WO2021126978A1

WO2021126978A1 - Materials and methods related to transgenic plants having reduced levels of alkaloids and carcinogens

Info

Publication number: WO2021126978A1
Application number: PCT/US2020/065312
Authority: WO
Inventors: Deyu Xie; Mingzhuo LI
Original assignee: North Carolina State University
Priority date: 2019-12-17
Filing date: 2020-12-16
Publication date: 2021-06-24

Abstract

The present disclosure provides materials and methods relating to transgenic plants. In particular, the present disclosure provides novel nucleic acid molecules, constructs, and methods for generating transgenic plants (e.g., tobacco plants) with modifications involving Production of Anthocyanin Pigment 1 (PAP1) and Transparent Testa 8 (TT8), as well as Nicotiana tabacum JAZ1, JAZ3, JAZ7, and JAZ10. Transgenic plants having such modifications exhibit enhanced characteristics such as reduced levels of alkaloids and nitrosamine carcinogens.

Description

MATERIALS AND METHODS RELATED TO TRANSGENIC PLANTS HAVING REDUCED LEVELS OF ALKALOIDS AND CARCINOGENS

CROSS REFERENCE TO RELATED APPLICATIONS

|0001| This application claims priority to and the benefit of U.S. Provisional Patent Application No. 62/949,272 filed December 17, 2019, which is incorporated herein by reference in its entirety for all purposes.

INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0002} Incorporated by reference in its entirety herein is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 118,870 Byte ASCII (Text) file named “2020- 12-16_38150- 601_SQL_ST25.txt,” created on December 16, 2020.

FIELD

|0003] The present disclosure provides materials and methods relating to transgenic plants. In particular, the present disclosure provides novel nucleic acid molecules, constructs, and methods for generating transgenic plants (e.g., tobacco plants) with modifications involving Production of Anthocyanin Pigment 1 (PAP1) and Transparent Testa 8 (TT8), as well as Nicotiana tabacum JAZ1, JAZ3, JAZ7, and JAZ10. Transgenic plants having such modifications exhibit enhanced characteristics such as reduced levels of alkaloids and nitrosamine carcinogens.

BACKGROUND

|00 4] Nicotine is a major alkaloid of tobacco ( Nicotiana tabacum). This natural molecule is considered addictive (Thorndike and Rigotti, 2009, Grando, 2014, Sanner and Grimsrud, 2015, Lee et al, 2017, Arany et al, 2018, Greillier et al, 2018, Tidey et al, 2018, Santoro et al, 2019). Moreover, its related tobacco specific nitrosamines (TSNAs), such as nicotine- derived nitrosamine ketone (NNK), N-nitrosonomicotine (NNN), N’-nitrosoanatabine (NAT), N-nitrosoanabasine (NAB), and 4-(methylnitrosamino)-l-(3-pyridyl)-l-butanol (NNAL), are carcinogens in tobacco smoke (Hecht, 1998, Hecht et al, 2016, Konstantinou et al, 2018). Therefore, there is a global long-term effort to either reduce these metabolites in tobacco products or eliminate and strictly regulate tobacco smoke. [0005 j To date, numerous achievements have been made in elucidating the biosynthesis of nicotine and TSNAs to reduce their contents in cured tobacco leaves (Dawson, 1945, Tso and Jeffrey, 1956, Tso and Jeffrey, 1957, Stepka and Dewey, 1961, Ladesic and Tso, 1964, Mizusaki etal., 1973, Dewey and Xie, 2013). Nicotine is composed of two rings, one pyridine and the other pyrrolidine, which are biosynthesized from two distinct pathways (FIG. 1A). Aspartate oxidase (AS), quinolinate synthase (OS) and quinolinate phosphoribosyltransferase 1 and 2 (QPT1 and 2) genes have been demonstrated to encode enzymes that catalyze steps from aspartate to nicotinic acid (pyridine) through quinolinate and nicotinic mononucleotide intermediates (FIG. 1A) (Dewey and Xie, 2013, Shoji and Hashimoto, 2013). Of two QPT homologs, QPT2 but not QPT1 is specifically involved in the formation of pyridine (Shoji and Hashimoto, 2011a). Ornithine decarboxylase (ODC), N-putrescine methyltransferase (PMT), and N-methylputrescine oxidase (MPO) genes have been proved to encode enzymes that catalyze three steps from ornithine to 4-methylaminobutanal, which spontaneously forms N- methy 1 -D ¹ -pyrrol ini um cation with a pyrrolidine ring (FIG. 1A) (Dewey and Xie, 2013, Shoji and Hashimoto, 2013). Although the condensation mechanism of these two rings remains open for further studies, two genes, A622 (an isoflavone reductase-like gene) and BBL (berberine bridge enzyme-like gene) have been shown to involve these last steps (Hibi etal, 1994, DeBoer et al, 2009, Kajikawa et al, 2009, Kajikawa et al, 2011, Dewey and Xie, 2013, Shoji and Hashimoto, 2013, Lewis et al, 2015). Further demethylation of nicotine catalyzed by CYP82E4 and its homologs forms nomicotine (Gavilano and Siminszky, 2007, Chakrabarti et al, 2008, Lewis etal, 2010). The mechanisms of the formation of anatabine and anabasine are unknown (Dewey and Xie, 2013). One hypothesis is that these two alkaloids also result from the BBL catalysis of nicotinic acid. The other is that anabasine is derived from lysine, a different pathway (FIG. 1A) (Dewey and Xie, 2013). Four main TSNAs, NNK, NNN, NAT, and NAB, result from the nitrosation of nicotine, nomicotine, anatabine, and anabasine during the leaf curing process, respectively (FIG. 1A). To date, the mechanisms related to the nitrosation still require further investigation (Dewey and Xie, 2013). In addition to these known pathway genes, the regulation mechanisms of the nicotine pathway are appropriately elucidated. The myelocytomatosis oncogene (MYC) and APETALA 2/ethylene response factor (AP2/ERF) are two families of transcription factors (TFs) that directly bind to promoters of pathway genes to regulate the nicotine biosynthesis (De Boer et al, 2011, Shoji and Hashimoto, 2011b, Zhang et al, 2012, Dewey and Xie, 2013, Shoji and Hashimoto, 2013). Furthermore, it has been demonstrated that jasmonate (JA), a plant hormone, essentially regulates the nicotine biosynthesis (Baldwin et ctl, 1997, Imanishi et ctl, 1998, Shoji et ah, 2000, Xu and Timko, 2004). In the past decade, the regulation mechanism of nicotine biosynthesis by JA was elucidated by the demonstration of a co-receptor complex consisting of coronatine insensitive 1 (COI1) (Xie et ciL, 1998), a Skp/Cullin/F-box (SCF^con) complex, and JA ZIM-domain (JAZ) repressor (Shoji et ciL, 2008, De Boer et ciL, 2011, Shoji and Hashimoto, 2011b, Zhang et ctl, 2012). When roots lack isoleucine- JA (JA-Ile), two N. tabacum JAZ repressors, NtJAZl and NtJAZ3, bind to the NtMYC2 activators to turn off nicotine biosynthesis. In the presence of JA-Ile, this molecule induces the interaction of SCF^con and JAZ to form a complex, leading to ubiquitination of JAZ to release NtMYC2 that further activates the nicotine pathway (FIG. 1A) (Shoji et ciL, 2008, Shoji and Hashimoto, 2011b, Zhang et ciL, 2012). To date, based on those pathway and regulatory genes, antisense and RNAi have been reported to down-regulate gene expression to reduce nicotine, nomicotine, and TSNAs in leaves (Xie et ctl, 2004b, DeBoer et ctl, 2013, Lewis et ctl, 2015, Zhao et ciL, 2016). However, one problem is that the reduction of nicotine is traded with the increase of anatabine, which is not the goal of metabolic modification (Chintapakom and Hamill, 2003, DeBoer et ctl, 2011). In relation to this problem, whether unknown mechanisms exist to regulate the nicotine biosynthesis and can be further applied to effectively reduce nicotine, nomicotine, and TSNAs has not been investigated. Addressing this question will enhance the development of novel biotechnologies to significantly reduce these harmful compounds in tobacco.

SUMMARY

[0006 j Embodiments of the present disclosure include an isolated polynucleotide comprising a first nucleic acid molecule comprising a sequence encoding a Production of Anthocyanin Pigment 1 (PAP1) polypeptide or a fragment thereof, the first nucleic acid molecule operably linked to a heterologous promoter; and a second nucleic acid molecule comprising a sequence encoding a Transparent Testa 8 (TT8) or a fragment thereof, the first nucleic acid molecule operably linked to a heterologous promoter. In some embodiments, the first and second nucleic acid molecules are capable of being expressed in a plant cell.

[0007j In some embodiments, the polynucleotide further comprises at least one additional nucleic acid molecule selected from the group consisting of (i) a nucleic acid molecule comprising a sequence encoding a Nicotiana tabacum JAZ1 (NtJAZl) polypeptide or a fragment thereof, operably linked to a heterologous promoter; (ii) a nucleic acid molecule comprising a sequence encoding a Nicotiana tabacum JAZ3 (NtJAZ3) polypeptide or a fragment thereof, operably linked to a heterologous promoter; (iii) a nucleic acid molecule comprising a sequence encoding a Nicotiana tabacum JAZ7 (NtJAZ7) polypeptide or a fragment thereof, operably linked to a heterologous promoter; and (iv) a nucleic acid molecule comprising a sequence encoding a Nicotiana tabacum JAZ10 (NtJAZIO) polypeptide or a fragment thereof, operably linked to a heterologous promoter.

[0008] In some embodiments, the first nucleic acid molecule comprises a sequence that is at least 70% identical to SEQ ID NO: 1. In some embodiments, the second nucleic acid molecule comprises a sequence that is at least 70% identical to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a sequence that is at least 70% identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a sequence that is at least 70% identical to SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a sequence that is at least 70% identical to SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a sequence that is at least 70% identical to SEQ ID NO: 12. In some embodiments, the polynucleotide comprises a sequence that is at least 70% identical to SEQ ID NO: 13. [0009] In some embodiments, the PAP1 polypeptide or fragment thereof is exogenous. In some embodiments, the TT8 polypeptide or fragment thereof is exogenous. In some embodiments, the PAP1 polypeptide or fragment thereof is from a flowering plant. In some embodiments, the PAP1 polypeptide or fragment thereof is from Arabidopsis . In some embodiments, the TT8 polypeptide or fragment thereof is from a flowering plant. In some embodiments, the TT8 polypeptide or fragment thereof is from Arabidopsis. In some embodiments, the plant cell is a crop plant selected from the group consisting of rice, maize, wheat, barley, peanut, potato, sesame, olive tree, palm oil, banana, soybean, sunflower, canola, sugarcane, alfalfa, millet, leguminosae (bean, pea), flax, lupinus, rapeseed, tobacco, poplar, cotton, alfalfa, barrel medic, and white clover.

[0010] In some embodiments, the isolated polynucleotide comprises a regulatory sequence or regulatory element. In some embodiments, the heterologous promoter is operably linked to the first nucleic acid molecule and confers constitutive expression of PAP1. In some embodiments, the heterologous promoter is operably linked to the first nucleic acid molecule and confers conditional expression of PAP1. In some embodiments, the heterologous promoter is operably linked to the second nucleic acid molecule and confers constitutive expression of TT8. In some embodiments, the heterologous promoter is operably linked to the second nucleic acid molecule and confers conditional expression of TT8. [00111 In some embodiments, the polynucleotide is stably integrated into the genome of the plant cell. In some embodiments, the polynucleotide is transiently transformed into the plant cell.

|0012] In some embodiments, the polynucleotide comprises at least a third nucleic acid molecule comprising a sequence encoding a polypeptide or a fragment thereof, the third nucleic acid molecule operably linked to a heterologous promoter. In some embodiments, the third nucleic acid molecule comprises a sequence encoding a TTG1 (WD40) polypeptide or fragment or homolog thereof.

[0013] Embodiments of the present disclosure also include a vector or construct comprising the polynucleotide described above. In some embodiments, the polynucleotide is stably integrated into the genome of the transgenic plant. In some embodiments, the transgenic plant is a tobacco plant, plant variety, or cultivar. In some embodiments, the transgenic plant is a red tobacco variety, a dark tobacco varieties, any transgenic tobacco variety (e.g., P+T-NL, P+T- Kyl71, PAP1 tobacco), any dark tobacco variety (e.g., Narrow Leaf Madole and KY171), any Oriental tobacco variety (e.g., Nicotiana tabacum Xanthi), Flue-cured tobacco (e.g., K326, NC71, NC196, NC938, CC143), and Burley tobacco (e.g., TN94, KT 215LC, KT 212LC, KT 210LC, KT 209LC, KT 206LC, KT 204LC, TN 90LC, KY 14 x L8LC, HB 04PLC, HB 3307PLC, HB 4488PLC, Hybrid 404LC, N 7371LC, NC 7LC).

[0014] In some embodiments, the at least one tissue of the plant comprises reduced levels of at least one of nicotine, nomicotine, anabasine, anatabine, myosine, and tobacco specific nitrosamines (TSNAs). In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.5 ppm.

[0015| In some embodiments, the least one tissue of the plant comprises a level of nicotine that is reduced by at least 15%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by at least 30%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by at least 25%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by at least 30%. In some embodiments, the at least one tissue of the plant comprises a level of myosine that is reduced by at least 15%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by at least 40%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomi cotine (NNN) that is reduced by at least 55%. In some embodiments, the at least one tissue of the plant comprises a level of N’- nitrosoanatabine (NAT) that is reduced by at least 70%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by at least 60%. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs not greater than 3.5 ppm. In some embodiments, the at least one tissue of the plant comprises an increased level of anthocyanin. In some embodiments, roots of the plant comprise an increased level of flavan-3-ols and/or proanthocyanidins.

[0016] In some embodiments, the at least one tissue of the plant comprises decreased expression of at least one of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL, and ERF189. In some embodiments, the at least one tissue of the plant comprises increased expression of at least one of CHS, CHI, F3H, F3 Ή 3GT, DFR, ANS and ANR. In some embodiments, at least one tissue of the plant comprises increased expression of at least one of NtJAZl, NtJAZ3, NtJAZ7, and NtJAZl 0.

[0017] Embodiments of the present disclosure also include a method of enhancing at least one property of a tobacco plant comprising transforming the tobacco plant with the isolated polynucleotide described above.

[0018 j In some embodiments, the present disclosure also includes a method of enhancing at least one property of a tobacco plant comprising transforming the tobacco plant with an isolated polynucleotide comprising one or more of NtJAZl, NtJAZ3, NtJAZ7, and NtJAZlO.

[0019] In some embodiments, the at least one property of the tobacco plant comprises: a decreased level of at least one of nicotine, nomicotine, anabasine, anatabine, myosine, NNN, NNK, NAT, NAB, total tobacco alkaloids, and/or total tobacco specific nitrosamines (TSNAs); and/or an increased level of anthocyanin; and/or an increased level of flavan-3-ols and proanthocyanidins.

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIGS. 1A-1B: Biosynthetic pathways and regulation of nicotine, other tobacco alkaloids, and anthocyanin in the cytosol. A, biosynthetic pathway of tobacco nicotine, nomicotine, and tobacco specific nitrosamines (TSNAs) and known regulation mechanism in wild-type tobacco plants. MYC2 and EAR are positive transcription factors that activate the expression of most pathway genes. In the absence of isoleucine-jasmonate (Ile-JA), NtJAZ 1 and 3 (JAZ) repressors binds to MY C2 to inhibit the activation of the pathway genes (red lines). In the presence of bioactive Ile-JA (green arrows), SCF^con perceives this plant hormone to form a new JA-SCF^con complex to bind to JAZ and lead JAZ to proteasomal degradation. The degradation of JAZ release MYC2 to activate pathway gene expressions toward the biosynthesis of nicotine. Gene abbreviations are QS: quinolinate synthase, QPT2: quinolinate phosphoribosyltransferase 2, ODC: ornithine decarboxylase, MPT1: N-methylputricine transferase, MPOl: methylputricine oxidase 1, A622: an isoflavone reductase like enzyme, BBL: berberine bridge enzyme-like protein, and NND: nicotine N-demethylase. B, biosynthetic pathways and regulations of nicotine and anthocyanins in red tobacco plants. Nicotine biosynthesis limited in roots is as described in A. Red tobacco is programmed by Arabidopsis PAP1 (MYB75). PAP1 and TT8 (bHLH) are two positive transcription factors that are recruited together with the WD40 protein to form a master regulatory complex activating anthocyanin biosynthesis in plants. PAP1 and TT8 join WD40 to form WD40- bHLH-MYB complex that activates anthocyanin biosynthesis in all tissues. Gene abbreviations are CHS and CHI: chalcone synthase and isomerase, F3H: flavonone-3-hydroxylase, F3’H and F3’5’H: flavonoid-3 ’-hydroxylase and 3 ’5 ’-hydroxylase, DFR: dihydroflavonol reductase, ANS: anthocyanidin synthase, 3-GT: gly cotransferase. ANR encodes anthocyanidin reductase, a key enzyme toward proanthocyanidin biosynthesis.

[00211 FIGS 2A-2P: Reduction of nicotine, nomicotine, TSNA, and total alkaloid contents in transgenic red tobacco plants compared to wild-type dark tobacco plants. A-L, reduction of nicotine (A-B), nomicotine (C-D), NNK (E-F), NNN (G-H), NAT (I-J), and NAB (K-L) in different groups of leaves of P+T-NL (A, C, E, G, I, and K) and P+T-KY171 plants (B, D, F, H, J, and L). M-N, reduction of total tobacco alkaloids in four groups of leaves of P+T-NL (M) and P+T-KY171 (N) plants. O-P, cartoons showing leaf groups from both wild type (O) and transgenic red plants (P). Green and red bars represent wild type and red tobacco plants, respectively. Bl, B2, B3, and B4 labels represent the 1^st, 2^nd, 3^rd, and 4^th leaf groups from the base to the top of tobacco plant, respectively. Each metabolite in each group of leaves was quantified from leaves harvested from 120 tobacco plants. Bars labelled with low case “a” and “b” means significant difference between green and red pair bars (n=120, P-value less than 0.05). Percentages labeled on the top of red bars mean reduction compared to green bars. [0022] FIGS. 3A-3B: Reduction of anabasine, anabatine, and myosmine in leaves of red P+T transgenic tobacco plants compared to wild type ones. A, levels of arabasine, anabatine and myosmine were reduced in all leaf groups of P+T-NL plants compared to those of wild type NL. B, levels of anabasine, anabatine, and myosmine were reduced in all leaf groups of P+T-KY171 compared to those of wild type KY171. Green and red bars represent wild type and red tobacco plants, respectively. Bl, B2, B3, and B4 labels represent the 1^st, 2^nd, 3^rd, and 4^th leaf groups from the base to the top of plants, respectively. Each metabolite in each group of leaves was quantified from 120 tobacco plants. Paired green and red bars labelled with low case “a” and “b” mean significant difference (n=120, P-value less than 0.05). Percentages labeled on the top of red bars indicate reduction levels compared to green bars. Abbreviation, NL: Narrow Leaf Madole, P+T-NL: PAP1/TT8 transgenic Narrow Leaf Madole and P+T- KY171: PAP1/TT8 transgenic KY171.

[0023] FIGS. 4A-4B: Reduction of nicotine, nomicotine, anabasine, and anatabine in PAP1 tobacco leaves. A, levels of nicotine, nomicotine, anabasine, and anatabine were reduced in flue-cured leaves of PAP 1 tobacco compared to leaves of wild type Xanthi control in 2011. B, levels of nicotine, nomicotine, anabasine, and anatabine were reduced in Hue-cured leaves of PAP1 tobacco compared to leaves of wild type Xanthi control in 2012. Green and red bars represent wild type and red tobacco plants, respectively. I, II, III, IV, and V labeled on the x- axis represent the 1^st, 2^nd, 3^rd, 4^th and 5^th group of leaves from the top to the bottom of tobacco plant, respectively. Each metabolite in each group of leaves was quantified from leaves of 120 tobacco plants. Bars labelled with low case “a” and “b” means significant difference between green and red pair bars (n=120, P-value less than 0.05). Percentages labeled below the x-axis show reduction levels of each metabolite compared to green bars.

[0024] FIGS. 5A-5B: Reduction of total nicotine, nomicotine, anabasine, and anatabine in all leaves of PAP1 tobacco plant. Total levels of nicotine, nomicotine, anabasine, and anatabine were reduced in all leaves of PAP 1 tobacco compared to wild type Xanthi controls in 2011 (A) and 2012 (B). Green and red bars represent wild type and red tobacco plants, respectively. Bars labelled with low case “a” and “b” means significant difference between green and red pair bars (n=120, P-value less than 0.05). Percentages labeled below x-axis show reduction levels of each metabolite compared to green bars.

[0025] FIGS. 6A-6B: Reduction of NAB, NAT, NNK and NNN in Hue-cured leaves of PAP1 tobacco compared to leaves of wild type Xanthi control. Contents of NAB, NAT, NNK and NNN were reduced in each group of leaves and all leaf groups of PAP 1 tobacco compared to corresponding leaf groups of wild type Xanthi control in 2011 (A) and 2012 (B). Green and red bars represent wild type and red tobacco plants, respectively. I, II, III, IV, and V labelled on x-axis represent the 1^st, 2^nd, 3^rd, 4^th and 5^th leaf groups from the top to the base of tobacco plant, respectively. Each metabolite in each group of leaves was quantified from leaves of 120 tobacco plants. Bars labelled with low case “a” and “b” means significant difference between paired green and red bars (n=120, P-value less than 0.05). Percentages labeled below x-axis show reduction levels of each metabolite compared to green bars.

[0026] FIGS. 7A-7B: Reduction of total TSNAs in flue-cured leaves of PAP1 tobacco. Contents of NNN, NNK, NAT, and NAB were summed to calculate total contents in flue-cured leaves of all groups in 2011 (A) and 2012 (B). The total contents showed the significant reduction of total TSNAs.

[0027] FIGS. 8A-8L: Comparison of nicotine and nomicotine contents in leaves and roots of wild-type Narrow Leaf Madole (NL) and KYI 71, P+T transgenic NL and KYI 71, and vector control transgenic seedlings. The contents of nicotine and nomicotine were significantly reduced in roots and leaves of both P+T transgenic NL and KY lines. A-C: reduction of nicotine (A), nomicotine (B), and total nicotine and nomicotine (C) in leaves of three P+T-NL lines (1, 2, and 3); D-F: reduction of nicotine (D), nomicotine (E), and total nicotine and nomicotine (F) in roots of three P+T-NL lines (1, 2, and 3); G-L reduction of nicotine (G), nomicotine (H), and total nicotine and nomicotine (I) in leaves of three P+T-KY lines (1, 2 and 3); J-L: reduction of nicotine (J), nomicotine (K), and total nicotine and nomicotine (L) in roots of three P+T-NL lines (1, 2, and 3). Bars labeled with “a” and “b” means p-value less than 0.05 and bars labelled with the same low case a or b means no significant difference.

[0028| FIGS. 9A-9X: Transcriptional comparison of seven nicotine pathway genes, four JAZs, and ERF189 in roots of transgenic and control seedlings. A-J and U-V, in comparison with gene expression levels in roots of wild type (WT) NL and vector control (VC) transgenic plants, qRT-PCR analyses showed that in roots of P+T-NL transgenic lines, the expression level of NtJAZl (A), NtJAZ3 (B), NtJAZ7 (U), and NtJAZIO (V) were significantly increased, the expression of ODC2 (C) was not changed, and the expression levels of PMT1 (D), PMT2 (E) MPO (F), QPT2 (G), A 622 (H), BBLs (I) (primer pairs designed for all three BBLs), and ERF189 (J) were significantly decreased. K-T and W-X, in comparison with the gene expression levels in roots of wild type (WT) KYI 71 and vector control (VC) transgenic plants, qRT-PCR analyses showed that in roots of P+T-KY transgenic lines, the expression levels of NtJAZl (K), NtJAZ3 (L), NtJAZ7 (W), and NtJAZIO (X) were significantly increased and the expression levels of ODC2 (M), PMT1 (N), PMT2 (O) MPO (P), QPT2 (Q), A 622 (R), BBLs (S) (primer pairs designed for all three BBLs), and ERF189 (T) were significantly decreased. Data of three transgenic lines are shown for both P+T-NL and P+T-KY genotypes. Wild type samples were pooled from five plants. Data of three lines are shown for vector control NL and KYI 71 transgenic plants. WT: wild type, P+T NL1, P+T NL2, P+T NL3: three lines of PAP1 and TT8 stacked transgenic NL plants, VC-1, 2, and 3-NL: three vector control transgenic NL lines, P+T KYI, P+T KY2, P+T KY3: three lines of PAP 1 and TT8 stacked transgenic KY171 plants. VC-1, 2, and 3-KY: three vector control transgenic KYI 71 lines. Green and red bars represent wild type and vector control transgenic, and red P+T-NL and P+T-KY plants, respectively. Values represent the mean ± S.D. (n=3). Asterisks on top of the bars indicate that values are significantly lower or higher in red transgenic lines than in wild type plants (*P<0.05, **P<0.01, ***P<0.001). Standard bars mean standard errors.

[0029] FIGS. 10A-10E: Binding and activation of NtJAZl and NtJAZ3 promoters by PAP1 and TT8 alone, PAP1-TT8 together, and PAP1-TT8-WD40 complex. A, identification and location of three types of MYB response elements (MRE) and G-box in NtJAZl and NtJAZ3 promoters. B, electrophoretic mobility shift assay (EMSA) showing that PAP1 and TT8 bind to three types of MRE and G-box of NtJAZl andNtJAZ3 promoters, respectively. Competitive and non-competitive probes were used for binding of both TFs. 20* and lOx: concentrations of tested competitive and non-competitive probes 20 and 10 times as those MRE and G-box probes. C, fold change values from Chip-qPCR showing that both PAP1 and TT8 bind to NtJAZl and NtJAZ3 promoters in vivo. Approximately 150 bp NtJAZl and NtJAZ3 promoter fragments containing both MRE and G-box were enriched by anti-HA antibodies in qRT-PCR analysis. The regions of NtJAZl and NtJAZ3 promoters that do not contain MRE and G-box were used as negative controls. Green and red bars represent wild type and red tobacco plants, respectively. D, schematic diagrams showing four effector constructs (PK2GW7-GFP, PAP1, TT8 and WD40) and two reporter constructs (pGreenII-0800-Jazl and Jaz3) for dual-luciferase assay. E, luciferase (LUC)/renilla (REN) luminescence ratios from dual luciferase assays showing that PAP 1 andTT8 alone bound and activated promoters of both NtJAZl andNtJAZ3, two TF together increased promoter activity, and two TF and WD40 together increased the most activity and the promoters fused to firefly luciferase (reporter). The promoters of NtJAZl and NtJAZ3 genes were used in dual luciferase assays. Values represent the mean ± S.D. (n=5). Asterisks on top of bars indicate that the values are significantly higher than those of controls (*P<0.05, **P<0.01, ***P<0.001).

[0030] FIGS. 1 lA-1 IB: Images showing expression and purification of binding domains of PAP1 and TT8 induced in E. coli in vitro. The 13KD R2R3 domain of PAP1 was fused to 42KD MBP-tag and the 12 KD bHLH domain was fused to His-tag. Fused protein fragments were induced in E. coli. A, a linear domain map of PAP 1 shows the R2R3 domain and a PAGE image shows the fused MBP-R2R3 fragment after partial purification. B, a liner domain map of TT8 shows the bHLH domain and other domains and a PAGE image shows fused bHLH- His-tag fragment after purification.

[003 Ff FIGS. 12A-12B: Electrophoretic mobility shift assays (EMSAs) showing weak binding of TT8 to the G-box-like probe and no binding of PAP 1 to the MRE-like probe. A, EMSA assays showed that the bHLH domain of TT8 could bind to the G-box-like (CACGTT) element of NtPMT2 and NtODC in the absence of competitive probes but could not bind to the G-box like element in the presence of competitive probe. Comparing experiments showed that the binding signal from TT8 to the G-box like probe was weaker than that from TT8 to the G- box element of NtJAZl and NtJAZ3. B, EMSAs showed no binding of the R2R3 domain of PAP1 to the MRE-like (AACAACC) element of NtPMT2 and NtODC promoters. The MREs (ACCCACC and AACTACC) of NtJAZl and NtJAZ3 promoters used as positive control showed strong binding reactions.

[0032j FIGS. 13A-13B: Dual-luciferase and chip-qPCR experiments showing no activation of NtPMT2 and NtODC 2 promoters by PAP1 and TT8 alone, PAP1 and TT8 together, and PAP1-TT8-WD40 complex. A, the ratios of luciferase (LUC)/renilla (REN) luminescence from dual luciferase assays showed that PAP1 and TT8 alone, two TFs together, and two TFs and WD40 together could not bind to and activate promoters of both NtPMT2 and NtODC2. The promoters were fused to firefly luciferase (reporter). The promoters of NtPMT2 and NtODC 2 genes from both Narrow Leaf Madole and KYI 71 varieties were used in dual luciferase assays. B, Chip-qPCR assays showed that both PAP1 and TT8 did not bind to the promoters of NtPMT2 and NtODC 2 in vivo. Approximately 150 bp NtPMT2 and NtODC 2 promoter fragments containing both MRE-like and G-box-like were enriched by anti-HA antibodies in qRT-PCR analysis. The NtPMT2 and NtODC2 promoter regions that lack MRE- like and G-box-like elements were used as negative controls. Green and red bars represent wild type and red tobacco plants, respectively.

[0033] FIGS. 14A-14B: Anthocyanin levels in roots and leaves of wild type and red P+T transgenic tobacco plants. A, anthocyanin was produced in P-T-NL roots and leaves but not in wild type control tissues (low values for control samples were from background). B, anthocyanin was produced in P-T-KY171 roots and leaves but not in wild type control tissues (low values are from background). Three biological samples were extracted for tissues of each genotype. Anthocyanin levels were represented with absorbance values recorded at 530 nm on aUV spectrometer.

[0034] FIGS. 15A-15D: Formation of flavan-3-ols and proanthocyanidin in red P+T transgenic tobacco roots. A, bluish color resulted from the reaction of DMACA with flavan-3- ols and proanthocyanidins in the P-T-NL 1 root extract but not from the reactions of DMACA and the P-T-NL1 leaf and wild type leaf and root extracts. B, bluish color resulted from the reaction of DMACA with flavan-3-ols and proanthocyanidins in the P-T-KY1 root extract but not from the reactions of DMACA and the P-T-KY1 leaf and wild type leaf and root extracts. C, the level of flavan-3-ols and proanthocyanidins was significantly higher in P-T-NL 1 roots than in leaves and in wild type control tissues (low values obtained for control samples were from background). D, the level of flavan-3-ols and proanthocyanidins was significantly higher in P-T-NL1 roots than in leaves and in wild type control tissues (low values obtained for control samples were from background). The levels of flavan-3-ols and proanthocyanidin were represented with absorbance values recorded at 640 nm on a UV spectrometer, respectively. Three biological samples were extracted for tissues of each genotype. Student t-Test was performed to evaluate statistical significance (P-value less than 0.05).

[0035j FIGS. 16A-16B: Transcriptional upregulation of eight flavonoid pathway genes in red transgenic P+T-NL and P+T-KY171 tobacco plants. A, qRT-PCR analysis showed that the expression levels of CHS, CHI, F3H, F3 H. 3GT, DFR, ANS and ANR were significantly upregulated in roots and leaves of red P+T-NL tobacco plants compared to those of wild type NL plants. B, qRT-PCR analysis showed the expression levels of CHS, CHI, F3H, F3 Ή, 3GT, DFR, ANS and ANR were significantly upregulated in roots and leaves of red P+T-KY171 tobacco plants compared to those of wild type KY171 plants. Three plants were used as one biological sample. Three biological samples were used for qRT-PCR analysis. Values are averaged from three biological samples.

[0036 j FIG. 17: A model showing a novel triple regulation of the PAP1-TT8-WD40 complex leading to the reprogramming of tobacco plants. The overexpression of PAP1 and TT8 recruits WD40 to form a stable PAP1-TT8-WD40 complex that leads to both transcriptional and metabolic reprogramming of tobacco plants to create red genotypes from wild-types. In addition, the PAP1 overexpression alone activates TT8 homolog expression and then recruit WD40 to form this complex. The complex performs three regulation functions, (1) positive activation of anthocyanin pathway in all tissues, (2) positive activation of JAZ members associated with JA and JA-signaling pathway in roots, and (3) down-regulation of nicotine pathway (roots).

|0037] FIG. 18: Schematic diagram showing procedures for field farming practice and leaf harvest from wild type and red transgenic tobacco plants. Simplified steps were similar to protocols used in tobacco agriculture in North Carolina.

[0038 j FIGS. 19A-19B: Field design for farming practice of red P+T transgenic plants. A, three plots were selected from field to form replicates at the Oxford research station. In each plot, 50 red T2 transgenic plants (homozygotes) were planted for each of P+T-NL and P+T- KY genotypes. In addition, 50 plants for wild type NL and KYI 71 controls were planted side by side. In total, 150 plants were grown for each genotype to collect leaves and analyze nicotine, TSNAs, and other alkaloids. Each genotypic plant was enclosed by K326 tobacco plants as buffer zones to prevent the escape of transgenic plants. Abbreviation, NL: Narrow Leaf Madole, P+T-NL: PAP1/TT8 transgenic Narrow Leaf Madole and P+T-KY171: PAP1/TT8 transgenic KYI 71. B, two weeks old seedlings were grown in soil in float tray in the greenhouse at the research station. Seedlings include Narrow Leaf Madole (NL), KYI 71, P+T-NL, and P+T-KY171.

[0039] FIG. 20: Representative images of planting, plant growth, and phenotypes of wild type NL, wild type KY171, and transgenic red P+T-NL, and red P+T-KY171 tobacco plants in the field from the first day to 75^th day after planting.

[0040 j FIGS. 21A-21E: Representative images showing the harvest of plants and cleanup of plant residues from the field.

[0041] FIGS. 22A-22D: Representative images and schematic diagrams showing comparison of leaf colors after air-curing and leaf positions for grouping and sampling.

[0042] FIGS. 23A-23E: Field farming practice of PAP1 tobacco plants and leaf harvest. PAP1 tobacco plants were isogenic homozygotes generated from the Xanthi variety that overexpresses PAP1. Field farming practice was performed in the field at the research station in Oxford, North Carolina in 2011 and 2012. A, this scheme shows field design for growth of PAP1 tobacco plants. PAP1 and wild type Xanthi plants were grown side by side and surrounded by wild type K326 variety to prevent the escape of PAP 1 tobacco plants. B, plants in the field were photographed after thirty days of planting (planting protocol is the same as described for P+T- NL and KY171 plants). C, schemes show fifteen leaves remained after topping, numeration of leaves from the top to the base, and grouping of leaves for metabolite analysis. D, this scheme shows leaf harvest. Each leaf was cut into two halves, one half with the main midvein for Hue-curing and the other half frozen in liquid nitrogen for metabolite analysis as required. E, this image shows color phenotypes of cured PAP1 leaves and wild type Xanthi leaves for metabolite analysis.

|0043] FIGS. 24A-24B Upregulation of NtAnla mdNtAnlb in roots of red PAP1 tobacco plants. NtAnla mdNtAnlb in tobacco are two homologs of TT8. Both NtAnla (A) mdNtAnlb (B) transcripts are upregulated in the red PAP1 tobacco plant overexpressing PAP1. PAP1 and NtAnla/NtAnlb forms a complex to positively activate the biosynthetic pathway of anthocyanins in red PAP1 tobacco.

[0044] FIGS. 25A-25E: Representative images and schematic diagrams showing field trials of red PAP1 tobacco plants and Hue-curing. DETAILED DESCRIPTION

[0045f Embodiments of the present disclosure provide materials and methods relating to transgenic plants. In particular, the present disclosure provides novel nucleic acid molecules, constructs, and methods for generating transgenic plants (e.g., tobacco plants) with modifications involving Production of Anthocyanin Pigment 1 (PAP1) and Transparent Testa 8 (TT8), as well as Nicotiana tabacum JAZ1, JAZ3, JAZ7, and JAZ10. Transgenic plants having such modifications exhibit enhanced characteristics such as reduced levels of alkaloids and nitrosamine carcinogens.

[0046| It has been challenging to simultaneously reduce tobacco alkaloids and specific nitrosamine (TSNA) carcinogens biosynthetically regulated by jasmonate. As disclosed herein, new mechanisms and innovations are provided that achieve this aim. Production of Anthocyanin Pigment 1 (PAP1/MYB), Transparent Testa 8 (TT8/bHLH), and WD40 protein form a master regulatory MBW complex that activates anthocyanin biosynthesis in Arabidopsis. PAP1 and TT8 were synthetically coupled to create two new genotypic red tobacco varieties (namely P+T-NL and P+T-KY171) from two commercial dark tobacco varieties, Narrow Leaf Madole (NL) and KY171. In addition, an isogenic red PAP1 tobacco was created using PAP1 alone. Following industry protocols, three years of field trials and leaf curing were performed. The contents of nicotine, nomicotine, anabasine, anatabine, and all TSNAs were significantly reduced in most or all leaves. More fundamentally, the content of nicotine-derived nitrosamine, a tobacco carcinogen proposed by the FDA to not exceed 1.0 ppm in content in finished smokeless tobacco products, was reduced to less than 0.5 ppm in all cured leaves. Furthermore, high production of anthocyanins added antioxidative and anti carcinogen values. Production of flavan-3-ols and proanthocyanidins added resistance or tolerance of roots to pathogens. Mechanistic investigations uncovered two new regulation mechanisms: (1) the transcriptional down-regulation of key biosynthetic pathway genes of nicotine; (2) the transcriptional activation of Jasmonate ZIM-domain ( JAZ ) repressors by PAP1 and TT8 alone, PAP1 and TT8 together, and the MBW complex. These findings for the first time disclose a triple regulation function by an MBW complex of plants, (1) activation of anthocyanin pathway, (2) activation of JAZ, and (3) negative regulation of nicotine pathway. [0047| Over the past decade, the discovery of JAZ repressors has led to explosive progress in the study of plant hormone JA to understand the mechanisms of its signaling pathway involved in plant development and in diverse plant responses to the environment (Chini et al, 2007, Santner and Estelle, 2007, Thines et al, 2007, Howe et al, 2018). Numerous excellent reviews have successively summarized new knowledge regarding JAZ and its associated complexes that are involved in plant resistance to diseases, herbivores, drought and cold, development of flowers, roots, and trichomes, regulation of stomata opening, senescence processes, and diverse secondary metabolism pathways (such as anthocyanin and nicotine) (Chico et al, 2008, Song et al, 2014, Goossens et al, 2017, Hu et al, 2017, Huang et al, 2017, Zhang etcil, 2017, Guo etcil, 2018, Howe et al, 2018). As summarized herein, the main discoveries from the JAZ family identified in Arabidopsis thaliana are disclosed. Thirteen JAZ (#1-13) members are structurally characterized to contain Jas and ZIM (TIFY) domains (Song et al, 2014, Chini et al, 2016, Howe et al, 2018). In addition, eight members, JAZ1 2, 5, 6, 7, 8, 10 and 13, contain a third domain, N-term domain, such as an EAR domain in JAZ13 and a cryptic MYC2-interacting domain (CMID) in JAZ1 (Chini et al, 2016, Howe et al, 2018). JAZ binds to canonical interactors via these domains to perform diverse regulatory functions. The Jas domain binds to COI1 and different TFs. The ZIM domains interacts with JAZs, Novel Interactor of JAZs (NINJA, a corepressor), and TFs. The N-term domain binds to TFs and the topless (TPL) corepressor. TFs interacting with the Jas domain include basic helix-loop-helix (bHLH), myeloblastosis oncogene (MYB), and ethylene insensitive (EIN) members (Chini et al, 2016). TFs interacting with the ZIM domain include MYB and WRKY members. TFs interacting with the N-term domain mainly include bHLH members. Intensive studies on the repression of the MYC2 activator by JAZ have particularly elucidated mechanisms of plant resistance to pathogens and herbivores (Chini et al, 2007, Chung et al, 2008, Demianski et al, 2012, Zabala et al.. 2016) . Data from MYC2 and other interactors have concluded a global JA signaling pathway, which is composed of (1) JA-Ile binding to the SCF^con complex to form a new complex, (2) the new complex binding to JAZ repressor, (3) ubiquitination of JAZs and (4) release of TFs, which perform positive or negative regulatory functions. To interpret JA signaling pathway and JAZ functions, Howe et al (2018) recently established a regulation modularity that dissected networks to associate with resilience, metabolisms, and other diverse physiologies of plants (Howe et al, 2018). In comparison, regulation mechanisms of JAZs, themselves in planta has gained less discussion. To date, the only accepted mechanism is that the transcription of JAZs is regulated by a negative MYC2-based feedback loop (Chini et al, 2007, Figueroa and Browse, 2012). Both transcription and promoter analysis have shown that MYC2 binds to the G-box of promoters of Arabidopsis JAZs (Chini et al, 2007). However, questions regarding whether MYC2 and its homologs are the only activators of JAZs in diverse conditions and whether other TFs are also involved in the activation of JAZs expression remain unexplored. [0048| Arabidopsis Production of Anthocyanin Pigment 1 ( PAP1 ) encodes a R2R3-MYB TF, namely MYB75 (Borevitz et ctl, 2000). PAP1 has been demonstrated to partner with Transparent Testa 8 (TT8, a bHLH)), Glabra 3 (GL3, a bHLH), and Transparent Testa Glabra 1 (TTG1, WD40), to form a mastery regulatory complex PAP1-TT8/GL3-TTG1 (MBW) (FIG. IB), which positively activates anthocyanin biosynthesis (Gonzalez et cil, 2008, Shi and Xie, 2011, Zhou et cil, 2012). To date, PAPl has been used to create novel crop varieties for value- added traits (Xie et al, 2006, Butelli et al, 2008, He et al, 2017). A novel isogenic red PAPl progeny was created (namely PAPl tobacco), which was metabolically reprogramed by PAPl to synthesize high production of anthocyanin (FIG. IB). Based on cis-regulatory elements of JAZ1, JAZ3, JAZ7, and JAZ10, we hypothesized that PAPl and its MBW complexes or other transcription factors such as TT8 likely regulate nicotine biosynthesis in red tobacco plants. To test this hypothesis, based on general industry standards that commercial varieties, field trials, and leaf curing are essential to evaluate nicotine, nomicotine, and TSNAs, three commercial tobacco cultivars were used to conduct nearly nine years of experiments including three years of field trials. A stacked T-DNA cassette for a coupled overexpression of both TT8 and PAPl was synthesized and introduced in two commercial dark tobacco varieties. T2 homozygous red progeny were selected from more than five TO lines (out of 20). Based on tobacco growing protocols, T2 PAP1-TT8 (P+T) transgenic and isogenic PAPl plants were grown in the field. Alkaloid analysis revealed significant reduction of nicotine, nomicotine, and all TSNAs in most or all red leaves. Further molecular and biochemical experiments demonstrated that TT8 and PAPl alone, PAPl and TT8 together, and the PAP1/TT8/TTG1 complex bound and activated promoters of tobacco JAZ1 and JAZ 3 (Nl.lAZI and NtJAZ3), increased their expression in roots, and downregulated expression of key nicotine pathway genes. These findings reveal new regulation mechanisms of JAZ expression and nicotine biosynthesis in tobacco plants. Moreover, these findings disclose a novel triple regulation function of the PAP1/TT8/TTG1 complex, which is characterized by positive activation of anthocyanin biosynthesis, positive activation of JAZ, and negative regulation of nicotine biosynthesis. More significantly, PAPl, PAPl and TT8, the TTG1/TT8/PAP1 complex are effective for tobacco harm reduction.

[0049] Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting. 1. Definitions

[0 50f Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.

[0051 i The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0052] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6- 9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0053] “Correlated to” as used herein refers to compared to.

[0054] As used herein the term “polynucleotide” refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).

|0055| The term “isolated” refers to at least partially separated from the natural environment e.g., from a plant cell.

[0056] Nucleic acid sequences described herein include fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion. [0057] According to some embodiments of the present disclosure, a polynucleotide encodes a polypeptide comprising an amino acid sequence at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, and 100% identical to the amino acid sequence of a naturally occurring plant orthologue of the polypeptides provided herein.

[0058] According to some embodiments of the present disclosure, the polypeptide comprises an amino acid sequence at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, and 100% identical to the amino acid sequence of a naturally occurring plant orthologue of the polypeptides described herein.

|0059] As used herein the phrase “complementary polynucleotide sequence” refers to a sequence, which results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA dependent DNA polymerase. Such a sequence can be subsequently amplified in vivo or in vitro using a DNA dependent DNA polymerase.

[0060] As used herein the phrase “genomic polynucleotide sequence” refers to a sequence derived (isolated) from a chromosome and thus it represents a contiguous portion of a chromosome.

|0061| The term “plant” as used herein encompasses a whole plant, a grafted plant, ancestor(s) and progeny of the plants and plant parts, including seeds, shoots, stems, roots (including tubers), rootstock, scion, and plant cells, tissues and organs. The plant may be in any form including suspension cultures, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. Plants that are particularly useful in the methods of the present disclosure include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including a fodder or forage legume, ornamental plant, food crop, tree, or shrub selected from the list comprising Acacia spp.. Acer spp.,Actinidia spp ,Aesculus spp ,Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp.. Arachis spp. Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp, Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetaria, Davallia divaricata, Desmodium spp., Dicksonia squarosa, Dibeteropogon amplectens, Dioclea spp. Dolichos spp.. Dorycnium rectum, Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana, Eragrestis spp., Erythrina spp., Eucalypfus spp., Euclea schimperi, Eulalia vi/losa, Pagopyrum spp.. Leijoa sellowlana,

Fragaria spp., Flemingia spp, Freycinetia banksli, Geranium thunbergii, Ginkgo biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hemaffihia altissima, Heteropogon contoffus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hypeffhelia dissolute, Indigo incamata, Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus spp.. Macrotyloma axillare, Mains spp.. Manihot esculenta, Medicago saliva, Metasequoia glyptostroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophorum africanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp.. Pisum sativam, Podocarpus totara, Pogonarthria fleckii, Pogonafftiria squarrosa, Populus spp., Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp.. Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys vefficillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vida spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, straw, sugar beet, sugar cane, sunflower, tomato, squash tea, maize, wheat, barley, rye, oat, peanut, pea, lentil and alfalfa, cotton, rapeseed, canola, pepper, sunflower, tobacco, eggplant, eucalyptus, a tree, an ornamental plant, a perennial grass and a forage crop. Alternatively, algae and other non-Viridiplantae can be used for the methods of the present disclosure.

[0062] According to some embodiments of the present disclosure, the plant used by the methods provided herein is a crop plant such as rice, maize, wheat, barley, peanut, potato, sesame, olive tree, palm oil, banana, soybean, sunflower, canola, sugarcane, alfalfa, millet, leguminosae (bean, pea), flax, lupinus, rapeseed, tobacco, poplar and cotton.

[0063] According to some embodiments of the present disclosure the plant is a dicotyledonous plant.

[0064] According to some embodiments of the present disclosure the plant is a monocotyledonous plant.

10065] According to some embodiments of the present disclosure, there is provided a plant cell exogenously expressing the polynucleotide of some embodiments of the present disclosure, the nucleic acid construct of some embodiments of the present disclosure and/or the polypeptide of some embodiments of the present disclosure.

[0066] According to some embodiments of the present disclosure, expressing the exogenous polynucleotide of the present disclosure within the plant is affected by transforming one or more cells of the plant with the exogenous polynucleotide, followed by generating a mature plant from the transformed cells and cultivating the mature plant under conditions suitable for expressing the exogenous polynucleotide within the mature plant.

[0067] According to some embodiments of the present disclosure, the transformation is performed by introducing to the plant cell a nucleic acid construct which includes the exogenous polynucleotide of some embodiments of the present disclosure and at least one promoter for directing transcription of the exogenous polynucleotide in a host cell (a plant cell). Further details of suitable transformation approaches are provided herein.

[0068] As mentioned, the nucleic acid construct according to some embodiments of the present disclosure comprises a promoter sequence and the isolated polynucleotide of some embodiments of the present disclosure. [0069] According to some embodiments of the present disclosure, the isolated polynucleotide is operably linked to the promoter sequence.

[0070] A coding nucleic acid sequence is “operably linked” to a regulatory sequence (e.g., promoter) if the regulatory sequence is capable of exerting a regulatory effect on the coding sequence linked thereto.

[0071] As used herein, the term “promoter” refers to a region of DNA which lies upstream of the transcriptional initiation site of a gene to which RNA polymerase binds to initiate transcription of RNA. The promoter controls where (e.g., which portion of a plant) and/or when (e.g., at which stage or condition in the lifetime of an organism) the gene is expressed.

[0072] According to some embodiments of the present disclosure, the promoter is heterologous to the isolated polynucleotide and/or to the host cell.

[0073] As used herein the phrase “heterologous promoter” refers to a promoter from a different species or from the same species but from a different gene locus as of the isolated polynucleotide sequence.

[0074] According to some embodiments of the present disclosure, the isolated polynucleotide is heterologous to the plant cell.

10075] Any suitable promoter sequence can be used by the nucleic acid construct of the present disclosure. Preferably the promoter is a constitutive promoter, a tissue-specific, or an abiotic stress-inducible promoter.

[0076] According to some embodiments of the present disclosure, the promoter is a plant promoter, which is suitable for expression of the exogenous polynucleotide in a plant cell. [0077] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, plant biology, genetics and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

2. Nucleic Acids, Polypeptides, and Related Compositions and Methods

[0078] Embodiments of the present disclosure involve a new regulation mechanism activating JAZ transcription that demonstrates a new regulatory function of the regulatory PAP1-TT8-TTG1 (MBW) complex (FIG. 17). As described above, The JAZ-COI1 complex- based JA signaling pathway has been intensively documented to show diverse JA roles that essentially involve plant growth and development, metabolism, and responses to different environmental conditions. In comparison, the regulation of JAZ transcription remains open for further studies. To date, the cis-regulatory element in the promoter sequences of JAZs is mainly characterized to contain a G-box motif consisting of GACGTG. MYC2 members are the only transcription factors that have been shown to activate the expression of JAZs with a negative feedback loop manner. Although this mechanism has been demonstrated to be a fine-tuning regulation, it was hypothesized that this does not necessarily exclude other unknown mechanisms that regulate JAZs and the JA signaling pathway because of their essential roles for diverse plant responses to adapt to different stresses. In this present disclosure, promoter sequences of NtJAZ members of tobacco plants were examined. The results show that NtJAZl, NtJAZ3, and NtJAZ? promoters include MRE elements (cis AC-elements) such as ACCCACC (MRE1), ACCCCAC (MRE2). or AACTACC (MRE3), which are targets of R2R3-MYB transcription factors (Grotewold et cil, 1994, Ganter et cil, 1999, Prouse and Campbell, 2013, Zhu et cil, 2015, Li et cil, 2017). NtJAZl, NtJAZ3, NtJAZ 7 and NtJAZIO promoters have G- box elements.

|0079] Furthermore, three MRE elements contain five nucleotides, CC(orT)AC. which have been demonstrated to be the PAP1 cis-regulatory element (Dare et cil, 2008). Based on these element features, it was hypothesized that MYB members alone or their related complexes can activate JAZ transcription. The PAP1/TT8 complex was established for engineering of anthocyanins (Shi and Xie, 2011, Xie and Shi, 2012) and this complex was applied to the creation of red tobacco cells and crops (Xie et ctl, 2006, Zhou et ctl, 2008, He et ctl, 2017). In the present disclosure, field trials further showed that the coupled overexpression of stacked PAP1 and TT8 or PAP1 alone strongly activated a constitutive anthocyanin pathway. Experiments were conducted to test the mechanistic hypothesis. The gene expression data demonstrated that the coupled overexpression of the PAP1 and TT8 significantly increased the transcripts of NtJAZl, NtJAZ3, NtJAZ? , and NtJAZIO in red tobacco plants (FIG. 9A-B, U-V, K-L, and W-X). Biochemical data from EMSA, Chip-Q-PCR, and dual-luciferase assays demonstrated that PAPl and TT8 alone not only could bind to G-box and MRE motifs, but also activate the activity of two promoters, respectively (FIG. 10A-E).

|0080| Furthermore, dual-luciferase assays showed that PAPl and TT8 together significantly increased promoter activity of NtJAZ3 (FIG. 10E). The complete PAP1-TT8- TTG1 complex increased the highest activity of both NtJAZl and NtJAZ3 promoters (FIG. 10E). Taken together, all data demonstrate that PAP1 alone, TT8 alone, PAP1 and TT8 together, and the complete PAP1-TT8-TTG1 complex can bind to promoters of NtJAZl and NtJAZ3, then activate and increase their transcription. Based on these findings, it is likely that homologous MBW complexes in other plants are involved in JAZ-based JA signaling pathways that control diverse plant metabolic responses to the environment.

[0081] The findings provided herein disclose a new regulation mechanism negatively controlling nicotine biosynthesis that uncovers another new regulation function of the regulatory PAP1-TT8-TTG1 complex (FIG. 17). As abovementioned, this complex activates the expression of NtJAZl, NtJAZ3, NUAZ7. and NtJAZIO in roots. These four NtJAZ proteins bind to MYC2 to negatively control the transcription of nicotine pathway genes (FIG. 1A). As a simultaneous consequence, the transcription factor ERF189 gene and six or seven key pathway genes, such as QPT2, PMT1, mdPMT2, were significantly down-regulated in at least four tested transgenic lines (FIG. 9C-J and M-T-). The contents of nicotine, nomicotine, anatabine, anabasine, and TSNAs were significantly reduced in most or all leaf groups of red plants in a simultaneous manner (FIG. 2). More fundamentally, this new regulation mechanism provides a novel strategy for biotechnological innovation to successfully overcome long-term challenges occurred in efforts for the reduction of tobacco nicotine and carcinogens, such as NNN (FDA, 2017, Berman and Hatsukami, 2018). Based on known pathway and regulation mechanisms of nicotine biosynthesis (FIG. 1A), multiple previous studies developed gene suppression or silencing technologies with anti-sense or RNAi of pathway genes (FIG. 1), such as PMT, ODC, QPT, NDM, A622, BBL, and others. Gene suppression of BBL and QPT was practiced in the field, while other gene suppression was performed in control growth conditions. The resulting data showed reduction of nicotine contents. However, non-wanted challenges were created. One problematic challenge was that the decrease of nicotine led to the increase of anatabine and no reduction of other tobacco alkaloids (Chintapakom and Hamill, 2003, DeBoer et al, 2011).

[0082] Another challenge is that reduction of harmful compounds is limited. An RNAi of A622 was reported to reduce NNN and total TSNAs, but not to decrease nicotine, anabasine, anatabine, and other TSNAs (Lewis et al, 2008). To date, gene silencing of BBL has been reported to be one of the most effective strategies to reduce nicotine four-fold (Lewis et al, 2015), however, TSNAs and other alkaloids were not reduced by the RNAi of BBL. In comparison with previous reports, embodiments of the present disclosure demonstrate that the coupled overexpression of the stacked TT8/PAP1 or the PAP1 expression alone significantly reduced nicotine, nomicotine, anabasine, anatabine, and TSNAs in most of red leaf groups (FIGS. 2-3 and FIGS. 4-7). In particular, the content of NNN was reduced to a level less than 0.5 ppm in all red leaf groups (FIGS. 2G-2H, and FIG. 6). The total contents of TSNAs were reduced two-three-fold in red leaves compared to wild type leaves. Therefore, the PAP1-TT8- TTG1 complex-based technology is practically fundamental to reduce tobacco harm. In addition, PAP1 alone or PAP1-TT8-TTG1 complex increases additional beneficial values. Red plants produce high yield of anthocyanins, which are important nutrients with multiple health benefits, such as antioxidative, anticancer, anti-cardiovascular, anti-aging, and other functions. This fact shows the practical significance of this regulatory complex of plants.

[0083] Thus, the regulatory PAP1-TT8-TTG1 (MBW) complex plays a triple regulation function, positive activation of anthocyanin biosynthesis, positive activation of JAZs, and negative regulation of JAZ-associated metabolism in plants (FIG. 17). The triple regulation mechanism is that the regulatory complex positively binds to cis-MRE and G-box elements in promoters of anthocyanin pathway genes and JAZ repressor genes.

[0084| In accordance with the above, embodiments of the present disclosure include an isolated polynucleotide comprising a first nucleic acid molecule comprising a sequence encoding a Production of Anthocyanin Pigment 1 (PAP1) polypeptide or a fragment thereof, the first nucleic acid molecule operably linked to a heterologous promoter; and a second nucleic acid molecule comprising a sequence encoding a Transparent Testa 8 (TT8) or a fragment thereof, the first nucleic acid molecule operably linked to a heterologous promoter. In some embodiments, the first and second nucleic acid molecules are capable of being expressed in a plant cell.

[0085| In some embodiments, the first nucleic acid molecule comprises a sequence that is at least 70% identical to SEQ ID NO: 1. In some embodiments, the first nucleic acid molecule comprises a sequence that is at least 75% identical to SEQ ID NO: 1. In some embodiments, the first nucleic acid molecule comprises a sequence that is at least 80% identical to SEQ ID NO: 1. In some embodiments, the first nucleic acid molecule comprises a sequence that is at least 85% identical to SEQ ID NO: 1. In some embodiments, the first nucleic acid molecule comprises a sequence that is at least 90% identical to SEQ ID NO: 1. In some embodiments, the first nucleic acid molecule comprises a sequence that is at least 91%, 92%, 93%, 94% 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1. In some embodiments, the first nucleic acid molecule comprises a sequence that is less than 100% identical to SEQ ID NO: 1.

|0086| In some embodiments, the second nucleic acid molecule comprises a sequence that is at least 70% identical to SEQ ID NO: 2. In some embodiments, the second nucleic acid molecule comprises a sequence that is at least 75% identical to SEQ ID NO: 2. In some embodiments, the second nucleic acid molecule comprises a sequence that is at least 80% identical to SEQ ID NO: 2. In some embodiments, the second nucleic acid molecule comprises a sequence that is at least 85% identical to SEQ ID NO: 2. In some embodiments, the second nucleic acid molecule comprises a sequence that is at least 90% identical to SEQ ID NO: 2. In some embodiments, the second nucleic acid molecule comprises a sequence that is at least 91%, 92%, 93%, 94% 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 2. In some embodiments, the second nucleic acid molecule comprises a sequence that is less than 100% identical to SEQ ID NO: 2.

[0087] In some embodiments, the polynucleotide comprises a sequence that is at least 80% identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a sequence that is at least 85% identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a sequence that is at least 90% identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a sequence that is at least 91%, 92%, 93%, 94% 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a sequence that is less than 100% identical to SEQ ID NO: 3.

[0088] In some embodiments, the PAP1 polypeptide or fragment thereof is exogenous. For example, the PAP1 polypeptide can be exogenous to (i.e. not naturally present in) the cell in which it is expressed. In some embodiments, the TT8 polypeptide or fragment thereof is exogenous. For example, the TT8 polypeptide can be exogenous to (i.e. not naturally present in) the cell in which it is expressed. In some embodiments, the PAP1 and the TT8 are from the same source cell or tissue, and in other embodiment the PAP1 and the TT8 are from a different source cell or tissue. The PAP1 and/or the TT8 can be obtained from any plant cell of any plant species. In some embodiments, PAPl and/or TT8 can be fragments, derivatives, variants, and/or fusions.

|0089] In some embodiments, the PAP 1 polypeptide or fragment thereof is from a flowering plant. In some embodiments, the PAPl polypeptide or fragment thereof is from Arabidopsis. In some embodiments, the TT8 polypeptide or fragment thereof is from a flowering plant. In some embodiments, the TT8 polypeptide or fragment thereof is from Arabidopsis. In some embodiments, the plant cell is a crop plant selected from the group consisting of rice, maize, wheat, barley, peanut, potato, sesame, olive tree, palm oil, banana, soybean, sunflower, canola, sugarcane, alfalfa, millet, leguminosae (bean, pea), flax, lupinus, rapeseed, tobacco, poplar, cotton, alfalfa, barrel medic, and white clover.

[0090] In some embodiments, the isolated polynucleotide comprises a regulatory sequence or regulatory element that confers its expression in a host cell. In some embodiments, the polynucleotide comprises a heterologous promoter that is operably linked to the first nucleic acid molecule and confers constitutive expression of PAP1. In some embodiments, the polynucleotide comprises a heterologous promoter that is operably linked to the first nucleic acid molecule and confers conditional expression of PAP1. In some embodiments, the polynucleotide comprises a heterologous promoter that is operably linked to the second nucleic acid molecule and confers constitutive expression of TT8. In some embodiments, the polynucleotide comprises a heterologous promoter is operably linked to the second nucleic acid molecule and confers conditional expression of TT8. In some embodiments, the promoter that is operably linked to the first nucleic acid molecule is the same as the promoter that is operably linked to the second nucleic acid molecule. In some embodiments, the promoter that is operably linked to the first nucleic acid molecule is distinct from the promoter that is operably linked to the second nucleic acid molecule. In some embodiments, the first and the second nucleic acid molecules are operably linked to a single promoter. As would be recognized by one of skill in the art based on the present disclosure, various promoters can be used, including but not limited to CaMV35S (35S), TTG1, PvUbi2p, and ZmUbilp. 35S and TTG1 promoters, which are useful to overexpress various genes in both dicotyledonous and monocotyledonous plants. Additionally, PvUbi2p and ZmUbilp promoters can be used express these genes in monocotyledonous plants.

(0091] In some embodiments, the polynucleotide comprises at least a third nucleic acid molecule comprising a sequence encoding a polypeptide or a fragment thereof. In some embodiments, the polynucleotide comprises at least a fourth, fifth, sixth, seventh, eighth, ninth, or tenth nucleic acid molecule comprising a sequence encoding a polypeptide or a fragment thereof. In accordance with these embodiments, the additional nucleic acid molecule can be operably linked to a heterologous promoter (as described above). In some embodiments, the additional nucleic acid molecule comprises a sequence encoding a TTG1 (WD40) polypeptide or fragment, derivative, or homolog thereof. In some embodiments, the additional nucleic acid molecule comprises a sequence encoding a NtJAZl polypeptide or fragment, derivative, or homolog thereof. In some embodiments, the additional nucleic acid molecule comprises a sequence encoding a NtJAZ3 polypeptide or fragment, derivative, or homolog thereof. In some embodiments, the additional nucleic acid molecule comprises a sequence encoding a NtJAZ7 polypeptide or fragment, derivative, or homolog thereof. In some embodiments, the additional nucleic acid molecule comprises a sequence encoding a NtJAZIO polypeptide or fragment, derivative, or homolog thereof. [00921 Embodiments of the present disclosure also include a vector or construct comprising the polynucleotides described herein. Suitable vectors and constructs that can be used to express the nucleic acid molecules of the present disclosure are well known in the art, as are means for altering them using standard genetic and molecular biological techniques. In some embodiments, the polynucleotide is stably integrated into the genome of the transgenic plant by means known in the art. In some embodiments, the transgenic plant is a tobacco plant, plant variety, or cultivar. In some embodiments, the transgenic plant is a red tobacco variety, a dark tobacco varieties, any transgenic tobacco variety (e.g., P+T-NL, P+T-Kyl71, PAP1 tobacco), any dark tobacco variety (e.g., Narrow Leaf Madole and KYI 71), any Oriental tobacco variety (e.g., Nicotiana tabacum Xanthi), Flue-cured tobacco (e.g., K326, NC71, NC196, NC938, CC143), and Burley tobacco (e.g., TN94, KT 215LC, KT 212LC, KT 210LC, KT 209LC, KT 206LC, KT 204LC, TN 90LC, KY 14 x L8LC, HB 04PLC, HB 3307PLC, HB 4488PLC, Hybrid 404LC, N 7371LC, NC 7LC).

[0093j In some embodiments, at least one tissue of a transgenic plant comprising the polynucleotides described herein comprises reduced levels of at least one of nicotine, nomicotine, anabasine, anatabine, myosine, and tobacco specific nitrosamines (TSNAs). In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid- derived nitrosamine that is not greater than 0.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.45 ppm. In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.4 ppm. In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.35 ppm. In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.3 ppm. In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid- derived nitrosamine that is not greater than 0.25 ppm. In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.2 ppm. In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.15 ppm. In some embodiments, the at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.1 ppm.

|0094j As would be understood by one of ordinary skill in the art based on the present disclosure, determining whether levels of at least one of nicotine, nomicotine, anabasine, anatabine, myosine, and/or tobacco specific nitrosamines (TSNAs) are reduced can be done according to a variety of biochemical protocols, such as those described further herein. Determining reduction of nicotine, nomicotine, anabasine, anatabine, myosine, and/or tobacco specific nitrosamines (TSNAs) in a plant tissue or cell can performed using various measurements, such as ppm, % reduction, concentration, and the like, including determinations that are absolute and/or determinations that are relative to a control or standard. The control or standard can be a plant not expressing a particular gene (e.g., a non-transgenic plant, a wildtype plant, an un-induced transgenic plant, and the like), and/or the standard or control can be a plant cell or tissue that does not express a particular gene (even if other cells or tissues of that same plant do express that gene).

[0095] In some embodiments, the least one tissue of the plant comprises a level of nicotine that is reduced by at least 15%. In some embodiments, the least one tissue of the plant comprises a level of nicotine that is reduced by at least 10%. In some embodiments, the least one tissue of the plant comprises a level of nicotine that is reduced by at least 5%. In some embodiments, the least one tissue of the plant comprises a level of nicotine that is reduced by about 5% to about 15%. In some embodiments, the least one tissue of the plant comprises a level of nicotine that is reduced by about 5% to about 10%. In some embodiments, the least one tissue of the plant comprises a level of nicotine that is reduced by about 10% to about 15%. |0096j In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by at least 30%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by at least 25%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by at least 15%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by at least 5%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by about 5% to about 30%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by about 5% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by about 5% to about 10%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by about 10% to about 30%. In some embodiments, the at least one tissue of the plant comprises a level of nomicotine that is reduced by about 20% to about 30%. [0097] In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by at least 25%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by at least 15%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by at least 5%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by about 5% to about 25%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by about 5% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by about 5% to about 10%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by about 10% to about 25%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by about 15% to about 25%. In some embodiments, the at least one tissue of the plant comprises a level of anabasine that is reduced by about 20% to about 25%. [0098] In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by at least 30%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by at least 25%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by at least 15%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by at least 5%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by about 5% to about 30%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by about 5% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by about 5% to about 10%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by about 10% to about 30%. In some embodiments, the at least one tissue of the plant comprises a level of anatabine that is reduced by about 20% to about 30%.

[0099] In some embodiments, the at least one tissue of the plant comprises a level of myosine that is reduced by at least 15%. In some embodiments, the at least one tissue of the plant comprises a level of myosine that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of myosine that is reduced by at least 5%. In some embodiments, the at least one tissue of the plant comprises a level of myosine that is reduced by about 5% to about 15%. In some embodiments, the at least one tissue of the plant comprises a level of myosine that is reduced by about 10% to about 15%. In some embodiments, the at least one tissue of the plant comprises a level of myosine that is reduced by about 5% to about 10%.

[0100] In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by at least 15%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by at least 5%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by about 5% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by about 5% to about 15%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by about 5% to about 10%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by about 10% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of total alkaloids that is reduced by about 15% to about 20%.

[0101] In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by at least 40%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by at least 30%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by about 10% to about 40%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by about 10% to about 30%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by about 10% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by about 20% to about 40%. In some embodiments, the at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by about 30% to about 40%. [0.102| In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosonomicotine (NNN) that is reduced by at least 55%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by at least 50%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosonomicotine (NNN) that is reduced by at least 40%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by at least 30%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosonomicotine (NNN) that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosonomicotine (NNN) that is reduced by about 10% to about 55%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by about 10% to about 50%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by about 10% to about 40%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosonomicotine (NNN) that is reduced by about 10% to about 30%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by about 10% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by about 20% to about 55%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosonomicotine (NNN) that is reduced by about 30% to about 55%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by about 40% to about 55%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by about 50% to about 55%. |0103] In some embodiments, the at least one tissue of the plant comprises a level of N’- nitrosoanatabine (NAT) that is reduced by at least 70%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by at least 60%. In some embodiments, the at least one tissue of the plant comprises a level of N’- nitrosoanatabine (NAT) that is reduced by at least 50%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by at least 40%. In some embodiments, the at least one tissue of the plant comprises a level of N’- nitrosoanatabine (NAT) that is reduced by at least 30%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of N’- nitrosoanatabine (NAT) that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of N’ -nitrosoanatabine (NAT) that is reduced by about 10% to about 70%. In some embodiments, the at least one tissue of the plant comprises a level of N’ -nitrosoanatabine (NAT) that is reduced by about 10% to about 60%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 10% to about 50%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 10% to about 40%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 10% to about 30%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 10% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 20% to about 70%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 30% to about 70%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 40% to about 70%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 50% to about 70%. In some embodiments, the at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by about 60% to about 70%.

[0104| In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosoanabasine (NAB) that is reduced by at least 60%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by at least 50%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosoanabasine (NAB) that is reduced by at least 40%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by at least 30%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosoanabasine (NAB) that is reduced by at least 20%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by at least 10%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosoanabasine (NAB) that is reduced by about 10% to about 60%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by about 10% to about 50%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by about 10% to about 40%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by about 10% to about 30%. In some embodiments, the at least one tissue of the plant comprises a level ofN-nitrosoanabasine (NAB) that is reduced by about 10% to about 20%. In some embodiments, the at least one tissue of the plant comprises a level of N- nitrosoanabasine (NAB) that is reduced by about 20% to about 60%. In some embodiments, the at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by about 30% to about 60%. In some embodiments, the at least one tissue of the plant comprises a level ofN-nitrosoanabasine (NAB) that is reduced by about 40% to about 60%. In some embodiments, the at least one tissue of the plant comprises a level ofN-nitrosoanabasine (NAB) that is reduced by about 50% to about 60%.

(0105| In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs not greater than 3.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs not greater than 3.0 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs not greater than 2.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs not greater than 2.0 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs not greater than 1.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs not greater than 1.0 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs not greater than 0.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs from about 0.5 ppm to about 3.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs from about 1.0 ppm to about 3.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs from about 2.0 ppm to about 3.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs from about 3.0 ppm to about 3.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs from about 1.0 ppm to about 3.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs from about 2.0 ppm to about 3.5 ppm. In some embodiments, the at least one tissue of the plant comprises a level of total TSNAs from about 3.0 ppm to about 3.5 ppm.

[0106 j In some embodiments, the at least one tissue of the plant comprises an increased level of anthocyanin. In some embodiments, the at least one tissue of the plant comprises an increased level of flavan-3-ols and/or proanthocyanidins.

|0107| In some embodiments, the at least one tissue of the plant comprises decreased expression of at least one of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL and ERF189. In some embodiments, the at least one tissue of the plant comprises decreased expression of at least two of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL and ERF 189. In some embodiments, the at least one tissue of the plant comprises decreased expression of at least three of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL and ERF189. In some embodiments, the at least one tissue of the plant comprises decreased expression of at least four of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL and ERF189. In some embodiments, the at least one tissue of the plant comprises decreased expression of at least five of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL and ERF189. In some embodiments, the at least one tissue of the plant comprises decreased expression of at least six of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL and ERF189. In some embodiments, the at least one tissue of the plant comprises decreased expression of at least seven of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL and ERF189. In some embodiments, the at least one tissue of the plant comprises decreased expression of all eight of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL and ERF 189.

[0108] In some embodiments, the at least one tissue of the plant comprises increased expression of at least one of CHS, CHI, F3H, F3 Ή 3GT, DFR ANS and ANR. In some embodiments, the at least one tissue of the plant comprises increased expression of at least two of CHS, CHI, F3H, F3 Ή. 3GT, DFR, ANS and ANR. In some embodiments, the at least one tissue of the plant comprises increased expression of at least three of CHS, CHI, F3H, F3 Ή. 3GT, DFR ANS m& ANR. In some embodiments, the at least one tissue of the plant comprises increased expression of at least four of CHS, CHI, F3H, F3 Ή. 3GT, DFR, ANS and ANR. In some embodiments, the at least one tissue of the plant comprises increased expression of at least five of CHS. CHI, F3H, F3 Ή. 3GT, DFR, ANS and ANR. In some embodiments, the at least one tissue of the plant comprises increased expression of at least six of CHS, CHI, F3H, F3 Ή. 3GT, DFR, ANS and ANR. In some embodiments, the at least one tissue of the plant comprises increased expression of at least seven of CHS, CHI, F3H, F3 Ή. 3GT, DFR, ANS and ANR. In some embodiments, the at least one tissue of the plant comprises increased expression of all eight of CHS, CHI, F3H, F3 Ή. 3GT, DFR, ANS and ANR.

[0109] In accordance with the above embodiments, the polynucleotides, nucleic acid molecules, and corresponding transgenic plants of the present disclosure can be used to make various tobacco and tobacco-derived products known in the art, including but not limited to, cigarettes (e.g., clove, bidis, flavored cigarettes, kreteks), electronic cigarettes, cigars and cigarillos, hookah smoked products, pipes and oral tobacco (e.g., spit and spit-less smokeless chew, snuff, and dissolvable tobacco products) and nasal tobacco. Such product can also include any product intended to mimic tobacco products, contain tobacco flavoring, or deliver nicotine. 3. Materials and Methods

[011 Of Tobacco materials. Six genotypes of tobacco ( Nicotiana tabacum) plants were used in the various embodiments of the present disclosure. Two commercial dark tobacco varieties were Narrow Leaf Madole (NL) and KYI 71 (Andersen et al. , 1990 , Pearce etal., 2015). Two transgenic genotypes were generated fromNL and KYI 71 described below. Two others were an oriental tobacco variety (N. tabacum Xanthi) and a PAP1 tobacco, a novel red homozygous isogenic red Xanthi variety (292#), (FIG. IB), which was metabolically programmed by the Arabidopsis PAP1 (MYB75) (Xie etal, 2006).

[0.111 i Synthesis of T-DNA, development of binary constructs, and genetic transformation of two dark tobacco varieties. PAP1 and TT8 of A. thaliana encode aR2R3- MYB and bHLH TF, respectively. A T-DNA cassette was synthesized, in which PAP1 and TT8 were stacked for a coupled overexpression. From 5’ - to 3’ end, the cassette was composed of attLl, the PAP I cDNA (NP_176057), NOS (terminator), 35S promoter, the TT8 cDNA (CAC14865), and attL2 (Supportive materials). The synthesized sequence was introduced to the entry vector pUC57 and then cloned into the destination binary vector pK2GW7 by attL ^c attR combination (LR) reaction with LR clonase. The resulting binary vector, namely PAP1- TT8-pK2GW7, was further introduced into competent cells of Agrobacterium tumefaciens strain GV3101. A positive colony was selected for genetic transformation of tobacco. In addition, the pK2GW7 vector was also used for genetic transformation as control. These constructs were transformed into two globally commercial dark tobacco varieties, Narrow Leaf Madole (NL) and KY171, respectively. Transformation and selection of TO transgenic plants were followed using protocols reported previously (He et al, 2017). Transgenic plants from NL and KY171 were labeled to be P+T-NL and P+T-KY171, respectively. More than 20 TO transgenic plants were obtained for each variety and grown in the greenhouse to select TO seeds, which were further selected on medium supplemented with antibiotics to screen antibiotic resistant T1 progeny as reported previously. A 3: 1 ratio of seed germination to death indicated one single copy of T-DNA transformed into plants. This ratio was observed in the T1 progeny of a few of TO plants. In the present disclosure, lines with one single copy of transgene were the focus of various experiments. A large number of seeds were obtained from the T1 progeny of each line with a 3: 1 ratio. Seeds from these types of T1 progeny were screened on medium supplemented with 50 mg/1 kanamycin. If all seeds from a T1 plant could germinate T2 seedlings, it indicated that such a T1 progeny was a homozygous line. Accordingly, red homozygous T2 plants were obtained and used for growth in the field. In addition, PCR and RT-PCR were performed to demonstrate the presence of transgene in the genome of TO and T2 transgenic plants and the expression of both PAP1 and TT8 in both P+T-NL and P+T-KY171 plants.

|0112] Field trial of P+T-NL and P+T-KY171 T2 progeny and air curing. Homozygous T2 progeny of P+T-NL and P+T-KY171 were planted at the research station in Oxford, North Carolina in 2015. In addition, Narrow Leaf Madole and KY171 plants were planted as controls. Prior to planting transgenic plants in the field, permits from APHIS at USDA were obtained for this field trial. North Carolina State University is licensed to grow transgenic tobacco plants in the field. Every single step followed the protocol requested in the license. Field planting followed the protocol of commercial tobacco production in North Carolina, including selection and designing of field, planting, phenotypic observation and field management, topping, harvest of leaves, and air curing (FIG. 18).

[0113] The field used to grow transgenic plants was isolated from other fields by a forest. Three field plots were designed as three planting replicates. Red tobacco plants and control plants were grown in rows side by side. Two or three rows of commercial K326 tobacco plants were grown beside red and control plants as a buffer zone in order to enclose transgenic plants (FIG. 19 A).

|0114] Field design for farming practice of red P+T transgenic plants is illustrated in FIGS. 19A-19B. Planting in the field included three steps: seed germination and seedling growth in float trays (Table 1) in a greenhouse (containment), transportation of seedlings, and field planting. Seeds were planted in float trays in hydroponic conditions. During seed germination, three plots were selected at the research station, supplemented with 560 kg. ha ¹ of 8-8-24 base fertilizer, and then treated with clomazone and carfentrazone-ethyl/sulfentrazone for weed control. After two months of growth, seedlings were transported to and planted in the field. Fifty plants for each genotype were planted in one row in each field plot. In addition, wild type Narrow NL Madole and KYI 71 plants were planted side by side as a control. One plot was planted 200 plants in four rows including 50 plants for each of P+T-NL, P+T-KY171, NL Madole, and KY171 genotypes. Three plots were planted as replicates. Accordingly, each genotype was planted 150 plants in total. Four rows of wild type K326 tobacco plants were planted between two neighbor plots and around plots as the buffer zones. The management of plant growth in the field followed a protocol developed for commercial plants in the research station. Three plots were side dressed with 168 kg ha ¹ of 15.5-0-0 (Nitrogen-phosphate- potassium) fertilizer. In the first week of July, when flower buds started to develop from shoot apex, all plants were topped and kept 16 leaves. After topping, plants were treated with maleic hydrazide to control suckers.

[0115] Table 1: Float trays used for seedlings in the water nursery bed in the greenhouse. The same trays were prepared for PAP1 tobacco plants.

[0116J Planting, plant growth, and phenotypes of wild type and red P+T transgenic tobacco plants in field from the first day to 75 days after planting (FIG. 20). In the first week of August, topped plants were cut from the base and hung up upside down on a truck, and then transported to a ventilation bam for air curing at the research station (FIGS. 21 A-21B). Leaves from the bottom to the top of plants were labelled as 1-16 (FIGS. 22C-22D). After harvest, plant residues were completely cleaned up from the field and transported to the laboratory for autoclaving (FIGS. 21C-21E). The air curing took one to two months to dry all leaves. Air- cured leaves of each plant were harvested beginning with the base to the top positions (FIGS. 22C-22D). The first four base leaves (#1-4) from 10 plants were collected together as one biological sample. This group of leaves was labelled as Bl. Therefore, B1 had five biological replicates in one plot. In three plots, Bl had 15 biological samples. Likewise, the second four leaves (# 5-8) were collected and labelled as B2. The third four leaves (#9-12) were labelled as B3. The top four leaves (#13-16) were labeled as B4. After harvest, all leaves were further dried at 70°C in an oven for 24 hr. The dried leaves were ground into fine powder in a stainless- steel blender (Conair, East Windsor, NJ) and were used for alkaloid content analysis as described below.

[0117} Harvest of plants from field and cleanup of field. As shown in FIGS. 21A-21E, plants were harvested after 30 days of topping. Plants were cut and hung upside down in ventilated bams. Harvested plants were transported to ventilated bams on a truck (FIG. 21 A); Plants were placed in a ventilated bam for air-curing FIGS. 21A-21B), and the field was cleaned up to remove all remained transgenic roots, leaves, and other plant residues after harvest (FIG. 21C), examination of field (FIG. 21D), and plant tissues placed in an autoclave bag (FIG. 21E). All remaining tissues were transported to laboratory and autoclaved for one hour.

[0118] Comparison of leaf color after air-curing and grouping of leaves for sampling. As shown in FIGS. 22A-22D, different air-cured leaf colors of Narrow Leaf Madole (NL) and P+T-NL tobacco plants are provided (FIG. 22A); and different air-cured leaf colors of KY171 and P+T-KY171 tobacco plants are shown (FIG. 22B). Also, schemes showing numeration of leaves from the base to the top and grouping of leaves from wild type plants (FIG. 22C) and red tobacco plants (FIG. 22D) are provided. Four groups of leaves for each genotype were collected for metabolite analysis. P+T: PAP1/TT8 transgenic.

[0119] Field trial of red PAP1 tobacco plants and flue-curing. PAP1 tobacco is the progeny of an isogenic homologous line (#292) of red PAP1 Xanthi plants that are programmed by the overexpression of AtPAPl(PAPl) (Xie and Dixon, 2005). Field design, seed germination, plantation, field management, and plant growth management were the same as described above. The field trials for PAP1 tobacco were conducted over two years. In 2011 and 2012, seedlings were planted in the field on May 11 and May 1, respectively. The different planting dates were selected because of weather conditions. In addition to red PAP1 tobacco plants, wild type Xanthi was planted as control, and two commercial cultivars, K326, and NC7, were planted as protective buffer zones (FIGS. 23A-23E). Three plots were designed as three replicates and each plot was planted 100 plants. In total 300 red PAP1 tobacco plants were grown in the field. Plants were topped to keep 15 leaves on July 15, 2011 and July 10, 2012, when flower buds started to develop from shoot apexes. Leaves from the base to the top were numerated #1- #15, which were arranged into five groups, I: leaves #1-3, II: leaves 4-6, III: #7- 10, IV: #11-12, and V: #13-15 (FIG. 23C). Xanthi tobacco is a Turkish cultivar, thus, its leaf harvest protocol is different from that used for dark tobacco described above. In addition, the dates of leaf harvest were different in 2011 and 2012 due to weather conditions. In 2011, leaves were harvested from plants from September 12 to 28. On September 12, 2011, the group I leaves were harvested from 1-50 plants. Leaves from five plants were pooled together as one biological replicate. After excised from plants, each leaf was immediately cut longitudinally into two halves from the median vein. One half with the median vein was flue-cured in a bam at the research station (FIGS. 23D-23E). The other half was immediately frozen in liquid nitrogen and transported to the laboratory and stored in a -80°C freezer. For each plot, ten biological replicates were prepared for both flue-cured and non-cured for late experiments. Likewise, five groups of uncut entire leaves were harvested from 51-100 plants. Leaves from five plants were pooled together as one biological sample. These leaves were used as a control for cut leaves. The group II, III, IV, and V leaves were harvested on Sept. 18, 14, and 28. Steps were the same as those for the group I leaves. In 2012, the group I, II, III, IV, and V leaves were collected on Aug. 9, Aug. 16, Aug. 24, Sept. 2, and Sept. 13. Steps of leaf harvest were the same as those in 2011. After one week of Hue-curing, dried leaves were stored in a dry room and then ground into fine powder for nicotine, nomicotine, and TSNA analysis as described below. Any plant residue was completely cleaned up from the field.

[0120| Plant growth in phytotron. All genotypes grown in the field were also grown in the phytotron for isolation of DNA and RNA, sequencing, gene expression profiling, cloning, and anthocyanin analysis. The growth conditions consisted of a constant temperature of 28±3 °C and a 16/8-h (light/dark) photoperiod with a light intensity of 200 pmol m² s ¹. Plants were grown hydroponically in 10 cm deep pots, which allowed growth of roots. After seed germination, seedlings were grown for 45 days to harvest roots and leaves, which were immediately frozen in liquid nitrogen and then stored in a -80°C freezer until used for isolation of DNA and RNA and other experiments. Meanwhile, plants were grown in pot soil to collect leaf tissues. Nicotiana benthamiana plants were grown in the same phytotron conditions for dual-luciferase experiments. Leaves of 35 days old plants were used as material for dual- luciferase assays described below.

[0121] Determination of TSNAs in red leaves of P+T-NL and P+T-KY171 transgenic tobacco plants with high performance liquid chromatography coupled with triple quadrupole tandem mass spectrometer. Accurate quantification of tobacco specific nitrosamines (TSNA) was completed with high performance liquid chromatography coupled with triple quadrupole tandem mass spectrometer (HPLC-QQQ-MS/MS). This analysis was performed on an Agilent 1200 series HPLC System coupled with AB Sciex Triple quadrupole mass spectrometer (API 5000 with Electrospray). Four TSNAs, N-nitrosonomicotine (NNN), N-nitrosoanatabine (NAT), N-nitrosoanabasine (NAB), and nicotine-derived nitrosamine ketone (4-(methylnitrosamino)-l-(3-pyridyl)-l-butanone, NNK) in air-cured leaves, were quantified. One hundred milligrams of dry leaf powder were extracted in an aqueous ammonium acetate solution (100 mM aqueous ammonium acetate containing four deuterium analogs for TSNA) and filtered through disposable PVDF syringe filters into autosampler vials. The extract was separated in a Phenomenex Gemini C18 column with 3.0 pm particle 2.0 xl50 mm. The injection volume was 2.0-5.0 pi. TSNAs were detected by multiple reaction monitoring (MRM) of the precursor ion to a product ion specific for each compound. Quantification was achieved using an internal standard calibration comprised of ten points. A separate internal standard was used for each analyte by using a mixture of four stable isotope- labeled analytes. Results are reported in units of ng/g (ppb). Data was determined to be acceptable if the correlation coefficient for the calibration curve was greater than 0.99, standards were within 85% to 115% of expected concentration values, check solution values were within 75% to 125% of target, peak shape and resolution were acceptable (based on historical data), and values for the QC samples were within established control limits. The instrument parameters for MS, HPLC gradient, the quadrupole mass spectrometer parameters, reagents and standards are listed in Table 2-5.

|0122] Table 2: Instrument Parameters used in Tobacco Specific Nitrosamines analysis.

[0123 j Table 3: HPLC Gradient used in Tobacco Specific Nitrosamines analysis.

10124] Table 4: Typical Parameter Table Triple Quadrupole Mass Spectrometer used in Tobacco Specific Nitrosamines analysis.

Typical Parameter Table Triple Quadrupole Mass Spectrometer

|0125] Table 5: Reagents and Standards in for Tobacco Specific Nitrosamines analysis.

[0126| Determination of nicotine and other tobacco alkaloids in red leaves of P+T-NL and P+T-KY171 transgenic tobacco plants by gas chromatograph-flame ionization detector. Analysis of gas chromatograph (GC) equipped with a flame ionization detector (FID) is a standard industry method to quantify nicotine and other tobacco alkaloids. In the present disclosure, analysis of nicotine and other tobacco alkaloids was performed on an Agilent 6890 gas chromatograph (GC) equipped with a flame ionization detector (FID) and an Agilent 7683 automatic sampler. One hundred milligrams of air-cured dry leaf powder were alkalinized in 2 mM sodium hydroxide (NaOH). This solution was extracted with methyl-tert-butyl ether (MTBE) spiked with an internal standard using a wrist-action shaker. The mixture was allowed to separate, and the resulting MTBE layer was transferred to an autosampler vial for analysis of nicotine, anabasine, and nomicotine by GC-FID. Quantification was achieved using an internal standard calibration comprised of six points. Data was determined to be acceptable if the correlation coefficient of the calibration curve was greater than 0.9980, the response factors (RF) were consistent, the percent relative standard deviation (%RSD) for RF equal or less than 5%, the check solution values were within 10% of target, values for the quality control (QC) samples were within established control limits, and chromatograms had appropriate identification of peaks. The instrument parameters, the oven program, and reagents and conditions used in alkaloid analysis are listed in Tables 6-8.

[0127J Table 6: Instrument Parameters used in Tobacco Alkaloids analysis.

[0128} Table 7: Oven Program used for in Tobacco Alkaloids analysis.

[0129} Table 8: Reagents and Standards used for Tobacco Alkaloids analysis.

[0ί3q| Determination of TSNAs and tobacco alkaloids in red PAP1 tobacco plants by high performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS). HPLC-ESI-MS analysis was performed on a 2010EV LC/UV/ESI/MS instrument (Shimadzu, Japan). One gram of powdered sample was extracted in 20 ml of methanol in a flask placed on a shaker for one hour at room temperature. The samples were centrifuged twice at 4000 rpm and aliquots of the supernatant were transferred to a 2.0 ml glass vial. The samples were separated on an Eclipse XDB-C18 analytical column (250 mm *4.6 mm, 5 pm, Agilent, Santa Clara, CA, USA). The mobile phase solvents were composed of 1% acetic acid in water (solvent A; HPLC-grade acetic acid and LC-MS grade water) and 100% LC-MS grade acetonitrile (solvent B). To separate metabolites, the following gradient solvent system, with ratios of solvent A to B, was used: 90:10 (0-5 min), 90:10-88:12 (5-10 min), 88:12-80:20 (10-20 min), 80:20-75:25 (20-30 min), 75:25-65:35 (30-35 min), 65:35-60:40 (35-40 min), 60:40-50:50 (40-55 min), and 50:50-10:90 (55-60 min). The column was then washed for 10 min with 10% solvent B. The flow rate and the injection volume were 0.4 mL/ min and 20 pi, respectively. The total ion chromatograms of positive electrospray ionization were recorded from 0 to 60 min by mass spectrum detector and mass spectra were scanned and stored from m/z of 120-1,600 at a speed of 1,000 amu/s. Standards of nicotine, nomicotine, anabasine, NAB, NAT, NNAL, NNK, andNNN (Sigma, St-Louis, MO) were used to establish standard curve with an coefficient value at least 98%. [0.1311 DNA and RNA extractions. Genomic DNA was extracted using a DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. Fresh plant samples were ground into powder in liquid nitrogen. One hundred milligrams of powdered sample were weighed to a 1.5 ml tube, followed by the addition of 400 pi of extraction buffer (API) and 4.0 mΐ RNase A. The tube was vortexed appropriately and then incubated for 10 min at 65°C, while it was gently inverted upside-down 2-3 times to mix the sample. The tube was added 130 mΐ of buffer 2 (Buffer AP2) and mixed gently, followed by a 5.0 min incubation on ice. The resulting mixture was transferred onto a QIAshredder spin column, which was centrifuged for 2 min at 20,000 x g. The resulting flow-through was gently pipetted into a new tube, followed by the addition of 1.5 volumes of Buffer 3 (AP3). The resulting extraction was gently mixed by pipetting and loaded onto a DNeasy Mini spin column. After centrifugation for 1 min at 12, 000 x g, the flow-through liquid was disposed to a waste container. The resulting DNA-bound column was placed into a new 2 ml collection tube. Buffer 3 (500 mΐ, buffer AW) was added to the top of the column, which was centrifuged for 1.0 min at 12,000 x g to wash it. The flow-through was disposed. This wash step was repeated twice to remove contamination. The washed spin column was placed into a new 1.5 ml tube and was added 50 mΐ autoclaved double deionized water, followed by 5.0 min incubation at room temperature (15-25°C). The column was finally centrifuged for 1.0 min at 12, 000 x g to elute DNA in the 1.5 ml tube. The DNA samples were stored in a -20°C freezer until use.

[0132] RNA was extracted from plant samples using Trizol extraction reagents. Extraction steps followed the manufacturer’s protocol with slight modification. Root and leaf samples were ground into a fine powder in liquid nitrogen and 100 mg powdered samples were placed into a new RNase-free 1.5 ml tube. To the tube was immediately added 1.0 ml Trizol reagent, mixed thoroughly by vortexing, and then incubated at room temperature for 10 min. The tube was centrifuged for 10 min at 12,000 x g and 4°C. The resulting supernatant was pipetted into a new RNase-free tube, followed by immediately adding 200 mΐ chloroform, 35 mΐ 3 M sodium acetate, 15 mΐ b-mercaptoethanol, and 10 mΐ 10% PVPP. The tube was vortexed thoroughly for 1.0 min, placed on ice for 15 min, and then centrifuged for 10 min at 12,000 x g and 4°C. The resulting supernatant was further pipetted into a new 1.5 ml tube, to which was added the same volume of chilled isopropanol and 200 mΐ 3M sodium acetate. The tube was placed in -20 °C freezer for 30 min and then centrifuged for 10 min at 12,000 x g and 4°C. After the removal of the supernatant, the remaining RNA pellet was washed three times with 75% ethanol. DNase I (2 units) was added to the RNA solution for 20 min in the room temperature. The treated RNA solution was added 100 mΐ phenol: IAA (24: 1), completely mixed, and then placed in the room temperature for 10 min to denature DNase. The tube was centrifuged for 10 min at a speed of 12,000 rpm. The water phase including RNA was transferred to a new RNase-free tube, followed by adding chilled isopropanol and mixing well gently. Steps of RNA precipitation and washing with 75% ethanol were as described above. The resulting DNA-free RNA pellet was air-dried completely and dissolved in 35 pi RNase-free autoclaved water. The quality and the concentration of RNA samples were examined using gel electrophoresis and quantified using a Nanodrop Microvolume Spectrophotometers 3300 (Waltham, MA, USA).

[0133 j Polymerase chain reaction and quantitative reverse transcript-polymerase chain reaction. All quantitative real-time RT-PCR (qRT-PCR) for wild-type and red transgenic plants described below were performed with SYBR-Green PCR Master-mix (Bio- Rad, Hercules, CA) on a Step-One Real-time PCR System (Thermo Fisher, Waltham, MA). Primers are included in Table 9. The reaction system was composed of 12 mΐ mixture, including: 10 mI-SYBR-green, 1.0 mΐ 10 mM forward and reverse primer, and 1.0 mΐ cDNA template. The thermal program followed the protocol of Bio-rad SYBR-Green PCR Master- mix (Table 9) Amplified values were normalized against GAPDH, a housekeeping gene. For each gene, at least three biological replicates were completed to calculate the relative expression level. Table 9: Thermal cycle and sequences of primers designed for PCR, qRT- PCR, Q-PCR, respectively.

[0134| Cloning of NtJAZl, NTJAZ3 , PMT2 , and ODC2 promoters from Narrow Leaf Madole and KY171 cultivars. The promoter sequences of tobacco NtJAZl, NtJAZ3, PMT2, and ODC2 were identified from the genomic sequences of the NT90 cultivar curated at NCBI (https://www.ncbi.nlm.nih.gov/). The length of each sequence was identified to be 1000 bp. Based on these sequences, primers were designed for PCR to amplify these promoters from genomic DNA of both Narrow Leaf Madole and KY171 tobacco plants (Table 9), and then the amplified genomic DNA fragments were cloned to pEASY-Tl for sequencing. Briefly, the DNA fragments from PCR were purified by using a gel-extraction Kit (Thermo Fisher, Waltham, MA) following the manufacturer’s instruction and then ligated to the pEASY-Tl plasmid using a T4-ligase system (10 pi reaction system: 1 mΐ T4 buffer, 1 mΐ T4-ligase, 1.0 mΐ pEASY-Tl linear plasmid and 7.0 mΐ purified PCR product). The resulting recombinant plasmid was transformed into the competent cell ToplO, which were screened on LB medium with 50 mg/1 ampicillin. Positive colonies were selected for sequencing at Eton Bio (Durham, NC, USA). All obtained promoter sequences were 1000 bp. Analysis of promoter sequences and identification of regulatory elements such as AC- and AC-like elements were completed with the PLACE (www.dna.affrc.go.jp/PLACE/) and PlantPan (plantpan.itps.ncku.edu.tw/) tools. The four promoters were used for electrophoretic mobility shift assay and dual luciferase assay described below.

[0135 j Electrophoretic mobility shift assay for PAP1 and TT8 binding to promoters.

To perform electrophoretic mobility shift assay (EMSA), gene-specific primers were designed (Table 9) for PCR to amplify the binding domains of both PAP 1 and TT8. The amplified PAP 1 binding domain from the N-terminus is 534 bp, which includes R2R3 MYB domain sequences for Gate-way cloning. The amplified TT8 binding domain franking the bHLH region is 252 bp in length, in which both BamHI and Sacll restriction sites were added to the two ends for further cloning. After confirmation of sequence accuracy, three expression vector systems, pRSF- Dute, pet-Dute, and pDest-His-MBP, were comparatively tested to induce soluble recombinant proteins. The pDest-His-MBP vector was selected, a Gateway cloning system for the R2R3 domain of PAP1. This vector franks an MBP-tag and His-tag in the N-terminus. It was introduced into an entry vector pDonr221 through BP reaction (Gateway™ BP Clonase™ Enzyme Mix, Carlsbad, CA) and then performed LR exchange reaction (Gateway™ LR Clonase™ Enzyme Mix, Carlsbad, CA) to clone the R2R3 binding domain sequence into pDest-His-MBP vector by following the manufacturer’s protocol. The resulting PAPl-N- pDest-His-MBP vector with ampicillin selection was transformed into competent cells of E. coli strain BL21 (DE3). Positive colonies were screened for protein induction described below. [0136] Promoter sequences of NtJAZl and NtJAZ3 and identification of cis-elements. 1000 bp nucleotides of NtJAZl (SEQ ID NO: 22) and NtJAZ3 (SEQ ID NO: 23) promoter sequences were cloned from Narrow Leaf Madole and KYI 71 varieties. Red colored nucleotides (CACGTG) are G-box element bound by the bHLH domain of TT8. Blue colored nucleotides (ACCCACC. ACCCCAC and AACTACC) are MRE regions bound by the R2R3 domain of PAP 1. Green colored nucleotides are the start codon region of open reading frame. [01 7] Promoter sequences of NtPMT2 and NtODC2 and identification of cis-elements. 1000 bp nucleotides of NtPMT2 (SEQ ID NO: 25) and NtODC2 (SEQ ID NO: 24) promoter sequences were cloned from Narrow Leaf Madole and KYI 71 varieties. Red colored nucleotides (CACGTT) are G-box-like element. Blue colored nucleotides (ACCAACC) are MRE-like element. Green colored nucleotides are the start codon region of open reading frame. [0.1381 Data indicated that the pRSF-Dute vector with a His-tag in the N-terminus was appropriate for expression of the bHLH domain of TT8. In order to clone the bHLH domain into pRSF-dute, the 252 bp PCR product of bHLH domain described above and pRSF-dute PRSF vector were digested with BamHI and Sac I, then were ligated using NEB T4 ligase by following the manufacturer’s protocol (NEB, MA, USA). The resulting expression vector, TT8-bHLH-pRSF-dute with kanamycin selection, was transformed into competent cells of E. coli strain BL21 (DE3). Positive colonies were screened for protein induction.

[0139 j One positive colony from each of both PAPl-N-pDest-His-MBP and TT8-bHLH- pRSF-dute transformed E. coli (BL21/DE3) was inoculated to 200 ml liquid LB medium contained in 500 ml E-flask. The flasks were placed on a shaker and incubated for 10 hrs at a speed of 250 rpm/min at 37°C. When the concentration of E. coli reached to an OD value of 0.6 measured at 600 nm, isopropyl b-D-l-thiogalactopyranoside (IPTG) was added into liquid culture up to 500 mM. The E. coli culture was continuously incubated overnight at 28°C and then harvested into 50 ml tubes by 10 min of centrifugation at 4000 rpm and 4°C. The remaining E. coli pellet was thoroughly suspended in autoclaved double deionized water, followed by centrifugation as described above. This wash step was repeated once. The washed pellet was thoroughly suspended in 100 mM Tris-HCl buffer (pH 7.5) and then lysed with ultrasonication at with 400 W power for 20 min (every 3 sec with a 3 sec interval) on ice. The lysed mixture was centrifuged at 4°C for 30 min. The resulting supernatant containing soluble proteins was transferred to a new 50 ml tube for purification. Protein purification was completed with a His-tag Protein Purification kit (Clonetech, Catalog 635659, Mountain View, CA) by following the manufacturer’s protocol. Finally, the recombinant PAPl-His-MBP-Tag and TT8-bHLH-His-Tag proteins were collected in Tris-HCl buffer with pH7.0. The resulting purified proteins were used for EMSA assay described below.

|0140] Probes were prepared for EMSA of both PAP1 and TT8. Based on regulatory elements obtained from four promoter sequences and PAP1 binding features, four oligonucleotide sequences were selected to prepare different probes for PAP1, MREl: ACCCACC, MRE2: ACCCCAC, MRE3: AACTACC, and MRE-like: AACAACC. Based on four promoter sequences and TT8 binding features, two oligonucleotide sequences probes, G- BOX: CACGTG and G-BOX-like: CACGTT, were prepared for TT8. These six probes were synthesized with a biotin labeling using a Pierce™ Biotin 3' End DNA Labeling Kit (Thermo Fisher, Waltham, MA).

[0141] The DNA-binding reactions between probes and two transcription factors were carried out using a LightShift™ Chemiluminescent EMSA Kit (Thermo Fisher, Waltham, MA) according to the manufacturer’ protocol. The reactions were carried out in 20 mΐ of mixture, which was composed of 2.0 pg purified protein and 0.5 mM biotin-labeled DNA probe reaction buffer, 50 mM KC1, 5% (vol/vol) glycerol, and 1.0 pg poly(deoxyinosinicdeoxycytidylic) acid (polydPdC). After the binding reactions were completed in 20 min at room temperature, all reaction products were loaded on 6% (g/100 ml) nondenaturing polyacrylamide gels, which were placed into a gel box for electrophoresis at 160 V for 60 min. Proteins were then transferred to Hybond-N+ nylon membranes (Thermo Fisher, Waltham, MA). After five times of strict washing, the band shifts were detected using Chemiluminescent Nucleic Acid Detection Module system (Thermo Fisher, Waltham, MA) by following the manufacturer’s manual. Binding images were photographed using a pre-cold CCD camera (SYNGENE GBOX, MD, USA).

[0142] Dual luciferase assays. Dual luciferase assay was carried out to analyze the regulatory activity of PAP 1 and TT8 TFs alone, two TFs together, and two TFs together with WD40 in activating NtJAZl, NtJAZ3, PMT2 and ODC2 promoters. A reporter vector and an effector vector were used to perform dual luciferase assays. The reporter vector is pGreenll- 0800 that contains multiple restriction enzyme sites immediately at the N-terminus of a firefly - luciferase gene, such as BamHI, Notl, and EcoR V. This vector also contains NPTII gene for kanamycin-based screening. To clone promoters into the pGreenII-0800 vector, primers were designed to add two restriction enzyme sites in the two ends to amplify each promoter sequence (Table 9). The primer pairs designed for NtJAZl, NtJAX3 and ODC2, and PMT2 promoters included BamHI and Notl, EcoRV and BamHI, and EcoR V and Not I restriction enzymes sites, respectively. Each promoter sequence was amplified by PCR with the same thermal programs (Table 9) and then purified as described above. This reporter vector and promoters of NtJAZl, NtJAZ3, PMT2, and ODC2 were digested by specific restriction enzymes as designed. The digested vector and each promoter were ligated using T4 ligase. The resulting ligation products were transformed into competent cells ToplO. Positive A. coli colonies were obtained from screening on LB medium supplemented with 50 mg/ml kanamycin. After purification, four reporter vectors, namely /riZfy_m-pGreenl 1-0800, /riXfy_m-pGreen 11 - 0800, G/Xfym-pGreenll-OSOO, and P 7¾_TO-pGreenII-0800, were obtained for transient expression in tobacco.

[0143] Meanwhile, the ORFs of GFP, PAP1, TT8, and WD40 were cloned into the effector vector PK2GW7 (He el ah, 2017), in which each was driven by a 35S-promoter. First, the forward and reverse primers designed for amplification of the ORFs of these genes were added an attBl (forward primer) and an attB2 (reverse primer) adapter (Table 9). PCR was performed to amplify each ORF with an attB in the 5-end and an attB2 adapter in the 3-end. Each PCR product was purified using gel-extraction Kit (Thermo Fisher, Waltham, MA). The purified promoters were ligated to the pDonr207 plasmid with BP reactions as described above to obtain plasmids pDonr207-GFP, pDonr207-PAPl, pDonr207-TT8, and pDonr207-TTGl, which were then introduced into E. coli Top 10 strain of for positive colonies screened on LB medium containing 50 mg/ml gentamicin. The GFP, PAP1, TT8, and WD40 ORFs in the pDonr207 plasmid were then cloned to the expression vector PK2GW7 via LR reaction as described above. The resulting recombinant PK2GW7-GFP, PK2GW7-PAP1, PK2GW7-TT8, and PK2GW7-WD40 plasmids were introduced to E. coli ToplO to select positive colonies on LB medium containing 50 mg/1 spectinomycin. One positive colony was selected to purify each recombinant plasmid for transient expression in tobacco.

[0144] Activation of Agrobacterium was prepared for both effectors and reporters for transient expression experiments. An enhancer vector pSoup+P19 and each of four reporter vectors, JAZl_pro- pGreenII-0800, ./4Z _{/ m}-pGreenII-0800. PM7¾_TO-pGreenII-0800 and O/Xfym-pGreenI 1-0800. were transformed into competent Agrobacterium GV3101 by electroporation shock method with 2000V voltage. The pSoup+19 was used as cooperator. Using the same method, each of four effector vectors, GFP- PK2GW7, / P/-PK2GW7. TT8- PK2GW7, and JFD40-PK2GW7, was transformed into competent Agrobacterium GV3101. The reporter Agrobacterium GV3101 cells were screened on LB medium supplemented with 50 mg/1 rifampicin and 50 mg/1 kanamycin at 30°C. The Agrobacterium GV3101 cells containing an effecter were screened on LB medium supplemented with 50 mg/1 rifampicin and 50 mg/1 spectinomycin at 30°C. Each of the resulting positive reporter and effecter colonies were inoculated into 50 ml liquid LB medium in 250 ml E-flasks and cultured on a shaker with 200 rpm at 28°Cfor 48 hrs. Then, 100 pi suspension culture from each GV301 reporter and effecter was inoculated to 50 ml fresh liquid LB medium in 250 ml E-flask. Each flask was placed on the same shaker to continue to culture up to an OD value of 0.6 at the wavelength of 600 nm. Cultured Agrobacterium cells were harvested to 50 ml tube and centrifuged at 4000 rpm for 10 min. The resulting Agrobacterium pellet was suspended in infiltration buffer (1 OmM pH5.5 MES, lOmM MgC12, 150 mM acetosyringone) to an OD600 value of 0.2-0.3. The re suspended Agrobacterium was then incubated at room temperature for 2 hrs prior to transient expression experiments.

|0145] Transient expression assay was performed in leaves of Nicotiana benthamiana using activated Agrobacterium cells. Two types of activated Agrobacterium cultures, 100 pi reporter Agrobacterium GV3101 cells and 450 mΐ effecter Agrobacterium GV3101 cells were mixed appropriately, then, 200 pi mixed culture was infiltrated into three locations of four young leaves from 35-day old N. benthamiana. Five independent plants were infiltrated for each paired effector (transcription factor) and reporter (promoter) (e.g. PAP1 vs. NtJAZlp ). After infiltration, all plants were grown in the phytotron for four days prior to analysis of dual- luciferase detection using a Dual-Luciferase Reporter Assay System kit (Promega, Madison, USA). Briefly, leaf discs with 1.0 cm diameter were punched into a 1.5 ml tube and then homogenized in 500 pi Passive Lysis Buffer. The homogenized mixture was centrifuged for 10 min at 12,000 rpm at 40°C. The resulting supernatant was transferred to a new 1.5 ml tube and then diluted 50 times with the Passive Lysis Buffer. Ten mΐ diluted extract was mixed with 40 mΐ Luciferase Assay Buffer. The firefly luminescence (LUC) from samples was immediately recorded 5.0 sec on a GloMax 20/20 luminometer (Promega, Madison, USA) followed by 10 sec intervals. Then, the reaction was stopped by adding 40 mΐ Stop and Glow Buffer and immediately recorded for a second luminescence using renilla (REN) luminescence. The ratios of LUC to REN were calculated. For each pair of a reporter (promoter) and an effector (transcription factor), five biological replicates were performed to obtain LUC to REN ratio values. Five biological replicates were also performed for the empty pGrenn-II-0800 and GFP gene as effecter controls.

|0146] Cross-linked Chromatin immunoprecipitation (ChIP) assays. Gateway cloning was used to develop two plasmids to fuse GFP to the C-terminus of PAP 1 and TT8 for genetic transformation. A pair of primers (Table 9) was designed to amplify the PAP1 ORF without the stop codon. The resulting PCR product was purified as described above and then cloned into the pDonr221 vector via BP reaction. The PAP 1 fragment was further cloned to the upstream of GFP in the destination vector pGWB5 via LR reaction. The resulting recombinant vector pGWB5-PAPl-GFP driven by 35S promoter was introduced into competent E. coli Topol 0 cells for amplification and purification. Positive colonies selected on LB medium containing kanamycin were used to amplify binary vector as described above. The binary vector was introduced into competent Agrobacterium GV301 cells. For binary vector expressing TT8, a pair of primers (Table 9) was also designed for PCR. The reverse primer was designed include a HA-tag sequence. The resulting PCR product was cloned into the plasmid PK2GW7 as described above. The resulting binary vector PK2GW7-TT8-HA-tag was also introduced into competent Agrobacterium GV301 cells. Both fused PAP-GFP and TT8-HA- tag proteins were introduced to N. benthamiana plants that were grown in the phytotron as described above. [0! 47| Nuclei were isolated from transgenic tobacco leaves. Fresh leaf tissue (500 mg) was ground into fine powder in liquid nitrogen and then suspended thoroughly in 25 ml nuclei isolation buffer (HEPES pH7.6, 1M sucrose, 5 mM KC1, 5mM MgCl, 5 mM EDTA, 1% formaldehyde, 14 mM 2ME, 0.6 % triton X-100, 0.4 M PMSF). The mixture was kept at room temperature for 10 min of cross-linking, then added 1.7 ml 2 M glycine to stop the cross- linking. The cross-linked mixture was filtered through a gauze to remove residues. The flow through containing nuclei was centrifuged at 3000 ^c g for 10 min. After the removal of the supernatant, the remaining nuclei were suspended in isolation buffer (HEPES pH7.6, 1M sucrose, 5mM KC1, 5mM MgCl, 5mM EDTA) and mixed appropriately. Then, 800 pi 15% Percoll solution (15% Percoll, lOmM HEPES, 1M sucrose, 5mM KC1, 5mM MgCl, 5mM EDTA) was added to the mixture and gently vortexed, followed by centrifugation at 3000 x g for 5 min. After the removal of supernatant, the nuclei pellet was suspended in nuclei lysis buffer (50 mM Tris-HCl pH7.5, 1% SDS, 10 mM EDTA) for 30 min to release chromatin. The chromatin suspension was then sonicated 3 min (every 4 sec with 9 sec interval) on ice in a Sonic Dismembrator (Fisherbrand™ Model 505 Sonic Dismembrator, Thermo Fisher, Waltham, MA). This sonication sheared DNA (chromatin)-protein into little fragments, which were shown to be 250-1000 bp examined by gel electrophoresis. Then, the chromatin mixture was centrifuged at 13,000 ^c g for 3.0 min to obtain the supernatant for IP.

(0148] GFP monoclonal antibody GF28R and HA-Tag monoclonal antibody (2-2.14) (ThermoFisher, USA) were used for ChIP. The IP assay was composed of 100 mΐ supernatant (chromatin mixture), 900 mΐ ChIP dilution buffer (1 % triton X-100, 1 mM EDTA, 15 mM Tris-HCl pH7.5, 150 mMNaCl), and 5 mΐ HA-antibody or GFP-antibody contained in a 1.5 ml tube. The tube was incubated 4 hrs at 4 °C. The cross-linked DNAs were immunoprecipitated by HA-antibody or GFP-antibody. The resulting immune complexes were washed three times with 0.5 ml lysis buffer (0.05 M HEPES, 250 mM NaCl, 1 mM EDTA, 1 % triton X-100, 0.1 % sodium deoxycholate(m/v), 0.1%SDS, 10 mM sodium butyrate, O.OOlmM PMSF, lx cocktail), followed by three times of washing with 0.5ml LNDET buffer (250mM LiCl, 1% NP40, 1 % sodium deoxycholate (m/v), lmM EDTA), and three times of washing with 0.5 ml TE buffer (10 mM Tris-HCl pH7.5, lmM EDTA). These washes removed free antibodies and non-specific chromatins. Finally, the DNA-protein complex was suspended in 0.5 ml TE buffer in a 1.5 ml tube. Then, the same volume of phenol/chloroform (1:1, v/v) was added into the tube and appropriately mixed. The tube was centrifuged for 10 min at 12,000 xg. The upper aqueous phase was transferred to a new 1.5 ml tube and the added 0.1 volume 3 M sodium acetate. The tube was gently vortexed and centrifuged at 12,000 ^c g for 10 min. After the removal of the supernatant, the precipitated DNA was air-dried and dissolved in 30 pi autoclaved double deionized- water. The purified DNA was used as templates for ChIP -qRT- PCR analysis. In addition, a positive input DNA (DNA fragments without IP reaction) was used as a positive control. Primers used for amplifying four promoters and thermal programs were as described above (Table 9).

[0149] Reduction of nicotine, nornicotine, anatabine, anabasine, myosmine, and TSNAs in two genotypic red P+T-NL and P+T-KY171 tobacco plants. Field trials that follow commercial production practices are essential to examine the effects of new varieties or genes on nicotine biosynthesis and TSNA content. Two red genotypes and their corresponding wild-type tobacco variety were planted in the field at the research station in Oxford, North Carolina, to understand the effects of the PAP1-TT8 complex on the contents of nicotine, nornicotine, and TSNA. Two red genotypes are named P+T-NL and P+T-KY171, which resulted from the coupled overexpression of the synthetic PAP1 and TT8 in Narrow Leaf Madole (NL) and KY171, two main commercial dark tobacco genotypes. The field production ofhomozygous T2 P+T-NL and P+T-KY171 progeny followed industry protocols and the field production protocol of GMO tobacco, and leaves were air-cured in ventilation bams.

10150 [ Phenotypes of two red versus two wild-type genotypic tobacco plants in the field and air cured leaves. As shown in FIGS. 25A-25D, field farming practice of four genotypes was performed in the field in Oxford, North Carolina. Phenotypes of 30-day (upper) and 60- day old WT-NL vs. red P+T-NL plants are provided in FIG. 25A. Phenotypes of 30-day (upper) and 60-day old WT-KY171 vs. red P+T-KY171 plants are provided FIG. 25B. Phenotypes of topped plants (FIG. 25C) and air curing (FIG. 25D) are also provided. Plant name abbreviations are WT-NL: wild-type dark narrow leaf Madole variety, P+T-NL: PAP1 and TT8-stacked transgenic NL, WT-KY171: wild-type dark KY171 variety, and P+T-KY171: PAP1 and TT8- stacked transgenic KY 171.

[0151] Statistical analysis. ANOVA and Fisher’s LSD test using SAS software (Cary, NC) were used to evaluate statistical significance in nicotine, nornicotine, anabasine, NNN, NNK, NAT, and NAB. All data that is presently available and explanation of results.

[0152] GenBank™ IDs. As provided herein, the various nucleic acids and polynucleotides of the present disclosure can be associated with GenBank™ identification reference numbers. For example, the GenBank™ ID for PAP1 is AT1G56650; the GenBank™ ID for TT8 is AT4G09820; the GenBank™ ID for NtJAZl is AB433896.1; the GenBank™ ID for NtJAZ3 is AB433898.1; the GenBank™ ID for NtJAZ7 is KC246554; and the GenBank™ ID for NtJAZIO is KC246560. [0.1531 Additionally, with respect to various promoters disclosed herein, the GenBank™ ID for NtJazl Pro is NW_015811548.1; the GenBank™ ID for NtJaz3 Pro is NW_015929051.1; the GenBank™ ID for NtJaz7 Pro is NW 015943873.1; the GenBank™ ID for NtJazlO Pro is NW_015881628.1; the GenBank™ ID for NtODCl Pro is NW_015934162.1; and the GenBank™ ID for NtPMTl Pro is NW_015891702.1.

4. Examples

[0154] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods of the present disclosure described herein are readily applicable and appreciable, and may be made using suitable equivalents without departing from the scope of the present disclosure or the aspects and embodiments disclosed herein. Having now described the present disclosure in detail, the same will be more clearly understood by reference to the following examples, which are merely intended only to illustrate some aspects and embodiments of the disclosure, and should not be viewed as limiting to the scope of the disclosure. The disclosures of all journal references, U.S. patents, and publications referred to herein are hereby incorporated by reference in their entireties.

[0 J 55j The present disclosure has multiple aspects, illustrated by the following non-limiting examples.

Example 1

[0156] Significant reduction of nicotine, nornicotine, anatabine, anabasine, myosmine, individual TSNAs, total TSNAs, and total tobacco alkaloids in leaves of PAP1 and TT8- coupled red tobacco plants. Quantification with HPLC-QQQ-MS showed reduction of nicotine, nornicotine, anabasine, anatabine, and myosmine in cured leaves of two genotypes of TT8 and / /V -coupled red tobacco plants compared to non-transgenic controls. The contents of nicotine were reduced by 45-51% in all cured leaf groups of the P+T-NL genotype (FIG. 2A) and by 19-32% in upper three groups of cured leaves of P+T-KY171 genotype (FIG. 2B). The contents of nornicotine were decreased by 39-44% and 30-40% in all cured leaf groups of the T-P-NL genotype and the P+T-KY171 genotype, respectively (FIGS. 2C-2D). The contents of anabasine, anatabine, and myosmine were reduced by 27-45%, 55-66%, and 19-25% in all cured leaf groups of the P+T-NL genotype (FIG. 3A ), respectively, and were reduced by 27- 45%, 32-56%, and 29-35% in all cured leaf groups of the P+T-KY171 genotype, respectively (FIG. 3B). [0!57| More importantly, quantification showed that the contents of four carcinogenic TSNAs were significantly decreased in all groups leaves of the two genotypes. The content of NNK in all groups of cured leaves was reduced by 40-70% in the P+TP+T-NL genotype and 57-79% in the P+T-KY171 genotype (FIGS. 2E-2F). The content ofNNN in all groups of cured leaves was decreased by 63-74% in the P+T-NL genotype and 57-79% in the P+T-KY171 genotype (FIGS. 2G-2H). The content of NAT in all groups of cured leaves was decreased by 77-92% in the P+T-NL genotype and 70-80% in the P+T-KY171 genotype (FIGS. 2I-2J). The content of NAB in all groups of cured leaves was decreased by 72-80% in the P+T-NL genotype and 60-77% in the P+T-KY171 genotype (FIGS. 2K-2L). More fundamentally, the content ofNNN was less than 0.5 ppm, two-fold lower than the FDA’s proposed rule to limit NNN in smokeless tobacco products to 1.0 ppm (FDA, 2017, Konstantinou el cil, 2018). Furthermore, the total content of TSNAs that were 7.07 ppm and 9.01 ppm in wild type NL andKY171 leaves were reduced to 2.67 ppm and 3.47 ppmin P+T-NL and P+T-KY171 leaves. Further quantification of total tobacco alkaloids showed that the content of total alkaloids was decreased by 44-51% in all cured leaf groups of the P+T-NL genotype and 20-32% in the three upper group leaves of P+T-KY171 genotype (FIGS. 2M-2N).

Example 2

[0158] Reduction of nicotine, nomicotine, anatabine, anabasine, myosmine, individual TSNAs, total TSNAs, and total tobacco alkaloids in leaves of PAP1 tobacco. The PAP1 tobacco genotype is an isogenic homozygous red variety programmed from Xanthi by PAP1 (Xie and Dixon, 2005). Field trials were conducted in 2011 and 2012. The field design and crop management were the same as described above. Leaves were Hue-cured in bams. Quantification with HPLC-ESI-MS showed reduction of nicotine, nomicotine, anabasine, and anatabine. The content of nicotine was reduced by 10-50% and 0-25% in 2011 and 2012, respectively (FIGS. 4A-4B). The contents of nomicotine, anabasine, and anatabine were reduced by 25-70% and 5-55%, 30-60% and 0-20%, and 0-60% and 10-40% in 2011 and 2012, respectively (FIGS. 4A-4B). To understand effects of PAP1 on these metabolites, the total alkaloid content was also calculated from all leaves of the whole PAP1 tobacco plant. The resulting data showed that the total contents of nicotine, nomicotine, anabasine, and anatabine in the entire plant were reduced by 30%, 45%, 50%, and 40% in 2011 and 10%, 20%, 10%, and 30% in 2012 respectively (FIGS. 5A-5B).

[0159] Additionally, the contents of NNN, NNK, NAB, and NAT were significantly reduced in Hue-cured PAP1 tobacco leaves (FIGS. 6A-6B). In the four groups of leaves in 2011 and in 2012, the content of NNN was reduced by 20-60% and 25-60%, the content of NNK was reduced by 5-50% and 0-60%, the content of NAB was reduced by 20-40% and 15-50%, and the content of NAT was reduced by 50-65-% and 35-70%, respectively. The content of NNN was less than 0.5 ppm (FIGS. 6A-6B), two-fold lower than the FDA’s proposed 1 ppm. The contents of NNK, NAT, and NAB were also reduced to less than 1 ppm (FIGS. 6A-6B). In addition, the total contents for each TSNA was calculated in leaves of whole plants. The resulting data showed that the contents of NNN, NNK, NAB, and NAT were reduced by 20- 60% (P -value < 0.05) in PAP1 leaves in 2011 and 2012 (FIGS. 6A-6B). The total content of all TSNAs in the entire plants was reduced by nearly 57% and 40% (P -value < 0.05) in 2011 and 2012, respectively (FIGS. 7A-7B).

Example 3

[0160] Significant reduction of nicotine, nornicotine, and total alkaloids in leaves of PAP1 and TT8-coupled tobacco seedlings HPLC-MS analysis showed that the contents of nicotine, nornicotine, and the total amount of the two compounds in roots and leaves of three analyzed P+K-NL and P+K-KY plants were significantly reduced 1.5-3.4, 1.3-2.5-, and 1.9- 3.3-fold, respectively, compared with those in wild-type and vector control plants (FIGS. 8A- 8L).

Example 4

[01 11 Downregulation of nicotine pathway genes and upregulation of four NtJAZ genes in red P+T-NL and P+T-KY171 tobacco plants. Gene expression profiling was performed to characterize transcript profiles of 16 genes (FIG. 1 A) involved in the biosynthesis of nicotine in roots of both P+T-NL and P+T-KY171 genotypes. qRT-PCR was performed to characterize the transcriptional profiles of 16 genes. The resulting data showed that the expression levels of main nicotine biosynthetic genes were significantly lower in P+T-NL and P+T-KY171 genotypes than in wild wild-type and vector control plants. The expression levels of PMT1, PMT2, MPOl, QPT2, A622, BBL and ERF189 were significantly reduced by 52- 60%, 40%-50%, 35-55%, 25-55%, 55-60%, 16-57%, and 60-70% in roots of both P+T-NL (1, 2, and 3), respectively (FIGS. 9C-9J), and the expression of PMT1, PMT2, MPOl, QPT2, A622, and ERF189 were significantly reduced by 63-80%, 31-85%, 40-63%, 80-90%, 40-60%, and 10-40% in roots of P+T-KY (1, 2, and 3) genotypes (FIGS. 9M-9T). The expression levels of OCD2 was not altered in roots of the P+T-NL 1, 2 and 3 genotypes (FIG. 9C) but significantly decreased by 75-85% in roots of the P+T-KY1, 2, and 3 genotypes (FIG. 9M). [0.1621 In contrast with the decreased expression of those pathway genes, qRT-PCR analysis showed that the expression levels of four JAZ repressor genes, NtJAZl, NtJAZ3, NtJAZ7, and NtJAZIO, were significantly increased by 550-620%, 380-440%, 320-490%, and 1500-1600% in roots of the P+T-NL (1, 2, and 3) genotypes (FGIS. 9A-9B and 9U-9V), respectively, and by 220-320%, 200%-350%, 180-330%, and 175%-350% in roots of the P+T-KY (1, 2, and 3) genotypes, respectively (FIGS. 9K-9L and 9W-9X).

Example 5

[0163] Both PAP1 and TT8 bind to and activate the promoters of NtJAZl and NtJAZ3.

The PAP1 and TT8 are two key components of the master regulatory PAP1-TT8-TTG1 (MYB- bHLH-WD40) complex that activates anthocyanin biosynthesis in Arabidopsis. PAP1 and TT8 have been shown to bind to MRE (ANCNNNC) and G-Box (CACGTG) elements in promoters, respectively. To understand whether the up-regulation of NtJAZl and NTJAZ3 was associated with the binding and activation functions of PAPl and TT8, the promoter sequences of both NtJAZl and NtJAZ3 (PTONTJAZI and ProNtJAn) (SEQ ID NO: 4 and SEQ ID NO: 5) were identified from the genomic sequence of tobacco NC90 tobacco curated at NCBI. One kb nucleotides in the proximal upstream from the starter codon (ATG) were obtained for sequence characterization. Sequence analysis revealed that both Provu izi and ProNUAZ3 have the MRE and G-Box element. The promoter sequences from both NL and KYI 71 varieties were further cloned. Sequence analysis revealed that PTONTJAZI has two MRE elements, MREl: ACCCACC at position -180 and MRE2: ACCCCAC at position -172, and two G-Boxes, CACGTG at positions -232 and -395; and PromjAZ3 has one MRE3 element: AACTACC at position -169 and one G-box CACGTG at position -960 (FIG. 10A). 1.5 kb in the proximal upstream from the start codon (ATG) were obtained for the promoter sequences of NtJAZ7 and NtJAZIO (SEQ ID NO: 6 and SEQ ID NO: 7). Sequence analysis revealed that NtJAZ7pro have the MRE and G-box elements, while NtJAZlOpro only has G-box elements.

[0164J EMSA assay in vitro was carried out to test whether PAPl and TT8 could bind to the MRE and G-Box elements of NtJAZl _pro and NtJAZ3_pro. The R2R3-MYB binding domain (amino acids 1-178) of PAPl was cloned to pDEST-His-MBP (at His-and MBP Tag fusion at the N-terminus) and the bHLH binding domain (amino acid 359-443) of TT8 was cloned to PRSF-Dute (at His-Tag fusion at the N-terminus) (FIGS. 1 lA-1 IB). Two constructs were introduced to E. coli to successfully induce recombinant peptides, which were further purified with a His-tag purification system (FIGS. 11 A-l IB). Biotin probes were prepared for MREl (ACCCACC), MRE2 (ACCCCAC), MRE3 (AACTACC), and G-Box (CACGTG). Both competitive and non-competitive probes were used as controls for EMSA assay. The resulting data showed that the recombinant R2R3 binding domain could directly bind to three MRE element probes and the recombinant bHLH binding domain could directly bind to the G- Box (FIG. 10B). The binding efficiency of both recombinant R2R3 and bHLH binding domains was competed by competitive probes but not competed by non-competent probes (FIG. 10B). These data demonstrate that both PAP1 and TT8 bind to the NtJAZl_pro and NtJAZ3_pro.

[0I65j ChIP-Q-PCR analysis was performed to examine whether PAP1 and TT8 could bind to ProNTJAzi and PromjAZ3 in vivo. In ChIP experiments, GFP was fused at the 3-end of PAP1 in the binary vector pGWB5 to obtain pGWB5-PAPl-GFP, which was further introduced into NL and KYI 71. An HA-tag sequence was fused to the 3-end of TT8 in the binary vector PK2GW7 to obtain PK2GW7-TT-HA-tag, which was also introduced into NL and KY171 tobacco plants. The IP experiments of PAP1 and TT8 were performed by using GFP and HA monoclonal antibodies. The ChIP PCR results showed that the amplified NtJAZl and NtJAZ3 promoter fragments was increased 5-9 times by PAP1 and 3.8-5.2 times by TT8 (FIG. IOC). [0166{ Dual-luciferase assay was completed to demonstrate whether PAP 1, TT8, and WD40 functioned together to activate the NtJAZl and NtJAZ3 promoters in tobacco. PAP1, TT8, and WD40 were used as effectors. The ORF sequences of GFP, PAP1, TT8, and WD40 were respectively cloned into the PCB2004 plasmid to generate four constructs, in which each was driven by a 35S-promoter (FIG. 10D). Both NtJAZl and NtJAZ3 promoters and a luciferase gene were used as the reporter. The two promoter sequences were cloned into the plasmid pGreenII-0800 to drive the luciferase gene (FIG. 10D). Effectors and reporters were incubated for dual-luciferase assays. Promoters alone and a binary vector were used as controls. The resulting data showed that TT8 significantly activated the activity of both NtJAZl and NtJAZ3 promoters, and PAP1 significantly and slightly activated the activity of NtJAZl and NtJAZ3 promoters, respectively (FIG. 10E). Compared with controls, the activity of two promoters were increased 1.8-7.1 times by PAP1 or TT8. It was interesting that compared to PAP1 and TT8 alone, PAP1 and TT8 together enhanced a higher activity of the NtJAZ3 promoter. Furthermore, PAP1, TT8, and TTG1 together increased 10.2 to 23.6 times of the activity of both NtJAZl and NtJAZ3 promoters, much higher than PAP1 and TT8 alone and PAP1 and TT8 together (FIG. 10E). These findings demonstrate that the PAP1-TT8-TTG1 complex transcriptionally activates both NtJAZl and NtJAZ3. [0.1671 In accordance with the embodiments in this example, a schematic T-DNA cassette, including A tPPl and 4/776' genes in aPK2GW7 vector, is shown below.

35S AtPAPI Tnos 35s AtTT8 T35S

PAP7-7T8-PK2GW7

[0168] The 35S pro constitutively promotes transcription of both AtPAPI ( PAP1 ) and AtTT8 (TT8). Tnos terminates the transcription of AtPAPI and T35S terminates the transcription oΐAίTT8.

[0169j As described further herein, AtPAPI ( PAP1 ) encodes a R2R3-MYB transcription factor. It joins AtTT8 as well as endogenous WD40 protein to form an MBW complex. Its overexpression alone also activates tobacco NtANla and NtANlb (FIGS. 24A-24B), two homologs of AtTT8, to form an MBW complex. It binds to key anthocyanin pathway genes, DFR, ANS, 3-GT, F3 Ή F3H, CHS, CHI, and AtTT8. This binding activates or upregulates the expression levels of these genes. Therefore, it activates and upregulates the anthocyanin pathway in tobacco and other plants. It binds to repressor genes of the nicotine pathway, NtJAZl, NtJAZ3, and NtJAZ7. It activates and upregulates the expression levels of NtJAZl, NtJAZ3, and NtJAZ7, thus reduces the expression levels of key nicotine biosynthesis genes, PMT1, PMT2, ODC2, MPO, QPT2, A622, BBLs, and ERF189. Additionally, 4/776 encodes a bHLH transcription factor. It joins AtPAPI as well as endogenous WD40 protein to form an MBW complex. It binds to key anthocyanin pathway genes, DFR, ANS, 3-GT, F3’H, F3H, CHS, CHI, and AtTT8.This binding activates and upregulates expression levels of these genes. Therefore, it activates and upregulates the anthocyanin pathway in tobacco and other plants. It binds to negative regulatory genes of the nicotine pathway, NtJAZl, NtJAZ3, NtJAZ7, and NtJAZlO. It activates and upregulates the expression levels of NtJAZl, NtJAZ3, NtJAZ7, and NtJAZl 0, thus reduces the expression levels of key nicotine biosynthesis genes, PMT1, PMT2, ODC2, MPO, QPT2, A622, BBLs, and ERF189.

[0170] PAP1 and TT8 of A. thaliana encode a R2R3-MYB and bHLH TF, respectively. A T-DNA cassette was synthesized, in which PAP1 and TT8 were stacked for coupled overexpression. From 5’- to 3’ end, the cassette was composed of attLl, the PAP1 cDNA (NP_176057), NOS (terminator), 35S promoter, the TT8 cDNA (CAC 14865), and attL2 . The synthesized sequence was introduced to the entry vector pUC57 and then cloned into the destination binary vector pK2GW7 by attL ^c attR combination (LR) reaction with LR clonase. The resulting binary vector, namely PAPl-TT8-pK2GW7, was further introduced into competent cells of Agrobacterium tumefaciens strain GV3101. A positive colony was selected for genetic transformation of tobacco. In addition, the pK2GW7 vector was also used for genetic transformation as control.

AtPAPI T AtTT8

A nos 35S

35S AtPAPI Tnos 35S AtTT8 T35S

B

PAP1-TT8-PK2G\N7

[0171 j In accordance with these embodiments, the diagram above shows gene stacking design for DNA synthesis and cloning. A cloning cassette was designed for stacking attLl, PAP1 cDNA (AtPAPI), NOS terminator (Tnos), 35 S promoter, TT8 cDNA (AtTT8), NOS terminator (Tnos), and attL2 for synthesis and for Gate-way based cloning into binary vector (diagram A). And a gene stacking map in T-DNA shows the order of PAP1 and TT8 driven by 35 S promoter cloned in the binary vector PK2GW7 for genetic transformation of commercial tobacco (diagram B).

Example 6

|0172j PAP1 and TT8 do not activate promoters of ODC2 and PMT. It was further examined whether PAP1 and TT8 could activate promoters of NtODC2 and NtPMT, two key upstream pathway genes of nicotine biosynthesis. About 1.0 kb nucleotide sequences (SEQ ID NO: 8 and SEQ ID NO: 9) were obtained for these two promoters from the tobacco genomic sequences curated at NCBI. Sequence analysis showed that two promoters do not have typical MRE and G-Box elements. Instead, the promoter of NtPMT2 has an MRE-like element (AACAACC at position -530 and a G-Box like (CACGTT at position -186) element (SEQ ID: 9).

|0173| EMSA experiments were performed to test whether PAP1 and TT8 could bind to MRE-like and G-Box-like elements. The EMSA results indicated that the TT8 binding domain could bind to the G-Box like (CACGTT) element. However, when a competitive probe was added, the binding signal was lost (FIG. 12A). When G-box elements from Nl.IAZI mdNtJAZ3 were used as positive control, the resulting data showed that the signal from G-Box like element was much weaker (FIG. 12 A). This result indicates that TT8 can weakly bind to the promoter oiNtPMT2. When MRE-like element probe was prepared for EMSA, the resulting data showed that PAP1 could not bind to the MRE-like probe (AACAACC). while PAP1 strongly bound MREl and MRE3 probes from NtJAZl and NtJAZ3 promoters used as positive controls (FIG. 12B).

[0174J Dual-luciferase assay and ChIP-Q-PCR were also performed to test if PAP 1 and TT8 could activate the ODC2 and PMT2 promoters. The dual-luciferase assay data showed that neither PAP1 and TT8 alone, two together, nor PAP1, TT8, and TTG1 together could activate the activity of the two promoters (FIG. 13 A). Meanwhile, the CHIP-Q-PCR data showed that PAP1 and TT8 could not enrich binding elements of the two promoters in vivo (FIG. 12B). All these data demonstrate that PAP1, TT8, and their complex cannot activate the promoters of these two key pathway genes.

Example 7

[0175| Upregulation of common pathway genes of anthocyanin in leaves and roots and one proanthocyanidin-specific gene in roots of red P+T-NL and P+T-KY171 tobacco plants. UV-spectrometry measurements showed that the levels of anthocyanins were higher in leaves than in roots of both P+T-NL and P+T-KY171 genotypes, while anthocyanins were hardly detected in wild type NL and KY171 tissues (FIGS. 14A-14B). DMACA analysis showed the formation of flavan-3-ols and proanthocyanidins in roots but not in leaves of both P+T-NL and P+T-KY171 genotypes (FIGS. 15A-15D). Six pathway genes, including CHS, CHI, F3H, F3 Ή, DFR, and AMS', control both anthocyanin and proanthocyanidin biosynthesis (FIG. IB). In addition, ANR is a key gene specifically toward the PA formation, while 3-GT is involved in glycosylation of anthocyanidins. Transcripts of anthocyanin and proanthocyanidin (PA) pathway genes in roots of both P+T-NL and P+T-KY171 genotypes were examined using qRT-PCR. The resulting data showed that the expression levels of the six common pathway genes and 3-GT were up-regulated 2-1000 times in roots and leaves of the two genotypes (FIGS. 16A-16B). The expression of ANR was activated in roots of the two genotypes,. These results explained that the red pigmentation is much less in roots than in leaves (FIG. IB and FIG. 14A-14B).

5. Sequences

|0176] Transgene Sequences: [0.177 j AtPAPl (Arabidopsis thaliana Production of Anthocyanin Pigment 1, a R2R3-MYB member), AtTT8 (Arabidopsis thaliana Transparent Testa 8, a basic Helix Loop Helix member), 35S promoter, and NOS terminator.

|0178] AtPAPl (SEQ ID NO: 1):

(0179] ATGGAGGGTTCGTCCAAAGGGCTGCGAAAAGGTGCTTGGACTACTGAA

GAAGAT AGT CTCTT GAGAC AGTGC ATTAAT AAGT AT GGAGAAGGC AAAT GGC AC

C AAGTTC CT GT AAGAGCT GGGCT AAAC CGGTGC AGGAAAAGTT GT AGATT AAGA

TGGTTGAACTATTTGAAGCCAAGTATCAAGAGAGGAAAACTTAGCTCTGATGAA

GTCGATCTTCTTCTTCGCCTTCATAGGCTTCTAGGGAATAGGTGGTCTTTAATTGC

TGGAAGATTACCTGGTCGGACCGCAAATGACGTCAAGAATTACTGGAACACTCA

TCTGAGTAAGAAACATGAACCGTGTTGTAAGATAAAGATGAAAAAGAGAGACAT

TACGCCCATTCCTACAACACCGGCACTAAAAAACAATGTTTATAAGCCTCGACCT

CGATCCTTCACAGTTAACAACGACTGCAACCATCTCAATGCCCCACCAAAAGTTG

ACGTTAATCCTCCATGCCTTGGACTTAACATCAATAATGTTTGTGACAATAGTAT

CATATACAACAAAGATAAGAAGAAAGACCAACTAGTGAATAATTTGATTGATGG

AGAT A AT AT GT GGTT AGAGA A ATT C CT AGAGGA A AGC C A AGAGGT AGAT ATTTT

GGTTCCTGAAGCGACGACAACAGAAAAGGGGGACACCTTGGCTTTTGACGTTGA

TCAACTTTGGAGTCTTTTCGATGGAGAGACTGTG AAATTTGATTAG

(0180] AtTT8 (SEQ ID NO: 2):

[0181] ATGGATGAATCAAGTATTATTCCGGCAGAGAAAGTGGCCGGAGCTGAG

AAAAAAGAGCTT C AAGGGCT GCTT AAGACGGC GGTT C AAT CTGT GGACT GGACT

TATAGTGTCTTCTGGCAATTTTGTCCTCAACAACGGGTCTTGGTGTGGGGGAATG

GATACTACAACGGTGCAATAAAGACGAGGAAGACAACTCAACCAGCGGAGGTG

ACGGCGGAAGAGGCTGCGTTAGAGAGGAGCCAACAGCTCAGGGAGCTTTATGAG

ACACTTTTAGCCGGAGAGTCAACGTCAGAAGCAAGAGCATGCACCGCATTGTCA

CCGGAGGATTTGACGGAGACAGAATGGTTTTATCTAATGTGTGTGTCTTTCTCTTT

TCCTCCTCCATCTGGGATGCCAGGAAAAGCGTATGCAAGGAGGAAGCACGTATG

GCTAAGTGGTGCAAATGAAGTTGACAGTAAAACTTTTTCTAGAGCTATTCTCGCT

AAGAGTGCTAAAATTCAGACAGTGGTTTGCATTCCAATGCTTGATGGTGTTGTGG

AACT AGGC AC AAC GAAAAAGGT AAGAGAAGAT GT AGAGTTT GTT GAGCTC AC AA

AGAGTTTCTTCTATGACCACTGCAAGACGAACCCAAAGCCGGCTCTTTCTGAACA

CTCC AC CT ACGAAGT GC AT GAAGAAGCC GAAGAC GAAGAAGAAGT AGAAGAAG

AGAT GAC AAT GT C AGAGGA A AT GAGGC TT GGCT CTC CT GAT GAT GAAGAT GTTT C

CAATCAAAATCTACACTCTGATCTTCATATTGAATCAACCCATACGTTAGACACA CAT ATGGAC AT GAT GAATCTAAT GGAGGAAGGT GGAAACT ATT CT C AGAC AGT A

ACAACACTTCTCATGTCACACCCCACAAGTCTTCTTTCAGATTCAGTTTCCACATA

TT CTT AC AT C C AAT C ATC GTTT GCC AC GT GGAGGGTT GAGAAT GGC AAAGAGC AT

CAGCAAGTGAAAACGGCGCCGTCGTCACAATGGGTGCTCAAACAAATGATCTTC

AGAGTTCCTTTCCTCCATGACAACACTAAAGATAAGAGGCTACCGCGGGAAGAT

CT GAGC C AC GT AGT AGC AGAGC GAC GC AGGAGGGAGA AGCT GA AC GAGA A ATT

CATAACGTTGAGATCAATGGTTCCATTTGTGACCAAGATGGATAAAGTCTCAATC

CTTGGAGACACCATTGCGTACGTAAATCATCTTCGAAAGAGGGTCCATGAGCTTG

AGAATACTCATCATGAGCAACAGCATAAGCGGACGCGTACTTGTAAGAGAAAAA

C ATCGGAGGAGGT GGAGGTTT C CAT CAT AGAGA AT GAT GTTTT GTT AGAGAT GA

GATGTGAGTACCGAGATGGTTTGTTGCTTGACATTCTTCAGGTTCTTCATGAGCTT

GGTATAGAGACTACGGCAGTTCATACCTCGGTGAACGACCATGATTTCGAGGCG

GAGATAAGGGCGAAAGTAAGAGGGAAGAAAGCAAGCATCGCTGAGGTCAAAAG

AGCCATCCACCAAGTCATAATACATGATACTAATCTATAG

[0182| T-DNA cassette: 35S-AtPAPl-Tnos-35S-TT8-T35S (SEQ ID NO: 3):

[0183] GCAGTCAAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGAT

ATATTTCTCAAGATCAGAAGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTC

ACAAACCAAGGCAAGTAATAGAGATTGGAGTCTCTAAAAAGGTAGTTCCCACTG

AAT C AAAGGC CAT GGAGT C AAAGATT C AAAT AGAGGACCT AAC AGAACTCGCC G

TAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGA

AAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAA

AGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAAT

ATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAG

ATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAG

GCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCC

ACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTG

GATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTT

CGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGAACACGGGG

GACTCTAGAGGATCCCCGGGTGGTCAGTCCCTT[ tfMP7]TCCAAAGGGCTGCGAA

AAGGTGCTTGGACTACTGAAGAAGATAGTCTCTTGAGACAGTGCATTAATAAGT

ATGGAGAAGGCAAATGGCACCAAGTTCCTGTAAGAGCTGGGCTAAACCGGTGCA

GGAAAAGTTGTAGATTAAGATGGTTGAACTATTTGAAGCCAAGTATCAAGAGAG

GAAAACTTAGCTCTGATGAAGTCGATCTTCTTCTTCGCCTTCATAGGCTTCTAGGG

AATAGGTGGTCTTTAATTGCTGGAAGATTACCTGGTCGGACCGCAAATGACGTCA AGAATTACTGGAACACTCATCTGAGTAAGAAACATGAACCGTGTTGTAAGATAA

AGATGAAAAAGAGAGACATTACGCCCATTCCTACAACACCGGCACTAAAAAACA

ATGTTTATAAGCCTCGACCTCGATCCTTCACAGTTAACAACGACTGCAACCATCT

CAATGCCCCACCAAAAGTTGACGTTAATCCTCCATGCCTTGGACTTAACATCAAT

AATGTTTGTGACAATAGTATCATATACAACAAAGATAAGAAGAAAGACCAACTA

GT GA AT A ATTT GATT GAT GGAGAT A AT AT GT GGTT AGAGA A ATT C CT AGAGGA A

AGCCAAGAGGTAGATATTTTGGTTCCTGAAGCGACGACAACAGAAAAGGGGGAC

ACCTTGGCTTTTGACGTTGATCAACTTTGGAGTCTTTTCGATGGAGAGACTGTGA

AATTTGATTAG[7¾os]CGATATCTTGCTGCGTTCGGATATTTTCGTGAGTTCCCGCC

ACAGACCCGGATGATCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGA

TTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGT

TAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTT

ATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAG

CGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG

CCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGG

GT GGT GGCT CT GAGGGT GGC GGTT CT GAGGGT GGCGGCT CT GAGGGAGAGATT A

GCCTTTTCAATTTCAGAAAGAATGCTAACCCACAGATGGTTAGAGAGGCTTACGC

AGCAGGTCTCATCAAGACGATCTACCCGAGCAATAATCTCCAGGAAATCAAATA

CCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGA[35A]TTCAGGACTAACTGCAT

CAAGAACACAGAGAAAGATATATTTCTCAAGATCAGAAGTACTATTCCAGTATG

GACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAGATTGGAGTCTC

TAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAAATAGA

GGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTT

AC GACT C AAT GAC A AGAAGAAAAT CTTC GT C AAC AT GGT GGAGC ACGAC AC ACT

TGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGA

GACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCT

ATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCC

ATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTC

CCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAA

CCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGA

CGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTC

ATTTGGAGAGAACACGGGGGACTCTAGAGGATCCCCGGGTGGTCAGTCCCTT[7T

S]ATGGATGAATCAAGTATTATTCCGGCAGAGAAAGTGGCCGGAGCTGAGAAAAA

AGAGCTTCAAGGGCTGCTTAAGACGGCGGTTCAATCTGTGGACTGGACTTATAGT GTCTTCTGGCAATTTTGTCCTCAACAACGGGTCTTGGTGTGGGGGAATGGATACT

ACAACGGTGCAATAAAGACGAGGAAGACAACTCAACCAGCGGAGGTGACGGCG

GAAGAGGCTGCGTTAGAGAGGAGCCAACAGCTCAGGGAGCTTTATGAGACACTT

TTAGCCGGAGAGTCAACGTCAGAAGCAAGAGCATGCACCGCATTGTCACCGGAG

GATTT GACGGAGAC AGAAT GGTTTT ATCT AAT GT GT GTGT CTTT CT CTTTT C CTCC

TCCATCTGGGATGCCAGGAAAAGCGTATGCAAGGAGGAAGCACGTATGGCTAAG

TGGTGCAAATGAAGTTGACAGTAAAACTTTTTCTAGAGCTATTCTCGCTAAGAGT

GCTAAAATTCAGACAGTGGTTTGCATTCCAATGCTTGATGGTGTTGTGGAACTAG

GCACAACGAAAAAGGTAAGAGAAGATGTAGAGTTTGTTGAGCTCACAAAGAGTT

TCTTCTATGACCACTGCAAGACGAACCCAAAGCCGGCTCTTTCTGAACACTCCAC

CT AC GA AGT GC AT GAAGA AGC C GA AGAC GA AGA AGA AGT AGA AGA AGAGAT GA

CAATGTCAGAGGAAATGAGGCTTGGCTCTCCTGATGATGAAGATGTTTCCAATCA

AAATCTACACTCTGATCTTCATATTGAATCAACCCATACGTTAGACACACATATG

GACATGATGAATCTAATGGAGGAAGGTGGAAACTATTCTCAGACAGTAACAACA

CTTCTCATGTCACACCCCACAAGTCTTCTTTCAGATTCAGTTTCCACATATTCTTA

CATCCAATCATCGTTTGCCACGTGGAGGGTTGAGAATGGCAAAGAGCATCAGCA

AGTGAAAACGGCGCCGTCGTCACAATGGGTGCTCAAACAAATGATCTTCAGAGT

TCCTTTCCTCCATGACAACACTAAAGATAAGAGGCTACCGCGGGAAGATCTGAG

CCACGTAGTAGCAGAGCGACGCAGGAGGGAGAAGCTGAACGAGAAATTCATAA

CGTTGAGATCAATGGTTCCATTTGTGACCAAGATGGATAAAGTCTCAATCCTTGG

AGACACCATTGCGTACGTAAATCATCTTCGAAAGAGGGTCCATGAGCTTGAGAA

TACTCATCATGAGCAACAGCATAAGCGGACGCGTACTTGTAAGAGAAAAACATC

GGAGGAGGTGGAGGTTTCCATCATAGAGAATGATGTTTTGTTAGAGATGAGATG

TGAGTACCGAGATGGTTTGTTGCTTGACATTCTTCAGGTTCTTCATGAGCTTGGTA

TAGAGACTACGGCAGTTCATACCTCGGTGAACGACCATGATTTCGAGGCGGAGA

TAAGGGCGAAAGTAAGAGGGAAGAAAGCAAGCATCGCTGAGGTCAAAAGAGCC

ATCCACCAAGTCATAATACATGATACTAATCTATAG[735A]cggccatgctagagtccgcaaaa atcaccagtctctctctacaaatctatctctctctatttttctccagaataatgtgtgagtagttcccagataagggaattagggttcttatagg gtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaa atccagtgacct

[0184] 1000 bp Jazl promoter sequence in the upstream of the coding regions (SEQ ID

NO: 4):

|0185] TAGCCTCTTATGGTTCGGCCCTTTCCCAGAAACCATGCATAACGGAAGC TTGGTGCACCAGGCTGCTTCGAAAAAGTGAATAACCAATGTTTGGCCATAAAAAT TTCAAATTTTACTTGAAGTTGAATTTCGGAATTTTTCGAATTTTTGAAAAACTCCA

AAGTTTTTCAAAATTTTTACTTCAAATCACTCATAAAAAATTAAAAAACAGCTCT

AAATTGTATTCATGTCCAATAATTTGAAAATATCATTTTCTCTTAATTTTTTTTTTT

ACTTTCTTCCAAAATTTCACATTTCTTATGTCCAAACGGCCACTAAATCACAATAA

ACTATTAGCTAAAAATTGATTTATCAAAACTAAATTCAAACAAATACTTACATAA

CCAACTGTTATCCAAATTAAAACCAAAGGACAGAGTAAAAACAATTTATTTATTT

TTTGGCAAGAACAAATATAAAAAGCCAAAAGAAAAAAAAAATGGAAAACTAAA

CGAAATACGAAGGAGGGCAGACGTTGTAAATATAAACAAAACAGAGGGCAATTT

ACTAGTGACCGAGCAACGCGCAATATACACAGCTGTATCGTTTTTTGAGACGTAA

AAGAAAACGTGTTTGAATTATGGATTACCTTTGTTTTTTCTTTGTCCATACTTTAA

TAATTTC ATTTCC C ATTT C AAAT C AAAAC CTTTTT GT ATTT GAATTTT GA AC C AAA

CAAACAAAACCACAAACCAGAGTTTTACTACATTAATGTACTGAAAACCCCACG

TGTTCCTCGTTCACGCATTAATTCTAACAAATAGGTATAGCCACCCCCCCTCTTAC

CCACCCACCCC ACCATTCAACACCCCCCCAATATCTTTTTTTCATATATATATATA

CACATTGTACTCAAAACAGATTCTTCATCAAATAGTTCCAAATTTATTTCAACTTA

C AAAT AT CTTT CT C AAGCTT ATTAC AGATT CTT GAT AT ATTT AGTTTTTT GCC AC C

GGAAAAC AAA ATGGGGTC AT

|0186j 1000 bp Jaz3 promoter sequence in the upstream of the coding regions (SEQ ID

NO: 5):

[0187] GAATGCTACACCGCTTTCAGTAGAAGAAACAAC ACGTGTTTGACATGC

GCCTTCCTTTATTTCCTTTTTTTGTTTAATCAATTTAATTTGAATTCCAGTTCAAAG

AAATTTT GT CTCT GAAAC AAAAC AAACAAAC AAAT AAAAT AGC AAAAAGTTT AA

AA AGAGA A A A A AGA A AGAGC A AGT GGG A ATTTTTTT GTTTTTT C AATT GGT AT GT

GATATTTACTCCTTCCTTTCACTTTTATTTGTCTATTATATTAATAATACATTTTCA

CTTTT ACTT ATTT ACT AT ACT AAATC AAGAGAAAAAGATTTTTTTTTTT CT AATTT

ACTTTTTTTTTCATTTTACCTTTACCATTAATTACTCATTCCGCAAATTATTTTTCA

AGACTTTTGGAAATAATATTTTTATTATTATGGGTATAATTGCAAAATATATACTT

TACTT ATTTTTTT AAAGGGAGTGCAAAGTCAAAATGGATAACTAAAAGTTAACGG

TGAGATTATATTACAACAACACAACAACAATAAACATATTATAATCTCACAAATA

GGGAAAAAGAGATCAATACGATAACTTCCCAAGGTTAACCTATTCTGGTATTATC

CCCTTAAACACGCTTAACTTTCGAGTTCTGATGAGATCCAATTACCCCAAATTTC

GA AGT A A A A AT A A A A AATT AATT A A A A A A A A A A A A ATT AAAAAGTTT GAT GGT A

GCAAGTGGAGAAT AATT AACCTTTGGAAAGAGCAAAGAGCACGCCTTT AAAT AA

ATAGTAAAGTAGGTAATTAAATATAGCTCAACACCTCCATATATTCCTCGTGCTT AACCCATCAACTAC CCGACCCTACCACGTCTTCTTCCGTGTTTGATTTAAACAGTC ATATATATACATGTGCTCTTAACCCATATATTCATTCAACTTTACTTTCAACATTT GC AACCTT AGAAGAAAGAAGAAGAAT ATTT AGT CTTTTTT GAC AGAAAAAGC AA AATATTTAC AAATGGC : AI ^: A IC

(0188] 1500 bp Jaz7 promoter sequence in the upstream of the coding regions (SEQ ID

NO: 6):

[0189{ CAAACTGTTAACGATCTTGTCAGATATCTCTGAAATCCTGAAGTTGGAG

CTAGTTTTAAGTGAAATAATGGAGAGAGATTTTATGGGTTTGACTCATCAC GTGA

AGCAAGAAGTCATTGAAGAACATATAGATCCAGGTATCATATTGTCTTTTCGTTT

ATGTTTCATGTTTTCTCTTCCTCTTATTTCAAGCTTGAATCTTTAGGCCAGTTACAC

CTTATTAATATTTCTATGATAATATCTCTTTCTGTTTAAATCGTCCCTTTTCCATTT

AATT AGT CT ATTT AGTT GAAGAACTTTTTTT C CTT GC AAACC AGCTATGGAAT C AA

GCCAAATAGTATTCGAAACTTATATGAAGCAGTAAAGATTGGATATCTTGATCTA

TCTCAAGATTTTCGTTTCATTTTTGAAAATTTCCTTCTTCCCCAAACAGAGACGGG

ATAGTTTCCTATTCGTCAAAACAAATTTTTTATTGATTTAATGTAAGTTTAACAGC

TGTATAATTTTATATTAGCAACGTACTGTGGTCC AC GTTGAGTGGGAATACTTCA

AAGGTAAAATTAAATAATGGCTAATAGTATTTGTTTCGGAGTGGGTTGTGCAACC

AT AGGATTT GGCTTTTTC AT A AGTTT GGAT GTTTC GAGGGAGGCTTT GTTT AGACT

TTAGTGTAGTCCATGCACCTTTTTTGAATGCATATTGTGCGTTGGATATACATTAC

TAACGTGCACCTGATAAGCTCTT AT ATT AGTTT ATTTGTGAAGAATAAAATTTAA

AATTTAGATGAGTTGTGGTGCCCCACAAGTCACCTTCTTT AATT AAT ATT AAATTA

TGGTGGTACATCACCAAGAACAAGATTAAAGTAATGAATAAAGTACTTTTGCTCC

CCCCATTAGAATAATGTATTAAAGAAAGCCCAAAGTATGGCTCTATGTATAAACT

TTTAATCTACTTTGACCAGATGGTTTTCCATGTTCTTTACTTCATCTTATGTATTTG

GAAAATACAATATTGTATATTATTATATTGCACATGAGATGCTTAGTAGTTAGCA

GCCTGTATTTTAATTCCAAGAAAGAGAACATGTTCACCCCCTTTTTCAGCTGCAC

CTATGAAGCACTTTGAATTATTTATTTGATCAGATTTTCTTATTATAAGGGAAAAA

AATGT CT GGGAAAAAGC ATAGAGGTT AT GAC AATTT ATAGTTT GGTGGGT C GGC

GTCTCGTCTGTCTTTTCTTAATATATACTTCAAACAATTTACCAGGGTGTTGTTTA

TTATTAGGTAACTACTCAATTGCATTTCTGTATTGGTAGAGTTAAAAGTTGAAGT

AGGTATTTAATTTCTTGTACATCAGAAGCCTGTTTATACACTTAGAAAATATAAT

GCTGGATGCAACTAATTAAGATGGTATCTTCTTCTCTTGTCTTATGTTGCAGCACC

TCTGAGAAGTTCAGCA GAGA, [0.190 j 1500 bp JazlO promoter sequence in the upstream of the coding regions (SEQ ID NO: 7):

10191 J CT C AGGAT A A AGT AGT A A A ATT GAT A AT C C C A AGATT A AT AC A AC AT A

(X AAAACTCAATAAGAAACAATACCATAATAACTAATCTCAGCATAACTTGTCTT

CAAATCAAACGACCCTTTAGAAGTTAAATTAAGCTCCGCTCAGAGTCGACTCGAC

GATGCTGAATTCACAAGC ACG TTATCAACATAGAAAAATAAAAGCAAAAATGAA

ATGCAAATGAGAAAGGAATGTTGCCTACTACTAATAAGGCCGGGTAAGAAAGAG

AGGT AA AAT GACT AGCTT AGTAACTTT ATT C AAT ATAAAAGGTT GGCT C AAT ACC

CTATCCGACTTTAAGTGAAGGGGCGCATCCACCGAAGATGGCAGCGGGAAAGAC

CGGAGCACGAACGAGGTAGCTTATGTTTTTTTCATCCTCACTACCCTAGTTTATAG

TCGAATCTAGAGAATATGAACTTCTCACATTCTTCTTTTTGGTACGTTGTTATGAA

CAACTCTGGTGCTCGATCTTAGGTCTGAGGTATGGGTCGAATCATGATAAAGAAG

GTTCGATGGTTGTATAATGCCCAAGCGGAATGGAAAGGATGATTCATTCGGATCG

ACATAAGAGTCCAACTACATCCATGTTGTATATTTGAAAGAGGTCGACCTCATTA

CTTCTCTCATGGTACACTTCTCTTCCCGCCGAGCCCCTTTTCTCCTTGGTCCACAG

AGACAAAAATGTAGGACCGGTTCCACCCTGATCTCGACATTCAAGCACGAATCC

CTTGAGCGCTTCAGCGACGAATAACAGCATGGGTAAAGCACTCTGCTGCGACGA

GCAGTCGGTTCTTATTGCATTCACCAAGATAGTCTTGCTCGCTCCTGAACTCTGGG

GCGAGTTCAACCACCACCTCCGGGTTTGAGCTTTGCTCGAGCGTAGTGAGCTAAC

TTCGT GACT GT GCTT AGCTT C C AGC ATT GC AAAAAGGAT AAC CTTT C ATT ATCT A

AGCGCTCTCAAAGGAGGGGTCCCACGAACTTCTTCCGCGAAGGTCAAGCCGTAG

TTCGTGTCTTTGGGAGAAGTGGAAGGAGTTACGAGGATGGAGGGCCCTTTGATTG

TAAGTGTTCTTATCTATGAGGGGGGTAAGTGCTAAATCCGATAAGCAGAAGGCCT

CACCGTAATAATAAGATTTGGTAGAATCTACAAATCTCGAATTTTAAGC ACGTGT

TTCCATAGGCACTCTAACGTTCCTACTTTCTGGTCCCCACTGCCGACCACTATCTT

TGAATTCCTCTCCTCCACTATCTTTTCCTTTTCCTATCCCTCCACTTTCCTATAAAA

TATAATATTCAATATTTTATTATTTCCCGAAACAATTAAAACGTGTTTAATGGAA

AGTT GAAAAAGT CT ATT C AAC AGGAAGT GTGAT AGC GAT GGATTTTTC AAAAC A

CCCAAAAAGTTGAGTGTGTAGTAATTTCCTTTATCTACCCTACAACCTTATCGTCT

CTACCATTACATTCACATGTTCCTCCTCTTATTTCCTTTTTTATTTTATTTTTTATTT

TT ATTTT AC AC C AGAAATAAGT AGAGCCTT C ATTTTTCCTTTT CT AGCT C AA AATT

TCTGAATAAACAGAACAACTTGTTCAGTTGTAAAATTGTAGTAGAATTTTTTGGG

[0.1921 1000 bp ODC2 promoter sequence in the upstream of the coding regions (SEQ ID

NO: 8):

101 3] CATGTGCTCTTTTCTTTCTTTATCCCGAGATTTGAAAATAAAATAAATTA

AATTAGAGAAAGAGGCTGGCTAAGCTAAACCAATCATGCACATGCATCTCCATTT

TACT ATT ATT A A AGGT AT GA AT AGATT AGA AT AGT GA A AGAT AC C AC C A AT C GGT

GT GATT GA AT GT A A A A A ATTT C AC CTTT A AT C AGAGATTTT C AC TT C A A ATTTT A A

AAATTGGGTCATCTTTAAGGAGCTCAAAATCCTTCGTAATTGACCTTTTACTATAT

AAATCTGAATATTTAAATTTCGAACAATGAACCGAAAAAAAAAAGAATAGTGAA

AG AGGAGA AGAT GT AAT GA A AGAGGACTTTT A AT AT GATT AGA ATT AT GT A AC A

AGTGAAATTACAAGTACAAGATTACAACTTTAATTATGTAATTTACAAATATAAT

AC AT AT C CT ATTT AAACT AAACT AAGC AATTT AATTTT AAAAGTC AC AAGTT AAA

ATAAAAACACACATTAATTAATATGATTAATGATAGACATTTATTTTTAAAAATA

CTCCGGTGCAAACACAATATACGAGTAATTATATGTGGATTGACTTCCACTGATT

TTTTCTTGATCCTCTAATATGTCGTAGAAAAAATCATGCACCGTTGGATAATATA

GATTT AATT AT C ATTT ACC C AAC AAAAAGT AC ATC ACTT CAT C AGATTT AC AT AA

ATGACTTATTGTAATTAAATTCAATACCATTGACCACCTACCCCTTCAACAGCTAT

TTCTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAGAAAATACTACGTAGAT

TACACAATATTATCAGTAGTAGTATCACTTTTCGTCCCTCTATATAATGATAAACA

TTTTTTGAGGfTTCCCCGrcTCAAAGGGAACAAGAGAAACATTCATATTATTGAA

TCCCTAGTTTCTTTTCTTTCCCTTTGATTCCTTCCTCTCATTTACCTCTCTCTTTTCT

TCCTTTGTTTGG

[0194j 1000 bp PMT2 promoter sequence in the upstream of the coding regions (SEQ ID

NO: 9):

101 5] ATTTGTGGAATTTGGGGCCATTTC AAAGGAAAAAGAAAAGATGACTTA

GCATTAATAAATCAAATTAAAATAAGGCTTAGCGTTAAAATCAAAGGAAATGGC

AAGCCTGGCTCCTGGAGCAATGCTTCTGAGGACAGTAGTAAAAACAATATCAGA

C AAAAAGT AAAGTT GTATT ATTT AGCTT GAGGAT AAAGTAT GT C ATT AGTTTTGT

GAGAGATTTGGTGTCCTCTACAATGATTGTTGAAGTCCCTATTTATAGCTATACA

CAGGAAACAAAATCCTAGGATCAAGCCCCTCTTAAATGACAATAATGGGGTTAA

TGATGAATATGTAGCGGCATGACATGAATGCCAAAATTCTCCGCAACGACTATTT

ATTT AAT ATTGAGGAATATTTTTT ATT AAATACTATCTGGTGAC AAGC ATTCGTTT

GCTTCCGTTGATTACGTTGATTTTGGGATCTACTCTATACCAACCGAAGCCGTTGT

CCTTGATCTTCGCTTTCATTTAATTCATCTTCCGTCTGCCTCCGATTTCACAAGTCA

TGCACCCATTCAATTATTTAATGGAAACCAATTTTACCCTATACAAATGGTACAT CATTCGTCAAATACTTTACTTGGATATAAACAATTTTGCCCGAGGAGTAAACAGA

TGCGAAGAAAGAAAGCAGACGATTAAAGAAATTTTTAAAAAAGGAGAGAGAAA

TGAACACACACATGTACTAATAAAATTAGGGTACTACTTTACTAATAATTGGACA

GAGACTAAATTCATATTTTAGTTCCAAAATGTCTCGGGCAGTCCAACCATGCACG

TTGTAATGATTTTTTAACTCTATTATATCGAGTTGCGCCCTCCACTCCTCGGTGTC

CAAATTGTATATAAATGCATATGTGTCTATTGGGAGTGTACATCAAGCTTTCATA

AAGTACAAATCGTAATACTTGTTGAAACATAATACTTTCTCTTCTCCAATTTGTTT

AG ΊΊ TAATTTTGAAA A

:

[0196] Coding nucleotide sequence of NtJAZl (SEQ ID NO: 10):

[0197 f ATGGGGTCATCGGAGATTGTAGATTCCGGCAAGGTCTCCGGCC AGAAG

TCTCAGTTTTCTCAAACTTGTAATCTTTCGAGCCAATTCTTGAAGAAAAAAGGTTC

TTTTGGAGATCTCAATAATCTTGGTATCTACCGCAGTTTTGAACCAACTGGAAAC

CAAACAACTACAACTACTATGAATTTATTGCCAATGATTGAAAAATCAGGTGATT

CAGCTGAGAAAAATTCTCAAAAGCCAATGAATCTTTTTCCTCAAGAAGTTATTTC

TACTGCAAAATCTGAACCAGAAAAGGCACAAATGACTATATTTTATGGTGGTCA

AGTT ATT GT ATTT GAT GATTTT C C AGC AGAT A A AGC AA AT GA A AT CAT GA AATT G

GCTACCAAGAAAACCAACAACAAACAGAATTTGGCTAGTAACATATTTTCTTATC

CT AT GGT AAAT AATC AAAATT C AGCT GAAT CT GTTACTAC C AATTTTT CT C AAGA

ACTTCGTACGCGAACTCACGTGCCAATATCACAATCCAGTGTTGCTGATTTACCA

ATT GCGAGACGAAATT C ACTT AC AAGATTTTT GGAGAAAAGAAAAGAT AGAATT

ACTTCAACTGCACCATATCAGATTTGCAACAAAAAAATAGCAGATTCTAAGAAT

GAGGAAAATAAGGCATGGCTTGGATTAGGTGCAAAGTTTGTTCCAGTGAAAACT

GAGCAGTTCTTTTAG

[0198] Coding nucleotide sequence of NtJAZ3 (SEQ ID NO: 11):

|0199] ATGGCATCATCGGAGATTGTGGATTCCGGTCGATTCGCCGCCGCCGCAG

CCGGTGGTCAGAAATCAAATTTCTCACAGACATGTAATTTGTTGAGCCAATACTT

GAAAGAGAAGAAAGGTTCCTTTGGAGATCTCAGCCTTGGTATCCACCGCGCCGG

C ACT ACT ACT AT GGATTT ATT GCC AAT GATT GAGAAATTTGGT GAGT C A AACC CT

CAGAAATCAATGAATCTGTTTCCTCAAACTGAGGCAAAATCTGAACCGGAGAAA

GCACAGATGACGATATTCTACGGCGGTCAAGTTATTGTGTTTAACGATTTTCCGG

CAGATAAAGCTAAGGAAATCATGCTTATGGCTAGTTGTACCCAAGGAAACAACA

ACTGTGCTACTCAGATTCAAAAAACAGCTGAATCTGCTTCAGATTTGGTACCTCA

GCCTATTATTTCTGGAGATTTACCAATCGCGAGACGAGCTTCACTTACTAGGTTTT

TAGAGAAAAGAAAAGATAGGCTGACTGCAAAAGCACCGTACCAATTAAGCAAC ACAAATAAACAAGCAGCAGTTTCTGAAAACAAGGTGTGGCTTGGATTGGGTGCT

C AATTTCC AGT GAAAGCT GAGC AATT CT AG

[O20Q] Coding nucleotide sequence of NtJAZV (SEQ ID NO: 12):

|0201] ATGAT GCTTGAAAAGC AAGGAAT AACGAACT AT AC AAT GAC AACTT AC

CCTCCACATAAAATTGGTACAAATTCAGTTCAGCAATCTCATGAAGTCAGAGTAC

TCCCAGTTGCTAATCAAACACATCAGATTTCTGTATCTACGAGCAATATGCATGG

TCGTCAGCCCTTAATTTCTTCTGCTGGACAGAATTTGATTTCTATAGTAAATCAAA

ATCCTGCTAAAGGAGCCCAAATAACAAGCCCCATTTCCATTCTTCCGACTCGCAA

TGGTGTTGTGGGCACTACTGAATTGAGGGGTGCTCCCAAGACTTCAGCTGGACCT

GCTCAGCTAACCATCTTTTATGCTGGTTCAGTCAGTGTTTACGACAATATTTCTCC

AGAGAAGGCTCAAGCTATCATGTTACTTGCTGGAAATACACCTACTGTTACTCCA

AGTACAACATCTACTACATCTCCAGTTCAGGAAATTCCTAAATCTCCTTCTGTTGA

TGCTTTTGTTGTAAACAAATGCCATAGTACTACATCGCCTAGTTTTTCCAGCCCCA

TTTCTATAACCTCACACGGCGTCTCTCAGTCTATTGGAGTACTGTCTAATAATACG

AATCAAATAACTATGAGTATCAGGTCAATCGGAGTCCTGACTAATTCTCCCTCTA

ACAAAATGGAGCCATCCAATGTTGTCCATTCTCAAGAATCTCATCCTCTTAGCCA

TACATTATCAGCTGTGCCTCAGGCTCGCAAAGCATCCTTAGTTCGGTTCTTGGAG

AAGCGCAAGGAAAGGGTACTGAGTGCATCACCATACGACAATAGCAAGCAAACT

TCACAATATAACACACCTGGATCTGGCAGCTGGAGCTTCTTTGCCAACTCTACAG

GATCCAGTACTGTTCTTCCTGCTACCAATTAG

[0202] Coding nucleotide sequence of NtJAZlO (SEQ ID NO: 13):

[0203 [ ATGTC AAATTCGC AAAATTCTTTTGACGGCGGC AGAAGAC ACGGC AAG

GC GC C GGAGAGAT C GA ATTT C GT GC AGACTT GT A ATTT ATT GAGT C AGTTT ATT A

AAGGAAAAGCTACTATTAGAGATCTGAATCTCGGAATAGCTGGAAAATCTGAAA

TCTCAGGTAAAAGTGATGTTACAGAAGCTGCAACTATGGATTTATTGACAATTAT

GGAAAAACCCTCTATTGAAAGTAAAGAACAAGAACAAAAATCCATAGATCCCGT

TCGTCAGAGTGCTGCAACAGAATCTTCTAGACATATGGAGGTGGCCGTAAATCA

GCCCAGCACGAGCAAAGAGGCACCAAAGGAGCCTAAGGCAGCACAATTGACTA

TGTTCTATGATGGTAAAGTGATCGTATTTGATGACTTTCCAGCAGACAAAGCTAG

AGCAGTAATGTTATTGGCTAGTAAAGGATGTCCTCAGAGTTCATTTGGCACTTTT

CATACTACAACCATCGACAAAATTAACACATCTGCTGCTGCCACTGCTTCTTTGA

CATGTAATAAAACTGATCAGCTTAAACCAAGTACAGTTTCTATTGCACCACAACA

ACAAAAGCAGCAGCAACTTCATGTTTCGTACAGTAAAAATGACCAGCTTAAGCC

AGGGTCCAGTTCTGCTGCACCGCAAGTACAGCACCAGCAGCTAGTCCATGTTTCT AGTACTAGTAAAACTGATCAGCTTAAGCCAGGATCAACTTCTTCTGCGTCGCAAA

AACAGCAGGAGCAACATCAGCAAACGCAGTCACAGACACCTGGAACTAGCAGCT

CTGAGCTACCTATTGCAAGAAGATCATCACTACATAGGTTTCTTGAGAAGAGGAA

AGATAGGGCAACGGCTAGAGCGCCATACCAAGTTGTACATAATAATCCGTTACC

ATCATCTTCAAATAATAATGGGGAATCATCTTCCAAGGATTGCGAAGATCAACTC

GATCTCAATTTCAAGTTATAG

[0204j Additional sequences referred to in the present disclosure and/or used in accordance with the various embodiments of the present disclosure include the following (see, also, the electronic sequence listing provided with this disclosure).

[0205] Table 10: Sequences.

Claims

CLAIMS What is claimed is:

1. An isolated polynucleotide comprising: a first nucleic acid molecule comprising a sequence encoding a Production of Anthocyanin Pigment 1 (PAP1) polypeptide or a fragment thereof, the first nucleic acid molecule operably linked to a heterologous promoter; and a second nucleic acid molecule comprising a sequence encoding a Transparent Testa 8 (TT8) or a fragment thereof, the second nucleic acid molecule operably linked to a heterologous promoter; wherein the first and second nucleic acid molecules are capable of being expressed in a plant cell.

2. The polynucleotide of claim 1, further comprising at least one additional nucleic acid molecule selected from the group consisting of:

(i) a nucleic acid molecule comprising a sequence encoding aNicotiana tabacum JAZ1 (NtJAZl) polypeptide or a fragment thereof, operably linked to a heterologous promoter;

(ii) a nucleic acid molecule comprising a sequence encoding a Nicotiana tabacum JAZ3 (NtJAZ3) polypeptide or a fragment thereof, operably linked to a heterologous promoter;

(iii) a nucleic acid molecule comprising a sequence encoding aNicotiana tabacum JAZ7 (NtJAZ7) polypeptide or a fragment thereof, operably linked to a heterologous promoter; and

(iv) a nucleic acid molecule comprising a sequence encoding aNicotiana tabacum JAZ10 (NtJAZIO) polypeptide or a fragment thereof, operably linked to a heterologous promoter.

3. The polynucleotide of claim 1 or claim 2, wherein the first nucleic acid molecule comprises a sequence that is at least 70% identical to SEQ ID NO: 1.

4. The polynucleotide of any of claims 1 to 3, wherein the second nucleic acid molecule comprises a sequence that is at least 70% identical to SEQ ID NO: 2.

5. The polynucleotide of any of claims 1 to 4, wherein the polynucleotide comprises a sequence that is at least 70% identical to SEQ ID NO: 3.

6. The polypeptide of any of claims 1 to 5, wherein the PAP1 polypeptide or fragment thereof is exogenous.

7. The polypeptide of any of claims 1 to 6, wherein the TT8 polypeptide or fragment thereof is exogenous.

8. The polynucleotide of any of claims 1 to 7, wherein the PAP1 polypeptide or fragment thereof is from a flowering plant.

9. The polynucleotide of any of claims 1 to 8, wherein the PAP1 polypeptide or fragment thereof is from Arabidopsis .

10. The polynucleotide of any of claims 1 to 9, wherein the TT8 polypeptide or fragment thereof is from a flowering plant.

11. The polynucleotide of any of claims 1 to 10, wherein the TT8 polypeptide or fragment thereof is from an Arabidopsi .

12. The polypeptide of any of claims 1 to 11, wherein the plant cell is a crop plant selected from the group consisting of rice, maize, wheat, barley, peanut, potato, sesame, olive tree, palm oil, banana, soybean, sunflower, canola, sugarcane, alfalfa, millet, leguminosae (bean, pea), flax, lupinus, rapeseed, tobacco, poplar, cotton, alfalfa, barrel medic, and white clover.

13. The polynucleotide of any of claims 1 to 12, further comprising a regulatory sequence or regulatory element.

14. The polynucleotide of any of claims 1 to 13, wherein the heterologous promoter operably linked to the first nucleic acid molecule confers constitutive expression of PAP 1.

15. The polynucleotide of any of claims 1 to 14, wherein the heterologous promoter operably linked to the first nucleic acid molecule confers conditional expression of PAP 1.

16. The polynucleotide of any of claims 1 to 15, wherein the heterologous promoter operably linked to the second nucleic acid molecule confers constitutive expression of TT8.

17. The polynucleotide of any of claims 1 to 16, wherein the heterologous promoter operably linked to the second nucleic acid molecule confers conditional expression of TT8.

18. The polynucleotide of any of claims 1 to 17, wherein the polynucleotide is stably integrated into the genome of the plant cell.

19. The polynucleotide of any of claims 1 to 18, wherein the polynucleotide is transiently transformed into the plant cell.

20. The polynucleotide of any of claims 1 to 19, wherein the polynucleotide comprises at least a third nucleic acid molecule comprising a sequence encoding a polypeptide or a fragment thereof, the third nucleic acid molecule operably linked to a heterologous promoter.

21. The polynucleotide of any of claims 1 to 20, wherein the third nucleic acid molecule comprises a sequence encoding a TTG1 (WD40) polypeptide or fragment or homolog thereof.

22. A vector or construct comprising the polynucleotide of any of claims 1 to 21.

23. A transgenic plant transformed with the polynucleotide of any of claims 1 to 21, wherein the polynucleotide is stably integrated into the genome of the transgenic plant.

24. The transgenic plant of claim 23, wherein the transgenic plant is a tobacco plant, plant variety, or cultivar.

25. The transgenic plant of claim 24, wherein the transgenic plant is a red tobacco variety, a dark tobacco varieties, a transgenic tobacco variety, a dark tobacco variety, an Oriental tobacco variety, a Flue-cured tobacco plant or variety, and a Burley tobacco plant or variety.

26. The transgenic plant of any of claims 23 to 25, wherein at least one tissue of the plant comprises reduced levels of at least one of nicotine, nomicotine, anabasine, anatabine, myosine, and tobacco specific nitrosamines (TSNAs).

27. The transgenic plant of any of claims 23 to 26, wherein at least one tissue of the plant comprises a level of tobacco alkaloid-derived nitrosamine that is not greater than 0.5 ppm.

28. The transgenic plant of any of claims 23 to 27, wherein at least one tissue of the plant comprises a level of nicotine that is reduced by at least 15%.

29. The transgenic plant of any of claims 23 to 28, wherein at least one tissue of the plant comprises a level of nomicotine that is reduced by at least 30%.

30. The transgenic plant of any of claims 23 to 29, wherein at least one tissue of the plant comprises a level of anabasine that is reduced by at least 25%.

31. The transgenic plant of any of claims 23 to 30, wherein at least one tissue of the plant comprises a level of anatabine that is reduced by at least 30%.

32. The transgenic plant of any of claims 23 to 31, wherein at least one tissue of the plant comprises a level of myosine that is reduced by at least 15%.

33. The transgenic plant of any of claims 23 to 32, wherein at least one tissue of the plant comprises a level of total alkaloids that is reduced by at least 20%.

34. The transgenic plant of any of claims 23 to 34, wherein at least one tissue of the plant comprises a level of nicotine-derived nitrosamine ketone (NNK) that is reduced by at least 40%.

35. The transgenic plant of any of claims 23 to 34, wherein at least one tissue of the plant comprises a level of N-nitrosonomicotine (NNN) that is reduced by at least 55%.

36. The transgenic plant of any of claims 23 to 35, wherein at least one tissue of the plant comprises a level of N’-nitrosoanatabine (NAT) that is reduced by at least 70%.

37. The transgenic plant of any of claims 23 to 36, wherein at least one tissue of the plant comprises a level of N-nitrosoanabasine (NAB) that is reduced by at least 60%.

38. The transgenic plant of any of claims 23 to 37, wherein at least one tissue of the plant comprises a level of total TSNAs not greater than 3.5 ppm.

39. The transgenic plant of any of claims 23 to 38, wherein at least one tissue of the plant comprises an increased level of anthocyanin.

40. The transgenic plant of any of claims 23 to 39, wherein roots of the plant comprise an increased level of flavan-3-ols and/or proanthocyanidins.

41. The transgenic plant of any of claims 23 to 40, wherein at least one tissue of the plant comprises decreased expression of at least one of ODC2, PMT1, PMT2, MPO, QPT2, A622, BBL, and ERF189.

42. The transgenic plant of any of claims 23 to 41, wherein at least one tissue of the plant comprises increased expression of at least one of CHS, CHI, F3H, F3 Ή 3GT, DFR, ANS and ANR.

43. The transgenic plant of any of claims 23 to 42, wherein at least one tissue of the plant comprises increased expression of at least one of NtJAZl, NtJAZ3, NtJAZ7, and NtJAZlO.

44. A method of enhancing at least one property of a tobacco plant comprising transforming the tobacco plant with the isolated polynucleotide of any of claims 1 to 21.

45. The method of claim 44, wherein the at least one property of the tobacco plant comprises: a decreased level of at least one of nicotine, nomicotine, anabasine, anatabine, myosine, NNN, NNK, NAT, NAB, total tobacco alkaloids, and/or total tobacco specific nitrosamines (TSNAs); an increased level of anthocyanin; and/or an increased level of flavan-3-ols and proanthocyanidins.