WO2021141179A1 - Oligonucleotide and plasmid for simultaneous detection of four serotypes of dengue virus, and method for analyzing serotype of dengue virus using same - Google Patents

Abstract

The present invention relates to oligonucleotide and plasmid for simultaneous detection of four serotypes of dengue virus and a method for analyzing serotypes of dengue virus using same. Even when a plurality of dengue virus serotypes or flaviviruses other than dengue viruses are mixed in the sample, each of the dengue virus serotypes can be quickly and specifically detected, and the amount of antigens present in the sample can be accurately measured using a plasmid, and thus the present invention can be utilized as data for a dengue virus treatment method and research.

Description

Oligonucleotide and plasmid for simultaneous detection of four serotypes of dengue virus and dengue virus serotype analysis method using the same

It relates to an oligonucleotide and a plasmid for simultaneous detection of four serotypes of dengue virus and a dengue virus serotype analysis method using the same, and more specifically to multiple serotypes of dengue virus. A primer that binds to , a probe that specifically binds to each serotype of dengue virus, and a probe that specifically binds to each serotype of dengue virus can be used to quickly It relates to a method capable of specifically detecting each serotype of dengue virus and accurately measuring the amount of antigen present in a sample.

Dengue virus belonging to Flavivirus has four serotypes ( types 1, 2, 3, and 4), and Aedes aegypti and Aedes albopictus are carriers of Dengue fever. fever) and dengue hemorrhagic fever (DHF).

Dengue virus, one of the mosquito-borne infectious diseases, has increased in incidence by more than 30% over the past 50 years, and there were more than 1,000 cases of outbreaks reported in Southeast Asia in 2019. In the past, ELISA and conventional PCR have been used as diagnostic methods, but these methods require several steps, take a long time, and have low accuracy such as false-positive results. For this reason, a diagnostic method using real-time amplification technology has recently been developed, and an attempt has been made to implement an accurate and sensitive detection method within a short time.

As a conventional method, there has been a nested PCR method targeting the envelope portion of the dengue virus, but it has a disadvantage in that it takes a long time to confirm the serotype of the dengue virus.

Therefore, it is possible to use a primer and probe set required to simultaneously detect each serotype of the dengue virus present in a sample in one tube, and a plasmid required to measure the absolute quantity of each serotype present in the sample. Compared to that, there is a need to develop an improved method that reduces the time and amount of sample used for confirming the serotype of the dengue virus.

Accordingly, the present inventors prepared a primer that specifically binds to multiple serotypes of dengue virus and a probe that specifically binds to each serotype of dengue virus, and using the primer and probe, a plurality of dengue virus serotypes or dengue virus It was confirmed that the accuracy of specifically detecting each serotype of dengue virus in a sample in which other flaviviruses were mixed was very good.

Accordingly, an object of the present invention. a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; And to provide an oligonucleotide set for Dengue virus serotype analysis, comprising a probe set comprising four probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8.

Another object of the present invention is a primer set comprising three kinds of primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; And to provide a composition for dengue virus serotype analysis, comprising a probe set comprising four probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8.

Another object of the present invention is a primer set comprising three kinds of primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; And to provide a kit for dengue virus serotype analysis, comprising a probe set comprising four probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8.

Another object of the present invention is a primer set comprising three kinds of primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; And to provide a dengue virus serotype analysis method using a probe set comprising four probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8.

An oligonucleotide and plasmid for simultaneous diagnosis of four serotypes of dengue virus and a dengue virus serotype analysis method using the same. Dengue virus serotype analysis results using the primer and probe according to the present invention indicates high accuracy.

The present inventors thus provided a primer set comprising three kinds of primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; And dengue virus serotype analysis using a probe set comprising four types of probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8 can rapidly and accurately analyze dengue virus serotypes present in a sample. possible effects were confirmed.

Hereinafter, the present invention will be described in more detail.

The term "dengue virus" as used herein refers to a virus belonging to the family Flaviviridae and the genus Flavivirus, and having a gene (+) single-stranded RNA having a length of about 11 Kb. Dengue virus has four serotypes 1, 2, 3 and 4, and in the present specification, dengue-1, dengue-2, dengue-3 and dengue-4 are each dengue virus serotype 1 , type 2, type 3 and type 4.

One aspect of the present invention provides a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; And it is an oligonucleotide set for Dengue virus serotype analysis, including a probe set comprising four probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8.

As used herein, the term "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, capable of forming a complementary template and a base pair, and serving as a starting point for template strand copying. single-stranded oligonucleotides that function. The primer can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature.

As used herein, the term “primer set” refers to a set including a forward primer and a reverse primer, which is used to specifically bind to a target gene and amplify it through a polymerase chain reaction.

As used herein, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases as short as possible to achieve specific binding to a gene or mRNA, and oligonucleotides It may be manufactured in the form of a probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like, and may be labeled for easier detection.

In one embodiment of the present invention, the oligonucleotide set may further include a primer consisting of the nucleotide sequence of SEQ ID NO: 1.

The primer consisting of the nucleotide sequence of SEQ ID NO: 1 can synthesize complementary cDNA using RNA of four serotypes of dengue virus as a template, and the synthesis of RNA from cDNA is polymerase chain reaction (PCR), reverse transcription Reverse Transcription PCR (RT-PCR), quantitative PCR (qPCR), Reverse Transcription-quantitative PCR (RT-qPCR), Real-time nested reverse transcription- Polymerase chain reaction (realtime nested RT-PCR; rt-nRT-PCR), digital polymerase chain reaction (dPCR), digital reverse transcription polymerase chain reaction (digital RT-PCR; dRT-PCR) and may be performed, for example, by reverse transcription polymerase chain reaction, but is not limited thereto.

In one embodiment of the present invention, each probe may be labeled with a fluorescence at one end and a quencher at the other end.

In one embodiment of the present invention, four types of probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8 are labeled with a fluorescence at the 5' end and a quencher at the 3' end (quencher) may be labeled.

As used herein, the term “fluorophore” refers to a fluorescent compound that absorbs light of a specific wavelength and emits light of another wavelength, and “quencher” acts on the excited state of the fluorophore to remove excitation energy and inhibit light emission. means a molecule that

In one embodiment of the present invention, the fluorophore is 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein; VIC), 6-carboxyfluorescein (FAM), ABY, JUN, fluorescein, hexachloro-6-carboxyfluorescein (HEX), tetrachloro-6 -Carboxyfluorescein (tetrachloro-6-carboxyfluorescein; TET), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein (2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein) ; JOE), 5-((2-aminoethyl)amino)naphthalene-1-sulfonic acid (5-((2-aminoethyl)amino)naphthalene-1-sulfonic acid), coumarin and coumarin derivatives, cyanine-5 (Cyanine-5; Cy5), lucifer yellow, texas red, tetramethylrhodamine, Yakima Yellow (YG), and Cal Fluor Red 610 (Cal Fluor Red 610) ; CFR), for example, the fluorophore of the probe consisting of the nucleotide sequence of SEQ ID NO: 5 may be 6-carboxyfluorescein (FAM), and the fluorophore of SEQ ID NO: 6 The fluorophore of the probe consisting of the nucleotide sequence may be ABY, and the fluorophore of the probe consisting of the nucleotide sequence of SEQ ID NO: 7 is 2-chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein (2- chloro-7-phenyl-1,4-dichloro-6-carboxyfluorescein; VIC), and the fluorophore of the probe consisting of the nucleotide sequence of SEQ ID NO: 8 may be JUN, but is limited thereto is not

In one embodiment of the present invention, the quencher is a minor groove binder (MGB), a QSY-based material, tetramethylrhodamine (TAMRA), 4-(4-dimethylaminophenylazo)benzoic acid (4 -(4-dimethylaminophenylazo)benzoic acid), 4-dimethylaminophenylazophenyl-4-maleimide, carboxytetramethylrhodamine and BHQ For example, the quencher of the probe consisting of the nucleotide sequence of SEQ ID NO: 5 may be a minor groove binder (MGB), and the quencher of the probe consisting of the nucleotide sequence of SEQ ID NO: 6 is QSY series material, the quencher of the probe consisting of the nucleotide sequence of SEQ ID NO: 7 may be a minor groove binder (MGB), and the quencher of the probe consisting of the nucleotide sequence of SEQ ID NO: 8 is a QSY-based material However, the present invention is not limited thereto.

In one embodiment of the present invention, four probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8 may specifically bind to cDNA of dengue virus serotype, respectively.

In one embodiment of the present invention, the probe consisting of the nucleotide sequence of SEQ ID NO: 5 may be one that specifically binds to cDNA of dengue-1 type.

The probe consisting of the nucleotide sequence of SEQ ID NO: 6 may specifically bind to cDNA of dengue-2 type.

The probe consisting of the nucleotide sequence of SEQ ID NO: 7 may specifically bind to cDNA of dengue-3 type.

The probe consisting of the nucleotide sequence of SEQ ID NO: 8 may specifically bind to dengue-4 cDNA.

In one embodiment of the present invention, the probe consisting of the nucleotide sequence of SEQ ID NO: 5 may specifically bind to cDNA of dengue-1 type, and the probe consisting of the nucleotide sequence of SEQ ID NO: 6 is cDNA of dengue-2 type may specifically bind to, the probe consisting of the nucleotide sequence of SEQ ID NO: 7 may specifically bind to cDNA of dengue-3 type, and the probe consisting of the nucleotide sequence of SEQ ID NO: 8 is dengue-4 type It may be that it specifically binds to cDNA of

That is, the probe set according to an embodiment of the present invention can specifically bind to the cDNA of each dengue virus serotype, so that a plurality of dengue virus serotypes or Flaviviruses other than dengue virus can be added to the sample or specimen. ), each serotype of dengue virus can be specifically detected with high accuracy even when mixed (see FIGS. 1 to 5 ).

Another aspect of the present invention is a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; and a probe set comprising four probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8. It is a composition for serotype analysis of dengue virus.

In one embodiment of the present invention, each probe may be labeled with a fluorescence at one end and a quencher at the other end.

In one embodiment of the present invention, the composition for dengue virus serotype analysis may further include a plasmid comprising the nucleotide sequence of SEQ ID NO: 9.

As used herein, the term “plasmid” refers to DNA that exists independently of chromosomes in bacterial cells and can independently proliferate, has a ring shape, and is not an essential gene for the survival of bacteria.

In one embodiment of the present invention, the plasmid comprising the nucleotide sequence of SEQ ID NO: 9 may include all nucleotide sequences specific for each of the four dengue virus serotypes. Therefore, the plasmid according to one embodiment may be used to construct a standard curve for absolute quantification of four dengue virus serotypes together with a primer and a probe set, and accordingly, the amount of dengue virus antigen present in the sample or specimen It can be used for accurate measurement by absolute quantification (refer to FIGS. 6 to 9).

In the present specification, IUB ambiguity codes are used to indicate the sequences of primers. Therefore, in the primer sequence, A represents adenine, G represents guanine, C represents cytosine, and T represents thymine. This applies equally to presenting all sequences herein.

Another aspect of the present invention is a method for serotyping Dengue virus comprising the steps of:

A preparation step of preparing cDNA obtained through the sample; and

Using the obtained cDNA as a template, a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4 and a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8 An amplification step of performing a first nucleic acid amplification reaction using a probe set including four types of probes.

Hereinafter, the method of the present invention will be described in detail by dividing it into stages.

The dengue virus serotype analysis method of the present invention can be applied to a sample expected to be infected with a dengue virus.

The sample may include a sample obtained from a patient infected with or expected to be infected with dengue virus, and the sample is a biological sample obtained from a subject to be tested, for example, a biopsy, cultured cells, saliva, skin tissue, It may be any one or more selected from the group consisting of blood, feces and urine, but is not limited thereto.

In one embodiment of the present invention, the first nucleic acid amplification reaction is a polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (quantitative PCR); qPCR), Real-Time Polymerase Chain Reaction (RT-PCR), Reverse Transcription-quantitative PCR (RT-qPCR), Real-Time Nested Reverse Transcription-Polymerase Chain Reaction ( Realtime nested RT-PCR; rt-nRT-PCR), digital polymerase chain reaction (dPCR), digital reverse transcription polymerase chain reaction (digital RT-PCR; dRT-PCR), but limited thereto it's not going to be

The first nucleic acid amplification reaction may be a real-time polymerase chain reaction, and may be performed using a method or kit known in the art, for example, Taqman multiplex master mix 2X (Thermo Fisher Scientific, USA) kit. may be, but is not limited thereto.

In one embodiment of the present invention, RNA of dengue virus may be isolated from a sample for cDNA synthesis in the preparation step.

In the method of isolating RNA from a sample, AGPC method (Acid Guanidium-Phenol-Chloroform), RNA extraction kit, cesium chloride density gradient centrifugation method (Guanidium/Cesium Chloride (CsCl) extraction method) can be used, for example, A spin column type RNA extraction kit may be used, but is not limited thereto.

The spin column method uses a membrane to filter RNA. Cells are lysed using a buffer solution containing RNase, and then RNA is bound to a silica membrane. Thereafter, after washing so that only RNA binds to the silica membrane, RNA can be isolated by using an elution buffer to recover the RNA present in the filter membrane. Specifically, in order to extract dengue virus RNA from a sample, a Viral RNA mini kit (QIAGEN, USA) or other similar kit may be used to isolate a nucleic acid from a sample according to the corresponding manual.

In one embodiment of the present invention, cDNA can be synthesized using a primer consisting of the nucleotide sequence of SEQ ID NO: 1.

In the method for synthesizing cDNA synthesis, cDNA is polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (qPCR), reverse transcription -Reverse Transcription-quantitative PCR (RT-qPCR), Real-Time Polymerase Chain Reaction (RT-PCR), realtime nested RT- PCR; rt-nRT-PCR), digital polymerase chain reaction (dPCR), digital reverse transcription polymerase chain reaction (digital RT-PCR; dRT-PCR), but is not limited thereto.

For example, the cDNA synthesis step may be performed by Reverse Transcription PCR (RT-PCR), and specifically, SuperScript IV First-Strand Synthesis System (Life Technologies, USA) or Other similar kits can be used to synthesize cDNA from isolated RNA according to the appropriate manual.

In one embodiment of the present invention, the primer consisting of the nucleotide sequence of SEQ ID NO: 1 may specifically bind to all four serotypes of the dengue virus, and thus each serotype RNA of the dengue virus isolated from the sample is a single Dengue virus cDNA can be quickly synthesized using only one primer.

In one embodiment of the present invention, the dengue virus serotyping method may further comprise the following steps:

preparing a standard curve by performing a second nucleic acid amplification reaction using a plasmid comprising the nucleotide sequence of SEQ ID NO: 9; and a detection step of detecting the amount of antigen contained in the sample by calculating the gene copy number by substituting the threshold cycle value (Ct) obtained in the amplification step into the prepared standard curve.

As used herein, the term "standard curve" refers to a linear relationship between the threshold cycle value and the gene copy number calculated by regression analysis of the threshold cycle value and gene copy number obtained through the nucleic acid amplification reaction using the plasmid, primer set, and probe set of the present invention. It means a function expression that indicates the relationship.

In the preparation step according to one embodiment, the plasmid may be a plasmid capable of containing all of the specific nucleotide sequences of each of the four serotypes of the dengue virus, and thus, using only one plasmid, the plasmid is used for the four serotypes of the dengue virus. It is possible to create a standard curve for the present invention, and the inventors of the present invention confirmed that the accuracy of the standard curve prepared through the plasmid of the present invention is very good (see FIGS. 6 to 6 ).

In the detection step, the amount of antigen present in the sample can be accurately detected by substituting the threshold cycle value of the result of nucleic acid amplification reaction of the cDNA of the sample using the primer set and probe set of the present invention.

In one embodiment of the present invention, the second nucleic acid amplification reaction is a polymerase chain reaction (PCR), a reverse transcription polymerase chain reaction (RT-PCR), a quantitative polymerase chain reaction (quantitative PCR). ; qPCR), Reverse Transcription-quantitative PCR (RT-qPCR), Real-Time Polymerase Chain Reaction (RT-PCR), Real-time Nested Reverse Transcription-Polymerase Chain Reaction (realtime nested RT-PCR; rt-nRT-PCR), digital polymerase chain reaction (digital PCR; dPCR), digital reverse transcription polymerase chain reaction (digital RT-PCR; dRT-PCR) can be performed, for example For example, it may be a real-time polymerase chain reaction, but is not limited thereto.

Another aspect of the present invention is a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; And it is a kit for serotype analysis of Dengue virus, comprising a probe set comprising four types of probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8.

In one embodiment of the present invention, the kit for dengue virus serotyping may include a DNA polymerase, a tube or other suitable container, a reaction buffer, deoxynucleotides (dNTPs), an enzyme, a dye, sterile water, etc. , but is not limited thereto.

It relates to an oligonucleotide and a plasmid for simultaneous detection of four serotypes of dengue virus and a dengue virus serotype analysis method using the same, and relates to a sample containing multiple dengue virus serotypes or non-dengue virus serotypes. Even when flaviviruses are coexisting, each serotype of dengue virus can be quickly and specifically detected, and the amount of antigen present in a sample can be accurately measured using a plasmid, so dengue virus It can be used as data for treatment and research.

1 is a graph showing the results of specifically detecting each dengue-1 type through a primer set and a probe set according to an embodiment of the present invention.

2 is a graph showing a result of specifically detecting each dengue-2 type through a primer set and a probe set according to an embodiment of the present invention.

3 is a graph showing the results of specifically detecting each dengue-3 type through a primer set and a probe set according to an embodiment of the present invention.

4 is a graph showing the results of specifically detecting each dengue-4 type through a primer set and a probe set according to an embodiment of the present invention.

5 is a graph showing the results of simultaneous detection of four dengue virus serotypes through a primer set and a probe set according to an embodiment of the present invention.

6 is a graph showing a standard curve of dengue-1 type prepared through a plasmid according to an embodiment of the present invention.

7 is a graph showing a standard curve of dengue-2 type prepared through a plasmid according to an embodiment of the present invention.

8 is a graph showing a standard curve of dengue-3 prepared through a plasmid according to an embodiment of the present invention.

9 is a graph showing a standard curve of dengue-4 prepared through a plasmid according to an embodiment of the present invention.

a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; and a probe set comprising 4 probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8; Containing, Dengue virus (Dengue virus) oligonucleotide set for serotype analysis.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

materials and methods

Cell and virus culture

Vero E6 (ATCC number CRL-1586) cells were cultured with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin in Dulbecco's minimal essential medium (DMEM). Thereafter, each of the viruses in Table 1 below was infected and used to evaluate the specificity of the primer set and probe of the present invention. Here, dengue virus, chikungunya virus, Japanese encephalitis virus, yellow fever virus and Zika virus of Table 1 below were purchased from each of the places of purchase shown in Table 1 or sold. Then, each virus was infected with Vero E6 cells, and the medium was collected after 7-10 days of culture.

virus	Sales/purchase information	remark
Dengue virus 1	NCCP; 43251	Dengue type 1
Dengue virus 2	NCCP; 43253	Dengue type 2
Dengue virus 3	NCCP; 43256	Dengue type 3
Dengue virus 4	NCCP; 43257	Dengue-4
Chikungunya virus	NCCP; 43132
Japanese encephalitis virus	KBPV; VR27
yellow fever virus	Bionner; plasmid synthesis
Zika virus Uganda	ATCC; 1838
Zika virus PuertoRico	ATCC; 1843

* NCCP stands for National Culture Collection for Pathogens (NCCP), KBPV stands for Bank for Pathogenic Viruses (KBPV), and ATCC stands for American Type Culture Collection (ATCC).

Viral RNA extraction and cDNA synthesis

Virus RNA cultured in Vero E6 cells was extracted using the Viral RNA Mini Kit (Qiagen, USA). Using the extracted RNA as a template, using the SuperScript IV First-Strand Synthesis System (Life Technologies, USA) kit and the primers for cDNA synthesis in Table 2 below, each virus was subjected to reverse transcription PCR (RT-PCR). cDNA was synthesized.

SEQ ID NO:	denomination	Sequence Listing (5'-> 3')	remark
One	DENV_primer1	CGGTTTCTCGCGCGTTT	Primers for cDNA synthesis

Real-time polymerase chain reaction

Real-time polymerase chain reaction was performed to evaluate the specificity of primers and probes and the detection sensitivity of the plasmid. The real-time polymerase chain reaction was performed with a target (Target) in Taqman multiplex master mix 2X (Thermo Fisher Scientific, USA) and a primer set of SEQ ID NOs: 2 to 4 in Table 3, SEQ ID NOs: 5 to 8 of dengue virus in Table 4 A probe that specifically binds to each serotype was introduced, and the target was used as a template.

And, the real-time polymerase chain reaction was initially performed for 2 minutes at 50°C and 10 minutes at 95°C, followed by a total of 40 times at 95°C for 15 seconds and at 55°C for 1 minute.

SEQ ID NO:	denomination	Sequence Listing (5'-> 3')	remark
2	DENV_primer2	AGAGCAGATCTCTGATGAATAACCAA	forward primer
3	DENV_primer3	TCTGGAAAAATGAACCAACGAA	forward primer
4	DENV_primer4	CGGTTTCTCTCGCGTTTCAG	reverse primer

SEQ ID NO:	denomination	Sequence Listing (5'-> 3')	remark
5	DENV_probe1	ACGGCTCGACCGTCT		Dengue type 1
6	DENV_probe2	AGGCGAGAAATACGC		Dengue type 2
7	DENV_probe3	ACGGGAAAACCGTCTAT		Dengue type 3
8	DENV_probe4	TCAGACCACCTTTCAAT	Dengue-4

Creating a standard curve for absolute quantification

To prepare a standard curve for absolute quantification, a plurality of target materials for quantification containing plasmids at different concentrations were prepared by diluting the plasmids in Table 5 below in stages, and the primer sets in Table 3 and Table 4 in each target material A probe was inserted and a real-time polymerase chain reaction was performed.

Then, in the real-time polymerase chain reaction, the degree of fluorescence according to the number of PCR cycles is measured, a site where the fluorescence signal is amplified exponentially is selected and set as a threshold line (Th), and the set threshold line and amplification curve are set. A standard curve was calculated by regression analysis of the threshold cycle value (Ct) and the number of copies at this intersection.

SEQ ID NO:	denomination	Sequence Listing (5'-> 3')	remark
9	DENV_plasmid	AGAGCAGATCTCTGGAAAAATGAACCAACGAAAAAAGACGGCTCGACCGTCTAAAAGACGGGAAAACCGTCTATAAAGGCGAGAAATACGCAAAAGGTGGTCAGACCACCTTTCAATATGCTGAAACGCGAGAGAAACCG

Example 1: Confirmation of specificity of primers and probes for each serotype of dengue virus

1-1. Confirmation of specificity of primers and probes for each dengue virus serotype

After extracting each RNA from dengue-1 type, dengue-2 type, dengue-3 type and dengue-4 type according to the above-described RNA extraction method, complementation using a primer for cDNA synthesis consisting of SEQ ID NO: 1 of Table 1 cDNA was synthesized.

Then, by targeting each cDNA of the synthesized dengue virus serotype, a primer set consisting of nucleotide sequences of SEQ ID NOs: 2 to 4 of Table 2, and probes of SEQ ID NOs: 5 to 8 of Table 3 were added, and each dengue virus serotype was added. of cDNA as a template, the real-time polymerase chain reaction according to the above-described method was initially carried out at 50 °C for 2 minutes and 95 °C for 10 minutes, followed by a total of 40 cycles at 95 °C for 15 seconds and 55 °C for 1 minute. And, the serotype of the dengue virus was detected by analyzing the fluorescence emitted by the probe in each real-time polymerase chain reaction.

As can be seen from the detection results in FIGS. 1 to 4 , when only the dengue-1 cDNA was present in the target, only the dengue-1 type was detected in the real-time polymerase chain reaction. In the case of dengue-2, 3, and 4, as in the case of dengue-1, when only a specific serotype of dengue virus was present in the target, only the serotype was detected according to the real-time polymerase chain reaction.

1-2. Confirmation of Specificity of Primers and Probes for Simultaneous Detection of Four Serotypes of Dengue Virus

After extracting each RNA from dengue-1 type, dengue-2 type, dengue-3 type and dengue-4 type according to the above-described RNA extraction method, complementation using a primer for cDNA synthesis consisting of SEQ ID NO: 1 of Table 1 cDNA was synthesized.

Thereafter, the primer set consisting of the nucleotide sequences of SEQ ID NOs: 2 to 4 of Table 2 and the probes of SEQ ID NOs: 5 to 8 of Table 3 were all put into the target containing all of the dengue-1 to dengue-4 cDNAs, and the above-mentioned According to the method, the real-time polymerase chain reaction was initially performed at 50° C. for 2 minutes and 95° C. for 10 minutes, followed by a total of 40 cycles at 95° C. for 15 seconds and at 55° C. for 1 minute.

As can be seen from the detection result in FIG. 5 , all serotypes of the dengue virus were specifically detected without cross-reaction during the real-time polymerase chain reaction even when the target contained cDNA of all serotypes of the dengue virus.

Therefore, as can be seen in FIGS. 1 to 5 , it is possible to accurately detect each serotype without cross-reaction in a real-time polymerase chain reaction through the primer set and probe of the present invention, and a plurality of dengue virus serotypes are present in the target. It was confirmed that each serotype can be specifically and simultaneously detected without cross-reaction even when they are mixed. This suggests that even when a sample or specimen contains multiple dengue virus serotypes, each serotype can be accurately detected without cross-reaction.

Example 2: Confirmation of specificity of primers and probes through cross-reaction against flaviviruses other than dengue virus

In order to confirm the cross-reaction of the primer set and probe of the present invention to flaviviruses other than dengue virus, two strains of Zika virus (Uganda, PuertoRico), Japanese encephalitis virus, and chikungunia virus (Chikungunya virus) and yellow fever virus (Yellow fever virus) RNA was extracted according to the above-described method, respectively, and cDNA was synthesized using the cDNA synthesis primer of the present invention.

Thereafter, by targeting the cDNA of each virus synthesized, the primer set and the probe of the present invention were all added, and a real-time polymerase chain reaction was performed to detect the amplification product.

flavivirus	detected or not
Chikungunya virus	-
Japanese encephalitis virus	-
yellow fever virus	-
Zika virus Uganda	-
Zika virus PuertoRico	-

As a result of the detection, as can be seen in Table 6 above, no flavivirus other than dengue virus was detected in each real-time polymerase chain reaction.

Therefore, it was confirmed that the primer set and probe of the present invention did not cross-react with flaviviruses other than dengue virus even if flaviviruses other than dengue virus were mixed in the target of the polymerase chain reaction, which was a sample or specimen. It suggests that the serotype of dengue virus can be accurately detected even when a plurality of flaviviruses are mixed in .

Example 3: Evaluation of detection sensitivity of plasmids for quantitative analysis

In order to evaluate the detection sensitivity of the plasmid of the present invention, the plasmid of Table 5 was diluted stepwise to prepare a plurality of target substances for quantification containing the plasmids at different concentrations, and the primer sets and Tables in Table 3 were added to the target substances. Insert the probe of No. 4 and perform a real-time polymerase chain reaction using the plasmid as a template according to the above-described method for an initial period of 50 °C for 2 minutes and 95 °C for 10 minutes, followed by a total of 40 cycles at 95 °C for 15 seconds and at 55 °C for 1 minute. was performed with

Afterwards, a threshold line (Th) for each dengue virus serotype is set through sequential real-time polymerase chain reaction, and the threshold cycle value (Threshold cycle; Ct) at the intersection of the set threshold line and the amplification curve is used. A standard curve was calculated for each dengue virus serotype, and the results are shown in FIGS. 6 to 9 and Tables 7 to 10.

Ct value versus gene copy number of dengue-1 standard curve (FIG. 6)
4	24.30123
3	27.97049
2	30.94839
One	33.62966

Ct value versus gene copy number of the dengue-2 standard curve (FIG. 7)
4	28.16289
3	31.73582
2	35.14215
One	38.052

Ct value versus gene copy number of dengue-3 standard curve (FIG. 8)
4	25.80641
3	29.66274
2	32.56523
One	35.10594

Ct value versus gene copy number of the dengue-4 standard curve (FIG. 9)
4	30.61671
3	33.59878
2	36.27532
One	39.77265

As can be seen in FIGS. 6 to 9 , all standard curves of dengue-1 to dengue-4 were obtained through real-time polymerase chain reaction using the plasmid of the present invention, and ^{The correlation coefficient R 2} of the real-time polymerase chain reaction was all 0.99 or more (see FIGS. 6 to 9 ), so it was confirmed that the plasmid of the present invention can be used as a standard material for quantitative analysis of each serotype of dengue virus.

As a result of the above experiment, if the plasmid of the present invention is used to detect dengue virus serotypes, it is possible to calculate a standard curve for each of the four serotypes of the dengue virus using one plasmid, and using the calculated standard curve for dengue It was confirmed that it can be used for absolute quantification of the serotypes of 4 viruses. That is, it is expected that the gene copy number of each serotype of dengue virus present in the sample can be accurately obtained by substituting the threshold cycle value obtained using the primer set and probe set of the present invention into the calculated standard curve during the nucleic acid amplification process. do.

Accordingly, it is expected that by using the primer set, probe and plasmid of the present invention, four serotypes of dengue virus can be distinguished at once without cross-reaction, and the amount of antigen can be detected by absolute quantification of each serotype at the same time. do.

It relates to an oligonucleotide and a plasmid for simultaneous detection of four serotypes of dengue virus and a dengue virus serotype analysis method using the same, and more specifically to multiple serotypes of dengue virus. A primer that binds to , a probe that specifically binds to each serotype of dengue virus, and a probe that specifically binds to each serotype of dengue virus can be used to quickly It relates to a method capable of specifically detecting each serotype of dengue virus and accurately measuring the amount of antigen present in a sample.

Claims (12)

1. a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; and

   a probe set comprising four types of probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8;

   Containing, Dengue virus (Dengue virus) oligonucleotide set for serotype analysis.
2. According to claim 1,

   The set is an oligonucleotide set for dengue virus serotype analysis, further comprising a primer consisting of the nucleotide sequence of SEQ ID NO: 1.
3. According to claim 1,

   A set of oligonucleotides for dengue virus serotype analysis, wherein each probe is labeled with a fluorophore at one end and a quencher at the other end.
4. a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4; and

   a probe set comprising four types of probes consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8;

   A composition for dengue virus serotype analysis, comprising a.
5. 5. The method of claim 4,

   The composition further comprises a plasmid comprising the nucleotide sequence of SEQ ID NO: 9, Dengue virus serotype analysis composition.
6. 5. The method of claim 4,

   Each probe is labeled with a fluorophore (fluorescence) at one end and a quencher (fluorescence) at the other end, a composition for dengue virus serotype analysis.
7. A method for serotyping Dengue virus comprising the steps of:

   A preparation step of preparing cDNA obtained through the sample; and

   Using the obtained cDNA as a template, a primer set comprising three primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 2 to 4 and a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 5 to 8 An amplification step of performing a first nucleic acid amplification reaction using a probe set including four types of probes.
8. 8. The method of claim 7,

   The cDNA is synthesized using a primer consisting of the nucleotide sequence of SEQ ID NO: 1, Dengue virus serotype analysis method.
9. 8. The method of claim 7,

   the method

   preparing a standard curve by performing a second nucleic acid amplification reaction using a plasmid comprising the nucleotide sequence of SEQ ID NO: 9; and

   a detection step of detecting the amount of antigen contained in the sample by calculating the gene copy number by substituting the threshold cycle value (Ct) obtained in the amplification step into the prepared standard curve;

   Further comprising, dengue virus serotyping method.
10. 8. The method of claim 7,

    The first nucleic acid amplification reaction is a dengue virus serotype analysis method, wherein the synthesis step is performed by a polymerase chain reaction (PCR).
11. 11. The method of claim 10,

    The polymerase chain reaction is a real-time polymerase chain reaction (RT-PCR), dengue virus serotype analysis method.
12. 10. The method of claim 9,

    The second nucleic acid amplification reaction is performed by Real-Time Polymerase Chain Reaction (RT-PCR).

Images