WO2021146814A1 - Ultrasensitive loop mediated isothermal amplification (us-lamp) to detect malaria - Google Patents

Abstract

Described herein is a method for detecting malaria from patient blood samples comprising loop mediated isothermal amplification of Plasmodium species including P. vivax, P. ovate, P. falciparum, P. malarae or P. knowlesi. Sets of genus- and species-specific oligonucleotide primers are used to amplify regions of the 18S rRNA gene.

Description

ULTRASENSITIVE LOOP MEDIATED ISOTHERMAL AMPLIFICATION fUS-LAMPt TO

DETECT MALARIA

CROSS REFERENCE TO RELATED APPLICTION

[0001] This application claims priority to United States Provisional Patent

Application number US 62/965,600, filed January 24, 2020, the entire contents of which is hereby incorporated by reference.

FIELD

[0002] The present disclosure relates generally to Ultrasensitive Loop Mediated

Isothermal Amplification (US-LAMP) to detect malaria for elimination.

BACKGROUND

[0003] Malaria elimination requires diagnostic methods able to detect parasite levels well below what is currently possible with microscopy and rapid diagnostic tests. This is particularly true in surveillance of malaria at the population level that includes so- called “asymptomatic” individuals.

[0004] In 2016, there were approximately 216 million estimated cases of malaria identified globally[1 ]. However, more cases remained undetected as the diagnosis of low-level infections is challenging at the field level. Approximately, 20-70% of the malaria infections are reported to be undetected by current non-nucleic acid tests such as microscopy and rapid diagnostic tests (RDTs)[2] RDTs and microscopy can detect Plasmodium infection when the parasite count is higher than 50, 000-200, 000/mL of whole blood[3-5]. Molecular detection tools have provided a window into these undetected cases which comprise the asymptomatic reservoir from which transmission can occur[6]. Questions remain as to whether these individuals are truly asymptomatic, but it is becoming apparent that they contribute to onward transmission[7-9]. Low-level infections can be detected by molecular diagnostic tools, such as PCR, Real Time PCR (qPCR) and Reverse Transcriptase-qPCR (RT-qPCR); however, these time-consuming methods are sophisticated, require a big budget for initial laboratory set up as well as expert personnel to operate the labs[10-12].

[0005] In contrast to PCR or qPCR, loop mediated isothermal amplification

(LAMP) based methods are quick, simple, and require little capital equipment. Several in- house LAMP assays have efficiently detected Plasmodium infection[13, 14] as well as identified drug resistance associated genetic markers in P. falciparum[15, 16], Currently, two complete commercial kits are available in the market: LoopAmp malaria (Pan/Pf) detection kit (Eiken Chemical Company, Tokyo, Japan) and lllumigene malaria LAMP assay (Meridian Biosciences, Cincinnati, USA), both of them have been reported to detect symptomatic malaria cases with high sensitivity and specificity[10-12, 17-19], These kits possess a limit of detection (LOD) of approximately 1000 parasites/mL; however, at the field level, parasite density can be much lower than 1000 parasites/mL. In some instances, almost 50% of the asymptomatic patients harbor a parasite level that beyond the LOD of these two kits (ie < 1000 parasite/mL)[6, 20], For example, the LoopAmp malaria kit was reported to be only 40.8% sensitive in an asymptomatic survey in Zanzibar[20], Therefore, the efficiency of the commercial LAMP assays are equivalent to the gold standard nested PCR which has a LOD ranging from 1000-10,000 parasites/mL[21], However, 18S rDNA based high volume qPCR[22] and 18S rRNA based RT-qPCR[23] have been reported recently to have a LOD of approximately 20 parasites/mL from whole blood. Additionally, 18S rRNA was found to be stable in filter paper dried blood spots (DBS) for up to six months while providing enough template to be detected by RT-qPCR[24], Previously, a field tailored reverse transcriptase LAMP demonstrated a LOD of 0.8 parasite/mL of whole blood using the gene exp1 [25], In contrast, 18S rRNA is known to be a stable target for RT-qPCR and advantageous as a multicopy target because a single P. falciparum parasite contains approximately 10,000 copies of 18S rRNA at the ring stage[23]. Although such quantitative data was not obtained for other species, some copies of the 18S rRNA gene are highly expressed at the asexual blood stages in other species[26-28],

SUMMARY

[0006] In one aspect there is provided a method of identifying a subject infected with a Plasmodium, comprising:

[0007] i) contacting a sample from a subject having a Plasmodium or suspected of having a Plasmodium, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

[0008] ii) incubating the resulting mixture at a reaction temperature and a reaction time; and

[0009] iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule,

[0010] wherein, if a signal detected, the subject is determined to have a

Plasmodium infection,

[0011] wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection.

[0012] In one aspect there is provided method of identifying a subject infected with a Plasmodium, comprising:

[0013] i) contacting a sample from a subject having a Plasmodium or suspected of having a Plasmodium, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

[0014] ii) incubating the resulting mixture at a reaction temperature and a reaction time; and

[0015] iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule,

[0016] wherein, if a signal detected, the subject is determined to have a

Plasmodium infection,

[0017] wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection.

[0018] In one example, the reaction temperature is about 63°C and the reaction time is about 30 minutes.

[0019] In one example, said Plasmodium is P. ova/e, P. vivax, P. falciparum, P.

Malarae or P. knowlesi.

[0020] In one aspect there is provided a method of identifying a subject infected with a P. falciparum, comprising:

[0021] i) contacting a sample from a subject having a P. falciparum or suspected of having a P. falciparum, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

[0022] ii) incubating the resulting mixture at a reaction temperature and a reaction time; and

[0023] iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule,

[0024] wherein, if a signal detected, the subject is determined to have a

Plasmodium infection,

[0025] wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection.

[0026] In one example, the reaction temperature is about 63°C and the reaction time is about 60 minutes.

[0027] In one example, said reaction mixture further comprises a detectable label.

[0028] In one example, said detectable label comprises a fluorescent moiety, a fluorogenic moiety, a chromogenic moiety, a hapten, an affinity tag, or a radioactive isotope.

[0029] In one example, said detectable label is SYBR green.

[0030] In one example, said subject is an animal, such as a domesticated animal, for example a cats or a dog; livestock such as a cow, a horse, a pig, a sheep, or a goat; a laboratory animal, such as a mouse, a rabbit, a rat, a guinea pig; a non-human mammals, such as a primate; a birds; a reptiles; an amphibians; a fish; or a human.

[0031] In one example, said target nucleic acid comprises or consist of 18S rRNA.

[0032] In one aspect there is provided an isolated polynucleotide comprising or consisting of the nucleotide sequence of SEQ ID Nos 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22.

[0033] In one aspect there is provided a kit comprising one or more isolated polynucleotides comprising or consisting of the nucleotide sequence of SEQ ID Nos 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22, and optionally a container, and/or optionally instructions for the use thereof.

[0034] In one aspect there is provided a kit comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[0035] In one aspect there is provided a kit comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[0036] In one aspect there is provided a commercial package comprising one or more isolated polynucleotides comprising or consisting of the nucleotide sequence of SEQ ID Nos 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22, and optionally a container.

[0037] In one aspect there is provided a commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[0038] In one aspect there is provided a commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[0039] In one aspect there is provided a commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

BRIEF DESCRIPTION OF THE FIGURES

[0040] Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached Figures.

[0041] Fig. 1 : Amplification curve obtained from CFX96 Real Time system for

Pan-LAMP assay. Here, a & b shows the amplification curve of P. falciparum dilution extracted from whole blood and DBS respectively e(one representative of each triplicate experiments). Similarly, c & d; e & f describe the amplicons obtained for P. vivax and P. ovale serial dilutions from whole blood and DBS extracts respectively. The threshold bar was fixed at 200 relative fluorescence units (RFU) to keep all background noise under the bar. The numbers indicated next to each curve are parasite count/mL. [0042] Fig. 2: Validation of Pan US-LAMP assay on serially diluted clinical specimens. US-LAMP assay was 427 carried on whole blood (a, c, e) and dried blood spot (DBS) extracted total nucleic acid (b, d, f). Here, a & b; c & d; e& f summarized the data obtained from P. falciparum, P. vivax and P. ovale serial dilutions prepared from clinical specimens. Data was obtained from triplicate experiments where error bars indicate standard error of mean (SEM). Threshold time (min=minutes) was determined by placing the threshold bar at 200 RFU in the CFX96 Real Time system. R² indicates curve fitness value.

[0043] Fig. 3: Validation of P. falciparum specific US-LAMP assay on clinical specimens using whole blood (a, b) and dried blood spot (c, d) extracted total nucleic acid. Experiments were performed in triplicate where error bars indicate standard error of mean (SEM). A and C are the representative ones of each triplicate experiments. Here again, the threshold time (min=minutes) was determined by placing the threshold bar at 200 RFU in the CFX96 Real Time system. Each number/mL is indicative of parasite count/mL and R2 indicates curve fitness value.

[0044] Fig. 4: Observation of fluorescence by pre-addition of gel green in the reaction mixture. Here, results were shown for P. vivax dilutions. A representative experiment is shown. DBS stands for dried blood spot.

[0045] Fig. 5: Initial optimization of the genus-specific (pan) US-LAMP assay on

3D7 culture spiked whole blood. Here, reaction time was plotted against log parasite count per mL. Results were obtained through US-LAMP assay using trizol-saponin extracted total nucleic acid from whole blood (A) and spin-column extracted total nucleic acid from filter paper dried blood spots (B). Experiments were performed in triplicate and error bars in the figure indicate standard error of mean (SEM). Threshold time (min=minutes) was determined by placing the threshold bar at 200 relative fluorescence units (RFU) in the CFX96 Real Time system.

[0046] Fig. 6: Gel green fluorescence observed after Pan-LAMP assay on P. ovale dilutions from batched total nucleic acid extraction approach. Here, top row shows the results from a typical single spot assay (LOD; 25-50 parasites/mL); middle row depicts the results obtained after combination of three negative control spots with one positive spot of variable parasite count. Similarly, the bottom row delineates the outcome of the combination of one positive spot with four negative control spots. NTC stands for no template control (water control). This figure is one representative of a triplicate experiment.

[0047] Fig. 7: depicts the results of amplification using Pan Primer (Han) and

New genus primers set-1 , with various samples. Comparison of amplification time required by Pan primers set and new genus specific primer set-1. Here, serially diluted P. falciparum (strain 3D7) culture spiked blood was used to determine the LOD of the assays.

DETAILED DESCRIPTION

[0048] Generally, the present disclosure provides the first ultrasensitive loop mediated amplification method capable of detecting malaria from both whole blood and dried blood spots.

[0049] In a one aspect, described herein is the use of isothermal amplification in the method of detecting a Plasmodium in a sample from a subject.

[0050] In a one aspect, described herein is the use of isothermal amplification in the method of detecting a P. falciparum in a sample from a subject.

[0051] In some examples, described herein is the use of isothermal amplification in the method of detecting a P. vivax, a P. ovale, a P. falciparum, P. Malarae or a P. knowiesi,. in a sample from a subject.

[0052] Isothermal amplification refers to nucleic acid amplification that is not dependent on significant changes in temperature. Isothermal amplification is carried out substantially at about the same single temperature. In some examples, isothermal amplification is substantially isothermal, for example, may include small variations in temperature, such as changes in temperature of about 1° C to about 2°C, during the amplification reaction.

[0053] In a specific example, the isothermal amplification used is loop-mediated isothermal amplification (LAMP). LAMP is a method for amplifying DNA and/or RNA, which is a single-step amplification reaction utilizing a DNA polymerase with strand displacement activity and/or reverse transcriptase.

[0054] In one example, a polypeptide used in LAMP has both DNA polymerase and strand displacement activity and reverse transcriptase activity. In another example, two separate polypeptide are used, a first polypeptide with DNA polymerase and strand displacement activity, and a second polypeptide with reverse transcriptase activity. [0055] Typically, at least four primers, which are specific for eight regions within a target nucleic acid sequence, are typically used in LAMP. However, in some examples, two primers may be used for LAMP. In some example, five primers are used. In other examples, six primers are used. In still other examples, more than six primers are used. [0056] LAMP-based technology possesses the advantages of high sensitivity, rapid amplification, and simple operation.

[0057] In addition, the ability to amplify nucleic acid under isothermal conditions enables the use of simple and cost-effective equipment, without the requirement of thermal cycling.

[0058] In LAMP assays, both the amplification and detection of specific amplicons may be accomplished in a single step, thereby significantly decreasing the reaction time compared to other amplification reactions, such as PCR.

[0059] In some examples of LAMP, in the case in which six primers are used, typically, the primers include a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (FIP), and a backward inner primer (BIP). A forward loop primer (LPF), and a backward loop primer (LPB). The amplification reaction includes a DNA polymerase having strand displacement activity, and produces a stem-loop DNA with inverted repeats of the target nucleic acid sequence. LAMP methods are known.

[0060] We have targeted 18S rRNA and corresponding genes that remains stable on DBS for up to 5 months

[0061] In the case of P. falciparum, lower limits of detection of 25 parasite/mL and

50-100 parasite/mL from whole blood and DBS were obtained, respectively. A sensitivity of 97.0% (95% Cl; 2.5-99.8) and specificity of 99.1% (95% Cl; 97.6-99.7) was obtained for the detection of all species in asymptomatic individuals from Africa and Asia (n=494). [0062] A "gene" is an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a specific functional product and may include untranslated and untranscribed sequences in proximity to the coding regions (5 ' and 3 ' to the coding sequence). Such non-coding sequences may contain regulatory sequences needed for transcription and translation of the sequence or introns, etc.

[0063] The term “infection” as used herein, refers to a disease or condition attributable to the presence in a host of a foreign organism or agent that reproduces within the host. Infections typically involve breach of a normal mucosal or other tissue barrier by an infectious organism or agent. [0064] A subject that has an infection is a subject having objectively measurable infectious organisms or agents present in the subject's body.

[0065] A subject at risk of having an infection is a subject that is predisposed to develop an infection. Such a subject can include, for example, a subject with a known or suspected exposure to an infectious organism or agent. A subject at risk of having an infection also can include a subject with a condition associated with impaired ability to mount an immune response to an infectious organism or agent.

[0066] The term “Plasmodium" refers to a protozoan parasite. In some example, a plasmodium may infect a subject.

[0067] The term "Plasmodium falciparum" refers to a protozoan parasite that causes malaria, and is typically transmitted by Anopheles mosquitoes.

[0068] In one example, the subject has or is suspected of having a P. falciparum infection. Thus, in some examples, “infection” refers to an infection caused by P. falciparum.

[0069] In other examples, the subject has or is suspected of having a P. Malarae,

P. ovae, P. vivax, orP. knowlesi, infection. Thus, in some example, “infection” refers to an infection caused by P. Malarae, P. ovae, P. vivax, or P. knowlesi.

[0070] Malaria has traditionally been treated with quinolines, such as chloroquine, quinine, mefloquine, and primaquine, and with antifolates, such as sulfadoxine- pyrimethamine.

[0071] Artemisinin combination therapy (ACT) is the current World Health

Organization (WHO) recommended treatment against uncomplicated malaria.

[0072] Artemisinin is a sesquiterpene lactone endoperoxide extracted and isolated from the leaves of Artemisia annua, and well-known as an antimalarial medicine. [0073] In some examples, in ACT combination therapy, a combination of an artemisinin derivative with a longer-acting antimalarial that has a different mode of action. [0074] Examples of treatment of uncomplicated P. falciparum malaria include, but are not limited to: artemether plus lumefantrine; artesunate plus amodiaquine; artesunate plus mefloquine; dihydroartemisinin plus piperaquine; or artesunate plus sulfadoxine- pyrimethamine (SP).

[0075] It will be appreciated that treatment and dosage(s) may vary with age of subject, whether the subject is pregnant, the presence of co-infection (e.g., co-infection with HIV), and /or geographical location (e.g., if a subject is in a country or region with endemic malaria).

[0076] Artemisinin resistant malaria is increasing rapidly, for example in southeast Asia.

[0077] In the case in which a P. falciparum infection is or becomes resistant to

ACT treatment, in some examples, the subject may be treated with Artemsinin combination therapy (ACT) for 7 days or ACT plus Mefloquine for 3 days, based on expert opinion.

[0078] LAMP methods are known.

[0079] Generally, in LAMP, the amplification reaction includes a DNA polymerase having strand displacement activity, and produces a stem-loop DNA with inverted repeats of the target nucleic acid sequence. In some examples, a reverse transcriptase is also used.

[0080] In a specific example of the present application, six primers are used in

LAMP.

[0081] In another specific example, eight primers are use in LAMP.

[0082] The reaction is carried out under conditions suitable for LAMP.

[0083] As noted above, a LAMP reaction is typically performed at a substantially constant temperature.

[0084] In some example, the reaction temperature is about 61 °C to about 67°C.

In a specific example, the reaction temperature is about 63°C.

[0085] In some example, the reaction time is about 20 minutes to about 70 minutes. In a specific example, the reaction time is about 30 minutes. In another specific example, the reaction time is about 60 minutes.

[0086] Non-limiting examples of DNA polymerase with strand displacement activity include, Bst DNA polymerase; Bst DNA polymerase large fragment; Bst 3.0 DNA polymerase; Bca (exo-)DNA polymerase; DNA polymerase I Klenow fragment; Bsu DNA Polymerase, large Fragment; Vent DNA polymerase; Vent (exo-)DNA polymerase (Vent DNA polymerase deficient in exonuclease activity); Deep Vent DNA polymerase; Deep Vent(exo-)DNA polymerase (Deep Vent DNA polymerase deficient in exonuclease activity); cp29 phage DNA polymerase; MS-2 phage DNA polymerase; TopoTaq DNA Polymerase, or Bst 2.0 WarmStart DNA polymerase. In a specific example the DNA polymerase is Bst 2.0 WarmStart DNA polymerase. [0087] Non-limiting examples of RNA reverse transcriptase include, but are not limited to, Warm Start reverse transcriptase.

[0088] As will be appreciated, the reaction mixture will include a variety of reagent, including but not limited to, buffers (e.g., TRIS-HCI), chelating agents, salts and/or ions (e.g., KCI, (NH₄)₂SO₄, a betaine and MgSO₄), a detergent (e.g., Tween® 20 or Triton X-100,), deoxyribonucleotides (dNTP), and any other ingredient that are useful in supporting and/or optimizing a particular reaction, such as a dye for detection of duplexed nucleic acid accumulation, a probe for detection of product, single strand binding proteins or recombinase enzymes, reverse transcriptase. Useful and optimal concentrations of each ingredient can be determined empirically. The reaction mixture is incubated at a temperature or combination of temperatures effective to produce amplification products using any given assay. Optimal temperature ranges and patterns are determined empirically.

[0089] The term “subject”, as used herein, refers to an animal, and can include, for example, domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.), mammals, non-human mammals, primates, non-human primates, rodents, birds, reptiles, amphibians, fish, and any other animal. In a specific example, the subject is a human.

[0090] The term “sample” or “biological sample”, as used herein, refers to animal or human samples including, without limitation, any biological fluid (blood, bone marrow, plasma, serum, bronchoalveolar washing fluid, urine, nasal secretion, ear secretion, urethral secretion, cerebrospinal fluid, pleural fluid, synovial fluid, peritoneal fluid, sputum, lymph, plasma, ejaculate, lung aspirate, etc.), cell, tissue, organ or portion thereof that contains DNA. A sample can be obtained by conventional methods, using processes known in the state of the art by the person skilled in the art. In some examples, a sample is used directly (e.g., fresh or frozen), or can be manipulated prior to use, for example, by extraction (for example of nucleic acids), fixation (e.g., using formalin) and/or embedding in wax (such as FFPE tissue samples). In a specific example, the sample is a blood sample.

[0091] The terms "nucleic acid," “polynucleotides,” and “oligonucleotides” refers to biopolymers of nucleotides and, unless the context indicates otherwise, includes modified and unmodified nucleotides, and both DNA and RNA. [0092] In some examples, the methods as described herein may be performed using DNA as the nucleic acid template for amplification.

[0093] In some examples, the methods as described herein may be performed using RNA as the nucleic acid template for amplification.

[0094] In some examples, the methods as described herein may be performed using DNA and RNA as the nucleic acid templates for amplification.

[0095] In a specific example, the RNA is rRNA. In a more specific example, the rRNA is 18S RNA.

[0096] The nucleic acid or “target nucleic acid” is generally contained in a biological sample.

[0097] The sample or biological sample may be obtained from a subject. The sample or biological sample also includes intracellular parasitic genomic DNA or RNA such as from P. falciparum. Accordingly, in one example, the target nucleic acid is P. falciparum nucleic acid. The nucleic acid may be derived from nucleic acid contained in said biological sample. For example, genomic DNA, or cDNA synthesized from mRNA, or nucleic acid amplified on the basis of nucleic acid derived from the biological sample. [0098] The term “primer”, “oligonucleotide” or “oligonucleotide primer” refers to a short polynucleotide that satisfies the requirements that it must be able to form complementary base pairing sufficient to anneal to a desired nucleic acid template, for use in LAMP. It will be appreciated that the primer backbone is not necessarily limited to the one via phosphodiester linkages. For example, it may be composed of a phosphothioate derivative having S in place of O as a backbone or a peptide nucleic acid based on peptide linkages. The bases may be those capable of complementary base pairing.

[0099] The oligonucleotides as used herein can function not only as the origin of synthesis but also as a template for synthesis of complementary chain. The term polynucleotide includes oligonucleotides, which have a relatively short chain length. Significantly, a primer need not be fully complementary in order to anneal to a binding site on a polynucleic acid.

[00100] The oligonucleotide primers are generally isolated.

[00101] The terms isolated as used herein generally refers to a biological component (such as a nucleic acid) that has been substantially separated or purified away from biological or other components. Nucleic acids that have been “isolated” include nucleic acids purified by standard purification methods. The term also embraces nucleic acids prepared by recombinant expression in a host cell and subsequently purified, as well as chemically synthesized nucleic acid molecules. Isolated does not require absolute purity, and can include nucleic acid molecules that are at least 50% isolated, such as at least 75%, 80%, 90%, 95%, 98%, 99%, or even 99.9% isolated. An isolated nucleic acid may be in solution (e.g., water or an aqueous solution) or dried. [00102] LAMP amplification products may be determined and/or measured in a variety of ways, as would be known to the skilled worker.

[00103] The LAMP amplification product produced by the methods disclosed herein may be deterred by any suitable method, including but not limited to, detection of turbidity, color, fluorescence, or by gel electrophoresis. In some examples, the detection can be carried out “by eye” (e.g., visually observing changes in turbidity, color, or fluorescence under ambient or ultraviolet light) or using an appropriate instrument (e.g., a turbidometer, fluorimeter, or spectrophotometer).

[00104] In some example, the reaction mixture further comprises a detectable label.

[00105] Non limiting example of detectable labels include fluorescent or fluorogenic moieties (e.g., fluorophores), chromogenic moieties, haptens (such as biotin, digoxigenin, and fluorescein), affinity tags, and radioactive isotopes (such as ³²P, ³³P, ³⁵S, and ¹²⁵l).

[00106] In some examples, a fluorescent dye is used. In some examples, fluorescence of a fluorescent indicator dye is increased by a stimulus, such as binding of a metal ion. In other examples, fluorescence of a fluorescent indicator dye is decreased (quenched) by a stimulus, such as binding of a metal ion. The fluorescent indicator dye can be detected by any suitable method, including visually (e.g., under ambient or ultraviolet light) or using instrumentation for detection of fluorescence.

[00107] In some examples, the fluorescent indicator dye is calcein.

[00108] In some example, the fluorophore includes but is not limited to fluorescein dyes such as fluorescein dT, 5-carboxyfluorescein (5-FAM), 6-carboxyfluorescein (6- FAM), 2', 4', 1 ,4,-tetrachlorofluorescein (TET), 2', 4', 5', 7', 1 ,4-hexachlorofluorescein (HEX), and 2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE)), cyanine dyes such as Cy5, dansyl derivatives, rhodamine dyes (e.g. tetramethyl-6-carboxyrhodamine (TAMRA), and tetrapropano-6-carboxyrhodamine (ROX)), DABSYL, DABCYL, cyanine, such as Cy3, anthraquinone, nitrothiazole, and nitroimidazole compounds, or other nonintercalating dyes.

[00109] Method of the invention are conveniently practiced by providing the compounds and/or compositions used in such method in the form of a kit. Such kit preferably contains the composition. Such a kit preferably contains instructions for the use thereof.

[00110] In one aspect there is provided a method of identifying a subject infected with a Plasmodium, comprising:

[00111] i) contacting a sample from a subject having a Plasmodium or suspected of having a Plasmodium, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

[00112] ii) incubating the resulting mixture at a reaction temperature and a reaction time; and

[00113] iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule,

[00114] wherein, if a signal detected, the subject is determined to have a Plasmodium infection,

[00115] wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection. [00116] In one aspect there is provided method of identifying a subject infected with a Plasmodium, comprising:

[00117] i) contacting a sample from a subject having a Plasmodium or suspected of having a Plasmodium, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

[00118] ii) incubating the resulting mixture at a reaction temperature and a reaction time; and

[00119] iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule,

[00120] wherein, if a signal detected, the subject is determined to have a Plasmodium infection,

[00121] wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection.

[00122] In one example, the reaction temperature is about 63°C and the reaction time is about 30 minutes.

[00123] In one example, said Plasmodium is P. ova/e, P. vivax, P. falciparum, P. Malarae or P. knowlesi. [00124] In one aspect there is provided a method of identifying a subject infected with a P. falciparum, comprising:

[00125] i) contacting a sample from a subject having a P. falciparum or suspected of having a P. falciparum, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

[00126] ii) incubating the resulting mixture at a reaction temperature and a reaction time; and

[00127] iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule,

[00128] wherein, if a signal detected, the subject is determined to have a Plasmodium infection,

[00129] wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection.

[00130] In one example, the reaction temperature is about 63°C and the reaction time is about 60 minutes.

[00131] In one example, said reaction mixture further comprises a detectable label.

[00132] In one example, said detectable label comprises a fluorescent moiety, a fluorogenic moiety, a chromogenic moiety, a hapten, an affinity tag, or a radioactive isotope.

[00133] In one example, said detectable label is SYBR green. [00134] In one example, said subject is an animal, such as a domesticated animal, for example a cats or a dog; livestock such as a cow, a horse, a pig, a sheep, or a goat; a laboratory animal, such as a mouse, a rabbit, a rat, a guinea pig; a non-human mammals, such as a primate; a birds; a reptiles; an amphibians; a fish; or a human.

[00135] In one example, said target nucleic acid comprises or consist of 18S rRNA. [00136] In one aspect there is provided an isolated polynucleotide comprising or consisting of the nucleotide sequence of SEQ ID Nos 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22.

[00137] In one aspect there is provided a kit comprising one or more isolated polynucleotides comprising or consisting of the nucleotide sequence of SEQ ID Nos 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22, and optionally a container, and/or optionally instructions for the use thereof.

[00138] In one aspect there is provided a kit comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[00139] In one aspect there is provided a kit comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[00140] In one aspect there is provided a commercial package comprising one or more isolated polynucleotides comprising or consisting of the nucleotide sequence of SEQ ID Nos 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22, and optionally a container.

[00141] In one aspect there is provided a commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[00142] In one aspect there is provided a commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[00143] In one aspect there is provided a commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

[00144] To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in anyway.

[00145] EXAMPLES

[00146] In some aspects, we have developed a single reaction tube, low-cost ultrasensitive LAMP (US-LAMP) test targeting 18S rRNA for all malaria species. This relatively inexpensive and easy-to-perform test works from whole blood and dried blood spots (DBS) and can be used for ultrasensitive visual detection of malaria for elimination surveillance efforts in low middle-income countries (LMIC).

[00147] Abstract:

[00148] Background: Malaria elimination requires diagnostic methods able to detect parasite levels well below what is currently possible with microscopy and rapid diagnostic tests. This is particularly true in surveillance of malaria at the population level that includes so-called “asymptomatic” individuals.

[00149] Method: We have developed the first ultrasensitive loop mediated amplification method capable of detecting malaria from both whole blood and dried blood spots. We have targeted 18S rRNA and corresponding genes that remains stable on DBS for up to 5 months

[00150] Results: In the case of P. falciparum, lower limits of detection of 25 parasite/mL and 50-100 parasite/mL from whole blood and DBS were obtained, respectively. A sensitivity of 97.0% (95% Cl; 2.5-99.8) and specificity of 99.1% (95% Cl; 97.6-99.7) was obtained for the detection of all species in asymptomatic individuals from Africa and Asia (n=494).

[00151] Conclusion: This tool is ideally suited for low middle-income countries where malaria is endemic and ultrasensitive surveillance of malaria is highly desirable for elimination.

[00152] Methods and materials:

[00153] Primer design. For Plasmodium genus-level detection, a set of genus- specific (Pan) primers was adopted from a previous study[13]. Modified P. falciparum- specific primers (Pf) were developed for this study (Table 1)[29] Briefly, P. falciparum- specific primers were modified to amplify a specific region of the 18S rRNA gene located at chromosome 5 and 7, since these two copies are highly expressed at the blood stages of their life cycle [23, 30],

[00154] Table 1

Primer set; Primer name Sequence

Genus (Han et al, 2007) F3 GTATCAATCGAGTTTCTGACC (SEQ. I D NO: 23)

B3 CTTGTCACTACCTCTCTTGT (SEQ ID NO: 24)

F1P TCG A ACTCT A ATT C CCCGTTAC CTATCAGCTTTTG ATGTTAGGGT ( SEQ ID NO : 25 )

B1P CGGAGAGGGAGCCT G AG AAAT AG AATT G G GT A ATTT A CG C G (SEQ ID NO: 26)

LPF CGTCATAGCCATGTTAGGCC (SEQ ID NO: 27)

LPE AGCTACCACATC7AAGGAAGGCAG (SEQ ID NO: 28)

P falciparum F3 TGGTGG G AATTT A AA AC CTTC (SEQ ID NO: 17)

(modified from Mchon ef cri,2014) B3 CGCTTTAATACGCrr CCT c (SEQ ID NO: 18)

F1P GCTA77GGAGC7GGAA77ACCGCAGAGTAACAA7TGGAGGG (SEQ ID NO: 19)

B1P GT7GCAGT7AAAACGCTCG7AGTC7AAAA7AGTTCCCC7AGAA7AG7 (SEQ ID NO: 20)

LPF CTGCTGGCACCAGACTT (SEQ ID NO: 21)

LPE TGAATTTCAAAGAATCGATATTTTATTGTAACT (SEQ ID NO: 22)

[00155] Nucleic acid extraction -whole blood. For whole blood specimen, a modification 110 of the traditional Trizol Reagent (Invitrogen, Burlington, ON) based RNA extraction protocol was used. Briefly, 250mI_ of whole blood was mixed with 50mI_ of 5% Saponin (Sigma-Aldrich, Oakville, ON) solution and kept at room temperature for 15 minutes. In this step, blood was mixed with saponin by shaking the tubes by hand, no vigorous mixing such as vortex mixing was applied. Then, Saponin lysate was mixed and homogenized with 1500 mI_ of Trizol reagent (pH was adjusted to 7.2) and kept at room temperature for 10 minutes. Afterward, blood lysate was centrifuged at 4°C and 10,000 rpm for 5 minutes and the supernatant decanted for downstream purification. The subsequent steps were performed according to the manufacturer’s instructions except for the final washing step (no 70% ethanol required) [31], Two mI_ of the extract was used for each US-LAMP reaction. [00156] Nucleic acid extraction - Dried Blood Spots (DBS). A modified total nucleic acid extraction protocol from DBS was used [24], Fifty mI_ of the whole blood sample was spotted onto Whatman 903 protein saver card (GE Healthcare, Mississauga, ON), allowed to air-dry overnight. A standard 6mm-diameter hole puncher was used to cut spots into individual tubes. Dried blood containing filter paper pieces were mixed with lysis buffer [24] and incubated at 65°C and 250 rpm shaking speed for 2.5 hours in an orbital shaker. We transferred 700mI_ supernatant into HiBind® DNA mini columns (Omega Bio-tek, Norcross, GA) and centrifuged at 2000rpm for 2 minutes followed by another spinning step of 8000rpm for one minute. Column-bound nucleic acid was washed with 500 mI_ of the “wash buffer 1” by centrifuging the column at 8000rpm for 1 minute. Columns were washed with 500 mI_ of the “wash buffer 2” through centrifuging at 13000rpm for 3 minutes. An eluate of total nucleic acid with 50 mI_ of TE buffer (five minutes wait after the addition of TE buffer) was obtained by centrifuging at 8000 rpm for one minute. Ten mI_ of the filter paper extract was used in a single US-LAMP reaction.

[00157] Additional specific example of total nucleic acid extraction from filter paper dried blood spots

[00158] In a specific example, the lysis buffer comprises: 3M Guanidine thiocyanate, 16.7% Isopropanol 2% Triton X100, 10mM EDTA, 5mM Tris-HCI pH 7.4, 0.1% 6N HCI, 0.5% 2-mercaptoethanol (pH 6.0-6.5)

[00159] In a specific example, wash buffer-1 is the same as the lysis buffer, except no 2-mercaptoethanol.

[00160] In a specific example, hase buffer-2 comprises: 25% Ethanol, 25% Isopropanol, 100mM sodium chloride, 10mM Trizma HCI pH 7.4.

[00161] Ultrasensitive loop mediated amplification (US-LAMP) conditions. Bst 2.0 WarmStart® DNA polymerase was combined with WarmStart® reverse transcriptase in 1X Isothermal Amplification Buffer (New England Biolabs, Whitby, ON) to perform the US- LAMP assay. In a 25-μL LAMP reaction mixture, 1.6 mM F1P and B1P, 0.8 mM LPF and LPB, 0.2 mM F3 and B3 primer concentrations, 8mM MgSO₄, 1.4 mM dNTPs, 0.8M Betaine (Sigma-Aldrich, Oakville, ON, Canada), 8 unit of Bst 2.0 WarmStart® DNA Polymerase and 7.5 unit of Warm Start® reverse transcriptase were used. The assay was optimized with pre-addition of 0.5μL of 50X SYBR green (Invitrogen, Burlington, ON) in the reaction mixture. Amplification was measured based on increased relative fluorescence units (RFU) per minute in the CFX- 96 Real-Time PCR detection system (Bio-Rad, Mississauga, ON). A threshold RFU value of 200 was chosen based on the background noise. Optimization studies were performed to arrive at the ideal incubation of 63°C for both Pan and Pf-LAMP assays. The final assay duration was fixed at 30 minutes for the Pan-LAMP assay and 60 minutes for the Pf-LAMP assay after optimizing the amplification curves using the CFX96 Real Time System. For visual detection of LAMP amplification, one micro-liter of 0.35% (v/v) Gel green (Biotium, Freemont, CA), and 3mM Hydroxynapthol blue (Sigma-aldrich, Oakville, ON), was added to the master mix [32] Nuclease free water (VWR, Mississauga, ON) was used to constitute the final reaction volume. After amplification, the reaction tubes were exposed to blue LED light using a Blue Light Transilluminator (New England Biogroup, Atkinson, NH) to visualize the fluorescence due to the inter-chelation of gel green with the amplicons.

[00162] Limit of detection (LOD) analysis. Uninfected blood, collected from a healthy donor, was spiked with in vitro culture of P. falciparum strain 3D7. A serial dilution of spiked blood with uninfected blood was made resulting in a parasite count range of 1 to 10,000 parasite/mL. Total nucleic acid was extracted from whole blood as well as from the DBS (50μL) prepared from each dilution. Subsequently, the nucleic acid was amplified from the extracts by genus (Pan) and P. falciparum (Pf)-specific primers sets in the CFX-96 Real Time system. To detect real-time 156 amplification, fluorescence measurement was taken every minute.

[00163] After initial assessment on culture-spiked blood, whole blood from one of each P. falciparum, P. vivax and P. ovale infected patient was diluted with healthy donor blood to obtain a parasite count ranging from 1 to 10,000 parasite/mL. Here, P falciparum dilutions were tested in triplicate by both Pan and Pf specific primers set while P. vivax and P. ovale dilutions were tested in triplicate with only genus-specific primers. LODs were determined using the CFX-96 Real Time System subsequently confirmed through observing gel green fluorescence. If at least two out of three replicates of a certain dilution were tested positive by LAMP assay, the result was noted as positive. [00164] Stability studies. The stability of total nucleic acid, including RNA, in the dried blood spot was evaluated. Multiple DBS were made from the serially diluted P. falciparum (3D7) culture spiked whole blood specimens. Total nucleic acid was extracted in duplicate from those spots at 3, 10, 17, 24, 30, 60, 90, 120 and 150 days and tested the extracts by genus-specific primers. [00165] Assay verification using clinical samples. A combination of whole blood specimens (symptomatic returning travelers to Calgary, Canada) and dried blood spots (asymptomatic individuals from Ethiopia and Bangladesh) were used for verification and validation of the assay. For symptomatic travelers, 41 malaria positive specimens and 72 negative specimens based on microscopy were obtained between September 2017 to May 2018 were used. Of the 41 positives, 24 were positive for P. falciparum, 12 were P. vivax positive and five were positive for P. ovale. Total nucleic acid was extracted from the fresh blood samples within 24 hours of collection by the modified Trizol extraction mentioned above. Additionally, to validate the utility of US-LAMP for detection of low-level infections, DBS samples collected previously from asymptomatic individuals were obtained from a relatively high transmission area (Gondar, Ethiopia, n=308) and a low transmission 180 area (Bandarban, Bangladesh, n=186). Whole blood samples were collected in EDTA tubes through venipuncture, and subsequently, 50mI_ of the EDTA mixed blood specimens were spotted onto Whatman 903 protein saver card immediately after collection. Then, the blood spots were air-dried and stored at the room temperature in Calgary which is around 20-25°C. Additionally, thick and thin blood smears were prepared for microscopy prior to the mixing with EDTA. Total nucleic acid was extracted from the DBS by the aforementioned protocol, and LAMP assays were conducted on the extracts with the pre-addition of gel green and hydroxynapthol blue in the reaction mixture. Ethical approval were obtained from the corresponding Ethical Review board of University of Gondar (CMHS08/28/2013), International Center for Diarrheal Disease Research, Bangladesh (icddr,b:PR-15021), and University of Calgary Conjoint Health Research Ethics Board (REB17- 2220). For sensitivity and specificity analysis, qRT- PCR[24] was used as the gold standard.

[00166] Results

[00167] Limit of detection (LOD) - culture spiked blood. A standard curve was obtained by plotting time to amplification against the logarithms of initial parasite count per mL. Fitness (R2) values were 0.813 and 0.641 respectively from whole blood and DBS. Our data confirm that the Plasmodium genus-level US LAMP assay consistently detects the presence of P. falciparum as low as 10 parasite/mL of culture spiked whole blood, whereas the detection limit was 25 parasite/mL from DBS (Fig. 5).

[00168] Limit of Detection (LOD) - clinical specimens. Standard curves were plotted using threshold time against the logarithms of initial parasite count per mL for P. falciparum using species-specific primers to determine the assay dynamic range (Fig. 1 & 2). We also detected the LODs of 50 parasite/mL and 50- 100 parasite/mL from whole blood and DBS in case of the P. falciparum- specific LAMP assay while the scurve fitness was 0.884 and 0.927 respectively (Fig. 3). Standard 203 curves were plotted separately for whole blood and DBS using time to amplification (threshold time) against the logarithms of initial parasite count per mL for P. falciparum, P. vivax, and P. ovale serial dilutions prepared from patient specimens. In the case of P. falciparum, LODs of 25 parasite/mL and 50-100 parasite/mL from whole blood and DBS were obtained, respectively (Fig. 1). Corresponding curve fitness values were 0.931 (whole blood) and 0.800 (DBS). LODs of 5-10 parasites/mL and 25-50 parasite/mL for P. vivax were obtained using whole blood and DBS (Fig. 2). LODs for P. ovale were 25 parasites/mL from whole blood and 25-50 parasite/mL from DBS. The curve fitness was 0.896 and 0.827 for corresponding whole blood and DBS extracts of P. ovale. Through pre-addition of gel green, visual detection of amplification was also possible (Fig. 4). Additionally, our data demonstrate that a maximum of four spots can be batched together without compromising the limit of detection (Fig. 6).

[00169] Stability of the genetic material. From P. falciparum strain 3D7 culture- spiked blood, we found that DNA and RNA are stable for at least 5 months on Whatman 903 protein saver card. However, best results were obtained within one month. After one month, we observed inconsistent amplification from lower dilutions at 25 and 50 parasites/mL (Table-2).

Table-2: Stability assessment of the nucleic acid on What im 903 protein saver card (dried blood spots [DBS]. Samples were extracted and tested in duplicate, each positive and negative symbol is indicative of the result from each Pan-LAMP assay on P. falciparum.

Parasitc/mL Da 03 Day 10 Day 17 Day 24 Day 31 Day 60 Day 90 Day 120 Day 150

10000

1000

100 50 25 10

[00170] Verification of US-LAMP. An initial verification study was performed on a set of clinical specimens from symptomatic returning travelers. Pan-LAMP and Pf-LAMP assays were 100% (95% Cl; 82.8-100) sensitive for the detection of symptomatic malaria, whereas specificity was 98.6% (95% Cl; 91.5-99.9) and 97.8% (95% Cl; 91.4-99.6) for pan-LAMP and Pf-LAMP assay (Table-2). Subsequently, DBS samples from asymptomatic individuals in Gondar (Ethiopia) and Bandarban (Bangladesh) were used to validate the assay on low-level infections. Overall, Pan-LAMP was 97% sensitive (95%

Cl; 82.5-99.8) and 99.1% (95% Cl; 97.6-99.7) specific for identifying asymptomatic Plasmodium infection while Pf-LAMP was concluded to be 100% sensitive and 99.8% specific for asymptomatic P. falciparum cases (Table-3). RT-qPCR and Pan-LAMP detected 29 and 32 positives, respectively, from the 308 microscopy negative DBS samples obtained from Gondar. The additional infections detected by US-LAMP 227 but not microscopy comprised 10 P. falciparum, 16 P. vivax, and 3 P. falciparum and P. vivax mixed infections. US-LAMP detected one additional P. falciparum asymptomatic carrier not identified by microscopy from the Bandarban region (Supplementary Table-1).

Detailed sensitivity and specificity calculations can be found in the Supplementary Tables (2-5). Table-3: Sensitivity and specificity of the US-LAMP assay on symptomatic and asymptomatic specimen compared to RT-PCR

Sample type Assay Sensitivity (%) 95% Specificity (%) 95% type Confidence Confidence interval (Cl} interval (Cl)

Symptomatic Pan-LAMP IOC B9.3-1CO 96 6 91 5-99.9

Calgary Pf-LAMP IOC S2 S-1C0 97 S 91 4-99.6

(N-113)

Asymptomatic Pan-LAMP IOC 39.5S-J00 IOC 97.4-lOC

Bangladesh Pf-LAMP IOC 39 58-lOC IOC 974-lOC

(N=1S6]

Asymptomatic Pan-LAMP 96 6 B0 4-99.S 96 S 96 1-99.5

Ethiopia Pf-LAMP IOC ^" 69.9-lCO ^" 99 7 97 S-10C

(N=308]

Overall Pan-LAMP 97 B2 5-99.S 99 1 97 6-99.7

Asymptomatic Pf-LAMP IOC 75.9-lCO 99 S 98 6-lQC

(N=494)

Table 4: Details of asymptomatic samples tested positive by RT-qPCR, Pan-LAMP and Pf-LAMP.

Sample Pan- RT- RT- P-f Ex

ID_ Region LAIVIP Ff-LAMP PCR Pf PCR Pv Microscopy coum/nsl cour.t/mL

^MT144 Pos POS POS Pos Neg 5555 31,622.80

™<-21 ¾U!¾£ Pos Pos Pos Pos Neg 135.0 649 2

5N07B ¾mfc£ Pos Pos Pos Pos Neg 12 7 263 1

MT149 San¾g_t Pos Pos Pos Neg Neg 49,1 0

M¾092 G_,o n djEf Pos Pos Pos Neg Neg 127.3 0

M=<:46 gpnpc! Pos Pos Pos Neg Neg 15.8 0

Mkl83 gM¾i Pos Pos Pos Neg Neg 3392 0

5NM4 ggji¾i Pos Pos Pos Neg Neg 92 0

SNOlS Ganger Pos Pos Pos Neg Neg 535.2 0

5ND25 G_ojnder Pos Pos Pos Neg Neg 56.2 0

SNMB ¾ii( Pos Pos Pos Neg Neg 116.3 0

SNESS sanUfit Pos Pos Pos Neg Neg 20.4 0

BDQ1-D5 §aMMter, Pos Pos Pos Neg Pos 90.2 0

BD03-1S ¾3Q0|rtgn Pos Pos Pos Neg Pos 1756 0

8D20-35 ¾en.½.bm Pos Pos Pos Neg Pos 11,040 0

8D24-D1 Pos Pos Pos Neg Neg 190.4 0

SNOBS 5M¾( Pos Neg Neg P05 Neg 0 5011.9

MK17S S9.n¾¾£ Neg Pos N=g Neg Neg 0 0

MT076 GonRer Pos Neg Neg Pos Neg 0 251.2

MT0S7 (fonder Pos Neg Neg Pos Neg 0 199.5

MP2B ¾ Pos Neg Neg Pos Neg 0 158 6

MT132 SMiL« Pos Neg Neg Pos Neg 0 501.8

MT133 G^rjSer Pos Neg Neg Pos Neg 0 125

MT139 Ganger Pos Neg Neg Pos Neg 0 1584

MT146 Gcjnder Pos Neg Neg Pos Neg 0 134.9

MT1S9 binder Pos Neg Neg P05 Neg 0 794 3

MS0S2 ggn&t Pos Neg Neg PQJ Neg 0 749.9 fvl¾097 Ganger Pos Neg Neg Pos Neg 0 531

M¾:40 Ganjet Pos Neg Neg Pos Neg 0 223 9

MK141 Gon^et Pos Neg Neg Pos Neg 0 166

MK209 binder Pos Neg Neg P05 Neg 0 116 5

5N013 SRHSUSC Pos Neg Neg Pos Neg 0 47_PS63

SN032 SRHSUSC Pos Neg Neg Pos Neg 0 103.2

MK0S8 Gander Neg Neg Neg Pos Neg 0 56 1

MK087 gandC! Pos Neg Neg Neg Neg 0 0

MK145 SM¾i Pos Neg Neg Neg Neg 0 0

SN014 SM¾i Pos Neg Neg Neg Neg 0 0

SN050 Gander Pos Neg_ Neg Neg Neg 0 0

* Parasite count/mL data were retrieved by comparing the threshold cycles (Ct) values with the standard curve generated in RT-pPCR.

[00171] Table 5 : 2x2 table for sensitivity and specificity calculation for symptomatic samples (returning travelers in Calgary). _ Pan-LAMP vs RT-qPCR _ Pf-LAMP vs RT-qPCR _

Method _ RT-PCR _ Method _ RT-PCR _

Pos Neg Total Pos Keg ~ota.

Pan- Pos 41 1 42 Pf- Pos 24 2 26

LAMP Keg 0 71 21 LAMP Keg 0 67 S7

Total 41 72 113 Total 24 £9 113

[00172] * pos = positive; neg = negative.

[00173] Table 6 : 2x2 table for sensitivity and specificity calculation for asymptomatic samples (Bandarban) samples.

_ Pan-LAMP vs RT-qPCR _ Pf-LAMP vs RT-qPCR _

Method _ RT-PCR _ Method _ RT-PCR _

Pos Neg Total Pos Keg Total

Pan- Pos 4 0 4 Pf- Pos 4 0 4

LAMP Neg 0 1S2 182 LAMP Neg 0 182 1S2

Total 4 162 166 Total 4 162 166

[00174] * pos = positive; neg = negative.

[00175] Table 7 : 2x2 table for sensitivity and specificity calculation for asymptomatic samples (Gondar) samples.

_ Pan-LAMP vs RT-qPCR _ Pf-LAMP vs RT-qPCR _

Method RT-PCR Method RT-PCR

Pos Neg Total Pos Neg Total

Pan- Pos 28 4 32 Pf- POS 12 1 13

LAMP Neg 1 273 275 LAMP Neg C 255 255

Total 25 279 306 Total 12 235 303

[00176] * pos = positive; neg = negative.

[00177] Table 8 : 2x2 table for sensitivity and specificity calculation for asymptomatic samples (Gondar + Bandarban) samples.

Pan-LAMP vs RT-qPCR Pf-LAMP vs RT-qPCR

Method _ RT-PCR _ Method _ RT-PCR _

Pos Neg Total Pos Neg Total

Pan- Pos 32 4 36 Pf- Pos 16 1 17

LAMP Neg 1 457 458 LAMP Neg 0 477 477

Total 33 461 454 Total 16 478 454

* pos = positive; neg = negative.

[00178] Discussion: [00179] Many LMIC do not have the laboratory infrastructure, training, or access to reagents to perform ultrasensitive PCR methods. LAMP with its minimal requirement of a water bath and visual read out provides a useful alternative for active surveillance of malaria in a population where elimination is being considered. We have developed the first easy-to-perform, low cost ultrasensitive LAMP assay (LOD below 100 parasites per mL) for malaria detection from DBS. Samples can be collected in the form of DBS from remote endemic areas, transported to a regional laboratory, preserved at room temperature for several months, and then tested. The assay achieved 100% sensitivity in detecting symptomatic malaria cases while maintaining a very high level of specificity (>97%). More importantly, US-LAMP demonstrated excellent sensitivity (>97%) and specificity (>99%) for detecting very low-level asymptomatic infections present in both high and low transmission settings in Africa and Asia. Here, an additional 32 out of 308 asymptomatic malaria infections (10.4%) were detected by US-LAMP in Gondar (Ethiopia) where moderate to high transmission malaria occurs highlighting the value ultrasensitive detection for elimination, as reviewed recently by Lindblade et al [9], In fact, more cases were detected by LAMP than the RT-qPCR standard used in this study likely due to improved LOD. In earlier studies, the US-LAMP relying on the gene exp1 concentrated RNA from a large volume (2 mL) of fresh whole blood [25], However, this is practically difficult to obtain at the field level especially from younger children.

[00180] This assay is only applicable for detecting P. falciparum cases not for identifying other species. Moreover, the stability of the mRNA transcript from the exp1 gene was not studied.

[00181] In low transmission settings, to save reagents, DBS samples can be batched into groups of four for initial screening and subsequently only positive batches selected for individual testing. The batch approach is particularly useful for the detection of asymptomatic malaria in large-scale surveys where positivity rate is expected to be low. Additionally, positive tested samples can be further assessed for gametocyte carriage by a Pfs25 specific LAMP assay if required [33],

[00182] Primers targeting P. falciparum were modified specifically to amplify 18S rRNA located in chromosome 5 and 7. The latter loci are known to be highly expressed in the blood stages of the P. falciparum [23], By using total nucleic acid (18S RNA and DNA) as the target for amplification instead of DNA only, we could attain an LOD of 5-50 parasite/mL in whole blood [13], This is a 1000-10,000-fold improvement in LOD compared to previous LAMP assays targeting 18S DNA alone. Our data exhibited that genus-level ‘Pan” primers had the best LOD in the case of P. vivax (5-10 parasites/mL) and P. falciparum (10 parasites/mL) using whole blood. Our study evaluated the Pan- LAMP assay on three species; P. falciparum, P. vivax and P. ovale. A limitation is that we could not test the assay on P. malariae and P. knowlesi due to lack of sample availability. Qualitative detection of fluorescence created by the gel green was robust and closely mirrored detection using a fluorescence detection system. Visual detection again makes the assay more amenable to a resource-limited setting. However, another limitation is the reliance on a column-based RNA extraction protocol which prevents the use of this assay at a health centre but is more suitable for a regional laboratory.

[00183] In summary, The US-LAMP assay presented here is robust and simple for surveillance of asymptomatic malaria cases that comprise the infectious reservoir which must be detected for malaria elimination in LMIC.

[00184] The embodiments described herein are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art. The scope of the claims should not be limited by the particular embodiments set forth herein, but should be construed in a manner consistent with the specification as a whole.

[00185] All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication patent, or patent application was specifically and individually indicated to be incorporated by reference.

[00186] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modification as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method of identifying a subject infected with a Plasmodium, comprising: i) contacting a sample from a subject having a Plasmodium or suspected of having a Plasmodium, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

ii) incubating the resulting mixture at a reaction temperature and a reaction time; and iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule, wherein, if a signal detected, the subject is determined to have a Plasmodium infection, wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection.

2. A method of identifying a subject infected with a Plasmodium, comprising: i) contacting a sample from a subject having a Plasmodium or suspected of having a Plasmodium, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

ii) incubating the resulting mixture at a reaction temperature and a reaction time; and iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule, wherein, if a signal detected, the subject is determined to have a Plasmodium infection, wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection.

3. The method of claim 1 or 2, wherein the reaction temperature is about 63°C and the reaction time is about 30 minutes.

4. The method of any one of claims 1 to 3, wherein said Plasmodium is P. ovale,

P. vivax, P. falciparum, P. Malarae or P. knowlesi.

5. A method of identifying a subject infected with a P. falciparum, comprising: i) contacting a sample from a subject having a P. falciparum or suspected of having a P. falciparum, with a reaction mixture comprising a DNA polymerase having strand displacement activity and reverse transcriptase activity, and a set of oligonucleotides under conditions suitable for LAMP, the set of oligonucleotides comprising or consisting of:

ii) incubating the resulting mixture at a reaction temperature and a reaction time; and iii) detecting a signal indicative of amplification of the region of the target nucleic acid molecule, wherein, if a signal detected, the subject is determined to have a Plasmodium infection, wherein, if a signal is not detected, the subject is determined to not to have a Plasmodium infection.

6. The method of claim 5, wherein the reaction temperature is about 63°C and the reaction time is about 60 minutes.

7. The method of claim 5 or 6, wherein said reaction mixture further comprises a detectable label.

8. The method of claim 7, wherein said detectable label comprises a fluorescent moiety, a fluorogenic moiety, a chromogenic moiety, a hapten, an affinity tag, or a radioactive isotope.

9. The method of claim 7, wherein said detectable label is SYBR green.

10. The method of any one of claims 1 to 9, wherein said subject is an animal, such as a domesticated animal, for example a cats or a dog; livestock such as a cow, a horse, a pig, a sheep, or a goat; a laboratory animal, such as a mouse, a rabbit, a rat, a guinea pig; a non-human mammals, such as a primate; a birds; a reptiles; an amphibians; a fish; or a human.

11. The method of any one of claims 1 to 10, wherein said target nucleic acid comprises or consist of 18S rRNA.

12. An isolated polynucleotide comprising or consisting of the nucleotide sequence of SEQ ID Nos. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22.

13. A kit comprising one or more isolated polynucleotides comprising or consisting of the nucleotide sequence of SEQ ID Nos 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22, and optionally a container, and/or optionally instructions for the use thereof.

14. A kit comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

15. A kit comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

16. A kit comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

17. A commercial package comprising one or more isolated polynucleotides comprising or consisting of the nucleotide sequence of SEQ ID Nos 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or 22, and optionally a container.

18. A commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

19. A commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences:

20. A commercial package comprising the following isolated polynucleotides comprising or consisting of isolated nucleotide sequences: