is a polynucleotide that suppresses or prevents the expression of the one or more TET enzymes.
  • the polynucleotide that inhibits expression of the one or more TET enzymes is selected from at least one of: RNAi, CRISPR, aptamer, shRNA, bifunctional shRNA, microRNA, antisense, siRNA, or a ribozyme.
  • the agent that inhibits the activity of the one or more TET enzymes is selected from l-([l,r-biphenyl]-3-yl)-4-amino-5-chloropyrimidin-2(lH)-one (Bobcat339), S-2- hydroxyglutarate (S-2HG), L-2-hydroxyglutarate (L-2HG), C35, N-oxalylglycine (NOG) and dimethyl methyl fumarate (DMF), or TETi76.
  • the ex-Tregs are further modified to express a chimeric antigen receptor.
  • the ex-Tregs activate CD4 + , CD8 + , or both CD4 + and CD8 + T cells.
  • the ex-Tregs have increased expression of genes related to Tfh selected from Gzmb, Pdcdl, Bcl6, Maf, Cxcr5, Tox2, Faml29b, Klrblc, or 1121.
  • the ex-Tregs have increased expression of genes related to Thl7 cells selected from Rorc, 1117a, or II 17f
  • the present invention includes a method of making Ten-Eleven Translocation (TET) deficient Treg cells (ex-Treg) comprising exposing bulk CD4 + T cells to an agent that reduces an activity or expression of one or more TET enzymes in the bulk CD4 + T cells to convert Tregs into ex-Tregs.
  • the bulk CD4 + T cells are isolated from a population of lymphocytes before culturing with the agent.
  • the method further comprises the step of isolating ex-Treg clones from the lymphocytes or the bulk CD4+ T cells.
  • the ex-Tregs have decreased foxp3 expression and a decrease in pro-tumorigenic function.
  • the ex-Tregs have an increased expression of at least one of: Fnl, Eomes, CcU, Itgam or Xcll . In another aspect, the ex-Tregs have a decreased expression of at least one of: Nrpl, Ikzf4, Ikzf2, Ccr6, Rnase4, or Xdh.
  • the Tregs are allogeneic, syngeneic or isogenic.
  • an agent transiently or permanently reduces the activity or expression of the one or more TET enzymes.
  • the agent that inhibits expression of the one or more TET enzymes is a polynucleotide that suppresses or prevents the expression of the one or more TET enzymes.
  • the polynucleotide that inhibits expression of the one or more TET enzymes is selected from at least one of: RNAi, CRISPR, aptamer, shRNA, bifunctional shRNA, microRNA, antisense, siRNA, or a ribozyme.
  • the ex- Tregs activate CD4 + , CD8 + , or both CD4 + and CD8 + T cells.
  • the ex-Tregs have increased expression of genes related to Tfh selected from Gzmb, Pdcdl, Bcl6, Maf, Cxcr5, Tox2, Faml29b, Klrblc, or 1121.
  • the ex-Tregs have increased expression of genes related to Thl7 cells selected from Rorc, 1117a, or II 17f
  • the ex-Tregs are further modified to express a chimeric antigen receptor.
  • the present invention includes a Ten -Eleven Translocation (TET) deficient Treg cell (ex-Treg) made by a method comprising culturing bulk CD4+ T cells with an agent that inhibits an activity or expression of one or more TET enzymes in the bulk CD4+ T cells, wherein the inhibition of the activity or expression of one or more TET enzymes in the bulk CD4+ T cells converts Tregs to ex-Tregs that have T effector cell-like activity.
  • the method further comprises the step of isolating exTreg clones from the treated bulk CD4+ T cells.
  • the ex-Tregs have decreased foxp3 expression and a decrease in pro-tumorigenic function.
  • the ex-Tregs have an increased expression of at least one of: Fnl, Eomes, CcU, Itgam or Xcll. In another aspect, the ex-Tregs have a decreased expression of at least one of: Nrpl, Ikzf4, Ikzf2, Ccr6, Rnase4, or Xdh. In another aspect, the agent transiently or permanently reduces the activity or expression of the one or more TET enzymes. In another aspect, the agent that inhibits expression of the one or more TET enzymes is a polynucleotide that suppresses or prevents the expression of the one or more TET enzymes.
  • the agent is a polynucleotide that inhibits expression of the one or more TET enzymes is selected from at least one of: RNAi, CRISPR, aptamer, shRNA, bifunctional shRNA, microRNA, antisense, siRNA, or a ribozyme.
  • the agent that inhibits the activity of the one or more TET enzymes is selected from l-([l,r-biphenyl]-3-yl)-4-amino-5-chloropyrimidin-2(lH)-one (Bobcat339), S-2-hydroxyglutarate (S-2HG), L-2-hydroxyglutarate (L-2HG), C35, N-oxalylglycine (NOG) and dimethyl methyl fumarate (DMF), or TETi76.
  • the ex-Tregs are further modified to express a chimeric antigen receptor.
  • the ex-Tregs activate CD4 + , CD8 + , or both CD4 + and CD8 + T cells.
  • the ex-Tregs have increased expression of genes related to Tfh selected from Gzmb, Pdcdl, Bcl6, Maf, Cxcr5, Tox2, Faml29b, Klrblc, or 1121.
  • the ex-Tregs have increased expression of genes related to Thl7 cells selected from Rorc, 1117a, or II 17f
  • the present invention includes a method for treating a patient in need of anti-tumor activity, the method comprising the steps of: obtaining or having obtained a biological sample comprising T cells from the patient; determining that the patient has Tregs that are suppressing an immune response to a tumor cell; isolating lymphocytes or bulk CD4+ T cells from the patient; culturing the lymphocytes or bulk CD4+ T cells with an agent that inhibits an activity or expression of one or more Ten-Eleven Translocation (TET) enzymes in the lymphocytes or bulk CD4+ T cells, wherein loss of TET enzyme function converts Tregs in the lymphocytes or bulk CD4+ T cells into ex-Tregs that have T effector-like cell activity; and reintroducing the ex-Tregs into the patient.
  • TET Ten-Eleven Translocation
  • the method further comprises the step of isolating and growing exTreg clones from the treated the lymphocytes or bulk CD4+ T cells prior to reintroducing into the patient.
  • the ex-Tregs activate CD4+, CD8+, or both CD4+ and CD8+ T cells.
  • the patient is a cancer patient.
  • the ex-Tregs provide enhanced activity of immune cells in the patient.
  • the present invention includes a method for treating a patient in need of anti-tumor activity, the method comprising the steps of: obtaining or having obtained a biological sample comprising T cells from the patient; determining that the patient has Tregs that are suppressing an immune response to the tumor; and reducing the activity or expression of one or more Ten-Eleven Translocation (TET) enzymes in the one or more Tregs to form ex-Tregs that have T effector-like cell activity in Tregs in the patient.
  • TET Ten-Eleven Translocation
  • the ex-Tregs activate CD4+, CD8+, or both CD4+ and CD8+ T cells.
  • the patient is a cancer patient.
  • the ex-Tregs provide enhanced activity of immune cells in the patient.
  • the present invention includes a method of converting regulatory T cells (Tregs) into Ten-Eleven Translocation (TET) deficient Treg cells (ex-Treg) in vitro comprising: isolating Tregs from a subject; and culturing the Tregs with an agent that inhibits an activity or expression of one or more TET enzymes in the Tregs, wherein loss of TET enzyme function converts the Tregs into ex- Tregs.
  • the ex-Tregs have decreased foxp3 expression and a decrease in pro-tumorigenic activity.
  • the ex-Tregs have an increased expression of at least one of: Fnl, Eomes, Ccl4, It gam or Xcll. In another aspect, the ex-Tregs have a decreased expression of at least one of: Nrpl, Ikzf4, Ikzf2, Ccr6, Rnase4, or Xdh. In another aspect, the agent transiently or permanently reduces the activity or expression of the one or more TET enzymes. In another aspect, the agent that inhibits expression of the one or more TET enzymes is a polynucleotide that suppresses or prevents the expression of the one or more TET enzymes.
  • the polynucleotide that inhibits expression of the one or more TET enzymes is selected from at least one of: RNAi, CRISPR, aptamer, shRNA, bifunctional shRNA, microRNA, antisense, siRNA, or a ribozyme.
  • the agent that inhibits the activity of the one or more TET enzymes is selected from l-([l,l'-biphenyl]-3-yl)-4- amino-5-chloropyrimidin-2(lH)-one (Bobcat339), S-2-hydroxyglutarate (S-2HG), L-2-hydroxyglutarate (L-2HG), C35, N-oxalylglycine (NOG) and dimethyl methyl fumarate (DMF), or TETi76.
  • the ex-Tregs are further modified to express a chimeric antigen receptor.
  • the ex- Tregs activate CD4 + , CD8 + , or both CD4 + and CD8 + T cells.
  • the ex-Tregs have increased expression of genes related to Tfh selected from Gzmb, Pdcdl, Bcl6, Maf, Cxcr5, Tox2, Faml29b, Klrblc, or 1121.
  • the ex-Tregs have increased expression of genes related to Thl7 cells selected from Rorc, 1117a, or II 17f
  • the present invention includes a method of making Ten-Eleven Translocation (TET) deficient Treg cells (ex-Treg) comprising obtaining one or more Treg clones and exposing the Treg clones to an agent that reduces an activity or expression of one or more TET enzymes in the one or more Treg clones to form ex-Tregs.
  • TET Ten-Eleven Translocation
  • the ex-Tregs have decreased foxp3 expression and a decrease in pro-tumorigenic function.
  • the ex-Tregs have an increased expression of at least one of: Fnl, Eomes, Ccl4, Itgam or Xcll.
  • the ex-Tregs have a decreased expression of at least one of: Nrpl, Ikzf4, Ikzf2, Ccr6, Rnase4, or Xdh.
  • the Tregs are allogeneic, syngeneic or isogenic.
  • an agent transiently or permanently reduces the activity or expression of the one or more TET enzymes.
  • the agent that inhibits expression of the one or more TET enzymes is a polynucleotide that suppresses or prevents the expression of the one or more TET enzymes.
  • the polynucleotide that inhibits expression of the one or more TET enzymes is selected from at least one of: RNAi, CRISPR, aptamer, shRNA, bifunctional shRNA, microRNA, antisense, siRNA, or a ribozyme.
  • the ex- Tregs activate CD4 + , CD8 + , or both CD4 + and CD8 + T cells.
  • the ex-Tregs have increased expression of genes related to Tfh selected from Gzmb, Pdcdl, Bcl6, Maf, Cxcr5, Tox2, Faml29b, Klrblc, or 1121.
  • the ex-Tregs have increased expression of genes related to Thl7 cells selected from Rorc, 1117a, or II 17f
  • the ex-Tregs are further modified to express a chimeric antigen receptor.
  • the present invention includes a Ten-Eleven Translocation (TET) deficient Treg cell (ex-Treg) made by a method comprising culturing Tregs with an agent that inhibits an activity or expression of one or more TET enzymes in the Tregs, wherein the inhibition of the activity or expression of one or more TET enzymes in the Tregs converts the Tregs to ex-Tregs that have T effector cell-like activity.
  • the ex-Tregs have decreased foxp3 expression and a decrease in pro- tumorigenic function.
  • the ex-Tregs have an increased expression of at least one of: Fnl, Eomes, Ccl4, Itgam or Xcll.
  • the ex-Tregs have a decreased expression of at least one of: Nrpl, Ikzf4, Ikzf2, Ccr6, Rnase4, or Xdh.
  • the agent transiently or permanently reduces the activity or expression of the one or more TET enzymes.
  • the agent that inhibits expression of the one or more TET enzymes is a polynucleotide that suppresses or prevents the expression of the one or more TET enzymes.
  • the agent is a polynucleotide that inhibits expression of the one or more TET enzymes is selected from at least one of: RNAi, CRISPR, aptamer, shRNA, bifunctional shRNA, microRNA, antisense, siRNA, or a ribozyme.
  • the agent that inhibits the activity of the one or more TET enzymes is selected from l-([l,l'-biphenyl]-3-yl)-4- amino-5-chloropyrimidin-2(lH)-one (Bobcat339), S-2-hydroxyglutarate (S-2HG), L-2-hydroxyglutarate (L-2HG), C35, N-oxalylglycine (NOG) and dimethyl methyl fumarate (DMF), or TETi76.
  • the ex-Tregs are further modified to express a chimeric antigen receptor.
  • the ex- Tregs activate CD4 + , CD8 + , or both CD4 + and CD8 + T cells.
  • the ex-Tregs have increased expression of genes related to Tfh selected from Gzmb, Pdcdl, Bcl6, Maf, Cxcr5, Tox2, Faml29b, Klrblc, or 1121.
  • the ex-Tregs have increased expression of genes related to Thl7 cells selected from Rorc, 1117a, or II 17f
  • the present invention includes a method for treating a patient in need of anti-tumor activity, the method comprising the steps of: obtaining or having obtained a biological sample comprising T cells from the patient; determining that the patient has Tregs that are suppressing an immune response to a tumor cell; isolating Tregs from a subject; culturing the Tregs with an agent that inhibits an activity or expression of one or more Ten-Eleven Translocation (TET) enzymes in the Tregs, wherein loss of TET enzyme function converts the Tregs into ex-Tregs that have T effector-like cell activity; and reintroducing the ex-Tregs into the patient.
  • TET Ten-Eleven Translocation
  • the ex-Tregs activate CD4+, CD8+, or both CD4+ and CD8+ T cells.
  • the patient is a cancer patient.
  • the ex-Tregs provide enhanced activity of immune cells in the patient.
  • the present invention includes a method for treating a patient in need of anti-tumor activity, the method comprising the steps of: obtaining or having obtained a biological sample comprising T cells from the patient; determining that the patient has Tregs that are suppressing an immune response to the tumor; isolating Tregs from a subject; obtaining one or more Treg clones and reducing the activity or expression of one or more Ten-Eleven Translocation (TET) enzymes in the one or more Treg clones to form ex-Tregs that have T effector-like cell activity; and reintroducing the ex- Tregs into the patient.
  • TET Ten-Eleven Translocation
  • the ex-Tregs activate CD4+, CD8+, or both CD4+ and CD8+ T cells.
  • the patient is a cancer patient.
  • the ex-Tregs provide enhanced activity of immune cells in the patient.
  • FIGS. 1A to IE show RNA-seq analysis for Treg cells isolated from WT or
  • FIG. 1A IPA analysis of canonical pathways for differentially expressed genes in Tet2/3 DKO Treg cells (14-weeks old). Categories related to DNA repair (rows 1, 5, 6, 8 and 9) DNA damage and cell cycle; categories related to immune cell function (rows 2-4, 10-13); category related to cancer (row 7).
  • FIG. IB Left panel, Representative flow cytometry analysis of BrdU incorporation in CD4 + Foxp3 + Treg cells in spleen and pLN from WT and
  • FIG. 1C are heatmaps showing expression (row z score of log2 TPM values) of Tfh-related genes in WT and DKO Tregs ( left panel ) and of Tfh and Thl7 related genes for WT and DKO
  • FIG. ID shows flow cytometry analysis of CXCR5 + PD-1 + Tfh cells (gated on CD4 + TCR + T cells) in the spleen and mLN of WT and DKO mice.
  • FIG. IE Flow cytometry analysis of GL7 + CD95 + germinal center B cells (gated on CD19 +
  • FIGS. 2A to 2F show the presence of WT Treg cells fails to rescue the inflammatory phenotype DKO mice.
  • FIG. 2C Schematic illustration for the generation of mixed bone marrow chimeras.
  • FIG. 2E Representative flow cytometry analysis for WT and DKO mixed bone marrow chimeras 18-20 weeks after transfer.
  • FIG. 2F Representative flow cytometry analysis for WT and DKO mixed bone marrow chimeras 18-20 weeks after transfer.
  • Statistical analysis was performed using two-tailed unpaired student’s t test (*P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001,
  • FIGS. 3A and 3B show fate mapping experiments show that Tet2/3 DKO Treg cells are less stable than Treg cells from heterozygous littermates.
  • FIG. 3A shows representative lineage tracing of
  • Treg cells in spleen and mLN from littermate mice of and genotypes Left panels, Contour plots showing that
  • FIG. 4A shows the hierarchical clustering of RNA-seq data for CD4+ naive T cells, WT Treg cells and Tet2/3 DKO Treg cells (two replicates for CD4+ naive T cells and four replicates for WT and Tet2/3 DKO Treg cells).
  • FIG. 4B shows examples of gene expression levels of Fnl, Eomes, Ccl4, Itgam, and Xcll in CD4+ naive T cells, WT Treg and Tet2/3 DKO Treg cells.
  • the Y-axis shows the FPKM (Fragment Per Kilobase per Million reads), the X-axis shows the different cell types.
  • FIG. 4A shows the hierarchical clustering of RNA-seq data for CD4+ naive T cells, WT Treg cells and Tet2/3 DKO Treg cells (two replicates for CD4+ naive T cells and four replicates for WT and Tet2/3 DKO Treg cells).
  • FIG. 4C shows expression levels of Treg signature genes Foxp3, Nrpl, Ikzf4, Ctla4, Ikzf2, Ccr6, Rnase4, and Xdh in ThO and iTreg cells differentiated under various conditions.
  • the Y-axis shows FPKM (Fragment Per Kilobase per Million reads), the X-axis shows the different cell types.
  • FIG. 4C shows that K-means clustering of genes differentially expressed in pairwise comparisons between CD4 + naive T cells, WT Treg and Tet2/3 DKO Treg cells. The number of genes in each cluster is shown on the left.
  • 4D shows expression levels of Treg signature genes Foxp3, Nrpl, Ikzf4, Ctla4, Ikzf2, Ccr6, Rnase4, and Xdh in CD4 + naive T cells, WT Treg and Tet2/3 DKO Treg cells.
  • the Y-axis shows FPKM (Fragment Per Kilobase per Million reads), the X-axis shows the different cell types.
  • FIGS. 5A and 5C shows CAR TILs lacking both Tet2 and Tet3 suppressed tumor growth.
  • FIG. 5 A shows a flowchart of experiment.
  • FIG. 5B shows tumor growth rates in individual mice.
  • FIG. 5C shows tumor sizes at day 22.
  • FIGS. 6A and 6B shows that L-2HG is a more potent TET inhibitor than the oncometabolite D- 2HG.
  • FIG. 6A shows thin-layer chromatography assay for TET1 activity. D-2HG partially, and L-2HG completely, inhibits 5hmC production by recombinant TET1 when tested at 50 mM.
  • FIG. 6B shows the quantification of the assay in A.
  • FIGS. 7A to 7C shows substantial suppression of tumor growth by CAR TILs depleted of L2HGDH.
  • FIG. 7A is a flowchart of experiment.
  • FIG. 7B shows tumor growth rates in individual mice.
  • FIG. 7C shows tumor sizes at day 22. Each point represents a recipient mouse.
  • the present disclosure describes that the increased proliferation of TET-deficient cells and their increased “stem-like” characteristics can be turned to good account during anti-tumor responses.
  • the inventors have found that inhibition of TET enzymes in CD4 and CD8 T cells, using at least three different approaches, results in enhanced antitumor immune responses against solid tumors.
  • TET deficiency in T regulatory (Treg) cells results in decreased expression of the Treg-specific lineage-determining transcription factor Foxp3 and decreased immunosuppressive activity against other tumor-infiltrating immune cells, resulting in an overall increase in immune anti-tumor activity.
  • Treg cells from Tet2/3 n n Foxp3 Cre mice were more prone to lose Foxp3 expression and become “ex-Treg” cells.
  • TET deficiency in Treg cells resulted in a dominant inflammatory outcome, as the ex-Tregs acquired effector functionality and also conferred inflammatory function on endogenous host CD4 + and CD8+ T cells.
  • the present disclosure provides that TET loss-of-function in many different subtypes of tumor-infiltrating T cells confers improved responses against solid tumors.
  • T cell refers to a lymphocyte involved in antigen-specific adaptive immune response and maturated in the thymus. T cells are commonly classified as naive T cells which are T cells that have never contacted antigens before and mature T cells which have met antigens and memory T cells may be included. T cells are further subcategorized at taught herein.
  • effector T cell refers to a cell which can differentiate into a variety of T cells capable of performing a specific immune response, e.g., a helper T cell, a cytotoxic T cell, or a natural killer T cell.
  • the term "regulatory T cell” or “Treg” refer to a T cell that inhibits activity of activated immune cells and has immune regulatory function. Tregs have a role in immune tolerance, and the regulatory T cell includes a natural regulatory T cell (nTeg), an induced regulatory T cell (iTreg) and a stabilized regulatory T cell.
  • the natural regulatory T cell having an immuno-suppressive function is a CD4+CD25+ T cell expressing Foxp3 (foxhead box P3), and is produced in the thymus expressing IL-10 and presents in the frequency of 5 to 10% among peripheral CD4+ T cells in a normal individual.
  • Induced regulatory T cells exhibits immuno-suppressive effect, expresses Foxp3 by self-stimulation or the stimulation of foreign antigens and differentiates in the periphery under a particular environment. Tregs play an important role in the immuno-suppression on the mucosal surface.
  • the term "antigen" is an agent that is recognized (i.e. bound by) an antibody and/or a T cell receptor.
  • the latter is normally only possible when the antigen is presented in the context of an MHC Class I or II molecule and after being processed by an antigen presenting cell such as a macrophage or a dendritic cell.
  • an antigen presenting cell such as a macrophage or a dendritic cell.
  • This means that relatively large polypeptides may be antigens even though they do not directly bind a T cell receptor but since shorter peptides that are products of antigen presenting cell-processing are recognized by T cell receptors, such proteins are nevertheless termed "antigens”.
  • an "immunogen” is a type of antigen, which is capable of eliciting a specific adaptive immune response that targets the antigen, i.e. immunogens are able to induce the production by the animal body of the antibodies and T cells that recognize antigens. This is in contrast to "haptens", which denote antigens that are not themselves capable of inducing an immune response but which are capable of being recognized by antibodies and/or T-cell receptors.
  • protein antigens include protein antigens, polypeptide antigens, polypeptide immunogens, “peptide antigens”, and “peptide immunogens”, which are each characterized by comprising, consisting essentially of, or consisting of a protein, polypeptide or peptide, which in itself is an antigen or immunogen.
  • proteins protein
  • polypeptide oligopeptide
  • peptide a polypeptide and protein typically is of a larger size (e.g. >100 amino acid residues)
  • an oligopeptide has between 10 and 100 amino acid residues
  • a peptide is an even shorter molecule
  • the present description and claims will as a rule indicate the relevant length of the proteins, polypeptides, oligopeptides and peptides disclosed herein.
  • These molecules are characterized by being constituted of multiple amino acid residues linked via peptide bonds.
  • a "protein” is also meant to designate a biomolecule comprising or consisting of at least one polypeptide, oligopeptide, or peptide, but which optionally may include other molecular entities, such as prosthetic groups, sugars, lipids, and various other derivatizations of the side groups in the amino acid chain(s).
  • the human adult protein hemoglobin is composed of 4 (2+2) polypeptides (2 identical a chains and 2 identical 13 chains), which are each tightly associated to a heme group (a prosthetic group).
  • an “epitope” refers to a region or part of an antigen, such as a poly(peptide) or protein disclosed herein, that elicits an immune response when administered to a subject.
  • An epitope may be a T cell epitope, i.e., an epitope that elicits, stimulates, induces, promotes, increases or enhances a T cell activity, function or response; for example a Th2 cell epitope.
  • Any peptide or combination of peptides of interest can be analyzed to determine whether they include at least one T cell epitope using any number of assays known in the art (e.g. T cell proliferation assays, lymphokine secretion assays, T cell non-responsiveness studies, etc.).
  • immune response includes T cell (cellular) mediated and/or B cell (humoral) mediated immune responses, or both cellular and humoral responses.
  • exemplary immune responses include T cell responses, such as Treg responses resulting in cytokine production and/or cellular cytotoxicity.
  • immune response includes responses that are indirectly affected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g., eosinophils, macrophages.
  • Immune cells involved in the immune response include lymphocytes, such as T cells (CD4+, CD8+, Thl and Th2 cells, memory T cells, regulatory T cells) and B cells; antigen presenting cells (e.g., professional antigen presenting cells such as dendritic cells, macrophages, B lymphocytes, Langerhans cells, and non-professional antigen presenting cells such as keratinocytes, endothelial cells, astrocytes, fibroblasts, oligodendrocytes); natural killer (NK) cells; and myeloid cells, such as macrophages, eosinophils, mast cells, basophils, and granulocytes.
  • T cells CD4+, CD8+, Thl and Th2 cells, memory T cells, regulatory T cells
  • B cells antigen presenting cells
  • professional antigen presenting cells such as dendritic cells, macrophages, B lymphocytes, Langerhans cells
  • non-professional antigen presenting cells such as keratin
  • biological sample refers to materials obtained from or derived from a subject or patient.
  • a biological sample includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histological purposes.
  • samples include bodily fluids such as blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, and the like), sputum, tissue, cultured cells (e.g., primary cultures, explants, and transformed cells) stool, urine, synovial fluid, joint tissue, synovial tissue, synoviocytes, fibroblast-like synoviocytes, macrophage-like synoviocytes, immune cells, hematopoietic cells, fibroblasts, macrophages, T cells, etc.
  • a biological sample is typically obtained from a eukaryotic organism, such as a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish.
  • a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish.
  • the present invention includes inhibitors against the expression and/or activity of TET proteins.
  • a method to inhibit TET enzymes includes the use of inhibitory nucleic acids can be a single- stranded sequence, or form a double- or triple-stranded sequence.
  • an inhibitory nucleic acid is a micro-RNA (miRNA), siRNA, shRNA, trans-splicing RNA, antisense RNA or triplex forming RNA.
  • Inhibitory, antisense, siRNA (small interfering RNA), miRNA (micro RNA), shRNA (small hairpin RNA), RNAi and antisense oligonucleotides can modulate expression of a target protein encoding gene for one or more of the TET enzymes, thereby modulating an immune response, such as a regulatory T cell (Treg) response, activity or function.
  • Treg regulatory T cell
  • Such molecules include those able to inhibit expression of a target gene involved in mediation of a disease process, thereby reducing, inhibiting or alleviating one or more symptoms of a disease.
  • Antisense includes single, double or triple stranded polynucleotides and peptide nucleic acids (PNAs) that bind RNA transcript or DNA (e.g., genomic DNA). Oligonucleotides derived from the transcription initiation site of a target gene, e.g., between positions -10 and +10 from the start site, are another particular example. Triplex forming antisense can bind to double strand DNA thereby inhibiting transcription of the gene. "RNAi" is the use of single or double stranded RNA sequences for inhibiting gene expression (see, e.g., Kennerdell et ah, Cell 95:1017 (1998); and Fire et ak, Nature, 391:806 (1998)).
  • Double stranded RNA sequences from a target gene coding region may therefore be used to inhibit or prevent gene expression/transcription in accordance with the methods and uses of the invention.
  • Antisense and RNAi can be produced based upon nucleic acids encoding target protein (e.g., as set forth in Table 1).
  • a single or double stranded nucleic acid e.g., RNA
  • target protein encoding gene e.g., as in Table 1).
  • siRNA refers to a therapeutic molecule involved in the RNA interference process for a sequence-specific post-transcriptional gene silencing or gene knockdown.
  • siRNAs have homology with the sequence of the cognate mRNA of the targeted gene.
  • Small interfering RNAs can be synthesized in vitro or generated by ribonuclease III cleavage from longer dsRNA and are the mediators of sequence -specific mRNA degradation.
  • siRNA or other such nucleic acids of the invention can be chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
  • the siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.
  • Specific siRNA constructs for inhibiting mRNA of a target gene may be between 15-50 nucleotides in length, and more typically about 20-30 nucleotides in length. Such nucleic acid molecules can be readily incorporated into various vectors for introduction into cells using conventional methods known to one of skill in the art.
  • RNA molecules or synthesis reagents Commercial suppliers of synthetic RNA molecules or synthesis reagents include Applied Biosystems (Foster City, Calif., USA), Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, Ill., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).
  • Chemical inhibitors of TET enzymes include, e.g., l-([l,F-biphenyl]-3-yl)-4-amino-5- chloropyrimidin-2(lH)-one (Bobcat339), S-2-hydroxyglutarate (S-2HG), L-2-hydroxyglutarate (L-2HG), C35, N-oxalylglycine (NOG) and dimethyl methyl fumarate (DMF), or TETi76, or combinations thereof.
  • fusion refers to sequences that contains one or more portions that are based upon, derived from, or obtained or isolated from, two or more different proteins or nucleic acids, i.e. are heterologous with respect to each other. That is, for example, a portion of the sequence may be based upon or from one particular protein or nucleic acid, and another portion of the sequence may be based upon or from a different protein or nucleic acid.
  • a fusion or chimeric sequence is a molecule in which different portions of the sequence are of different origins.
  • One such example is a chimeric antigen receptor (CAR), which can be used to modify a T cell, which after expression of the CAR are commonly referred to as CAR-T cells (CART), and which modify the targeting of the T cell.
  • CAR chimeric antigen receptor
  • Responses, disorders and diseases also include, without limitation, immune responses, immune disorders and diseases, inflammatory responses, or inflammatory disorders and diseases.
  • Responses, disorders and diseases also include, without limitation, autoimmune responses, disorders and diseases.
  • Responses additionally include T cell (e.g., Th* cell) response, function, activity, proliferation, or differentiation.
  • T cell e.g., Th* cell
  • the normal response or activity of a Treg is to dampen or reduce the activity of an effector T cell.
  • the term "subject” includes animals, typically mammalian animals, such as but not limited to humans (newborns, infants, toddlers, children, adults), non-human primates (apes, gibbons, chimpanzees, orangutans, macaques), domestic animals (dogs and cats), farm animals (horses, cows, goats, sheep, pigs), and experimental animals (mouse, rat, rabbit, guinea pig).
  • Subjects include animal disease models.
  • Subjects include naturally occurring or non-naturally occurring mutated or non-human genetically engineered (e.g., transgenic or knockout) animals.
  • Subjects further include animals having or at risk of having a chronic or acute condition, disorder or disease.
  • an “amount sufficient” or “amount effective,” in the appropriate context, can refer to therapeutic or prophylactic amounts.
  • Therapeutically or prophylactically sufficient or effective amounts mean an amount that, in a given subject, detectably improves the condition, disorder or disease, such as an inflammatory condition, disorder or disease, as assessed by one or more objective or subjective clinical endpoints appropriate for the condition, disorder or disease. Sufficiency or effectiveness of a particular treatment can be ascertained by various clinical indicia and endpoints.
  • the terms “treat,” and “therapy” refers to a method that provides an objective or subjective (perceived) improvement in a subjects' condition, disorder or disease, or an adverse symptom associated with the condition, disorder or disease.
  • Non-limiting examples of an improvement can therefore reduce or decrease the probability, susceptibility or likelihood that the subject so treated will manifest one or more symptoms of the condition, disorder or disease, or reducing the immune dampening activity of a Treg to cause an immune response, e.g., against a cancer cell.
  • any compound or agent e.g., drug
  • therapy or treatment having a beneficial, additive, synergistic or complementary activity or effect (beneficial or therapeutic) can be used in combination with the ex-Tregs of the invention.
  • a “second compound” or “second agent” refers to any compound or agent (e.g., drug) that is not the first compound or agent of the recited composition.
  • compositions can be formulated to be compatible with a particular route of administration.
  • Compositions for parenteral, intradermal, or subcutaneous administration can include a sterile diluent, such as water, saline, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents.
  • the preparation may contain one or more preservatives to prevent microorganism growth (e.g., antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose).
  • preservatives to prevent microorganism growth e.g., antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose).
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants such as ascorbic acid or sodium bisulfite
  • compositions for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and polyetheylene glycol), and suitable mixtures thereof.
  • Fluidity can be maintained, for example, by the use of a coating such as lecithin, or by the use of surfactants.
  • Antibacterial and antifungal agents include, for example, parabens, chlorobutanol, phenol, ascorbic acid and thimerosal.
  • Including an agent that delays absorption, for example, aluminum monostearate and gelatin, can prolong absorption of injectable compositions.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays, inhalation devices (e.g., aspirators) or suppositories.
  • the active compounds are formulated into ointments, salves, gels, creams or patches.
  • compositions, methods and uses in accordance with embodiments herein, including polypeptide sequences, subsequences, variants and derivatives, polymorphisms, treatments, therapies, combinations, agents, drugs and pharmaceutical formulations can be packaged in dosage unit form for ease of administration and uniformity of dosage.
  • dosage unit form refers to physically discrete units suited as unitary dosages treatment; each unit contains a quantity of the composition in association with the carrier, excipient, diluent, or vehicle calculated to produce the desired treatment or therapeutic (e.g., beneficial) effect.
  • the unit dosage forms will depend on a variety of factors including, but not necessarily limited to, the particular composition employed, the effect to be achieved, and the pharmacodynamics and pharmacogenomics of the subject to be treated.
  • TET proteins Loss of TET proteins in regulatory T cells unleashes effector function.
  • TET enzymes oxidize 5- methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) and other oxidized methylcytosines, mediating DNA demethylation and serving as new epigenetic marks.
  • the inventors demonstrate the role of TET proteins in Foxp3 + regulatory T (Treg) cells, a distinct lineage of CD4+ T cells that prevent autoimmunity and maintain immune homeostasis.
  • LSL LoxP-STOP-LoxP
  • a strong transcriptional stop site is flanked by two LoxP sites and inserted into the Rosa26 locus ahead of the cDNA sequence encoding YFP, ensuring that YFP expression is turned on only in Cre -expressing cells.
  • CD8 + T cells in Tet2/3 ⁇ Foxp3 ⁇ re DKO mice developed an aberrant dominant effector phenotype, which could not be suppressed by the presence of wildtype Treg cells in heterozygous females or in mixed bone marrow chimeras.
  • These data demonstrate the essential role of TET-mediated epigenetic modifications not only in maintaining the demethylated status of the Foxp3 CNS1 and CNS2 enhancers, thereby stabilizing Foxp3 expression, specifying Treg cell lineage and conferring stable Treg identity, but also in preventing indirectly the acquisition of aberrant effector function by bystander CD4 + and CD8 + T cells with otherwise normal TET function.
  • ex-Tregs In addition to simply losing suppressive function, ex-Tregs appear to be prone to acquire effector function. Again, the underlying mechanisms are not yet completely clear, but it is known that mice with Treg perturbations frequently compensate for insufficiency of T regulatory function by becoming hyperproliferative and hyperactivated. For instance, ex-Tregs arising as a result of deficiency in the mTOR-signaling regulator TSC1 produce increased levels of IL-17 and acquire Thl7 effector features under inflammatory conditions; and neuropilinl -deficient Treg cells produce high levels of IFNy, which feeds back to suppress Treg cell function 11.
  • Tet2/3 deficiency leads to increased expression of genes related to Tfh and/or Thl7 cell differentiation, both in CD4+Foxp3- T cells which include both exTregs and CD4+ bystander cells, and in CD4+Foxp3+ Treg cells.
  • mice Foxp3YFP-Cre mice, Congenic mice (strain B6.SJL-PtprcaPepcb/BoyJ) and scurfy mice were obtained from Jackson Laboratory. Tet2fl/flTet3fl/flFoxp3Cre mice were generated by the inventors by crossing Tet2fl/flTet3fl/fl with Foxp3Cre mice.
  • Tet2+/flTet3fl/flFoxp3Cre or Tet2fl/flTet3+/flFoxp3Cre female mice were crossed with Tet2fl/flTet3fl/flRosa26-YFP+ male mice to generate Tet2fl/flTet3fl/flFoxp3CreRosa26-YFP+ male mice for further analysis. All breeding and experiments were reviewed and approved by the Institutional Animal Care and Use Committee of the La Jolla Institute for Allergy and Immunology.
  • CD4 anti-mouse antibodies CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61), CD44 (IM7), CD45.1 (A20), CD45.2 (104), Nrpl (3E12), ICOS (C398.4A), CD103 (2E7), GITR (YGITR765), PD1 (29F.1A12), CD127 (A7R34), CD69 (H1.2F3).
  • Tfh and germinal center B cells For analysis of Tfh and germinal center B cells, single-cell suspensions were stained with anti-mouse antibodies TC3 ⁇ 4]3 (H57-597), CD19 (6D5), CXCR5 (L138D7), PD1 (29F.1A12), GL7 (GL7) and CD95 (Fas, Jo2).
  • TC3 ⁇ 4]3 H57-597
  • CD19 6D5
  • CXCR5 L138D7
  • PD1 29F.1A12
  • GL7 GL7
  • CD95 Fas, Jo2
  • intracellular staining cells were surface-stained and then stained with anti- Foxp3 (FJK-16S, eBioscience), anti-Helios (22F6) and anti-CTLA4 (UC104.89) antibodies (Biolegend) using the Foxp3 Fixation/Permeabilization kit (eBioscience) and analysed by flow cytometry.
  • BrdU incorporation assay Mice were injected with lmg of BrdU (IOOmI of lOOmg/ml stock solution) intraperitoneally. 24 hours later, mice were sacrificed and the cells from spleen and peripheral lymph nodes were stained for surface markers and then for BrdU according to the manufacturer’s protocol (BD Pharmingen, APC BrdU flow kit 552598).
  • Bone marrow cells were obtained from tibia and fibula from Foxp3Cre WT mice, Tet2/3fl/flFoxp3Cre mice and CD45.1 congenic mice. Erythrocytes and mature T cells were then depleted from the bone marrow cells using MACS LS columns.
  • the purified cells (2.5 xlO 6 ) from Foxp3Cre WT and Tet2/3fl/flFoxp3Cre mice were then mixed together with cells (2.5 10 f ) isolated from tibia and fibula from CD45.1 congenic mice at 1:1 ratio and transferred intravenously (i.v.) into lethally-irradiated CD45.1 congenic mice. Reconstituted mice were then sacrificed for analysis 14 to 20 weeks after adoptive transfer of bone marrow cells.
  • Scurfy CD4+ T cell adoptive transfer Scurfy CD4+ T cells were isolated from spleen and peripheral lymph nodes from male Scurfy mice and purified using Dynabeads (Life Tech, purity > 98%). 5x105 CD45.1+CD4+ scurfy T cells were injected into Rag 1 -deficient mice alone or mixed with 1x105 Treg cells isolated from Foxp3Cre WT or Tet2/3fl/flFoxp3Cre mice. 4 to 5 weeks after adoptive transfer, the percentage of CD45.1+CD4+ cells and CD45.2+ CD4+Foxp3+ cells were analyzed by flow cytometry. Alternatively, the inventors used bone marrow cells from scurfy mice, Foxp3Cre WT or Tet2/3fl/flFoxp3Cre mice for the adoptive transfer.
  • Tet2/3 DKO CD4+ T cell adoptive transfer Total CD4+ T cells were isolated from spleen and peripheral lymph nodes from CD45.2+ Tet2/3fl/flFoxp3Cre mice and double purified using Dynabeads (Life Tech, purity > 98.5%). 5> ⁇ 10 6 CD4+ T cells were adoptively transferred into immunocompetent congenic mice and analyzed 7 to 9 weeks after adoptive transfer. As a control, total CD4+ T cells isolated from CD45.2+ Foxp3Cre WT mice were also transferred into immunocompetent congenic mice, which did not show any cell expansion.
  • RNA-seq and TCR-seq analysis were mapped against the UCSC mouse genome mm9 using TopHat2 51 (v2.1.1) with the following parameters “-p 16 -N 2 —max-multihits 1 —read-gap- length 1 —transcriptome -index ” and the RefSeq gene annotation was obtained from the UCSC genome Bioinformatics database. The number of reads mapping to each gene was counted using featureCounts 52 (subread- 1.4.3-pl) with the following parameters “-g gene_name -s 2”.
  • DEGs Differentially expressed genes between WT and Tet2/3 DKO cell types were determined using the Bioconductor package DESeq2 53 with adjusted P value ⁇ 0.05 and a fold change threshold of > 1.5 or ⁇ 0.67. And genes with total counts ⁇ 1 in the sum of all conditions were removed from the analysis. Canonical pathway analysis was performed using Ingenuity Pathway Analysis software (license for La Jolla Institute).
  • Tet2 forward primer AACCTGGCTACTGTCATTGCTCCA SEQ ID NO: 1
  • Tet2 reverse primer ATGTTCTGCTGGTCTCTGTGGGAA SEQ ID NO: 2
  • Tet3 forward primer GTCTCCCCAGTCCTACCTCCG SEQ ID NO: 3
  • Tet3 reverse primer GTCAGTGCCCCACGCTTCA SEQ ID NO:4
  • Foxp3 forward primer GGCCCTTCTCCAGGACAGA SEQ ID NO: 5
  • Foxp3 reverse primer GCTGATCATGGCTGGGTTGT SEQ ID NO:6
  • HPRT forward primer CTGGTGAAAAGGACCTCTCG SEQ ID NO:7
  • HPRT reverse primer TGAAGTACTCATTATAGTCAAGGGCA SEQ ID NO: 8
  • Enzymes of the TET family are Fe(II) and 2-oxoglutarate-dependent dioxygenases that catalyze sequential oxidation of the methyl group of 5-methylcytosine (5mC) in DNA to 5-hydroxymethylcytosine (5hmC) and the further oxidized products 5-formalcytosine (5fC) and 5-carboxylcytosine (5caC).
  • These modified bases are intermediates in DNA demethylation as well as potential epigenetic marks capable of recruiting reader proteins that exert specific functions.
  • TET1, TET2 and TET3 are three mammalian TET proteins, TET1, TET2 and TET3, of which TET2 and TET3 are most highly expressed in cells of the immune and hematopoietic systems.
  • TET enzymes utilize 2-oxoglutarate (20G), Fe (II) and molecular oxygen to generate their oxidized products, with C0 and succinate formed as byproducts.
  • the enzymatic activity of TET proteins can be modulated by diverse factors, including the ambient levels of oxygen (hypoxia versus normoxia) and diverse metabolic enzymes that modulate the intracellular levels of either 20G itself or its competitive inhibitor 2-hydroxyglutarate (2HG).
  • Both stereoisomers of 2HG are inhibitors of TET proteins and other dioxygenases, with the D (or S( ) ) stereoisomer being significantly more potent than the L (or R(-)) form.
  • Treg function To determine the role of TET proteins in Treg function, the inventors compared the transcriptional profiles of endogenous WT and TET-deficient Treg cells with those of naive CD4 + T cells. Floxed exons 8-10 of Tet2 and exon 2 of Tel 3 were efficiently deleted in Treg cells isolated from 7 'e 12 fl 1 'e i 3 11 fl CD4( 're ( Tet2/3 DKO) mice compared to WT Tregs, as shown by RNA-seq. Naive CD4 + T cell replicates clustered together, as did replicates for WT and Tet2/3 DKO Treg cells (FIG. 4A).
  • K- means clustering of the 3,008 genes differentially-expressed in the three endogenously-differentiated cell types identified genes specifically expressed in CD4 + naive T cells (cluster 1), genes highly expressed in WT Treg cells compared to CD4 + naive T cells but less expressed in Tet2/3 DKO Tregs (clusters 2, 3), and genes expressed at low levels in naive CD4 + T cells and WT Treg cells, but highly expressed in Tet2/3 DKO Treg cells (clusters 4, 5) (FIG. 4A).
  • the selected Treg signature genes shown in FIG. 4C as being differentially expressed in in vvVra-diffcrcntiatcd T cells are also shown in FIG.
  • GSEA Gene set enrichment analysis
  • genes suppressed by ectopic expression of Foxp3 in conventional T cells 35 genes downregulated in WT Treg cells compared to naive T cells and genes downregulated in WT Treg cells compared to Tet2/3 DKO Treg cells, were underrepresented in iTregs generated with TGFp + VitC or TGFp + RA + VitC compared to iTregs differentiated with TGFp or TGFp + RA alone.
  • genes involved in DNA damage, DNA repair (Brcal, Atm, Rad50) and cell cycle (Cdknla, Cdkn2a, Hipk2) (rows 1, 5, 6, 8 and 9); genes implicated in immune cell function such as the antigen presentation pathway (H2-Aa, H2-Ab and H2-Ebl), Thl and Th2 activation pathways, etc. (rows 2-4, 10-13); and genes related to molecular mechanisms of cancer (row 7).
  • Tet2/3 DKO Treg cells The majority of cell cycle-related genes were upregulated in Tet2/3 DKO Treg cells, prompting the inventors to assess the proliferation of Tet2/3 DKO Treg cells in vivo.
  • the inventors injected WT and Tet2/3fl/flFoxp3Cre DKO mice with BrdU, a thymidine analog that is incorporated into newly synthesized DNA during replication, and analyzed Treg cells 24 h later. Indeed, Tet2/3 DKO Treg cells incorporated significantly more BrdU compared to WT Treg cells (FIG. IB).
  • FIG. ID shows flow cytometry analysis of CXCR5 + PD-1 + Tfh cells
  • FIG. IE Flow cytometry analysis of GL7 + CD95 + germinal center B cells (gated on CD19 + B cells) in the spleen and mLN of WT and 7 'e (23 ⁇ ⁇ h ' oxp ⁇ re DKO mice.
  • Statistical analysis was performed using two-tailed unpaired student’s t test (*P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001, ****P ⁇ 0.0001). Data are mean ⁇ S.D. from two to three independent experiments.
  • FIGS. 5A and 5C shows CAR TILs lacking both Tet2 and Tet3 suppressed tumor growth.
  • FIG. 5A shows a flowchart of the experiment. Unfractionated splenocytes from Tet2 fl/fl Tet3 fl/fl Cre-ERT2 Rosa26-YFP LSL mice were stimulated with anti-CD3/ anti-CD28 and retrovirally transduced on each of the following two days to express the anti-huCD19 CAR (transduction efficiency >70%).
  • FIG. 5B shows tumor growth rates in individual mice.
  • FIG. 5C shows tumor sizes at day 22. Each point represents a recipient mouse.
  • mice adoptively transferred with Tet2/3 fl/fl CAR T cells and then treated with tamoxifen four showed strikingly slowed tumor growth and one showed clear tumor regression and survived past the experimental period of 30 days; in contrast, control mice receiving Tet2/3 fl/fl CAR T cells without tamoxifen treatment, or WT CAR T cells with tamoxifen treatment, showed rapid tumor growth very similar to that of mice receiving PBS but no CAR T cells.
  • FIGS. 6A and 6B shows that L-2HG is a more potent TET inhibitor than the oncometabolite D- 2HG.
  • Both L- and D- stereoisomers inhibit TET enzymes and other aKG dependent dioxygenases, including the JmjC family of lysine demethylases and the prolyl hydroxy-lases PHD 1-3/ EGLN1-3 which regulate expression of the hypoxia-inducible transcription factors HIFla and HIF2a; however, L-2HG is a far more potent inhibitor than D-2HG.
  • FIG. 6A Thin-layer chromatography assay for TET1 activity. D-2HG partially, and L-2HG completely, inhibits 5hmC production by recombinant TET1 when tested at 50 mM.
  • FIG. 6B Quantification of the assay in A.
  • FIGS. 7A to 7C shows substantial suppression of tumor growth by CAR TIFs depleted of F2HGDH.
  • Unfractionated splenocytes from C57BF/6N mice were stimulated on day 0 with anti-CD3 and anti-CD28, retrovirally transduced on each of the following two days with virus encoding the anti- huCD19 CAR as well as with a pool of either non-targeting shRNAs (shNT) or shRNAs against L2HGDH, and selected for puromycin resistance.
  • shNT non-targeting shRNAs
  • shRNAs shRNAs against L2HGDH
  • FIG. 7A is a flowchart of experiment.
  • FIG. 7B shows tumor growth rates in individual mice.
  • FIG. 7C shows tumor sizes at day 22. Each point represents a recipient mouse.
  • mice receiving .v/?/.2//(77)//-transduccd CAR T cells showed decreased tumor growth rate and survived beyond 30 days, whereas 2 of 5 mice receiving CAR T cells transduced with non-targeting shRNAs (shNT) succumbed before day 22 and the remainder before day 30.
  • shNT non-targeting shRNAs
  • TET deficient CAR T cells suppress tumor growth, where TET deficiency is induced by TET2/3 knockout AND inhibition of F-2HG treatment.
  • the CAR T cells were 'unfractionated splenocytes', which contain a heterogeneous population of T cells, including CD4+ T cells.
  • the present invention can start with isolated lymphocytes, isolated CD4+ cells, or isolated Tregs, as the source of lymphocytes.
  • mice Foxp3-eGFP reporter mice (strain 006769) were originally obtained from Jackson Faboratory and further backcrossed to B6/C57 background for more than 10 generations. Tei ⁇ Tei 111 Foxp3-eGFP mice and lel2 II II lel3 1111 Foxp3-eGFP CD4-Cre mice were generated by the inventors using B6/Taconic background “Artemis” ES cells. All mice were on the B6 background and maintained in a specific pathogen-free animal facility in the Fa Jolla Institute for Immunology. Age and sex of the mice used for each experiment was stated in the methods. All animal procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the Fa Jolla Institute for Immunology and were conducted in accordance with institutional guidelines.
  • RNA-seq library preparation For WT and Tet2/3 DKO Treg samples, CD4 + eGFP + Treg cells were sorted from 3-weeks old Tet ⁇ Tet ⁇ Foxp3-eGFP CD4-Cre mice and Tet ⁇ Tet ⁇ Foxp3-eGFP littermate control mice (males).
  • ThO cells and iTreg cells C D4 cG F P C D25 C D62 L'A’ D44 l0 naive T cells were sorted from Foxp3-eGFP reporter mice (5-6 weeks old, female) and differentiated into ThO cells (activated with anti-CD3 and anti-CD28 antibodies in the absence of polarizing cytokines or neutralizing anti-cytokine antibodies) and iTreg cells under four different conditions: TGFp alone; TGFp + Vitamin C (VitC); TGFp + retinoic acid (RA); TGFp + RA + VitC.
  • eGFP ThO cells and eGFP + iTreg cells were sorted on day 6 after differentiation.
  • iTregs differentiated in the presence of TGFp alone for 6 days were harvested and sorted for Foxp3 (eGFP) + population. Cells were counted and plated at 0.8 c 10 6 cells per ml for restimulation with plate bound anti-CD3 at 50 ng/ml and anti-CD28 at 25 ng/ml. On day 6 after restimulation, Foxp3 (eGFP) population was sorted and used for RNA-seq.
  • RNA- sequencing libraries were prepared using Truseq stranded mRNA kit (Illumina) according to the manufacture’s protocol. Libraries were pooled in equal quantity and sequenced using Illumina HiSeq 2500 (Illumina) as 50-base-pair paired end reads (for WT and Tet2/3 DKO Treg samples), 125-base-pair paired end reads (for ThO and iTreg samples) or sequenced using Illumina NovoSeq 6000 (Illumina) as 50-base-pair single end read (for restimulation experiments).
  • RNA-seq analysis Processing of RNA-seq data was performed as follows: RNA-seq FASTQ files were quality and adapter trimmed using Trim Galore (vO.4.2) prior to mapping to the UCSC mouse genome mm9 using Tophat2 (v2.1.1) with the following parameters “-p 8 -N2” and the UCSC mm9 KnownGenes gtf transcript file. BAM files from Tophat where sorted with Samtools (vl.7) and duplicates were marked with PICARD (v2.5.0; http://broadinstitute.github.io/picard).
  • GSEA v4.0.2 Gene set enrichment analysis
  • CD4 + eGFP + Treg cells were sorted from 3-weeks old Tet ⁇ Tet ⁇ Foxp3-eGFP CD4-Cre mice and Tet ⁇ Tet ⁇ Foxp3-eGFP littermate control mice (females).
  • CD4 + eGFP CD25 CD62L hl CD44 l0 naive T cells were sorted from Foxp3-eGFP reporter mice (5-6 weeks old, male) and differentiated into ThO cells and iTreg cells under four different conditions: TGFp alone; TGFp + Vitamin C (VitC); TGFp + retinoic acid (RA); TGFp + RA + VitC.
  • TGFp alone TGFp + Vitamin C (VitC); TGFp + retinoic acid (RA); TGFp + RA + VitC.
  • TGFp + Vitamin C VitC
  • RA retinoic acid
  • TGFp + RA + VitC TGFp + RA + VitC.
  • eGFP ThO cells and eGFP + iTreg cells were sorted on day6 after differentiation.
  • ATAC-seq analysis ATAC-seq FASTQ files were quality and adapter trimmed using Trim Galore (vO.4.2) prior to mapping to the UCSC mouse genome mm9 using Bowtie2 (v2.2.6) with default parameters. Mapped SAM files were converted to BAM and putative PCR duplicates were marked with Samtools (vl.7). Regions of chromatin accessibility were determined using MACS2 (v2.1.0.20151222) with the following settings “-g mm -q 0.01”. The union of accessible regions in all samples were determined using the ‘GenomicRanges’ package (vl .36.1) in R and data was normalized to reads in peaks per million (RPM).
  • Differentially accessible regions were determined using EdgeR (v3.26.6) with a maximum FDR of 0.05 and a minimum fold-change of 2.
  • K-means clustering was performed using the ‘kmeans’ function of the stats package in R (v3.6.1) and plotted using the custom code similar to the heatmap2 function in R.
  • Genome plots were made with custom R code using the ‘rtracklayer’ package (vl.44.4) 65 .
  • ATAC-seq data for Naive CD4 T cells made use of ImmGen samples GSM2692322 and GSM2692323, which were used for comparison but not included in differential analyses.
  • Transcription factor motifs were determined using the scanMotifGenomeWide.pl script of HOMER software and motifs enriched in differentially accessible regions were determined by Fisher’s exact test with FDR correction.
  • CD4 + eGFP + CD25 + WT Treg cells and CD4 + eGFP CD25 CD62L I "CD44 I ° naive T cells were sorted from Foxp3-eGFP reporter mice (5-6 weeks old, male).
  • CD4 + eGFP CD25 CD62F hl CD44 l0 naive T cells were sorted from Foxp3-eGFP reporter mice (5-6 weeks old, male) and differentiated into iTreg cells under TGFp alone and TGFp + RA + VitC conditions.
  • eGFP + iTreg cells were sorted on day6 after differentiation.
  • DNA with ligated adaptors was then treated with sodium bisulfite (MethylCode, Thermo Fisher Scientific) for 4hrs, denatured and immunoprecipitated with anti-CMS serum (input samples were reserved as 1% of total DNA before immunoprecipitation).
  • Samples for immunoprecipitated DNA and input DNA were then purified using Phenol/Chloroform and amplified with index primers using KAPA HiFi HotStart Uracil+ Ready Mix (KAPA Biosystems).
  • KAPA Biosystems KAPA HiFi HotStart Uracil+ Ready Mix
  • the samples after PCR amplification were then purified using Ampure XP Beads (Beckman Coulter) and sequenced as 50- or 100-base-pair paired end reads using Illumina Hiseq 2500 (Illumina).
  • the spike-in amplicons were generated using lambda phage DNA as template and with dNTP mix or 5-Hydroxymethylcytosine dNTP mix (Zymo Research), respectively. Therefore, the cytosines in the C amplicon were unmethylated (used to monitor the bisulfite conversion efficiency), while the cytosines in the 5hmC amplicon were 5-hydroxymethylated (used for normalization of the number of reads to the global content of 5hmC levels in different samples).
  • P represents the average proportion of 5hmC reads of all CMS-IP or all input samples.
  • a final 5hmC normalization ratio (L/Q was calculated by correcting the 5hmC normalization ratio of CMS-IP samples (N c ) by the 5hmC normalization ratio for their respective input samples (N t ) as follows:
  • CMS-IP reads were normalized for reads per million multiplied by the final 5hmC normalization ratio (Nf).
  • a normalization ratio of 1 was used for input samples.
  • the resultant normalization reflected the global content of 5hmC in each sample.
  • Regions of enriched 5hmC were determined using MACS2 (v2.1.0.20151222) with the following settings “-g mm —broad -q 0.01” 63 .
  • the union of 5hmC enriched regions were determined using the ‘GenomicRanges’ package (vl.36.1) in R and differentially accessible regions were determined using EdgeR (v3.26.6) with an FDR ⁇ 0.05 and a fold-change >2.
  • WGBS library preparation For WT Treg and CD4 + naive T cell samples, CD4 + eGFP + CD25 + Treg cells and E04 + e0RR E025u062E w E044 10 naive T cells were sorted from Foxp3-eGFP reporter mice (5-6 weeks old, male). For Tet2/3 DKO Treg sample, CD4 + eGFP + CD25 + Treg cells were sorted from Tel2 , ⁇ , ⁇ Tel3 , ⁇ , ⁇ Foxp3-eGFP CD4-Cre mice (3-weeks old, male).
  • CD4 + eGFP CD25 CD62L I "CD44 I ° naive T cells were sorted from Foxp3-eGFP reporter mice (5-6 weeks old, male) and differentiated into iTreg cells under TGFp alone and TGFp + RA + VitC conditions.
  • eGFP + iTreg cells were sorted on day6 after differentiation.
  • Genomic DNA was isolated using PureFink Genomic DNA Mini Kit (ThermoFisher Scientific, K182001) or FlexiGene DNA Kit (Qiagen, 51206). Unmethylated lambda DNA (Promega, D1521) was spiked into the genomic DNA samples at a ratio of 1:200 to monitor the bisulfite conversion efficiency. The samples were then sheared using Covaris S2, purified with Ampure XP beads (Beckman Coulter) and processed with NEBNext End Repair and dA-Tailing Modules (NEB), and ligated to methylated Illumina Adaptors using NEBNext Quick Figation Module (NEB).
  • NEB NEBNext End Repair and dA-Tailing Module
  • DNA with ligated adaptors was then treated with sodium bisulfite (MethylCode, Thermo Fisher Scientific) for 4hrs and amplified with index primers using KAPA HiFi HotStart Uracil+ Ready Mix (KAPA Biosystems).
  • KAPA Biosystems KAPA HiFi HotStart Uracil+ Ready Mix
  • the samples after PCR amplification were then purified using Ampure XP Beads (Beckman Coulter) and sequenced as 125- or 250-base-pair paired end reads using Illumina Hiseq 2500 (Illumina).
  • WGBS analysis WGBS FASTQ files were quality and adapter trimmed using Trim Galore (vO.4.2) prior to mapping to the in silico bisulfite converted UCSC mouse genome mm9 using Bismark (v0.19.0) to call Bowtie2 (v2.2.6).
  • Mapped BAM files were sorted with Samtools (vl.7) and CpG methylation calls were extracted. CpG methylation calls were collapsed to one strand and DNA methylation coverage was determined as CpGs with >5x coverage per group resulting in DNA methylation data at 18,531,012 CpGs with an average coverage of 14.9x per CpG per sample (range 11.7x - 17.8x).
  • Differentially methylated loci were determined using DSS (v2.32.0) where significance was determined by an FDR ⁇ 0.05 and a mean CpG methylation difference of 0.2.
  • CD4 + CD25 CD62F hl CD44 lo eGFP naive T cells were FACS sorted from spleen and lymph nodes of Foxp3-IRES-eGFP reporter mice (6- to 8-week-old), and differentiated into iTregs with plate-bound anti-CD3 (clone 2C11) and anti-CD28 (clone 37.51) antibodies at 1 pg/ml in the presence of 2 ng/ml recombinant human TGFp (Peprotech) and lOOU/ml rhIF-2.
  • retinoic acid RA, sigma
  • Vitamin C Vitamin C
  • CD4 + naive T cells were sorted and labeled with the proliferation dye cell trace violet (Thermo Fisher Scientific) and differentiated into iTreg cells in the presence of TGFp alone or TGFp + RA + VitC at different concentration of rhIL-2 (0, 1, 5, 10, 25, 50, 75 and lOOU/ml).
  • the percentage of Foxp3 (eGFP) + cells, the percentage of viable cells (assessed using eBioscience fixable viability dye eFluor780) and cell proliferation (assessed using the cell proliferation dye cell trace violet) were monitored from day 2 to day 9 after differentiation.
  • CD4 + CD25 CD62L hi CD44 lo eGFP naive T cells and CD4 + Foxp3 (eGFP) + or CD4 + Foxp3 (eGFP) + CD25 + Treg cells are as following (Clone name, conjugated fluorescence, dilution, manufacturer and catalog number shown in brackets): CD4 (RM4-5, PerCP-Cy5.5, 1:200, Biolegend, #100540); CD25 (PC61, APC, 1:200, Biolegend, #102012); CD62L (MEL-14, BV421, 1:400, Biolegend, #104436); CD44 (IM7, PE, 1:200, Biolegend, #103008).
  • IL2R subunits For analysis of the expression levels of IL2R subunits from day 3 to day 6 after primary differentiation of iTregs in the presence of TGFp alone or TGFp + RA + VitC, single-cell suspensions were stained with anti-mouse antibodies against the following: CD4 (RM4-5, PerCP-Cy5.5, 1:200, Biolegend, #100540); IL2Ra/CD25 (PC61, Pacific Blue, 1:200, Biolegend, #102021); IL2Rp/CD122 (TM-pi, PE, 1:75, Biolegend, #123209); IL2Ry/CD132 (TUGm2, APC, 1:75, Biolegend, #132307).
  • CD4 RM4-5, PerCP-Cy5.5, 1:200, Biolegend, #100540
  • IL2Ra/CD25 PC61, Pacific Blue, 1:200, Biolegend, #102021
  • IL2Rp/CD122 TM-pi,
  • the membrane was washed with 2X SSC buffer, air-dried and vacuum-baked at 80°C for 2hrs, then blocked with 5% non-fat milk for 1 hour and incubated with anti-CMS antibody (1:3,000) overnight at 4°C. After incubating with HRP-conjugated anti-rabbit IgG secondary antibody, the membrane was visualized by enhanced chemiluminescence.
  • STAT5 phosphorylation To assess STAT5 phosphorylation in iTreg cells differentiated in the presence of TGFp alone or TGFp + RA + VitC, iTreg cells were collected and washed on day 6 after differentiation, 1.5 to 2X10 6 cells were plated in 100pL culture medium in a round-bottom 96-well plate. The cells were rested for 1 hour at 37C, then mixed with 100pL of 2X IL-2 cytokine mix to get a final concentration of OU/ml, 3U/ml, 5U/ml, lOU/ml and lOOU/ml of IL-2. The cells were then restimulated with IL-2 at 37°C for 1 hour.
  • cells were fixed with 4% Paraformaldehyde (Electron Microscopy Sciences) at room temperature for 10 minutes.
  • the fixed cells were washed twice with MACS buffer and permeabilized by adding 100pL of ice-cold True-Phos Perm Buffer (Biolegend) and incubated for at least 1 hour at -20°C.
  • the cells were then washed twice with MACS buffer, stained with mouse anti-Stat5 (pY694) (Clone: 47/Stat5 (pY694); AlexaFluor 647; lOuL/assay; catalog #612599; BD Biosciences) and analyzed by flow cytometry on LSR-II.
  • the cells were then washed twice with washing buffer (lOmM Tris-HCl pH8.0, 200mM NaCl, ImM EDTA and 0.5mM EGTA), once with shearing buffer (lOmM Tris-HCl pH8.0, ImM EDTA, 1% SDS).
  • washing buffer lOmM Tris-HCl pH8.0, 200mM NaCl, ImM EDTA and 0.5mM EGTA
  • shearing buffer lOmM Tris-HCl pH8.0, ImM EDTA, 1% SDS.
  • nuclei were resuspended in shearing buffer in 1.5ml Bioruptor Pico Microtubes (5X10 6 cells/ lOOpL) and sonicated using Bioruptor Pico sonication device (Diagenode) for 10 cycles (30 sec ON/30 sec OFF per cycle).
  • RNA-seq, ATAC-seq, CMS-IP and WGBS data will be deposited in the Gene Expression Omnibus database with the accession number GSE141152.
  • the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps.
  • compositions and methods may be replaced with “consisting essentially of’ or “consisting of’.
  • the term “consisting” is used to indicate the presence of the recited integer (e.g., a feature, an element, a characteristic, a property, a method/process step or a limitation) or group of integers (e.g., feature(s), element(s), characteristic(s), property(ies), method/process steps or limitation(s)) only.
  • the phrase “consisting essentially of’ requires the specified features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps as well as those that do not materially affect the basic and novel characteristic(s) and/or function of the claimed invention.
  • A, B, C, or combinations thereof refers to all permutations and combinations of the listed items preceding the term.
  • “A, B, C, or combinations thereof’ is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB.
  • expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth.
  • the skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
  • words of approximation such as, without limitation, “about”, “substantial” or “substantially” refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present. The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skill in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of approximation such as “about” may vary from the stated value by at least ⁇ 1, 2, 3, 4, 5, 6, 7, 10, 12 or 15%.
  • compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
  • each dependent claim can depend both from the independent claim and from each of the prior dependent claims for each and every claim so long as the prior claim provides a proper antecedent basis for a claim term or element.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hematology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des procédés et des compositions pour convertir des lymphocytes T régulateurs (Treg) en des lymphocytes Treg déficients pour la translocation dix-onze (abrégé TET de l'anglais «ten-eleven translocation ») (ex-Treg) in vitro comprenant : l'isolation des Treg d'un sujet; et la culture des Treg avec un agent qui inhibe l'activité ou l'expression d'une ou de plusieurs enzymes TET dans les Treg, la perte de la fonction enzymatique de TET convertissant les Treg en ex-Treg.
PCT/US2021/017949 2020-02-14 2021-02-12 Perte de protéines tet dans des lymphocytes t régulateurs libérant une fonction effectrice WO2021163555A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202062976706P 2020-02-14 2020-02-14
US62/976,706 2020-02-14

Publications (1)

Publication Number Publication Date
WO2021163555A1 true WO2021163555A1 (fr) 2021-08-19

Family

ID=77292963

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/017949 WO2021163555A1 (fr) 2020-02-14 2021-02-12 Perte de protéines tet dans des lymphocytes t régulateurs libérant une fonction effectrice

Country Status (1)

Country Link
WO (1) WO2021163555A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019108796A1 (fr) * 2017-11-29 2019-06-06 The Cleveland Clinic Foundation Composés modulant tet2 antitumoraux
WO2019217423A1 (fr) * 2018-05-07 2019-11-14 The Regents Of The University Of California Compositions et procédés pour modifier des lymphocytes t régulateurs

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019108796A1 (fr) * 2017-11-29 2019-06-06 The Cleveland Clinic Foundation Composés modulant tet2 antitumoraux
WO2019217423A1 (fr) * 2018-05-07 2019-11-14 The Regents Of The University Of California Compositions et procédés pour modifier des lymphocytes t régulateurs

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHUA GABRIELLA N. L., WASSARMAN KELLY L., SUN HAOYU, ALP JOSEPH A., JARCZYK EMMA I., KUZIO NATHANAEL J., BENNETT MICHAEL J., MALAC: "Cytosine-based TET Enzyme Inhibitors", ACS MEDICINAL CHEMISTRY LETTERS, vol. 10, no. 2, 14 February 2019 (2019-02-14), pages 180 - 185, XP055847318, ISSN: 1948-5875, DOI: 10.1021/acsmedchemlett. 8b00474 *
LIO CHAN-WANG J., RAO ANJANA: "TET Enzymes and 5hmC in Adaptive and Innate Immune Systems", FRONTIERS IN IMMUNOLOGY, vol. 10, 210, 12 February 2019 (2019-02-12), pages 1 - 13, XP055847314, DOI: 10.3389/fimmu.2019.00210 *
YUE XIAOJING, LIO CHAN-WANG J., SAMANIEGO-CASTRUITA DANIELA, LI XIANG, RAO ANJANA: "Loss of TET2 and TET3 in regulatory T cells unleashes effector function", NATURE COMMUNICATIONS, vol. 10, no. 1, 1 December 2019 (2019-12-01), pages 1 - 14, XP055847303, DOI: https://doi.org/10.1038/s41467-019-09541-y *

Similar Documents

Publication Publication Date Title
Cortes et al. RHOA G17V induces T follicular helper cell specification and promotes lymphomagenesis
Trowbridge et al. Innate immune pathways and inflammation in hematopoietic aging, clonal hematopoiesis, and MDS
Tsai et al. Insulin receptor-mediated stimulation boosts T cell immunity during inflammation and infection
Camara et al. Lymph node mesenchymal and endothelial stromal cells cooperate via the RANK-RANKL cytokine axis to shape the sinusoidal macrophage niche
Li et al. E3 ligase VHL promotes group 2 innate lymphoid cell maturation and function via glycolysis inhibition and induction of interleukin-33 receptor
Oh et al. An NF-κB transcription-factor-dependent lineage-specific transcriptional program promotes regulatory T cell identity and function
Schmidleithner et al. Enzymatic activity of HPGD in Treg cells suppresses Tconv cells to maintain adipose tissue homeostasis and prevent metabolic dysfunction
Pattanaik et al. Pathogenesis of systemic sclerosis
Hwang et al. B cell TLR7 expression drives anti-RNA autoantibody production and exacerbates disease in systemic lupus erythematosus–prone mice
Yoshimi et al. Gene disruption study reveals a nonredundant role for TRIM21/Ro52 in NF-κB-dependent cytokine expression in fibroblasts
Myers et al. Tonic LAT-HDAC7 signals sustain Nur77 and Irf4 expression to tune naive CD4 T cells
Luong-Gardiol et al. γ-catenin-dependent signals maintain BCR-ABL1+ B cell acute lymphoblastic leukemia
Miller et al. Meis1 is required for adult mouse erythropoiesis, megakaryopoiesis and hematopoietic stem cell expansion
Choudhary et al. Telomere and telomerase in stem cells: relevance in ageing and disease
JP2014001231A (ja) 炎症性皮膚疾患、障害または症状のための医薬組成物および診断方法
Manils et al. CARD14E138A signalling in keratinocytes induces TNF-dependent skin and systemic inflammation
Abdul Qayum et al. The Il9 CNS-25 regulatory element controls mast cell and basophil IL-9 production
Haljasorg et al. Irf4 expression in thymic epithelium is critical for thymic regulatory T cell homeostasis
AU2019269318A1 (en) Manipulating ARID5B expression in immune cells to promote metabolism, survival, and function
US20140288149A1 (en) Mir-142 and antagonists thereof for treating disease
US20220054548A1 (en) Mirna for use in therapy
US20070116681A1 (en) Ex vivo and in vivo methods and related compositions for generating hematopoietic stem cell populations
US20070048293A1 (en) Manipulation of PTEN in T cells as a strategy to modulate immune responses
Popović et al. Control of GM-CSF–Dependent Dendritic Cell Differentiation and Maturation by DEF6 and SWAP-70
WO2021163555A1 (fr) Perte de protéines tet dans des lymphocytes t régulateurs libérant une fonction effectrice

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21753541

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21753541

Country of ref document: EP

Kind code of ref document: A1