WO2021156846A1 - Antibacterial compositions for preventing antibiotic resistance in bacteria by inhibition of sos response - Google Patents

Abstract

Provided herein are compounds having formula I (MDRD1) and formula II (MDRD2) for use in preventing resistance against antibiotics in bacteria. The compounds MDRD1 and MDRD2 effectively inhibit autoproteolysis of LexA protein in bacteria thereby inhibiting SOS response in bacteria and preventing resistance against antibiotics. Provided herein also are methods and compositions for preventing resistance against antibiotics in bacteria. The compounds MDRD1 and MDRD2 can also be administered along with antibiotics in humans and animals, as antibiotic adjuvants to prevent antibiotic resistance.

Description

Antibacterial Compositions for Preventing Antibiotic Resistance in Bacteria by

Inhibition of SOS response

Field of Invention The present invention provides method for preventing resistance against antibiotics in bacteria. The present invention relates to antibacterial compositions for prevention of antibiotic resistance in bacterial species found in the hospital environment. Particularly, the present invention relates to antibacterial compositions comprising chemical compounds having ability to inhibit LexA autoproteolysis to prevent or reverse the development of antibiotic resistance.

Background of the Invention

Multidrug resistant organisms (MDRO) play a major role in causation of 30-70% of Hospital Acquired Infections (HAI). The highest rates of HAI are associated with the use of medical devices and longer stay in hospital. Body fluids from patients with infection can cause surface, water and air contamination in hospital rooms. Pathogenic bacteria can survive in the hospital environment for long periods of time. Prevalence of MDRO parallels the administration of multiple antibiotics and prolonged therapy durations due to selection of resistant bacteria. Transmission of resistant organisms between patients is facilitated by several factors such as medical devices, patient handling by medical personnel, inadequate hand hygiene, resistance to disinfectants and surface persistence. Routine and terminal cleaning practices and even automated disinfection systems cannot prevent HAI with 100% effectiveness.

The rising incidence of MDR due to associated high mortality rates is the major concern. As an effective approach, the mortality associated with resistant infections in HAI can only be reduced if existing antibiotics can be made effective again by preventing or reversing resistance. Common clinically relevant multidrug-resistant bacteria include multidrug-resistant (MDR) Mycobacterium tuberculosis, extended spectrum β-lactamase producing enterobacteriaceae bacteria (ESBL), carbapenemase producing Enterobacteriaceae (CPE, KPC), vancomycin-resistant enterococci (VRE), multidrug-resistant Acinetobacter baumannii (MRAB), vancomycin-resistant Staphylococcus aureus (VRSA), methicillin-resistant S. aureus (MRSA), etc.

Antibiotic resistance is a widespread and troubling phenomenon and a major cause of mortality and morbidity in humans and animals who are infected by resistant bacteria. There are multiple mechanisms by which bacteria adapt to adverse environmental conditions allowing their survival. These inherent adaptation and survival mechanisms allow bacteria to overcome the effects of antibiotics. Most antibiotics in current use are of bacterial origin and bacteria may have intrinsic ability to resist any one or several antibiotics. On the other hand, clinically relevant antibiotic resistance is acquired when bacteria are exposed to antibiotics during treatment of infections or when antibiotics are present in the environment as contaminants or waste.

Resistance mechanisms acquired following antibiotic exposure may be mediated by chromosomal alterations induced by mutations (mutational resistance). Bacteria may acquire antibiotic resistance even when not directly exposed to antibiotics. This is mediated by exchange of resistance determining genes by the processes of conjugation (F pilus mediated), transformation (transfer of naked DNA) and transduction (phage mediated). These processes are collectively called horizontal gene transfer. Bacterial gene mutations encode multiple bacterial resistance mechanisms. Some mutations alter the target sites of antibiotics, others encode factors that prevent antibiotics from binding to its target. Examples are mutations in DNA gyrase and topoisomerase IV prevent fluoroquinolone binding, rifampicin resistance due to rpo gene mutations. Plasmid encoded Qnr protein protects the target sites of fluoroquinolones. Tet-O and Tet-M proteins dislodge tetracycline from its ribosomal binding site. Chromosomal mutations and horizontal gene transfer give rise to the multidrug resistance phenotype with resistance developing to multiple antibiotics. The SOS response is a conserved bacterial adaptive response to DNA damage caused by agents such as UV irradiation, antibiotics, chemicals, reactive oxygen species produced during metabolic activity inside the bacterial cell. Single stranded DNA (ssDNA) accumulates during DNA damage. The recombination promoting protein RecA associates with ssDNA and then becomes an inducer of the SOS response. The SOS response regulator protein Lex A binds to RecA/ss DNA. This allows RecA to act as a facilitator of a conformational change in Lex A that brings about cleavage of the Lex A protein. Cleavage separates the N terminal domain (NTD) of Lex A from the C terminal domain (CTD). The NTD of Lex A in the intact protein binds to promoters of several genes in a winged helix form and represses transcription. Upon cleavage of Lex A, the DNA binding is weakened and the NTD is released. This triggers transcription in many genes and results in the SOS adaptive response wherein error prone DNA polymerases of the UMUDC complex attempt to repair DNA. Error prone repair introduces sequence changes in DNA which result in mutations promoting the antibiotic resistance phenotype.

US6068972 discloses methods and compositions for inhibiting the selection and propagation of a bacterial mutant that over expresses an efflux pump an approach for reducing bacterial tolerance to antibacterials, disinfectants and organic solvents. CN101243068B discloses pharmaceutical compositions comprising heterocyclic compounds of formula (I)for the treatment of multi-drug resistant bacterial infections in humans.

EP1674112A1 discloses use of an inhibitor of an AcrAB-like efflux pump for the preparation of a medicament for the treatment of a microbial infection; wherein the microbial infection has resistance to a drug which reduces the growth of the microbe.

W02009140215A2 discloses a method of treating a multidrug resistant bacterial or fungal infection, comprising a pharmaceutical composition that comprises an effective amount of one or more chelating compounds that chelates metal ions essential for function of (i) a bacterial or fungal metal dependent enzyme, (ii) another bacterial or fungal metal -dependent protein, or (iii) another bacterial or fungal metal- dependent biologic activity required for metabolism, multiplication or survival of said bacteria or fungi.

WO2015155549A1 discloses antibacterial and anti-mycobacterial drug compound of formula (I) for treating bacterial infections caused by resistant bacterial or microbial strains.

Several biological mechanisms promote the development of antibiotic resistance in bacteria. One of the mechanisms is bacterial SOS response to DNA damage which is controlled by LexA repressor in which the cell cycle is arrested and DNA repair and mutagenesis is induced. SOS genes are negatively regulated by LexA repressor protein dimers. Activation of the SOS genes occurs after DNA damage by the accumulation of single stranded (ssDNA) regions generated at replication forks, where DNA polymerase is blocked. RecA forms a filament around these ssDNA regions in an ATP-dependent fashion, and becomes activated. The activated form of RecA interacts with the LexA repressor to facilitate the LexA repressor's self-cleavage (autoproteolysis) from the operator. Inhibition of LexA autoproteolysis has been shown to prevent the development of antibiotic resistance as an effective approach to reduce MDR in bacteria residing in hospital environments and to prevent SOS response mediated evolution of resistance mechanisms.

US7592154B2 discloses methods and compositions for the use of modulating agents targeted to the bacterial SOS response, including both the members of the canonical SOS induction pathway (in E. coli i.e. recA, lex A, sfiA) and members of the dpi operon.

W02005056754A2 discloses methods and compositions for inhibition of drug resistance comprising achaogens, agents that inhibit a mutational process by binding to a gene product of RecA, RecB, RecC, RecD, RecF, RecG, Rec N, LexA, UmuC, UmuD, PolB, PolLV, PolV, PriA, RuvA, RuvB, RuvC, UmuC, UmuD, UvrA, UvrB, UvrD by covalently or non-covalently.

US7455840B2 discloses a method of inhibiting the evolution of resistance to a quinolone antibiotic in bacteria comprising administering to the bacteria a quinolone and a composition comprising an agent that inhibits LexA, thereby inhibiting an SOS response pathway in the bacteria. Lex A protein (MEROPS accession MER0000569; MEROPS ID S24.001) is a 202 amino acid protein belonging to the S24 family of serine proteases. The S24 family is characterized by two domains in the protein, that can be separated by autolysis. The two domains in Lex A are the N-terminal domain (NTD) comprising amino acid residues methionine 1 to leucine 69. NTD has DNA binding function, its dimeric form binds to conserved sequences in the promoters of more than 30 genes in E coli repressing transcription. The second domain is the C-terminal domain comprising glycine 75 to asparagine 198. The two domains are connected by a hinge region, amino acids glycine 70 to glutamine 74. The peptidase unit comprises amino acids 85-202.

Autolysis of the repressor Lex A protein occurs when the catalytic dyad comprising Serine 119 and Lysine 156 bring about cleavage of the peptide bond between Alanine 84 and Glycine 85 in the cleavage site region (CSR) comprising residues Glycine 75 to Tyrosine 98. The CTD of Lex A contains nine beta pleated sheets of its secondary structure. The anti parallel beta sheets B3 and B4 flank the residues at position to upstream of position 90 of the cleavage site region while the catalytic dyad lies between the parallel B5 to B9 strands. Hydrogen bonds between B3/B4 and B5/9 maintain the tertiary conformation of this domain structure. Crystal structure of Lex A (Luo et a 2001) reveals two conformational forms of Lex A, in which a loop bearing the scissile bond between Ala84 and Gly 85 is brought within 2.7A⁰ catalytic Seri 19 in the “C” conformation thus enabling cleavage. In the “NC” conformation the scissile bond lies 20 A⁰ away from the catalytic dyad. The conformational change occurs across a hydrophobic cleft on the protein surface and requires rotations around main chain bonds of Val 75, G80, R 81 and changes in the region Gly 85 to Glu 95. The hydrophobic cleft contains several conserved amino acids. In the NC conformation hydrophobic side chains of the CSR amino acids are buried in this region stabilizing this conformation. The Ser 119, Lys 156 catalytic dyad lies at one end of the hydrophobic cleft.

During the cleavage reaction a tetrahedral intermediate called ‘oxyanion hole’ is formed. The Ala 84 oxygen atom lies within hydrogen bonding distance to amide nitrogen of Ser 119 and Met 118. The beta hydroxyl group of Seri 19 forms a strong hydrogen bond with the epsilon amino group of general base Lys 156.

Studies of the crystal structure of Lex A and kinetic models of Lex A autoproteolysis induced by changes in protein conformation and movement of the cleavage loop indicate that when Rec A is activated after DNA damage and association with single stranded DNA, it associates with the residues 75-84 of Lex A stabilizing the C form of Lex A and enhancing the speed of the cleavage reaction (Luo 2001, Hostetler 2020). Dimeric form of Lex A is an efficient substrate for RecA mediated cleavage reaction. An allosteric effect on the cleavable (C) conformation of Lex A may be responsible for enhancing the kinetics of autoproteolytic reaction. (Giese et al 2008). Autoproteolysis of Lex A occurs when a change in protein conformation brings a loop (CSR) containing the scissile bond between Ala84 and Gly 85 close to the catalytic Seri 19. The movement of the loop occurs across a hydrophobic cleft on the protein surface, at one end of which lie Seri 19 and associated general base Lys 156.

Giuseppe Celenza et al (2019) in Life Sciences, hypothesized and verified that small boron -containing compounds are able to efficaciously inhibit the self -cleavage of the transcriptional repressor LexA, presumably via the formation of an acyl -enzyme intermediate as also computed by in silico analysis. It also provided the basis for systematic investigations on the identified molecular scaffolds. The effect of interference of compound 3, the amino phenylboronic derivative, on induced SOS response observed in the whole cell assay in E. coli is encouraging in defining molecules capable to reach the cytoplasmatic target LexA. A literature search was made for chemical inhibitors of serine proteases. Substituted isocoumarins are potent serine protease inhibiters. Novobiocin is an aminocoumarin and is an inhibitor of DNA gyrase and the SOS response in gram positive bacteria. Treatment with novobiocin inhibited Rec A expression when the SOS response was induced with ciprofloxacin (Schroder et al 2012). Novobiocin also inhibits the induction of the error prone DNA polymerase UMUDC complex in Acinetobacter baumani, when there is exposure to UV irradiation, ciprofloxacin, tetracycline antibiotics and development of resistance to rifampicin as a consequence of the SOS response is prevented by novobiocin treatment (Jara et al 2015). Various approaches have been disclosed to inhibit the multidrug resistance (MDR) in bacterial species in the form of pharmaceutical compositions. The present invention relates to inhibition of multidrug resistant organisms (MDRO) prevalently found in hospital surfaces and equipments which are the major causative agents of hospital acquired infection. Application of a formulation comprising a MDR disabler antibacterial compound in hospital environments will reduce the prevalence of MDRO and thus reduce the incidence of hospital acquired infections with multidrug resistant bacteria.

There is an urgent need to control the rising incidence of MDR due to associated high mortality rates.

Objective of the Invention

It is an object of the present invention to provide compounds that can prevent emergence of multidrug resistance (MDR) resistance in bacteria. It is another object of the present invention to provide a composition to mitigate hospital acquired infections (HAI) due to MDR bacteria. It is yet another object of the present invention to provide an antibacterial MDR disabler agent to be used in hospital environment.

It is a further object of the present invention to provide chemical compounds in a formulation that can prevent resistance to antibiotics in bacterial species, when administered in combination with antibiotics as antibiotic adjuvant.

It is also an object of the present invention to provide chemical compounds in a formulation that can inhibit LexA autoproteolysis. Summary of the invention

The following disclosure presents a simplified summary of the invention in order to provide a basic understanding of some aspects of the invention. This summary is not an extensive overview of the present invention. It is not intended to identify the key/critical elements of the invention or to delineate the scope of the invention. Its sole purpose is to present some concept of the invention in a simplified form as a prelude to a more detailed description of the invention presented later.

In an aspect of the present invention, there is provided a method of preventing resistance to antibiotics in bacteria by inhibiting SOS response, comprising treating the bacteria with 4-(1,3-dioxobenzo[de]isoquinolin-2-yl-N-(6-methylpyridine-2-yl) butanamide having formula I.

In another aspect of the present invention, there is provided a method of preventing resistance to antibiotics in bacteria by inhibiting SOS response comprising treating the bacteria with N-[3-(methylcarbamoyl) phenyl]-6-phenyl-1-lpropan-2- ylpyrazolo[3,4-b]pyridine-4-carboxamide having formula II. In a further aspect there is provided use of a compound having formula I for inhibition of SOS response in bacteria against antibiotics by inhibiting autoproteolysis of Lex A.

In a further aspect there is provided use of a compound having formula II for inhibition of SOS response in bacteria against antibiotics by inhibiting autoproteolysis of Lex A.

In yet another aspect there is provided a composition comprising a compound having formula I, wherein the compound having formula I inhibits Lex A protein induced SOS response in bacteria. In yet another aspect there is provided a composition comprising a compound having formula II, wherein the compound having formula II inhibits Lex A protein induced SOS response in bacteria.

In a further aspect there is provided a method for treating hospital surfaces and equipments with a compound of formula I. In a further aspect there is provided a method for treating hospital surfaces and equipments with a compound of formula II.

In another aspect there is provided a combination comprising an antibiotic and a compound having formula I.

In another aspect there is provided a combination comprising an antibiotic and a compound having formula II.

Other aspects, advantages, and salient features of the invention will become apparent to those skilled in the art from the following detailed description, which, taken in conjunction with the annexed drawings, discloses exemplary embodiments of the invention. Brief Description of Accompanying Drawings

The above and other aspects, features and advantages of the embodiments of the present disclosure will be more apparent in the following description taken in conjunction with the accompanying drawings, in which:

Figure 1 (A)Pose 6, illustrates binding pose of MDRD1 in Lex A cleavage site region (Pymol),

Figure 1 (B):Pose 9, illustrates binding pose of MDRD1 in Lex A cleavage site region (Pymol) Figure 2 (A) Pose7, illustrates binding pose of MDRD2 in Lex A cleavage site region (Pymol) Figure 2(B): Pose9 illustrates binding pose of MDRD2 in Lex A cleavage site region (Pymol)

Figure 3 illustrates LDS-PAGE 12% gel electrophoresis of total protein from E coli cell extracts along with protein ladder and positive control. Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample.

Figure 4(A-R) illustrates Lex A inhibition from 10 mins-45 mins after Ciprofloxacin alone or Ciprofloxacin ± MDRD1/2 treatment of E coli cultures.

4(A): 10 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- - Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample). 4(B): 15 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7 & 8- Ciprofloxacin+ MDRD2 treated sample, lane 9- Untreated sample prepared by freeze thaw protocol, 10- Untreated sample), 4(C): 20 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- - Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample). 4(D): 30 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4-

Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7 & 8- Ciprofloxacin+ MDRD2 treated sample, lane 9- Untreated sample.) 4(E): 10 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample) 4(F): 15 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4-

Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9-Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample). 4(G): 20 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- - Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample.). 4(H): 30 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7 & 8- Ciprofloxacin+ + MDRD2 treated sample, lane 10- Untreated sample), 4(1): 10 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample). 4(J): 15 mins after

Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9-Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample). 4(K): 20 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9-Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample). 4(L): 30 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- Ciprofloxacin+ MDRD2 treated sample, lane 10- Untreated sample), 4(M): 40 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- - Ciprofloxacin+ MDRD2 sample, lane 10- Untreated sample, LexA cleavage fragment arise at 11 kDa in lane of Ciprofloxacin only treated samples which is absent in other lanes). 4(N): 40 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- - Ciprofloxacin+ MDRD2 sample, lane 10- Untreated sample, LexA cleavage fragment arise at 11 kDa in lane of Ciprofloxacin only treated samples which is absent in other lanes), 4(N): 40 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9 -Ciprofloxacin+ MDRD2 sample, lane 10- Untreated sample, LexA cleavage fragment arise at 11 kDa in lanes of Ciprofloxacin only treated samples which is absent in other lanes), 4(P): 40 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- - Ciprofloxacin+ MDRD2 sample, lane 10- Untreated sample, LexA cleavage fragment arise at 11 kDa in lanes of Ciprofloxacin only treated samples which is absent in other lanes), 4(Q): 45 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- - Ciprofloxacin+ MDRD2 sample, lane 10- Untreated sample, LexA cleavage band has disappeared after 45 mins of induction), 4(R): 45 mins after Ciprofloxacin ± MDRD1/2 (Lane 1- ladder, lane 3 & 4- Ciprofloxacin treated sample, lane 5 & 6- Ciprofloxacin+ MDRD1 treated sample, lane 7- Positive control, lane 8 & 9- - Ciprofloxacin+ MDRD2 sample, lane 10- Untreated sample, Lex A cleavage band has disappeared after 45 mins of induction.

Figure 5 illustrates Temporal Profile of UMUD gene Expression in E coli after Ciprofloxacin treatment 0.128ug/ml (x4 MIC) Figure 6 illustrates Temporal Profile of RecA gene Expression in E coli after Ciprofloxacin treatment 0.128ug/ml (x4 MIC)

Figure 7 illustrates Gene Expression over time after ciprofloxacin combined with the inhibitor MDRD1

Figure 8 illustrates Gene Expression over time after ciprofloxacin combined with the inhibitors MDRD2

Figure 9 illustrates Rec A Gene Expression in E Coli with Different doses of MDRD2

Figure 10 illustrates UMUD Gene Expression in E coli with Different Doses of MDRD2

Figure 11 illustrates Rec A and UMUD gene expression with different doses of MDRD2

Figure 12 illustrates UMUD gene expression in E. coli with different dose of MDRD1

Figure 13 illustrates UMUD and RecA gene expression in E. coli with different dose of MDRD1 Figure 14 illustrates Rec A gene expression in E Coli treated with Ciprofloxacin 0.128ug/ml (x4 MIC) Mean RQ values 50 min post induction

Figure 15 illustrates Rec A gene expression in E Coli treated with Ciprofloxacin 0.128ug/ml (x4 MIC) Mean RQ values 60 min post induction Figure 16 illustrates UMUD gene expression in E Coli treated with Ciprofloxacin 0.128ug/ml (x4 MIC) Mean RQ values 50 min post induction

Figure 17 illustrates UMUD gene expression in E Coli treated with Ciprofloxacin 0.128ug/ml (x4 MIC) Mean RQ values 60 min post induction Figure 18 illustrates Normalized CT values of Rec A expression 50 mins post - induction. Group 1 Untreated, Group2 Ciprofloxacin alone, Group 3 Cipro+MDRD1 Group 4 Cipro+ MDRD2

Figure 19 illustrates Normalized CT values of Rec A expression 60 mins post - induction. Group 1 Untreated, Group2 Ciprofloxacin alone, Group 3 Cipro+MDRD1 Group 4 Cipro+ MDRD2

Figure 20 illustrates Normalized CT values of UMUD Gene Expression 50 mins post - induction. Group 1 Untreated, Group2 Ciprofloxacin alone, Group 3 Cipro+MDRD1 Group 4 Cipro+ MDRD2

Figure 21 illustrates Normalized CT values of UMUD Gene Expression 60 mins post - induction. Group 1 Untreated, Group2 Ciprofloxacin alone, Group 3 Cipro+MDRD1

Group 4 Cipro+ MDRD2

Figure 22 illustrates UMUD and RecA gene Quantification Results of Real Time PCR Experiments. 22A shows RRSB gene relative standard curve, 22B shows UMUD gene relative standard curve. 22C shows Rec A Relative Standard Curve. 22D shows Rec A amplification Replicate Samples with CIPROFLOXACIN +

MDRD1. 22E shows UMUD Amplification Replicate Samples with CIPROFLOXACIN + MDRD1, 22F shows RecA amplification Replicate Samples with CIPROFLOXACIN + MDRD2, 22G shows UMUD Amplification Replicate Samples with CIPROFLOXACIN + MDRD2, 22H shows UMUD gene responses after SOS induction of E Coli Cultures with only Ciprofloxacin: Time kinetics, 221 shows UMUD gene response time kinetics with MDRD1 (left) & MDRD2(right) + Ciprofloxacin, 22J shows Rec A Delta CT gene expression responses with MDRD1 & MDRD 2 (1-16) samples 50 mins (left) and 60 mins (right)- dose dependent, with or without Ciprofloxacin. 22K shows UMU D Delta CT gene expression responses with MDRD1-50 min (left) & 60 min (right)- dose dependent, with or without Ciprofloxacin. 22L shows UMU D Delta CT gene expression with MDRD2-50 mins (left) & 60 min (right)- dose dependent, with or without Ciprofloxacin

Figure 23 shows culture plating of E. coli cells for biofilm formation after various treatments

Figure 24 shows gram-stained bacilli after 3 days from the wells with biofilm cultures Figure 25 shows culture plating E. coli cells from biofilm cultures after various treatments

Figure 26 shows gram-stained bacilli after 10 days from the wells with biofilm cultures

Figure 27 shows gram-stained bacilli after 3 days from the wells with planktonic cultures

Figure 28 shows gram-stained bacilli after 10 days from the wells with biofilm cultures

Figure 29 shows culture plating E. coli cells from planktonic cultures after various treatments Figure 30 illustrates MH agar plates with E coli cultures, with MIC test strips of different antibiotics

Figure 31 A and 31B and 31C shows means of mutation rates with ciprofloxacin and MDRD1

Figure 32A and 32B shows means of mutation rates with ciprofloxacin and MDRD2 Figure 33 Box and whisker plot showing mutation rates in E Coli treated with ciprofloxacin and MDRD1/ MDRD2

Figure 34A and 34B shows scatter plot of mutation rates of E Coli treated with ciprofloxacin with or without MDRD1/MDRD2 in Biofilm and Planktonic cultures Figure 35A and 35B shows bar diagram of means of zone sizes in MH agar with 5ug ciprofloxacin disc diffusion, in Biofilm and Planktonic E Coli cultures

Persons skilled in the art will appreciate that elements in the figures are illustrated for simplicity and clarity and may not have been drawn to scale. For example, the dimensions of some of the elements in the figure may be exaggerated relative to other elements to help to improve understanding of various exemplary embodiments of the present disclosure.

Description of the Invention

The present invention is directed to compounds or formulations comprising compounds having Lex A repressor activity and methods to prevent resistance against antibiotics in bacteria.

The following description with reference to the accompanying drawings is provided to assist in a comprehensive understanding of various embodiments of the present disclosure as defined by the claims and their equivalents. It includes various specific details to assist in that understanding but these are to be regarded as merely exemplary. Accordingly, those of ordinary skill in the art will recognize that various changes and modifications of the various embodiments described herein can be made without departing from the scope and spirit of the present disclosure. In addition, descriptions of well-known functions and constructions may be omitted for clarity and conciseness. The terms and words used in the following description and claims are not limited to the bibliographical meanings, but, are merely used by the inventor to enable a clear and consistent understanding of the present disclosure. Accordingly, it should be apparent to those skilled in the art that the following description of various embodiments of the present disclosure is provided for illustration purpose only and not for the purpose of limiting the present disclosure as defined by the appended claims and their equivalents.

It is to be understood that the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a component surface" includes reference to one or more of such surfaces.

The terminology used herein is for the purpose of describing particular various embodiments only and is not intended to be limiting of various embodiments. As used herein, the singular forms "a," "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and/or "comprising" used herein specify the presence of stated features, integers, steps, operations, members, components, and/or groups thereof, but do not preclude the presence or addition of one or more other features, integers, steps, operations, members, components, and/or groups thereof. Also, expressions such as "at least one of," when preceding a list of elements, modify the entire list of elements and do not modify the individual elements of the list.

Described herein is a method of inhibiting the multidrug resistance in bacteria. Also described herein are compositions comprising the compounds having such activity of inhibiting the multidrug resistance in bacteria.

Autoproteolysis of Lex A occurs when a change in protein conformation brings a loop (CSR) containing the scissile bond between Ala84 and Gly 85 close to the catalytic Seri 19. The movement of the loop occurs across a hydrophobic cleft on the protein surface, at one end of which lie Seri 19 and associated general base Lys 156. In an embodiment of the present invention, there are provided chemical compounds that can bind to the hydrophobic cleft to prevent movement of the CSR and thus prevent cleavage of the Ala84-Gly85 peptide bond.

In order to locate and define binding sites for potential chemical inhibitors of the Lex A protein, to the present inventors have used the simplest chemical form of coumarin, a compound called isocoumarin as a tool compound to search the crystal structure of the Lex A protein deposited in the Protein Data Bank (PDB). Auto Dock Vina was used to perform blind docking followed by virtual screening which results in an output of a total of 4500 ligands. The ligands with the best poses, visualized in the region of the hydrophobic cleft, forming polar bonds with residues important for conformational change and cleavage were filtered out.

In an embodiment of the present invention there are provided two ligands which bind to Lex A protein and prevent autoproteolysis of Lex A. Present invention provides a compound MDRD1 (4-(1,3-dioxobenzo[de]isoquinolin- 2-yl-N-(6-methylpyridine-2-yl) butanamide) having formula (I) and analogues or derivatives thereof; and a compound MDRD2 (N-[3-(methylcarbamoyl) phenyl]-6- phenyl-1-lpropan-2-ylpyrazolo[3,4-b] pyridine-4-carboxamide) having formula (II) and analogues or derivatives thereof for inhibiting autoproteolysis of Lex A.

Formula I (MDRD 1)

Formula II (MDRD 2)

The compounds MDRD1 and MDRD2 have a similar mode of binding and inhibits Lex A protein autoproteolysis.

Therefore, in an embodiment of the present invention there is provided that the compounds MDRD1 and MDRD2 are potent inhibitor of Lex A protein.

The compounds MDRD1 and MDRD2 bind to the Lex A protein and inhibit autoproteolysis of the Lex A protein. This inhibition of autoproteolysis of the Lex A protein can stop SOS response in bacterial species which is responsible for evolution of resistance mechanisms.

Therefore, in an embodiment there is provided that MDRD1 and MDRD2 inhibit autoproteolysis of the Lex A protein followed by inhibiting SOS response in bacterial species which is responsible for evolution of resistance mechanisms.

The binding of the compounds MDRD1 and MDRD2 with the C terminal domain of Lex A protein prevents the autoproteolytic activity of LexA protein (Figure 1 & 2). Autoproteolysis occurs due to cleavage of the peptide bond between Alanine 84 and Glycine 85 in the C terminal domain of Lex A. Compound MDRD1 forms polar bond with Glycine 80, one of the amino acids important for conformational change during autoproteolysis. Mutation in Glycine 80 has been shown to prevent autoproteolysis in studies. Mode of binding of MDRD1 and polar bond with Glycine 80 will prevent autoproteolysis. Similarly, the mode of binding of MDRD2 and formation of polar bond with Lysine 156 will prevent the nucleophilic activity of Serine 119 and prevent cleavage of the peptide bond between Alanine 84 and Glycine 85 and Lex A autoproteolysis. Mutation in Lysine 156 has been shown to prevent autoproteolysis of Lex A in studies.

The present invention provides the compound MDRD1 and MDRD2 that are effective in binding Lex A protein and prevent the process of SOS response in bacterial cells by inhibiting autoproteolysis.

It was found by the inventors of the present invention that MDRD1 and MDRD2 inhibit the cleavage of native Lex A protein in E. coli when the SOS response is induced by treating E coli cells with ciprofloxacin. Further, it was found by the present inventors that MDRD1 and MDRD2 prevent the increased expression of UMUD and Rec A gene when the SOS response is induced by treating E coli cells with ciprofloxacin.

In one of the embodiments, there is provided method of inhibition of SOS response in bacteria. The present invention provides a method of preventing resistance to antibiotics in bacteria by inhibiting SOS response, comprising treating the bacteria with a compound of formula I or its analogues or derivatives.

The present invention provides a method of preventing resistance to antibiotics in bacteria by inhibiting SOS response comprising treating the bacteria with a compound of formula II or its analogues or derivatives. The compound of formula I and compound of formula II inhibits autoproteolysis of the SOS response regulator protein Lex A. The compound of formula I binds with the Glycine 80 of Lex A protein. The compound of formula II binds with the Lysine 156 of Lex A protein. The method prevents resistance to antibiotics in bacteria wherein the bacteria are selected from gram positive and gram negative bacteria. The gram positive bacteria can be selected from Staphylococcus aureus, Staphylococcus epidermidis and the gram negative bacteria can be selected from E. coli, Pseudomonas aeruginosa, Acinetobacter baumanii, Klebsiella spp, Enterobacter spp, Proteus spp. Not wished to be bound by theory, the list of bacteria may be extended to other bacterial species as well.

In a preferred embodiment, the bacteria is E. coli type strain ATCC 117755.

The antibiotics against which resistance is prevented is selected from fluoroquinolone antibiotics. Not to be limited by theory, the antibiotics against which resistance is prevented is selected from the antibiotics of classes penicillins, cephalosporins, macrolide antibiotics, fluoroquinolones, carbapenems, monobactams and others. In an embodiment, the antibiotics are Ciprofloxacin, Piperacillin tazobactam, Gentamycin, Cefotaxime, Ampicillin.

In an embodiment, there is provided use of the compound of formula I for inhibition of SOS response in bacteria against antibiotics. In an embodiment, there is provided use of the compound of formula II for inhibition of SOS response in bacteria against antibiotics. The inhibition of SOS response in bacteria against antibiotics is brought about by inhibiting autoproteolysis of Lex A.

In an embodiment, there are provided compositions comprising compounds MDRD1 having formula I and compounds MDRD2 having formula II. The present invention provides a composition comprising a compound MDRD1 having formula I and other excipients and diluents, wherein the compound MDRD1 inhibits Lex A protein induced SOS response in bacterial cells.

The present invention provides a composition comprising a compound MDRD2 having formula II and other excipients and diluents, wherein the compound MDRD2 inhibits Lex A protein induced SOS response in bacterial cells.

The present invention provides the composition can be formulated is in the form of liquids, powder, aerosol and sprays.

The present invention further provides the effective concentration of MDRD1 and MDRD2 that can prevent resistance to antibiotics. In an embodiment the effective concentration of MDRD1 and MDRD2 is in the range of 0.1uM to 10uM. In a preferred embodiment, the effective concentration of MDRD1 and MDRD2 is in the range of 1-2 uM and 5-7 uM respectively.

The present invention further provides the excipients and carriers required to formulate the compounds in a formulation.

In an embodiment of the present invention, there is provided that the compounds MDRD1 and MDRD2 are effective in disabling the multidrug resistance (MDR) in hospital acquired infections.

The antibacterial MDR disabler formulation of the present invention provides effective prevention to the high incidence of drug resistant hospital acquired infections. The antibacterial MDR disabler formulation is used in the prevention of antibiotic resistance in bacterial species found in the hospital environment, reason being that such resistant bacteria commonly lead to hospital acquired infections. Due to resistance to antibiotics, treatment of infections in hospitalised patients fails and there is high mortality rate which can be prevented or reversed by the application of the antibacterial MDR disabler formulation. The present invention provides an antibacterial MDR disabler comprising compound MDRD1 wherein the MDR disabler is applied on hospital surfaces and equipments.

The present invention provides an antibacterial MDR disabler comprising compound MDRD2 wherein the MDR disabler is applied on hospital surfaces and equipments. In one embodiment, the antibacterial MDR disabler is a formulation comprising MDRD1 and other excipients and diluents.

In another embodiment, the antibacterial MDR disabler is a formulation comprising MDRD2 and other excipients and diluents. In another embodiment, the antibacterial MDR disabler is a formulation comprisingMDRD1 and Ciprofloxacin and other excipients and diluents.

In another embodiment, the antibacterial MDR disabler is a formulation comprising MDRD2 and Ciprofloxacin and other excipients and diluents

In one embodiment antibacterial MDR disabler formulation is adapted for application on inanimate surfaces in the hospital environment - hard surfaces, floor, walls, furniture, instruments, water outlets, water supply, clothing, mops, basin, buckets, other cleaning equipment, discards, disposables etc.

In one embodiment the antibacterial MDR disabler formulation is in the form of liquids, powder, aerosol and sprays. In an embodiment of the present invention, there is provided use of MDRD1 and MDRD2 in the inhibition of Lex A autoproteolysis such that the antibiotic resistance in bacteria is prevented.

The present invention provides use of MDRD1 in inhibiting SOS response in bacterial cells, wherein the compound inhibits autoproteolysis in LexA protein. The present invention provides use of MDRD2 in inhibiting SOS response in bacterial cells, wherein the compound inhibits autoproteolysis in LexA protein.

The present invention relates to a method for treating hospital surfaces with the compound of formula I (MDRD1). The present invention also relates to a method for treating hospital surfaces with the compound of formula II (MDRD2). Treating hospital surfaces with MDRD1 and MDRD2 lead to prevention of antibiotic resistance developed in the bacteria on such hospital surfaces, which can cause hospital acquired infections.

The compounds of formula I and formula II can also be used along with antibiotics such as ciprofloxacin in animals and humans to overcome resistance against the antibiotics. The present inventors have found that evolution of mutation rates providing resistance to antibiotics can be inhibited by administering the antibiotics with MDRD 1 and MDRD 2.

Therefore, MDRD1 having chemical characteristics of drug like compounds can be used as antibiotic adjuvants for administration as drug for human use in combination with antibiotics like ciprofloxacin. Administration of MDRD1 in combination with antibiotics will prevent the development of resistance to antibiotics like ciprofloxacin. Also, MDRD2 having chemical characteristics of drug like compounds can be used as antibiotic adjuvants for administration as drug for human use in combination with antibiotics like ciprofloxacin. Administration of MDRD2 in combination with antibiotics will prevent the development of resistance to antibiotics like ciprofloxacin.

In an embodiment, the present invention provides a combination of antibiotic and a compound of Formula I to prevent the development of resistance to antibiotics. In another embodiment, the present invention provides a combination of antibiotic and a compound of Formula II to prevent the development of resistance to antibiotics. The combinations can further comprise pharmaceutically active excipients as known in the art.

Advantage of the invention:

The antibacterial MDR disabler formulation of the present invention provides effective prevention to the high incidence of drug resistant hospital acquired infections. The antibacterial MDR disabler formulation is used in the prevention of antibiotic resistance in bacterial species found in the hospital environment, reason being that such resistant bacteria commonly lead to hospital acquired infections. Due to resistance to antibiotics, treatment of infections in hospitalised patients fails and there is high mortality rate which can be prevented or reversed by the application of the antibacterial MDR disabler formulation. The MDR disabler compounds may also be administered along with antibiotics in animals and humans to overcome resistance towards antibiotics. Although the preferred embodiments of the present invention have been described explicitly, the invention is not limited to the above embodiments and has been further described with examples. The examples are intended to be purely exemplary of the invention and should therefore not be considered to limit the invention in any way. Efforts have been made to ensure accuracy with respect to numbers used, but some experimental errors and deviations should be accounted for.

Example 1: Effect of SOS Response Induction and its Inhibition by MDRD1 and MDRD2 on E coli Lex A Protein.

In vivo experiments have demonstrated that E coli cells contain 2.2 uM of the intact Lex A protein. On SOS induction by UV light the protein quantity diminishes and reforms when the SOS induction stimulus is removed. In vitro experimental assays mimicking in vivo SOS activation, using intact Lex A protein, Rec A, ssDNA oligomers and ATP demonstrate cleavage of the intact Lex A and production of smaller fragments of the C terminal and N terminal portions of the intact Lex A. Cleavage fragments can be seen after electrophoresis of protein in an SDS PAGE gel. SDS PAGE of whole cell extracts of E coli produced 44-49 kDa bands of the intact protein and faint bands of smaller cleavage fragments (Bunnell et al 2017). SDS PAGE of protein from mutant E coli strains with defective Lex A cleavage did not produce the smaller cleaved fragments after SOS induction.

Experimental Approach

E coli cultures grown to log phase were treated with x4 MIC of ciprofloxacin to induce the SOS response. Treated cultures were incubated at 37 deg C. To detect Lex A autoproteolysis following ciprofloxacin treatment in the time window of 10 minutes to 50 minutes after addition of ciprofloxacin, aliquots of the cultures were removed from the wells of the tissue culture plate at 10 minutes intervals and frozen at -80 degree C to be processed later for protein extraction. To detect inhibition of the SOS response parallel cultures were treated with a combination of MDRD1 or MDRD2 and ciprofloxacin and aliquots were frozen at - 80 deg C at 10 minutes intervals.

Aliquots of untreated samples were also frozen at 10 minutes intervals. Protein extraction and LDS PAGE was performed as detailed below. Induction protocol for protein extraction from untreated and treated E. coli cells

10 ul of stock E. coli culture was added into 2 ml of CMHB in 4 test tubes and incubated at 37 degree C for overnight growth. The next day the incubated culture was matched with McFarland standardl (3*10⁸ CFU/ml cells). In a 6 well tissue culture plate the overnight culture was diluted to McFarland standard 0.5(1.5*10⁸ CFU/ml cells) with CAMHB and 3 ml of culture was distributed to all the wells of the tissue culture plate and the plate was incubated at 37 degree C fori hr in shaking condition. After 1hr of incubation, Ciprofloxacin 4ul/lml culture of 1: 1000 solution was added to well nos 1-6 with final concentration 0.128ug/ml (4X MIC). In wells 2 and 5, 3ul ImM MDRD1 final concentration 3uM/ml was added together with ciprofloxacin at 0.128ug/ml. To wells 3 and 6, 7ul/ml of ImM MDRD2 to a final concentration of 7uM was added together with ciprofloxacin 0.128 ug/ml. There was an untreated E. coli culture as a control sample incubated separately. After addition of ciprofloxacin, plates were incubated at 37 degree C in shaking condition and after 10, 15, 20, 30, 40, 45 mins 500 ul of induced samples were collected in sterile MCT and spun at 13400 rpm for 5mins. The supernatant was discarded and the pellet was stored at -80 degree C directly.

Bacterial Protein Extraction Procedure

After freezing, bacterial pellet weight was measured in electronic weighing balance and according to pellet weight, quantities of BPER reagent, Lysozyme, DNase I, Protease inhibitor was calculated and added accordingly. The calculation was as per the datasheet of respective reagents.

The pellet was dissolved in the reagent mixture by gently pipetting up and down and incubated at 37 degree C for 20 mins. After incubation samples were centrifuged at 15000 rpm for 15 mins at 4 deg C and supernatant was collected in a sterile MCT without disturbing the pellet. Concentration of the protein supernatant samples were measured by Thermofisher Nanodrop and supernatant was immediately stored at -80 deg C.

Preparation of SDS-PAGE Gel

For gel electrophotresis 12% polyacrylamide gel was used. 15 ml of resolving gel mix and 6 ml of stacking gel mix was prepared for 3 gels. The proportions were as below:

Protein sample denaturation protocol for LDS-PAGE According to concentration of protein, amount of sample buffer to be added to extracted protein sample was calculated. NuPAGE™ LDS sample Buffer (4X), cat no NP0007 was used for denaturation.

Mix reagents and spin for 15 seconds and heat at 70 degree C for 10 mins and cool samples at room temperature before loading in gel.

Buffer used made in- house by standard protocols

1. Running Buffer (pH- 8.3)

2. Transfer Buffer (pH- 8.3) 3. Tris Buffer Saline (pH- 7.5)

4. TBST (Tris Buffer Saline with Tween 20)

5. Blocking solution (TBST+ 5% nonfat skimmilk)

Western Blot procedure

BioRad Mini 4 Gel™ Electrophoresis system was used. The inner chamber was filled with 1X running buffer upto lower glass plate and outer chamber was filled upto the mark for 2 gels. 50- 80 ug samples were loaded in gel along with pre stained protein ladder 10-245 kDa (Abeam Cat no abl 16028) and Recombinant E. coli LexA protein (Cat no ab63816, Abeam) was loaded as positive control. Electrophoresis was performed at 100 V until ladder bands were separated properly. The gel was removed from glass plate and a transfer sandwich made along with Nitrocellulose membrane, Biorad filter pad, sponge and fibre pad. Gel was placed at the side of black fibre pad and the membrane at the side of transparent fibre pad. This assembly was soaked in transfer buffer for 10 mins before placement in the transfer apparatus. Transfer of protein on to the Nitrocellulose membrane was done by Biorad Mini-Trans Blot™ apparatus. The chamber was filled upto ‘blotting’ mark with transfer buffer and transfer of the protein was conducted at 350 mA for 1 hr. To check the transfer of protein the nitrocellulose membrane was stained with Ponceau S stain for 5 mins. Photographs were taken. Membrane was destained with distilled water. Membrane was soaked in blocking solution for 1 hr at room temperature in shaking condition. Addition of primary antibody, Anti LexA DNA binding Region antibody (Cat no ab174384, Abeam) in 1:3000 dilution, antibody diluent 6 ml of blocking solution and

4 ml of TBS. Incubated overnight at 4 degree C in shaking condition for 17-20 hours. The next day membrane was washed 3 times with TBS (5 mins each). Addition of secondary antibody, Goat anti-rabbit IgG (H+L) HRP (Cat no: R-05072-500, Advansta) in 1:1000 dilution, antibody diluent was 2.5% nonfat milk in TBS and incubated for 2 hr at room temperature in the dark and shaking condition. After incubation with secondary antibody, membrane was washed 3 times with TBS (5 mins each). Colour development by addition of 5 ml of 4-chloro-1-naphthol chromogenic peroxidase substrate (15mg/ 5ml methanol) in 10 ml TBS was added to the membrane. 6 ul of 30% H2O2 was added to it for color development. Incubate the membrane for 20-30 mins in dark and observed result after incubation. In vitro cleavage or autodigestion of Lex A can be induced by incubating the protein in buffer at pH 9(Little1994). Rec A activation is brought about by single stranded DNA and the reaction proceeds with the addition of ATP in buffer containing DTT and magnesium. The cleavage fragments produced contain the N terminal and C terminal parts of the protein and form smaller bands than the full length protein(MoCY et al 2014, Bunnel et al 2017, Giese et al 2008). However, the quantity of purified Lex A protein required to yield the cleaved fragments that were well visualised in SDS PAGE gels is not clear. 1 uM of activated Rec A was used in a reaction containing 3- 5uM of purified Lex A protein to bring about Lex A cleavage (Little et al 1994).

A single 63 kDa band was visualised in all the lanes loaded with test samples, on staining with anti Lex A DNA binding region antibody. The positive control contains recombinant Lex A of 25 kDa and well stained bands were visualized after staining with the anti Lex A DNA binding region antibody. Results indicate that 63 kDa band represents the dimeric or modified dimeric forms of the native Lex A protein. Further analysis of the protein bands by techniques like mass spectrometry is required.

Single bands of size in between 11 to17 kDa in ciprofloxacin treated samples were obtained. Amount of whole cell extract of E. coli loaded in the lanes was 50 - 60 ug protein/ lane (Figure 3). The bands were visualised in four replicate cultures frozen at 40 mins after addition of ciprofloxacin but not in samples retrieved at 10 mins, 15 mins, 20 mins, 30 mins and 45 mins (Figure 4 A-R) implying that the cleavage reaction is time dependant and cleavage products are unstable. In none of the samples containing the SOS response inhibitors MDRD1 and MDRD2 at 40 mins or the untreated samples were the smaller 11-17 kDa bands detected. These bands were not present in samples in which the SOS response was inhibited by MDRD1 and MDRD 2 or in untreated samples. The implication is that MDRD1 and MDRD2 inhibit the cleavage of native Lex A protein in E. coli when the SOS response is induced by treating E. coli cells with ciprofloxacin.

Example 2: Temporal Profile of the Effect of Ciprofloxacin treatment alone for SOS induction on the gene expression of RecA and UMUD in E Coli cultures.

500 uL of E coli cultures grown overnight in CAMHB was placed in each well of a 12 well tissue culture plate. Fresh CAMHB 500 ul was added to each well and the plates were incubated for 90 mins with shaking at 37 deg C to obtain bacteria in the log phase of growth.

4 uL of a 1:1000 dilution of ciprofloxacin (x4 MIC) was added quickly to each well after starting a stopwatch. Incubation with shaking continued after addition of ciprofloxacin. At 10 minute intervals 1 ml of the culture was placed in sterile MCT and immediately frozen at -80 degC. The wells were sampled at 10 minute intervals for 2 hrs. 1 ml of an untreated sample was frozen separately at the beginning of the experiment.

The timed cultures remained in -80 deg C for minimum 1 hour. The MCT vials were then placed in cold centrifuge maintained at 4 degC and after 10 mins of thawing were centrifuged at 8000 rpm for 5 mins. After discarding the supernatants RNA extraction was performed by manual Trizol method without delay. Amplification of UMUD, Rec A and the control gene RRSB was performed as discussed in preceding sections. The method of quantitation was by delta delta CT method. Note on the use of control gene for delta delta CT and calculation of fold change or RO value- A review of the literature on control genes in E coli other than RRSB revealed ADK and Sec A as alternative genes. All the genes had a different T_m from the Rec A gene. Therefore amplification of Rec A and RRSB gene had to be carried out in separate experiments (PCR machine in use is Step One which does not have a gradient block) and the values of fold change (RQ) of gene expression for RecA was determined by manual calculation.

Result: After ciprofloxacin treatment at x4 MIC there was variable increase in expression of UMUD and Rec A from 10 mins upto 40 mins. The peak levels of gene expression were observed at 50 mins for UMUD gene and 60 mins for Rec A gene following SOS induction with ciprofloxacin as shown in Figures 5 and 6. Example 3:

Temporal Profile of Gene Expression over time after SOS induction of E Coli cultures with ciprofloxacin combined with the inhibitors MDRD1 & MDRD2

SOS induction was carried out as in (G). To each of 3 wells in a row , one received ciprofloxacin alone, the second well ciprofloxacin + MDRD1 (3uM) or MDRD2 ( 7 uM), and the third well in the row received MDRD1 or MDRD2 alone.

MDRD1 and MDRD2 independantly caused an increase in UMUD and RecA gene expression at 50 mins after treatment. The levels declined by 60 mins. When MDRD1(3uM) or MDRD2 (7uM) were combined with ciprofloxacin the rise in UMUD and RecA gene expression was suppressed both at 50 mins and 60 mins after treatment as shown in Figure 7 and Figure 8.

Result: MDRD1 and MDRD2 independantly caused an increase in UMUD and RecA gene expression at 50 mins after treatment. The levels declined by 60 mins. When MDRD1 (3uM) or MDRD2 (7uM) were combined with ciprofloxacin the rise in UMUD and RecA gene expression was suppressed both at 50 mins and 60 mins after treatment

Example 4: UMUD and Rec A gene expression levels in E Coli cultures related to dose of MDRD 1 or MDRD2 at 50 mins and 60 mins after SOS induction with Ciprofloxacin.

Experiments were carried out in sterile 12 well tissue culture plates. Each well contained 1 ml of E coli culture to which was added ciprofloxacin 1:1000 solution and MDRD1 or MDRD2. 500 uL of culture was frozen at -80 deg C at 50 mins and 60 mins for RNA extraction. (Figure 9, Figure 10, Figure 11, Figure 12, Figure 13). Result: MDRD1 doses of 0.5uM, 1.0 uM, 2.0 uM in combination with ciprofloxacin (x 4 MIC) suppressed Rec A and UMUD expression 50 minutes and 60 minutes post treatment in comparison to levels obtained with ciprofloxacin alone. There was a dose dependant increase in UMUD and RecA gene expression when cultures were treated with MDRD1 alone. Higher doses of MDRD 2 of 3.0uM, 4.0 uM, in combination with ciprofloxacin (x 4 MIC) suppressed Rec A and UMUD expression 50 minutes and 60 minutes post treatment in comparison to levels obtained with the lower dose of 2.0 uM MDRD2 in combination with ciprofloxacin or with ciprofloxacin alone. There was an increase in UMUD and RecA gene expression when cultures were treated with MDRD2 alone in the highest dose of 4.0 uM.

Example 5:

Gene expression levels of UMUD and Rec A in replicate E Coli cultures in which SOS response was induced with ciprofloxacin x4 MIC, in combination with or without MDRD1 and MDRD2

Method: 500 uL of an overnight E coli broth culture was placed in each of 7 wells in a 12 well tissue culture plate. 500 uL of CAMHB was added and the plates were incubated at 37 deg C with shaking for 90 mins to obtain bacteria in the log phase. Turbidity of the cultures were adjusted to McFarland 0.5 (1.5 x 10⁸ CFU/ml) with fresh sterile CAMHB as required.

Ciprofloxacin 1:1000 dilution 4 ul was added to well no 1 to 6. Immediately MDRD1 3 uM or MDRD2 7uM was added to well no 4 - 6. Well no 7 contained untreated sample. The plates were incubated for 50 mins with shaking and at this time 500 ul of culture was removed from well nos 1-7 into sterile MCT vials and frozen immediately at -80 deg C to be processed for RNA extraction as per protocol in sections C and D. After a further 10mins, i.e at 60 mins the rest of the cultures in wells 1-7 were frozen at -80 deg C to be processed later for RNA extraction and cDNA synthesis.

Method of RNA extraction: RNA extraction was done by a modified manual phenol- chlroform method using double chloroform extraction (Toni et al 2018) RNA quality was checked in Nanodrop spectrophotometer. RNA samples with A260/A280 of 1.8-2.0 were selected for real time PCR.

Eight batches of replicate cultures were processed with the above protocol.

Quantitative PCR and Calculation of Fold Change (Relative Quantitation) of Gene Expression Gene sequences and Primers Primers were designed in NCBI Primer Blast. Annealing temperatures were calculated with ThermoFisher Scientific T_m Calculator Tool.

UMUD gene

NC_000913.3:1230767-1231186 Escherichia coli str. K-12 substr. MG1655, complete genome.

Forward Primer- CCC GAC GGT ACA GCT TAT TC Reverse Primer - GTG GAT CAC CAC ACC AAA GA Calculated annealing temperature 57.0 degC

Rec A Gene NC_000913.3:c2823769-2822708 Escherichia coli str. K-12 substr. MG1655, complete genome

Forward primer- GT AAA ACC ACG CTG ACG TT

Reverse primer- ATA TCG ACG CCC AGT TTACG Calculated annealing temperature - 58.9 deg C RRSB gene(Control Gene)

NC_000913.3:4166659-4168200 Escherichia coli str. K-12 substr. MG1655, complete genome

Forward primer- TGCAAGTCGAACGGTAACAG Reverse primer- AGTTATCCCCCTCCATCAGG Calculated annealing temperature- 57.0 deg C

General Protocol for PCR Master Mix Preparation& PCR Cycle

PCR master mix was used of ThermoFisher containing SYBR green dye for quantitative PCR. Volume of reaction was 20ul, Primer Dilution- 10OuM working stock was diluted to 10uM working stock

PCR master mix for 20 ul reaction volume:SYBR Green Master Mix- 10 ul, Forward Primer - 0.6 uL (200nM),

Reverse Primer - 0.6 uL(200nM), Water - 6.8 uL,cDNA 2 uL

PCR reactions were carried out in 48 well plates in ABI Step One Machine. PCR Cycle Conditions

Step 1 50 deg C 2 mins, 95 deg C 2 mins, Step 2 Denaturation 95 deg C 15 secs,

Annealing57.0 deg C ( UMUD/RRSB)

15 secs For 40 cycles 58.9 degC ( RecA), Extension 72 deg C 1 min, Step 3 Melt Curve Standard Curve, determination of PCR Efficiency, Slope and R² values of RRSB, UMUD and Rec A amplification are shown in in Figure 22

PCR Efficiency relates to DNA amplification in each cycle of PCR. A doubling of the DNA template is expected in each PCR cycle. A PCR efficiency of 100% indicates that there is exact doubling of DNA template in each cycle as the PCR reaction progresses. E (Efficiency) = 10 (- 1/Slope)- 1 For 100% efficiency slope equals 3.3, R2 is the coefficient of correlation obtained for the standard curve and should be > 0.99.

R2 evaluates the efficiency of a primer set and the precision of serial dilutions.

Real time quantitative PCR was performed on the replicate samples for quantitation of gene expression changes of Rec A and UMUD in E coli cultures treated with x4 MIC of ciprofloxacin compared to untreated cultures and the effect of MDRD1 and MDRD2 when these were combined with ciprofloxacin x4 MIC in the treated cultures. The method of real time PCR quantification is the delta delta CT method.

CT ( cycle threshold) values obtained in the amplification cycles of each gene of interest (GOI) UMUD and RecA in the samples, were normalised by subtracting the CT values of the control gene (RRSB) in test samples from the CT value of the GOI in test samples. The normalised CT values of the control untreated samples for each GOI were then subtracted from each of the normalised CT values of the test samples to give the DD CT value.

CT in test sample (GOI) - CT in test sample (RRSB) = Δ CT ( GOI) test CT in untreated sample ( GOI) - CT in untreated sample (RRSB)= ACT (GOI) untreated sampl

Δ eCT ( GOI) test sample - Δ CT (GOI) untreated sample = ΔΔ CT (GOI) test sample

Fold Change in gene expression (RQ) = 2 ^{- Δ Δ} Figure 14 (50 mins RecA) , Figure 15 (RecA 60 mins, Figure 16 (UMUD 50 mins), Figure 17 (UMUD 60 mins). Results:(1) Increased measurable expression of the SOS response regulated genes UMUD and Rec A can be induced in E coli by treating with ciprofloxacin at doses which exceed the minimum inhibitory concentration. In the experiments with E coli type strain ATCC11775 a ciprofloxacin dose of 0.128ug/ml or x4 MIC of the strain was required to induce an increase in UMUD and Rec A in measurable amounts (CT values <30).

(2) The inhibitors MDRD1 and MDRD2 suppressed the increase in UMUD and Rec A expression in replicate experiments, demonstrating their inhibition of the SOS response. (3) The suppression of the SOS response is dose dependant and is enhanced with higher doses of MDRD1 and MDRD2 when they are combined with the antibiotic ciprofloxacin.

(4) The rise in UMUD and Rec A levels after ciprofloxacin induction is often variable in different aliquots of the same bacterial culture demonstrating that SOS response is not uniform in all bacteria.

(5) The SOS response and rise in the levels of UMUD and Rec A is also time dependant and responses are observed in the first 60 minutes after treatment with ciprofloxacin. Maximum responses occur at 50 minutes and 60 minutes after induction and there is a rapid decline thereafter. Example 6:

Analysis of Normalized CT values of RecA and UMUD gene

Analysis of Normalized CT values of RecA gene expression- Relative quantitation of RecA gene expression (Figure 14, Figure 15) shows a trend towards reduced expression of Rec A in the 60 minute samples compared to 50 minute samples in both the ciprofloxacin treated and combined treatment samples with lower expression in those samples receiving combined treatments. However when the normalised CT values of the 4 groups of untreated, ciprofloxacin treated, Cipro+ MDRD1 and ciprofloxacin + MDRD 2 treated samples were tested for statistical significance of differences in expression by the Kruskall Wallis test, the results were not significant (p>.05) in both the 50 minute and 60 minute samples.

Pairwise comparison of the differences in the median values of normalised CT between the ciprofloxacin alone and combined treatment samples by the Wilcoxon signed rank test did not reach statistical significance (p>.05) in both the 50 minute and 60 minute samples. (Figures 18, Figure 19). Analysis of Normalized CT values of UMUD gene expression -Relative quantitation ofUMUD gene expression increased in the ciprofloxacin alone treated E coli samples at 60 mins compared to the expression in the 50 minute samples (Figure 16, Figure 17). Combination of MDRD1 and MDRD2 suppressed UMUD expression in the 60 minute sample to a greater extent than in the 50 minute sample. Normalised CT values of the 4 groups of untreated, ciprofloxacin treated, Cipro+ MDRD1 and ciprofloxacin + MDRD 2 treated samples were tested for statistical significance of differences in expression of UMUD gene by the Kruskall Wallis test, the results were not significant (p>.05) in the 50 minute samples. However there was a statistically significant difference in expression of UMUD gene between the 4 groups of the 60 minute samples[H statistic 7.84 (3, N=56) p = .049, Figures 20, Figure 21).

Pairwise comparison of the differences in the median values of normalised CT between the ciprofloxacin alone and combined treatment samples by the Wilcoxon signed rank test did not reach statistical significance (p>.05) in both the 50 minute and 60 minute samples. Figure 18 shows Normalized CT values RecA 50 mins, Figure 19 shows Normalized CT values RecA 60 mins, Figure 20 shows Normalized CT value UMUD 50 mins, Figure 21 shows Normalized CT values UMUD 60 mins.

Example 7: Evolution of Resistance to Ciprofloxacin and its Inhibition by the SOS Response Inhibitors MDRD1 and MDRD2

Independent Antibacterial Effect of MDRD1 (2uM) and MDRD2 (5uM) in E Coli cultures:

E.coli culture was grown in CAMHB overnight at 37 degree C in triplicate in the presence of 2 uM of MDRD1 and 5uM of MDRD2. Culture turbidity was measured at 600 nm in the beginning and at the end of the 24 hrs. In all the sample tubes culture turbidity and OD values increased at the end the 24 hrs.

Therefore, MDRD1 (2uM) and MDRD2 (5uM) do not have an independent ANTIBACTERIAL effect in E Coli cultures after 24 hours growth in planktonic conditions. Mechanism of Mutational Resistance and SOS response activation

Ciprofloxacin is a third generation fluoroquinolone antibiotic is effective in the treatment of gram negative infections. The mechanism of action of ciprofloxacin and other fluoroquinolone antibiotics is by their inhibition of the function of two DNA polymerases, DNA gyrase and Topoisomerase IV in bacteria. DNA polymerases catalyse topological changes in DNA such as unwinding supercoiled DNA, stalling replication forks during DNA replication and DNA strand exchange. The DNA polymerases induce double stranded breaks (DSE) in DNA to enable these functions. Quinolone antibiotics bind to the ends of the DNA at the DSEs by intercalating DNA bases, preventing end re-joining. As a result DNA replication and transcription are blocked and result in reduced formation of mRNA for cellular protein synthesis. In addition, when the bound topoisomerases are released from DSEs, the free DNA ends result in fragmentation of the chromosome, generation of reactive oxygen species(ROS) and rapid cell death(Bush et al 2020). DNA fragmentation following low dose ciprofloxacin has been demonstrated by an in situ fluorescence assay (Tamayo et al 2009) ROS generation requires activation of the SOS response and stimulates the general stress response pathway, both of which lead to increased mutation rates even with low, sub-inhibitory concentrations of ciprofloxacin (Pribis et al 2019).

Development of Mutations and Increased Mutation Rates in E coli exposed to low doses of Ciprofloxacin Cirz et al 2005 demonstrated that E coli with an intact Lex A gene develop resistance to ciprofloxacin in an in vivo murine thigh infection model, whereas E coli strains with mutated Lex A SI 19A which is non-cleavable retained ciprofloxacin sensitivity. Wild type E coli cultures treated with ciprofloxacin at or just above the MIC in 14 day subcultures, demonstrated increased mutations in the form of base substitutions and deletions. The percentage of mutations were low or absent in strains with deletions in the DNA repair enzymes Pol B, UMUD complex, RecA, dinB, uvrBC and in non-cleavable Lex A S119 A. Mutation percentages and mutation rates (mutants/viable cell/day) increased progressively throughout the duration of 14 days. Rec A, a key enzyme for recombination and DNA repair, in complex with single stranded DNA stimulates the cleavage of Lex A.

Gulberg et al 2011 demonstrated that bacteria can become resistant when exposed to sub-MIC doses of antibiotics. When 1000 fold dilutions of E coli cultures were passaged every 24 hours for 700 generations in media containing 1/10 th MIC of ciprofloxacin, populations of E coli cells with MIC 8 -fold higher than the parent strain were found in more than 1% of the E coli cells. Estimation of Mutation Rates

Pope et al²² described two methods of estimating the mutation rates. The mutation accumulation method involves sampling a culture multiple times and counting the number of viable cells and mutant colonies at each time. If the growth rates of wild type and mutant bacteria are the same then mutation rate m can be estimated with the following formula: m = [(r2/N2- r1/ N1)] x In (N2/N1)

Mutant frequency (f) = r2/N2 -r1/N1)

N1 = no of colonies at time point 1 N2 = no of colonies at time point 2 r1= no of resistant colonies at time point 1 r2 = no of resistant colonies at time point 2

The second method of fluctuation analysis pioneered by Luria and Delbruck (Lang 2017) is done by starting several parallel cultures from a single broth culture, growing the cultures to saturation, then estimating the colony count in pooled cultures and the number of mutants by plating on selective medium from samples from individual cultures. μ = m/N where m is -In(p0) p0 = proportion of culture without mutants m= mutational events/culture

N= no of cultures GENERAL PROTOCOL FOR EVOLUTION EXPERIMENTS

Experiment Design for Determining Mutation Rates in E coli exposed to sub- MIC concentrations of Ciprofloxacin and its inhibition by MDRD1 and MDRD2

E coli ATCC 117755 were serially sub-cultured over 10 - 12 days in media containing low dose (sub-MIC) concentrations of ciprofloxacin over the entire period of the experiments. Experiments were done in BIOFILM and PLANKTONIC conditions in replicate series. In parallel, cultures of E coli were grown with sub-MIC concentrations of ciprofloxacin in combination with the inhibitors MDRD1 and MDRD2. Untreated E coli cultures were grown in serial sub-cultures in all the series, over 10-12 days.

On the 3^rd day of the serial subculture aliquots of the cultures were sub- cultured into CAMHB and grown overnight. The overnight broth cultures were serially diluted 10^-1 to 10^-8 in sterile MHB and without delay were lawn plated in non-selective medium for viable bacterial cell counts. Aliquots were lawn plated on MH agar containing x4 MIC (0.128ug/ml) ciprofloxacin for counting of ciprofloxacin resistant colonies.

The above procedure was repeated on day 10 and cultures were plated for viable cell counts and resistant colony counts on day 11. Plates were read for colony counts on day 12 after start of the series.

The cultures were monitored by examining gram stained smears prepared from each well at day 3 and day 10. Morphology of the bacteria and presence of filamentous forms were noted.

Further, day 11 cultures were lawn plated and examined for ciprofloxacin sensitivityby disc diffusion method with 5ug ciprofloxacin discs and incubating overnight. Clear zones sizes around the ciprofloxacin discs were recorded. Protocol for Preparation of Starting Cultures

From E. coli type strain ATCC117755 stock culture plate 4 to 5 colonies were picked up with sterile inoculation loop in CMHB and incubated overnight for fresh culture. On the next day subculture was made with 300 ul culture of overnight culture in 2700 CMHB and incubated it at 37°C for 1 hour. After 1 hour the turbidity was matched with McFarland standards 1 (3*10⁸ CFU/ml cells). As McFarland standard 0.5 (1.5*10⁸ CFU/ml cells) is needed the culture was diluted with CMHB for starting the series.

Protocol for BIOFILM Growth conditions Cultures were grown at room temperature (27 deg to 30 deg C) in static condition in tissue culture plates without any shaking for 24 hours. Culture volumes were 500uL /well.

Protocol for PLANKTONIC Growth conditions

Cultures were grown at 37 degree C in tissue culture plates in shaking condition for 24 hours. Culture volumes were 1000 uL/well.

MEDIA PREPARATION:

1. Protocol for preparing Muller Hinton Broth (MHB)

2.1 grams of Mueller Hinton Broth (HIMEDIA) was dispensed in 100 ml of distilled water and dissolved the medium completely. The media was sterilized by autoclaving at 15 lbs (121 °C) for 15 minutes and then cooled to room temperature and can be stored in refrigerator for future use.

2. Protocol for preparing Muller Hinton Agar (MHA) plate

3.8 grams of Muller Hinton Agar powder was dissolved completely in 100 ml of sterile distilled water and sterilized by autoclaving at 15 lbs pressure (121°C) for 15 minutes. The mixture was cooled to 45-50°C and mixed well to pour into sterile petri plates. The plates were kept undisturbed for 30-40 minutes in room temperature for proper solidifying of the agar.

3. Protocol for preparing Ciprofloxacin (0.128 ug/ml) containing MHA plates 3.8 grams of Muller Hinton Agar powder was dissolved completely in 100 ml of sterile distilled water and sterilized by autoclaving at 15 lbs pressure

(121°C) for 15 minutes. The mixture was cooled to 45-50°C and 37.9 ul of 1:100 ciprofloxacin (0.33ug/ml) was gently mixed with the sterile MHA properly. Then the media was poured into sterile petri plates. The plates were kept undisturbed for 30-40 minutes in room temperature for proper solidifying of the agar.

Table 1A: Protocol for starting evolution experiment in general after preparing the starting culture

Table IB: Protocol for transferring from day 2 - day 10/ 12 after starting of the experiment

Protocol for Viable Colony Count

Method of Serial Dilutions: 10Oul of overnight sub-culture from the 3^rd day or 10 th day growth in tissue culture plates of the respective series, was added to 900ul of MHB and mixed well. Then 100 ul was serially transferred in 900 uL CAMHB upto a dilution of 10^-8 of the cultures.

Without delay and within half an hour of preparation of the dilutions 50 ul of each dilution was dropped on the surface of Mueller Hinton agar and the cultures were spread evenly with a sterile disposable L shaped spreader. On the next day colonies that appeared on the plates were counted and counts recorded.

Method of viable plate count is as per standard procedure in the literature as detailed below.

CFU/ ml= No of viable cell count* 1/ Final dilution factor (FDF)

Protocol for ciprofloxacin resistant colony count The protocol was modified from the Miles and Misra method recommended in the literature. Mueller Hinton agar containing 0.128 ug/ml ciprofloxacin was prepared for ciprofloxacin resistant colony count. Initially the undiluted culture was centrifuged at 1800 RPM for 10 minutes and without disturbing the pellet, the supernatant was discarded. Then the whole pellet was dropped on the agar plate and spread with sterile L shaped spreader. But in this method in some cultures colonies were too numerous for counting, so this method was not continued for the whole series.

The plating procedure for resistant colony count was modified by plating 50 ul of a serially diluted subculture of dilution 10^-3 which was dropped on the surface of the ciprofloxacin containing Mueller Hinton agar plate and the cultures were spread evenly with a sterile disposable L shaped spreader. On the next day colonies that appeared on the plates were counted and recorded.

The number mutant colonies were estimated by:

No of mutant colonies x 1/Final dilution factor (FDF) Protocol for Zone diameter measurement by disk diffusion of Ciprofloxacin disc 5ug:

The overnight E coli subcultures of day 10 were lawn plated with sterile cotton swab sticks examined for clear zone sizes after placing 5ug ciprofloxacin discs and incubating overnight in non- selective Muller Hinton agar (MHA) . Zone size was measured by ruler scale.

Following Observations were made-

1. Viable colony count (N) for CFU/ml calculations: day3- N1, day 10 -N2

2. Resistant colony counts (r1) day 3 and (r2) day 10 cultures

3. Ciprofloxacin zone size in mm 4. Gram stained smears for filamentous morphology as an indicator of the induction of the stress SOS response after ciprofloxacin or MDRD1 or MDRD2 exposure. Calculation of Mutation rates:

Values of mutation rates were derived by applying below mentioned formula and squared and log values were calculated to analyze data.

Mutation rate (u): (r2/N2 -r1/N1)* In (N2/ N1) Method of Mutation Rate Calculation

At the end of day 10 or 12, mutations rates were calculated as below:

N1: Day 3^rd Colony count on non-selective medium (viable bacterial cell count) N2: Day 10^th colony count on non-selective medium (viable bacterial cell count) r1: Day 3^rd Resistant colony count on Ciprofloxacin plate r2: Day 10^th Resistant colony count on Ciprofloxacin plate

Mutation rate (u): (r2/N2 -r1/N1)* In (N2/ N1)

Calculating the Dilution Factor

SDF: SAMPLE DILUTION FACTOR

As 100 ul of culture was present in 1000 ul of total volume, SDF= 1/10

ITDF: INDIVIDUAL TUBE DILUTION FACTOR

As 100 ul of culture was transferred in each tube to total volume of 1000 ul from the previous tube,

ITDF= 1/10 TSDF: TOTAL SERIES DILUTION FACTOR ITDF_tube1* ITDF_tube2* ITDF_tube3* ... ITDF of countable plate tube

PDF: PLATING DILUTION FACTOR Volume of culture plated/ 1 ml FDF: FINAL DILUTION FACTOR FDF= SDF* TSDF* PDF

Ref: https://www.uvm.edu/~btessman/calc/serhelp.html EXAMPLE OF CALCULATING CFU/ml:

Let, viable colony count on MHA agar plate is 47, and 100 ul of 10^-6 dilution is plated for viable colony count. SDF= 100/1000= 1/10 [100 ul of overnight culture was put in total volume of 1000 ul for serial dilution]

ITDF= 100/1000= 1/10 [for serial dilution 100 ul of culture is transferred from previous tube to next tube to volume 1000 ul]

TSDF= ITDFtubei* ITDFtube2* ITDFtube3* ITDFtube4* ITDFtube5* ITDFtube6 = 1/10* 1/10* 1/10* 1/10* 1/10* 1/10

= 1/10⁶

PDF= 100/1000 = 1/10

FDF= SDF* TSDF* PDF

= 1/10* 1/10⁶* 1/10 = 1/10⁸

CFU/ml = No of viable colonies* 1/ FDF = 47* 1/10⁸ = 47* 10⁸ Modifications in the Method of Mutation Rate Calculation and Reasons for the same:

The above method was designed of estimating mutation rate by adapting two methods of mutation rate estimation, the mutation accumulation method and fluctuation analysis. The method is similar to the mutation accumulation method in that sampling is done repeatedly and that a large number of bacteria are evaluated at multiple time points. This method is a modification in that the cultures were sampled starting from replicate single broth cultures which were serially sub-cultured and samples for counting viable cells and mutant colonies were performed at two time points, on the 3^rd day and 10^th day of the experiment. This was done to allow time for the evolution of mutation in E coli cells during the period of serial subculture in the conditions of presence of ciprofloxacin and with or without the inhibitors MDRD1 and MDRD2.

The formula for calculation of mutation rates that was used includes the viable count (N1, N2) at the two time points and resistant colony counts (r1,r2 ) at the two time points. The number of sampling times was reduced to two for logistic reasons in order to allow time and resources for several replicate experiments in both BIOFILM and PLANKTONIC conditions with ciprofloxacin and with or without MDRD1 and MDRD2. This method is similar to the method of fluctuation analysis in the use of parallel cultures in which the number of simultaneous cultures was modified and instead introduced serial subcultures to allow time for the evolution of resistance to ciprofloxacin. Example 8

To study the evolution of resistance when SOS response is induced with ciprofloxacin in BIOFILM condition in 10 day replicate serial subcultures of Escherichia coli treated with sub- MIC doses (0.5x MIC) of ciprofloxacin and its inhibition by MDRD-land MDRD-2.

Purpose: To create culture growth conditions which mimic bacterial growth and survival during infections in the human body or in the hospital environment when bacteria are exposed to antibiotics.

Organism: Escherichia coli type strain ATCC 117755 Started: 07/09/2020

End date: 22/09/2020

Inhibitor used: MDRD-land MDRD2, SOS Induction with Ciprofloxacin x0.5 MIC (0.016ug/ml).

Experiment design was as follows: Fig 23 A shows wells 1-12 with E coli cultures treated with Ciprofloxacin (0.016 ug/ml) + MDRD 1 (2 uM). Fig 23B shows wells 1-12 with E Coli cultures treated with Ciprofloxacin (0.016 ug/ml) + MDRD 2 (7 uM). Fig 23C shows wells 1-6 with Untreated (control) E Coli cultures and well nos 7-12 with E Coli cultures treated with Ciprofloxacin only (0.016 ug/ml). Concentration of Ciprofloxacin used: 0.5x MIC of ciprofloxacin (0.016 ug/ml).

Concentration of MDRD-1: 2 uM

Concentration of MDRD-2: 7 uM Observation of Gram staining from the E Coli serial subcultures SOS induced with Ciprofloxacin, 3^rd day in biofilm condition:

In biofilm condition, gram negative bacilli were observed in all untreated cultures (panel 1). In ciprofloxacin only treated (panel 6) cultures gram negative filamentous morphology of E coli was observed. The frequency of filamentous forms was reduced in cultures treated with combination of ciprofloxacin+ MDRD1 or MDRD2 (panel 2- 5 and 7-10) (Figure 24).

Observation 3^rd day of serial subculture of E Coli:

Result of plating the 3^rd day cultures are shown in (Figure 25 A- H). Figure 25A and B shows 3^rd day Ciprofloxacin resistant colony of Untreated (well no: 1-6) & Ciprofloxacin treated (well no: 7-12) samples on 0.128 ug/ ml ciprofloxacin containing MHA. Figure 25C and D shows 3^rd day Viable colony count on MHA of Untreated (well no 1-6) & Ciprofloxacin treated (well no 7-12) samples. Figure 25 E shows Ciprofloxacin resistant colony of Ciprofloxacin+ MDRD1 treated (1-12) samples on 0.128 ug/ml ciprofloxacin containing MHA plate. Figure 25 F shows 3^rd day Ciprofloxacin resistant colony of Ciprofloxacin+ MDRD1 treated (1-12) samples on 0.128 ug/ml ciprofloxacin containing MHA plate. Figure 25 G shows 3^rd day Viable colony count on MHA plate ciprofloxacin+ MDRD1 treated samples (well no 1- 12). Figure 25 H shows 3^rd day Viable colony count on MHA plate ciprofloxacin+ MDRD2 treated samples (well no 1- 12)

Table 2A: 3^RD day result of untreated E Coli sub-cultures in BIOFILM growth conditions

Table 2B: 3^RD day result of Ciprofloxacin treated E coli sub-cultures

Table 2C: 3^RD day result of ciprofloxacin + MDRD-1 treated E Coli sub-cultures 5 in BIOFILM growth conditions

Table 2D: 3^RD day result of ciprofloxacin + MDRD-2 treated E Coli sub-cultures in BIOFILM growth conditions

Table 3A: 10th day result of untreated E Coli sub-cultures in BIOFILM growth conditions

Table 3B: 10th day result of ciprofloxacin treated E Coli sub-cultures in BIOFILM growth conditions

5

Table 3C: 10th day result of ciprofloxacin+ MDRD-1 (2uM) treated E Coli subcultures in BIOFILM growth conditions

Table 3D: 10th day result of ciprofloxacin + MDRD-2 (7uM) treated E Coli sub- cultures in BIOFILM growth conditions

Table 4A: Mutation rate calculation of untreated E Coli sub-cultures in BIOFILM growth conditions

Table 4B: Mutation rate calculation of Ciprofloxacin treated E Coli sub-cultures 5 in BIOFILM growth conditions

Table 5C: Mutation rate calculation of Ciprofloxacin + MDRD-1 treated E Coli sub-cultures in BIOFILM growth conditions

Table 5D: Mutation rate calculation of Ciprofloxacin + MDRD-2 treated E Coli sub-cultures in BIOFILM growth conditions

Observations of Gram Stained Smears from 10^th day E Coli serial sub-cultures in Biofilm conditions in which SOS response was induced with low dose ( 0.5x MIC) Ciprofloxacin with or without the inhibitors MDRD1 and MDRD2: In biofilm condition, gram negative bacilli were observed in all untreated samples. In ciprofloxacin only treated samples gram negative filamentous morphology of E coli was observed. The frequency of filamentous forms was reduced in samples treated with combination of ciprofloxacin+ MDRD1 or MDRD2 (Figure 26). Example 9

Similar experiments were conducted to study the evolution of resistance when SOS response was induced with ciprofloxacin in PLANKTONIC culture conditions in 10 day replicate serial subculture of Escherichia coli treated with sub- MIC doses (0.5x MIC) of ciprofloxacin and its inhibition by MDRD-1 and MDRD-2. Purpose: To observe differences in the rates of mutational resistance acquisition in response to SOS induction by Ciprofloxacin when E Coli were grown in planktonic conditions compared to biofilm growth conditions.

Organism: Escherichia coli type strain ATCC117755

Starting date: 16/06/2020 End date: 28/06/2020

Inhibitor used: MDRD-land MDRD2, SOS Induction with Ciprofloxacin x0.5 MIC (0.016ug/ml).

Experiment design was as follows: Plate set up was following as Figure 23 Concentration of Ciprofloxacin used: 0.5x MIC of ciprofloxacin (0.016 ug/ml). Concentration of MDRD-1: 1uM Concentration of MDRD-2: 5uM

3^rd day observation of gram staining from the SOS induced low dose Ciprofloxacin treated Planktonic E Coli cultures and untreated planktonic E Coli cultures: In 3^rd day planktonic culture condition of E Coli, gram negative bacilli were observed in all untreated cultures (panel 1). In ciprofloxacin only treated (panel 6) cultures, gram negative filamentous morphology of E coli was observed. The frequency of filamentous forms was reduced in cultures treated with combination of Ciprofloxacin+ MDRD1 or MDRD2 (panel 2-5 and 7-10) (Figure 27). Observation 3^rd day of serial sub-culture of E Coli in PLANKTONIC growth conditions: Observation 3^rd day of serial subculture of E Coli:

Result of plating the 3^rd day cultures are shown in (Figure 29 A- L). Figure 29 A shows 10^th day Ciprofloxacin resistant plating of Untreated (1-6). Figure 29 B shows 10^th day Viable cell count on MHA of Untreated (1-6) samples. Figure 29 C shows 10^th day Zone diameter of Untreated (1-6). Figure 29D shows 10^th day Ciprofloxacin resistant colonies of Ciprofloxacin treated (1-6) culture. Figure 29E shows 10^th day Zone diameter of Ciprofloxacin treated cultures (1-6). Figure 29F shows 10^th day Viable cell count on MHA of Ciprofloxacin treated cultures(1-6). Figure 29G shows 10^th day Ciprofloxacin resistant colonies of Ciprofloxacin+ MDRD1 treated cultures (1-12). Figure 29H shows 10^th day Zone diameter of Ciprofloxacin+MDRD1 treated cultures (1-12). Figure 29I shows 10^th day Viable cell count of Ciprofloxacin treated+MDRD1 treated cultures (1-12). Figure 29J shows 10^th day Ciprofloxacin resistant colonies of Ciprofloxacin+ MDRD2 treated cultures (1-12). Figure 29K shows 10^th day Zone diameter of Ciprofloxacin+MDRD2 treated cultures (1-12). Figure 29L shows 10^th day Viable cell count of Ciprofloxacin treated+MDRD2 treated cultures (1-12).

Table 6A: 3^RD day result of untreated E Coli sub-cultures in PLANKTONIC growth conditions

Table 6B:3^RD day result of Ciprofloxacin treated E Coli sub-cultures in PLANKTONIC growth conditions

Table 6C:3^RD day result of ciprofloxacin + MDRD-1 treated E Coli sub-cultures in PLANKTONIC growth conditions

Table 6D:3^RD day result of ciprofloxacin + MDRD-2 treated E Coli sub-cultures in PLANKTONIC growth conditions

Table 7A:10^th day result of untreated E Coli sub-cultures in PLANKTONIC growth conditions

Table 7B :10^th day result of ciprofloxacin induced sample

Table 7C:10^th day result of ciprofloxacin+ MDRD-1 treated E Coli sub-cultures in PLANKTONIC growth conditions

Table 7D :10^th day result of ciprofloxacin + MDRD-2 treated E Coli sub-cultures in PLANKTONIC growth conditions

Table 8A: Mutation rate calculation of untreated samples of E Coli sub-cultures in PLANKTONIC growth conditions

Table 8B: Mutation rate calculation of Ciprofloxacin treated E Coli sub- cultures in PLANKTONIC growth conditions

Table 8C: Mutation rate calculation of Ciprofloxacin + MDRD-1 treated E Coli sub-cultures in PLANKTONIC growth conditions

Table 8D: Mutation rate calculation of Ciprofloxacin + MDRD-2 treated E Coli sub-cultures in PLANKTONIC growth conditions

Observation of gram stained smears from E Coli sub-cultures in PLANKTONIC growth conditions on 10^th day

In PLANKTONIC cultures of E Coli, gram negative bacilli were observed in all untreated samples. In ciprofloxacin only treated samples gram negative filamentous morphology of E coli was observed. The frequency of filamentous forms was reduced in samples treated with combination of ciprofloxacin+ MDRD1 or MDRD2 (Figure 28)

Effect of MDRD1 and MDRD2 with other antibiotics other than Ciprofloxacin MIC strips of following antibiotics were used to show the evidence of Multi Drug Resistance following development of Ciprofloxacin resistance in PLANKTONIC culture of E Coli: 1. Piperacillin tazobactam (PTZ)

2. Gentamycin (GEN)

3. Cefotaxime (CTX)

4. Ampicillin (AMP) Two different wells from the experiment described above (details in Table 9) each from control, ciprofloxacin only induced, Ciprofloxacin+ MDRD 1 induced and Ciprofloxacin+ MDRD 2 induced were sampled; 1 well which had no growth and 1 well which had too numerous growth on ciprofloxacin resistant plate were chosen (Table 9). 7^th day serial sub-culture were selected for the experiment. 100 ul of culture was taken and spread on MHA plate with L-spreader. Above mentioned MIC strips were placed in the plates and incubated overnight at 37°C. Results were observed on next day.

No resistance was found against Piperacillin Tazobactam, Gentamycin, Ampicillin, Cefotaxime in the 7^th day serial sub-cultures of E coli which had become resistant to x4 MIC ciprofloxacin (Figure 30A and Figure 30B and Table 10).

Table 9: Selected Wells from 7^th day E Coli cultures:

Table 10: MIC values with different antibiotics- E Coli cultures SOS induced with Ciprofloxacin +/- MDRD1 or MDRD2.

Interpretation- Multi Drug Resistance development to Piperacillin Tazobactam, Gentamycin, Ampicillin , Cefotaxime was not observed in E coli which had become resistant to x4 MIC Ciprofloxacin when exposed to low dose Ciprofloxacin over 7 days in serial subculture.

Example 10

Results of Disc diffusion with Ciprofloxacin 5 ug on MHA agar of 10^th day E. coli serial sub-cultures which were continuously exposed to low dose ciprofloxacin for induction of SOS response, with or without MDRD1 or MDRD2 in BIOFILM and PLANKTONIC culture conditions.

The means of zone sizes measured by Ciprofloxacin disk diffusion, in replicate ciprofloxacin only treated E Coli cultures were reduced in comparison to untreated E coli cultures showing that bacteria had become resistant to ciprofloxacin after continuous exposure to low doses of ciprofloxacin. In cultures that were treated with a combination of ciprofloxacin and MDRD1 or MDRD2, the mean of zone sizes in replicate cultures were increased compared to zone sizes in ciprofloxacin only treated cultures demostrating that MDRD 1 and MDRD2 had inhibited the evolution of resistance to ciprofloxacin in the 10 day SOS induced sub-cultures. (Figure 35A and 35 B)

Example 11: Ciprofloxacin Sensitivity and Evolution of Resistance

Results: E coli type strain ATCC 117755 was grown in PLANKTONIC and BIOFILM culture conditions and treated the cultures with low dose ciprofloxacin alone or in combination with the inhibitors MDRD1 and MDRD2. E coli ATCC 117755 is sensitive to ciprofloxacin according to the criteria of CLSI (zone size >/=

26 mm, MIC < 1.0 ug/ml). On disk diffusion test with 5ug ciprofloxacin disk zone size was 31 mm, MIC test strip 0.032ug/ml, MIC test by macro dilution method 0.03 ug/ml.

Cultures were maintained in serial sub-culture for 10 -12 days to allow for the evolution of resistance to ciprofloxacin.

Continuous treatment of serial sub-cultures of E coli with low dose ciprofloxacin x0.5 MIC ( 0.016ug/ml) caused an increase in mutation rates by the end of the 10-12 day culture period, compared to untreated cultures also maintained in serial subculture for 10 days and the difference was statistically significant in both BIOFILM and PLANKTONIC growth conditions.

Culture Growth Conditions and Treatment with Inhibitors MDRD1 and MDRD2

E coli forms BIOFILM in the human body during infections at sites such as the urinary tract and in association with indwelling catheters (Sharma et al 2016)²⁴E coli infections at these sites are often treated with ciprofloxacin. Therefore it was important to grow the test organism in conditions that might promote biofilm formation, such as low culture volumes grown in flat bottomed tissue culture plates (Genevaux P et al)²⁵ in static conditions at 27 deg to 30 deg C²⁶ to test for the effects of the inhibitors MDRD1 and MDRD2 on the development of resistance to ciprofloxacin. Cultures were grown in planktonic conditions in 1 ml volumes with shaking at 37 deg C. Both sets of cultures received MDRD1 in doses of luM and 2 uM in planktonic growth conditions, 2 uM in biofilm cultures. MDRD2 dose was 5 uM and 7 uM in planktonic cultures and 7 uM in biofilm cultures. Inhibitors were combined with low dose ciprofloxacin in each case. The effect of MDRD inhibitors was not tested alone in the current evolution experiment series as in earlier dose finding pilot experiments it was found that there was no effect of MDRD1 or MDRD2 in various doses up to 10 uM for MDRD1 and up to 50uM for MDRD2, on ciprofloxacin sensitivity.

It is known that filamentous E. coli formed in response to ofloxacin, a fluoroquinolone with SOS response induction and the SOS response appeared to increase when ofloxacin was withdrawn. The filament formation was dependent on the SOS response. Therefore, persistence of antibiotic resistant E coli be may be indicated by the appearance of filamentous forms.

In the evolution of resistant culture series filamentous forms was observed in 87% of biofilm cultures and 62.8% of planktonic cultures both with the inhibitors as well as with ciprofloxacin alone. However, in cultures containing a combination of ciprofloxacin and MDRD1 or MDRD2 the frequency of filamentous forms are reduced compared to cultures treated with ciprofloxacin alone. This feature was observed in both biofilm and planktonic growth conditions and indicates that the SOS response and filament morphology are inhibited by MDRD1 and MDRD2.

To study the evolution of resistance to ciprofloxacin mutation rates were calculated in both biofilm and planktonic conditions. Figures 31 A and B shows a Graph showing distribution of mutation rates of untreated, ciprofloxacin treated, ciprofloxacin+ MDRD1 treated samples in both BIOFILM and PLANKTONIC condition. Data points are mean values of log mutation rates and error bars are representing standard deviation. Figure 31 C shows graph showing comparison of mean mutation rate of ciprofloxacin treated samples and ciprofloxacin+ 2 uM MDRD1 treated samples in BIOFILM condition with 95% CL

Figure 32A shows a Graph showing distribution of mutation rates of untreated, ciprofloxacin treated, ciprofloxacin+ MDRD2 treated samples in both BIOFILM and PLANKTONIC condition. Figure 32B shows a graph showing comparison of mean mutation rate of ciprofloxacin treated samples and ciprofloxacin+ 7 uM MDRD2 treated samples in BIOFILM condition with 95% Cl

Figure 33 shows a Box and whisker plot showing the distribution of mutation rates with 95% Cl in different growth conditions in planktonic cultures. Figure 34 A and 34 B shows Graph showing distribution of mutation rates in individual samples in E.coli biofilm and Planktonic cultures, respectively.

Analysis of log transformed mutation rates in planktonic conditions revealed extremely variable effects on the mutation rates on treatment with MDRD1 in 1 uM and 2uM and MDRD2 5uM and 7 uM in combination with ciprofloxacin. MDRD2 in 1 uM dose in combination with ciprofloxacin appeared to have reduced mutation rates close to that of untreated samples in 25% of samples. In contrast MDRD1 in 2 uM did not have the same effect on the reduction of mutation rates. MDRD2 in lower dose of 5uM in 30% samples also seemed to reduce mutation rates more than the higher dose of 7uM. The differences in the reduction of mutation rates for both MDRD1 and MDRD2 in either doses, when compared with ciprofloxacin alone were not statistically significant (p>.05). Analysis of log transformed mutation rates in biofilm conditions shows a statistically significant reduction of mutation rates in the case of MDRD1 2 uM and MDRD2 7 uM in combination with ciprofloxacin, compared with mutation rates in ciprofloxacin alone treated cultures. There both MDRD1 and MDRD2 appears to prevent the development of resistance to low dose ciprofloxacin. Exposure to low dose ciprofloxacin may occur during treatment of infections and in biofilms formed in the environment, which act as a reservoir of resistant bacteria. Thus, combination of MDRD1 and MDRD2 with ciprofloxacin will prevent the development of resistance and persistence of ciprofloxacin resistant bacteria. TABLE 11: TESTS OF STATISTICAL SIGNIFICANCE TO COMPARE MUTATION RATES IN DIFFERENT E.COLI CULTURE GROWTH CONDITIONS AND TREATMENT OF CULTURES.

Effect Sizes (Mutation Rate)

Biofilm Growth Conditions a.Untreated E coli cultures(1) vs Ciprofloxacin only treated cultures (2) (mean: -21.42, N1=15) (mean -4.63, N2=15)

Cohen’s D 6.3

Interpretation- Ciprofloxacin treated cultures had significantly higher mutation rates than untreated cultures, with large effect size. b. Cultures treated with Ciprofloxacin only (1) (mean: -4.63, N1 17)

Cultures treated with Ciprofloxacin + MDRD1 2uM (2)

(mean: -7.4 , N226) Hedges’ g = 1.022

Interpretation - Cultures treated with ciprofloxacin in combination with MDRD1 2uM in biofilm growth conditions had significantly lower mutation rates, with large effect size. c.Cultures treated with Ciprofloxacin only (1)

(mean: -4.63, N1 17)

Cultures treated with Ciprofloxacin + MDRD27uM (2)

(mean: -8.65 , N220)

Hedges g = 0.726 Interpretation - Cultures treated with ciprofloxacin in combination with MDRD2 7uM in biofilm growth conditions had significantly lower mutation rates, with large effect size.

The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention, in addition to those described herein, will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims. The invention is, therefore, to be limited only by the terms of the appended claims along with the full scope of equivalents to which the claims are entitled.

Claims

Claims:

1. A method of preventing resistance to antibiotics in bacteria by inhibiting SOS response, comprising treating the bacteria with 4-(1,3-dioxobenzo[de]isoquinolin-2- yl-N-(6-methylpyridine-2-yl) but an amide having formula I

and analogues or derivatives thereof.

2. A method of preventing resistance to antibiotics in bacteria by inhibiting SOS response comprising treating the bacteria with N-[3-(methylcarbamoyl) phenyl]-6- phenyl-1-lpropan-2-ylpyrazolo[3,4-b]pyridine-4-carboxamide having formula II

and analogues or derivatives thereof.

3. The method as claimed in claim 1 and claim 2, wherein the compound having formula I and the compound having formula II inhibits autoproteolysis of the SOS response regulator protein Lex A.

4. The method as claimed in claim 3, wherein the compound having formula I binds with the Glycine 80 of Lex A protein.

5. The method as claimed in claim 3, wherein the compound having formula II binds with the Lysine 156 of Lex A protein

6. The method as claimed in claim 1 and claim 2, wherein the antibiotic is selected from Ciprofloxacin and other fluoroquinolone antibiotics.

7. Use of a compound having formula I for inhibition of SOS response in bacteria against antibiotics by inhibiting autoproteolysis of Lex A.

8. Use of a compound having formula II for inhibition of SOS response in bacteria against antibiotics by inhibiting autoproteolysis of Lex A.

9. A composition comprising a compound having formula I, wherein the compound having formula I inhibits Lex A protein induced SOS response in bacteria.

10. A composition comprising a compound having formula II, wherein the compound having formula II inhibits Lex A protein induced SOS response in bacteria.

11. The composition as claimed in claims 9-10, wherein the composition further comprises excipients and diluents.

12. The composition as claimed in claim 9-10, wherein the compositions are formulated in the form of liquids, powder, aerosol and sprays.

13. A method for treating hospital surfaces and equipments with a compound of formula I.

14. A method for treating hospital surfaces and equipments with the compound of formula II.

15. A combination comprising an antibiotic and a compound having formula I.

16. A combination comprising an antibiotic and a compound having formula II.

17. The combination as claimed in claims 15 and 16, wherein the antibiotic is selected from Ciprofloxacin and other fluoroquinolone antibiotics.

18. The combination as claimed in claims 15 and 16, wherein the combination prevents antibiotic resistance in animals and humans by inhibiting SOS response in bacteria against the antibiotic.