WO2021135137A1 - Mitochondrial g-quadruplex dna-targeted fluorescent probe, and preparation method therefor and use thereof - Google Patents

Abstract

Disclosed in the present invention are a mitochondrial G-quadruplex DNA-targeted fluorescent probe, and a preparation method therefor and use thereof. The structure of the fluorescent probe is shown by formula (I), wherein R₁ is H, F, Cl, Br, or I; R₂ is -O(CH₂)_ntriphenyl phosphine, wherein n is any one integer of 2 to 10; R₃ is N-methylpiperazine, -NR₄R₅, or -NH(CH₂)_mR₆, wherein m is any one integer of 1 to 8; R₄ and R₅ each independently are hydrogen, C_1-8alkyl, or C_1-8haloalkyl; R₆ is amine, C_1-8alkylamino, or C_1-8alkoxyl group-substituted amino; and A^- is an N methylated anion, a halogen ion, a p-toluenesulfonic acid ion, or a trifluoromethanesulfonic acid ion. The fluorescent probe can specifically detect and recognize a mitochondrial G-quadruplex DNA structure, and is not interfered by other components; moreover, the fluorescent probe has good chemical stability, light stability, solubility, and biocompatibility, and has a wide application space in the biological function study of the mitochondrial G-quadruplex DNA.

Description

Fluorescent probe targeting mitochondrial G-quadruplex DNA, preparation method and application thereof Technical field

The present invention relates to the technical field of G-quadruplex DNA detection, and more specifically, to a fluorescent probe targeting mitochondrial G-quadruplex DNA, and a preparation method and application thereof.

Background technique

G-quadruplex DNA is a G-quadruplex formed by guanine-rich nucleic acid sequences through hoogsteen hydrogen bonds, and the G-quadruplexes are further stacked and folded to form G-quadruplex DNA. Bioinformatics analysis found that there are about 370,000 sequences in the human genome that have the possibility of forming G-quadruplexes, including the guanine repeat promoter region at the end of the telomere, ribosomal DNA (rDNA), and transcription initiation site (TSS), untranslated region (UTR) and other regions indicate that the G-quadruplex plays an important role in the human genome and transcriptome, and participates in the regulation of many important life processes. In the past ten years, research on G-quadruplexes has mainly focused on nuclear DNA and G-quadruplex; recent studies have found that mitochondrial DNA can also form a G-quadruplex structure. Little is known about the function of learning. Therefore, the presence of mitochondrial G-quadruplex DNA can be specifically detected in the cell, which is useful for studying the biological functions of mitochondrial G-quadruplex DNA and for elucidating cell dysfunction and disease pathogenesis related to mitochondrial damage. The mechanism has important meaning.

At present, some progress has been made in the research of detecting the structure of DNA G-quadruplex in cells. There are some fluorescent probes that can realize the detection of G-quadruplex DNA in cells. However, there are no reports on fluorescent probes that can specifically recognize mitochondrial G-quadruplex DNA. Moreover, due to the existence of a large excess of other nucleic acid secondary structures in the body and the complex intracellular environment, the specific detection of mitochondrial G-quadruplex DNA in the cell requires more problems than nuclear G-quadruplex DNA detection. .

Therefore, it is urgent to provide a fluorescent probe that specifically recognizes mitochondrial G-quadruplex DNA in cells.

Summary of the invention

The purpose of the present invention is to provide a fluorescent probe targeting mitochondrial G-quadruplex DNA against the lack of fluorescent probes that can specifically recognize mitochondrial G-quadruplex DNA in the prior art. The fluorescent probe of the present invention can specifically recognize mitochondrial G-quadruplex DNA in the cell without being interfered by other components in the cell, especially the interference of the G-quadruplex structure at other locations, such as nuclear G -Quadruplex DNA and G-quadruplex RNA, which can accurately detect and trace mitochondrial G-quadruplex DNA in living cells in real time.

Another object of the present invention is to provide a method for preparing the fluorescent probe targeting mitochondrial G-quadruplex DNA.

Another object of the present invention is to provide the application of the fluorescent probe targeting mitochondrial G-quadruplex DNA.

The above-mentioned objects of the present invention are achieved through the following schemes:

A fluorescent probe targeting mitochondrial G-quadruplex DNA, the structure of which is shown in formula (I):

Wherein, R ₁ is H, F, Cl, Br or I; R ₂ is -O(CH ₂ ) _n triphenylphosphonium, where n is any integer from 2 to 10; R ₃ is N-methylpiperazine , -NR ₄ R ₅ or -NH(CH ₂ ) _m R ₆ , where m is any integer from 1 to 8, and R ₄ and R ₅ are each independently hydrogen, C _1-8 alkyl or C _1-8 Halogenated alkyl group, R ₆ is amino group, C _1-8 alkylamino group or C _1-8 alkoxy substituted amino group; A ^- is N-methylated anion, halide ion, p-toluenesulfonic acid ion or trifluoromethanesulfonate Acid ion.

Preferably, the R ₂ is -O(CH ₂ ) _n triphenylphosphonium, where n is any integer from 2 to 6; R ₃ is N-methylpiperazine, -NR ₄ R ₅ or -NH( CH ₂ ) _m R ₆ , where m is any integer from 1 to 5, R ₄ and R ₅ are each independently hydrogen, C _1-4 alkyl or C _1-4 haloalkyl, R ₆ is an amino group, C _1-4 alkylamino groups or C _1-4 alkoxy substituted amino groups.

Preferably, the R ₂ is -O(CH ₂ ) _n triphenylphosphonium, wherein n is any integer from 2 to 6; R ₃ is -NR ₄ R ₅ , R ₄ and R ₅ are each independently hydrogen , C _1-4 alkyl or C _1-4 haloalkyl.

Preferably, the R ₂ is -O(CH ₂ ) _n triphenylphosphonium, wherein n is any integer from 2 to 6; the R ₃ is -NR ₄ R ₅ , R ₄ and R ₅ are each independently It is hydrogen, C _1-4 alkyl or C _1-4 haloalkyl.

Preferably, the R ₂ is -O(CH ₂ ) ₄ triphenylphosphonium.

Preferably, the R ₃ is -NR ₄ R ₅ , and R ₄ and R ₅ are each independently hydrogen, methyl, ethyl, propyl, trifluoromethyl or trifluoroethyl.

Preferably, the A ^- is a halide ion, a p-toluenesulfonate ion or a trifluoromethanesulfonate ion.

Preferably, the structure of the fluorescent probe is as shown in one of the following structures:

The present invention also protects the preparation method of the fluorescent probe targeting mitochondrial G-quadruplex DNA, including the following steps:

S1.2-pyrrolidone reacts with a compound of formula 2 in the presence of phosphorus oxychloride to obtain a compound of formula 3;

S2. The compound of formula 3 is reacted with sodium methoxide under the action of methanol to obtain the compound of formula 4; then the methyl group is removed to obtain the compound of formula 5;

S3. The compound of formula 5 _{undergoes a substitution reaction with Br(CH 2} ) _n Br to obtain a compound of formula 6, and then it undergoes a substitution reaction with triphenylphosphonium to obtain a compound of formula 7;

S4. The compound of formula 7 is reacted with the methylating reagent to obtain the compound of formula 8, and then the compound of formula 9 is reacted to prepare the compound of formula (I);

The structures of the compounds of formula 2 to formula 9 are shown below, where n is any integer from 2 to 10;

The application of the fluorescent probe targeting mitochondrial G-quadruplex DNA in detecting mitochondrial G-quadruplex DNA is also within the protection scope of the present invention.

Compared with the prior art, the present invention has the following beneficial effects:

The fluorescent probe provided by the present invention can specifically detect and recognize the structure of mitochondrial G-quadruplex DNA in living cells, and the detection process is not interfered by other components; at the same time, the fluorescent probe has good chemical stability, Light stability, good solubility and biocompatibility, simple preparation process and low cost have broad application space in the study of the biological function of mitochondrial G-quadruplex DNA.

Description of the drawings

Figure 1 shows the UV-Vis absorption spectrum of the fluorescent probe MitoISCH-1 in Tris-hydrochloric acid buffer.

Figure 2 shows the UV-Vis absorption spectrum of MitoISCH-1, a fluorescent probe MitoISCH-1, in the Tris-HCl buffer solution with different amounts of mitochondrial G-quadruplex DNA Mito27. Among them, the concentration of the fluorescent probe is 5 μM.

Figure 3 shows the fluorescence spectra of different mitochondrial DNA samples dropped into the fluorescent probe MitoISCH-1. Among them, the concentration of the fluorescent probe is 1 μM, and the concentration of the mitochondrial DNA sample is 3 μM.

Figure 4 shows the fluorescence titration curve of the fluorescent probe MitoISCH-1 dripped with different mitochondrial DNA samples in the Tris-HCl buffer solution. Among them, the concentration of the fluorescent probe is 1 μM.

Figure 5 shows the confocal laser confocal microscopy imaging of the fluorescent probe MitoISCH-1 to detect mitochondrial G-quadruplex DNA in living cells.

Detailed ways

The present invention will be further elaborated below in conjunction with specific embodiments, which are only used to explain the present invention and not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used, unless otherwise specified, are commercially available reagents and materials.

Example 1 Synthesis of Compound MitoISCH-1, MitoISCH-2, MitoISCH-3

The specific preparation process of the compounds MitoISCH-1, MitoISCH-2 and MitoISCH-3 is as follows:

(1) Take 10 g of 2-amino-4,5-difluorobenzoic acid and 18 g of 2-pyrrolidone and dissolve them in 150 mL of dry toluene, stir until fully dissolved; at room temperature, slowly add 35 mL of POCl ₃ dropwise. Stir at room temperature for 5h. The toluene and phosphorus oxychloride were spun off by rotary evaporation, and the concentrated liquid was poured into ice water, the pH was adjusted to weakly alkaline, and a large amount of white solid was precipitated. It was filtered and dried to obtain 10.47 g of white solid, namely compound (a).

(2) Dissolve 5 g of compound (a) and 5 g of sodium methoxide in 50 mL of methanol, reflux for 24 hours at 60°C, cool to room temperature, filter under reduced pressure, and evaporate the filtrate to obtain 4.6 g of white solid, namely compound (b).

(3) Dissolve 4 g of compound (b) in 20 mL of glacial acetic acid and 20 mL of hydrobromic acid, heat to reflux at 140°C for 48 hours, filter with suction, and evaporate the filtrate to obtain 3.4 g of white solid, namely compound (c).

(4) Dissolve 2g of compound (c), 2.5g of potassium carbonate and 2.4mL of 1,4-dibromobutane in 40mL of acetone, reflux and stir at 60°C for 24h, filter under reduced pressure, and evaporate the filtrate. Purified by silica gel chromatography using methanol: dichloromethane (volume ratio 1:250) as the eluent, and separated to obtain 2.8 g of white solid, namely compound (d).

(5) Dissolve 1g of compound (d) and 1.3g of triphenylphosphine in 20mL of acetonitrile, and stir at 90°C under reflux for 24h. After cooling to room temperature, the acetonitrile was evaporated to dryness, and purified by silica gel chromatography using methanol: dichloromethane (volume ratio 1:50) as the eluent to obtain 1.4 g of white solid, namely compound (e).

(6) Dissolve 0.5 compound (e) in 2mL acetonitrile, add 1mL methyl iodide, and react at 70℃

After 24h, cooled to room temperature, filtered with suction, washed with anhydrous ether and dried in vacuo to obtain 0.5 g of light yellow solid, namely compound (f).

(7) Dissolve 0.4 g of compound (f) and 0.18 g of 7-(diethylamino) coumarin aldehyde in 20 mL of ethanol, add a catalytic amount of piperidine, and stir at 90°C under reflux overnight. Cool to room temperature, evaporate ethanol, and purify by silica gel chromatography using methanol: dichloromethane (volume ratio 1:25) as eluent to obtain 0.37 g of tan solid, namely compound (MitoISCH-1).

(8) Dissolve 0.4 g of compound (f) and 0.18 g of 7-amino-coumarin aldehyde in 20 mL of ethanol, add a catalytic amount of piperidine, and stir at 90°C under reflux overnight. Cool to room temperature, evaporate ethanol, and purify by silica gel chromatography using methanol: dichloromethane (volume ratio 1:20) as eluent to obtain 0.32 g of tan solid, namely compound (MitoISCH-2).

(9) Dissolve 0.4 g of compound (f) and 0.18 g of 7-(methylpiperazine)-coumarin aldehyde in 20 mL of ethanol, add a catalytic amount of piperidine, and stir at 90°C under reflux overnight. Cool to room temperature, evaporate ethanol, and purify by silica gel chromatography using methanol: dichloromethane (volume ratio 1:15) as eluent to obtain 0.28 g of tan solid, namely compound (MitoISCH-3).

The structure and proton nuclear magnetic resonance data of compound MitoISCH-1 are shown below:

¹ H NMR(400MHz,MeOD)δ8.21(s,1H), 8.05–8.01(m,2H), 7.92–7.71(m,15H), 7.60(d,J=9.1Hz,1H), 7.52(d ,J=6.7Hz,1H), 6.85(dd,J=9.1,2.3Hz,1H), 6.61(d,J=2.1Hz,1H), 4.48(t,J=5.8Hz,2H), 4.39–4.32 (m,5H),3.65-3.52(m,6H),3.48–3.41(m,2H),2.24-2.15(m,2H),2.03-1.91(m,2H),1.25(t,J=7.1Hz ,6H). ¹³ C NMR (126MHz, DMSO) δ 160.00, 159.03, 156.64, 155.84 (d, J _{C, F} = 2.3Hz), 153.02 (d, J _{C, F} = 12.1Hz), 152.51, 150.94 (d, J _C,F ＝251.6Hz),144.77,139.03,138.46,134.62(d, ⁴ J _C,P =2.9Hz,3C),133.21(d, ² J _C,P ＝10.1Hz,6C),131.37,129.93 (d, ³ J _{C, P} = 12.5Hz, 6C), 126.68, 118.12(d, ¹ J _{C, P} = 85.7Hz, 3C), 112.73, 112.53(d, J _{C, F} = 21.0Hz), 112.02( d,J _C,F ＝7.5Hz),110.13,108.21,104.31,96.31,68.81,46.38,44.18(2C),40.93,28.54(d, ² J _C,P =16.8Hz),27.32,20.12(d, ¹ J _{C, P} = 50.7 Hz), 18.22 (d, ³ J _{C, P} = 3.7 Hz), 12.06 (2C). ¹⁹ F NMR (376 MHz, DMSO)δ-131.36. ³¹ P NMR (162 MHz, DMSO )δ24.06.Purity:99.4% by HPLC.HRMS(ESI):calcd for[(M-2I)/2] ²⁺ 389.6639,found 389.6626.

¹ H NMR (400 MHz, MeOD) δ 8.23 (s, 1H), 8.04-8.02 (m, 2H), 7.94-7.70 (m, 15H), 7.63 (d, J = 9.0 Hz, 1H), 7.51 ( d,J=6.8Hz,1H), 6.85(dd,J=9.0,2.4Hz,1H), 6.63(d,J=2.2Hz,1H), 4.45(t,J=5.6Hz,2H), 4.39- 4.32 (m, 5H), 3.90 (s, 2H), 3.65-3.52 (m, 2H), 3.47-3.41 (m, 2H), 2.25-2.13 (m, 2H), 2.03-1.91 (m, 2H). ¹³ C NMR (126 MHz, DMSO) δ 160.05 _{, 159.01, 156.62, 155.83 (d, J C, F} = 2.4 Hz), 153.03 (d, J _{C, F} = 12.3 Hz), 152.52, 150.96 (d, J _{C, F} = 251.8 Hz), 144.72, 139.02, 138.44, 134.61 (d, ⁴ J _{C, P} = 2.9 Hz, 3C), 133.22 (d, ² J _{C, P} = 10.2 Hz, 6C), 131.36, 129.94 (d, ³ J _C,P ＝12.6Hz,6C),126.67,118.14(d, ¹ J _C,P ＝85.8Hz,3C),112.74,112.51(d,J _C,F ＝21.1Hz),112.03(d,J _C,F =7.6Hz),110.12,108.23,104.34,96.33,68.80,46.36,40.91,28.52(d, ² J _C,P = 16.8Hz), 27.34, 20.15(d, ¹ J _C,P = 50.7Hz ), 18.23 (d, ³ J _{C, P} = 3.8 Hz). ¹⁹ F NMR (376 MHz, DMSO) δ-131.20. ³¹ P NMR (162 MHz, DMSO) δ 24.00. Purity: 98.2% by HPLC.HRMS (ESI):calcd for[(M-2I)/2] ²⁺ 361.6325,found 361.6332.

¹ H NMR (400 MHz, MeOD) δ 8.23 (s, 1H), 8.03-8.02 (m, 2H), 7.91-7.70 (m, 15H), 7.61 (d, J = 9.0 Hz, 1H), 7.50 ( d,J=6.6Hz,1H), 6.86(dd,J=9.0,2.4Hz,1H), 6.63(d,J=2.2Hz,1H), 4.47(t,J=5.8Hz,2H), 4.40– 4.33 (m, 5H), 3.67-3.51 (m, 6H), 3.49-3.40 (m, 2H), 2.39-2.30 (m, 4H), 2.26-2.14 (m, 2H), 2.22 (s, 3H), 2.03-1.91 (m, 2H). ¹³ C NMR (126MHz, DMSO) δ 160.07, 159.05, 156.56, 155.79 (d, J _{C, F} = 2.5 Hz), 153.13 (d, J _{C, F} = 12.3 Hz), 152.59 ,150.83(d,J _C,F ＝251.7Hz),144.68,139.13,138.53,134.67(d, ⁴ J _C,P ＝3.0Hz, 3C),133.25(d, ² J _C,P ＝10.3Hz,6C ),131.43,129.86(d, ³ J _{C, P} = 12.8Hz, 6C), 126.69, 118.23(d, ¹ J _{C, P} = 85.9Hz, 3C), 112.79, 112.59(d, J _{C, F} = 21.3 Hz),112.13(d,J _C,F ＝7.8Hz),110.17,108.21,104.38,96.30,68.89,46.43,46.08,44.21(2C),40.87,28.59(d, ² J _C,P =16.9Hz) , 27.39, 20.19 (d, ¹ J _{C, P} = 50.7 Hz), 18.27 (d, ³ J _{C, P} = 3.8 Hz), 12.06 (2C). ¹⁹ F NMR (376MHz, DMSO) δ-131.42. ³¹ P NMR(162MHz,DMSO)δ24.09.Purity:95.8% by HPLC.HRMS(ESI):calcd for[(M-2I)/2] ²⁺ 403.1693,found 403.1686.

Example 2 Performance test experiment

Take the fluorescent probe MitoISCH-1 as a representative to test the performance of the fluorescent probe MitoISCH-1 to recognize mitochondrial G-quadruplex DNA.

1. Test the in vitro recognition effect of the fluorescent probe MitoISCH-1 on mitochondrial G-quadruplex DNA

The sequence of the mitochondrial DNA sample tested includes:

Mito27: 5’-(AGGTCGGGGCGGTGATGTAGAGGGTGATGGT)-3’

Mito160:

5’-GGGCTTGATGTGGGGAGGGGTGTTTAAGGGGTTGGCTAGGGTATAATTGT

CTGGG-3’

Mito27mut: 5’-AGGTCGAAGCGGTGATGTAGAGAGTGATAGT-3’

Mito160mut:

5’-GAGCTTGATGTGAAGAGAAGTGTTTAAGAAGTTGGCTAGAGTATAATTGT

CTGAG-3’

MitoHP19:

5’-CAGTATCTGTCTTTGATTCTTTTTTGAATCAAAGACAGATACTG-3’

Among them, Mito27 and Mito160 are mitochondrial G-quadruplex DNA structures, MitoHP19 is a mitochondrial double-stranded DNA structure, Mito27mut and Mito160 are single-stranded DNA structures. DNA samples were purchased from Shanghai Shenggong. Dissolve an appropriate amount of DNA sample in Tris-HCl buffer (pH7.4, 10mM Tris, 100mM KCl), set ultra-micro UV concentration, heat at 95℃ for 5min, slowly cool and anneal to room temperature as storage solution, store at 4℃ stand-by.

Take compound MitoISCH-1 as the test fluorescent probe, dissolve it in dimethyl sulfoxide to prepare a 10mM stock solution, and then dilute it into a Tris-HCl buffer (pH 7.4, 10mM Tris, 100mM KCl). A fluorescent probe solution with a concentration of 5uM or 1uM is used for testing.

(1) Test the absorbance of the configured fluorescent 5uM probe solution. As shown in Figure 1, the fluorescent probe MitoISCH-1 has a maximum ultraviolet absorption intensity at about 525nm.

(2) Using Mito27 as the test mitochondrial G-quadruplex DNA, add Mito27 mitochondrial G-quadruplex DNA to the prepared 5uM fluorescent probe MitoISCH-1 buffer solution. As the amount of drop increases, The absorbance results of the mixed solution are shown in Figure 2.

The test result is: the maximum ultraviolet absorption peak of the fluorescent probe MitoISCH-1 is red-shifted from 530nm to about 600nm, and an isochromatic point appears at 570nm.

(3) Drop the above-mentioned different mitochondrial DNA samples into the 1uM fluorescent probe MitoISCH-1 buffer solution respectively, the final concentration of DNA is 3uM, and detect the fluorescence intensity after adding different mitochondrial DNA to the fluorescent probe MitoISCH-1, The test result is shown in Figure 3.

The test result is that the fluorescence response of the fluorescent probe MitoISCH-1 to mitochondrial G-quadruplex DNA (Mito27, Mito160) is significantly higher than that of other nucleic acid secondary structures. It can be seen that the fluorescent probe MitoISCH-1 can specifically recognize the structure of mitochondrial G-quadruplex DNA.

(4) Drop the above-mentioned different mitochondrial DNA test solutions into the 1uM fluorescent probe MitoISCH-1 buffer solution respectively, and test the changes in the fluorescence intensity of the mixed solution as the DNA concentration increases. The test results are shown in Figure 4. .

The results show that at the same concentration, the fluorescence response of the probe to the mitochondrial G-quadruplex Mito27 and Mito160 is significantly higher than other secondary structures, and with the increase of the concentration, the fluorescence intensity becomes stronger and stronger. The difference is becoming more and more obvious. It is proved that the fluorescent probe MitoISCH-1 specifically recognizes the structure of mitochondrial G-quadruplex DNA.

2. Test the specific recognition effect of the fluorescent probe MitoISCH-1 on mitochondrial G-quadruplex DNA in living cells

(1) Fluorescence microscopic imaging of G-quadruplex DNA in mitochondria

Put Hela (human cervical cancer cell) cells in culture medium (DMEM culture medium and 10% embryonic bovine serum), and place them in _{an incubator at 37°C, 5% CO 2} and 20% O ₂ for 24 to 48 hours . Take the fluorescent probe MitoISCH-1 (prepared with Hela cell culture medium 1.0μM MitoISCH-1) and add it to the culture dish and continue to culture for 3 hours. The sample is washed with culture medium for 3 times and fluorescence imaging is performed. The result is shown in Figure 5.

The experimental results found that the mitochondria of cells stained with MitoISCH-1 showed strong fluorescence. The experimental results showed that MitoISCH-1 has good cell membrane permeability and can be located in the mitochondria of cells. After pre-cultured with G-quadruplex ligand PDS (10μM) for 24 hours in Hela cells, the fluorescence intensity in mitochondria was significantly increased, indicating that MitoISCH-1 can be used for the detection of G-quadruplex DNA in mitochondria, and during the test process Medium cells maintain high activity.

The above experimental results show that the fluorescent probe of the present invention has the function of specifically recognizing the G-quadruplex DNA in the mitochondria of living cells, and can detect the changes of the G-quadruplex DNA in the mitochondria in real time.

The fluorescent probe provided by the present invention has a structure as shown in formula (I). In the structure, the conjugated system formed by the Isaindigotone structure and the coumarin is the parent structure of the probe that can specifically recognize the G-quadruplex DNA. Among them _{, when the substituents of R 1} and R ₃ are changed, it has little effect on the activity. R ₂ is the mitochondrial localization group, where the length of the linker connecting triphenylphosphine does not affect the positioning of the probe in the mitochondria and the specific recognition of G-quadruplex DNA in the mitochondria, so the compounds MitoISCH-2 and MitoISCH-3 It also has the effect of targeting mitochondrial G-quadruplex DNA.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit the scope of protection of the present invention. For those of ordinary skill in the art, they can also make decisions based on the above descriptions and ideas. For other changes or changes in different forms, it is not necessary and impossible to enumerate all the implementation methods here. Any modification, equivalent replacement and improvement made within the spirit and principle of the present invention shall be included in the protection scope of the claims of the present invention.

Claims (9)

1. A fluorescent probe targeting mitochondrial G-quadruplex DNA, characterized in that its structure is as shown in formula (I):

   

   Wherein, R ₁ is H, F, Cl, Br or I; R ₂ is -O(CH ₂ ) _n triphenylphosphonium, where n is any integer from 2 to 10; R ₃ is N-methylpiperazine , -NR ₄ R ₅ or -NH(CH ₂ ) _m R ₆ , where m is any integer from 1 to 8, and R ₄ and R ₅ are each independently hydrogen, C _1-8 alkyl or C _1-8 Halogenated alkyl group, R ₆ is amino group, C _1-8 alkylamino group or C _1-8 alkoxy substituted amino group; A ^- is N-methylated anion, halide ion, p-toluenesulfonic acid ion or trifluoromethanesulfonate Acid ion.
2. The fluorescent probe targeting mitochondrial G-quadruplex DNA according to claim 1, wherein the R ₂ is -O(CH ₂ ) _n triphenyl phosphate, wherein n is any one of 2-6 Integer; R ₃ is N-methylpiperazine, -NR ₄ R ₅ or -NH(CH ₂ ) _m R ₆ , where m is any integer from 1 to 5, and R ₄ and R ₅ are each independently hydrogen, C _1-4 alkyl group or C _1-4 haloalkyl group, R ₆ is an amino group, a C _1-4 alkylamino group or a C _1-4 alkoxy substituted amino group.
3. The fluorescent probe targeting mitochondrial G-quadruplex DNA according to claim 2, wherein said R ₂ is -O(CH ₂ ) _n triphenyl phosphate, wherein n is any one of 2-6 Integer; R ₃ is -NR ₄ R ₅ , R ₄ and R ₅ are each independently hydrogen, C _1-4 alkyl or C _1-4 haloalkyl.
4. The fluorescent probe targeting mitochondrial G-quadruplex DNA according to claim 3, wherein said R ₂ is -O(CH ₂ ) _n triphenyl phosphate, wherein n is any one of 2-6 Integer; said R ₃ is -NR ₄ R ₅ , R ₄ and R ₅ are each independently hydrogen, C _1-4 alkyl or C _1-4 haloalkyl.
5. The fluorescent probe targeting mitochondrial G-quadruplex DNA according to claim 4, wherein the R ₂ is -O(CH ₂ ) ₄ triphenyl phosphate.
6. The fluorescent probe targeting mitochondrial G-quadruplex DNA according to claim 5, wherein the R ₃ is -NR ₄ R ₅ , and R ₄ and R ₅ are each independently hydrogen, methyl, and ethyl. Group, propyl, trifluoromethyl or trifluoroethyl.
7. The fluorescent probe targeting mitochondrial G-quadruplex DNA according to claim 1, wherein the A ^- is a halide ion, p-toluenesulfonic acid ion or trifluoromethanesulfonic acid ion.
8. The method for preparing a fluorescent probe targeting mitochondrial G-quadruplex DNA according to any one of claims 1 to 7, characterized in that it comprises the following steps:

   S1.2-pyrrolidone reacts with a compound of formula 2 in the presence of phosphorus oxychloride to obtain a compound of formula 3;

   S2. The compound of formula 3 is reacted with sodium methoxide under the action of methanol to obtain the compound of formula 4; then the methyl group is removed to obtain the compound of formula 5;

   S3. The compound of formula 5 _{undergoes a substitution reaction with Br(CH 2} ) _n Br to obtain a compound of formula 6, and then it undergoes a substitution reaction with triphenylphosphonium to obtain a compound of formula 7;

   S4. The compound of formula 7 is reacted with the methylating reagent to obtain the compound of formula 8, and then the compound of formula 9 is reacted to prepare the compound of formula (I);

   The structures of the compounds of formula 2 to formula 9 are shown below, where n is any integer from 2 to 10;

   
9. The use of the fluorescent probe targeting mitochondrial G-quadruplex DNA of any one of claims 1 to 7 in the detection of mitochondrial G-quadruplex DNA.

Images