WO2021115011A1 - Method for preparing n-acetylgalactosamine transferase - Google Patents

Abstract

Disclosed is a prokaryotic expression system for expressing N-acetylgalactosamine transferase and a prokaryotic expression vector for expressing N-acetylgalactosamine transferase. The prokaryotic expression vector comprises a ppGalNAc-T protein expression cassette and a PDI protein expression cassette. The prokaryotic expression vector and the prokaryotic expression system for expressing N-acetylgalactosamine transferase use a co-expression single plasmid as well as a host cell having an intracellular oxidizing environment and perform the expression via a conventional general culture medium. Follow-up operations such as refolding are not required in the prokaryotic expression system and an operation method thereof.

Description

A method for preparing N-acetylgalactosamine transferase Technical field

The present invention relates to the field of biotechnology, in particular to a prokaryotic expression system for expressing N-acetylgalactosamine transferase, and further provides preparation by the above-mentioned prokaryotic expression system for expressing N-acetylgalactosamine transferase N-acetylgalactosamine transferase method.

Background technique

Glycosylation modification is an important form of protein post-translational modification. It not only participates in protein shear processing, cell proliferation and differentiation, immune inflammation and other processes, but also has an important impact on recombinant protein drugs. About 70% of recombinant protein drugs have glycosylation modification in their natural state, and N-sugar chains and O-sugar chains are the most common in protein drugs. The lack of glycosylation modification will cause the half-life of these protein drugs in the body to be shortened or the drug effect is reduced. For example, human interferon gamma lacking N-glycosylation modification will be degraded by proteases, resulting in a shortened half-life; ovulation-stimulating drugs Corifollitropin alfa (FSH) Lack of N-glycosylation can lead to heat denaturation and lower potency; O-glycosylation in breast milk protein is beneficial to the health of breastfed infants. This kind of human milk oligosaccharides (HMOs) can not only help The brain provides nutrients and can also regulate intestinal microbes and induce immune cell responses.

There are currently three methods for sugar chain synthesis: 1. Separation and purification from natural products; 2. Synthesis using chemical synthesis; 3. Synthesis using glycosyltransferase catalysis. Glycosyltransferase used for enzymatic synthesis of sugar chains not only has good specificity, and the purity of the obtained sugar chains is extremely high, but in vitro enzymatic synthesis of N-sugar chains and O-GalNAc sugar chains requires a large amount of glycosyltransferase. So far, in addition to the ppGalNAc-T glycosyltransferase that synthesizes O-GalNAc sugar chains, most human-derived glycosyltransferases can be replaced by isoenzymes derived from bacteria or yeast, such as mannosyltransferase Alg1, Alg2, Alg3, Alg9; N-acetylglucosamine transferase β3GNT; Sialyltransferase ST3Gal1; Galactosyltransferase B4GalT1. Glycosyltransferases or glycosidases derived from bacteria or other species can be used not only for the synthesis of human N-sugar chains and O-GalNAc sugar chains, but also for the development of glycosylation tool enzymes. In 2019, Hong, S. and others modified fucosyltransferase derived from bacteria and developed a technology for editing cell surface sugar chains. This technology can be used for the synthesis and labeling of sugar chains on the surface of cells, and the labeled sugar chains on the surface of tumor cells can be specifically recognized by monoclonal antibodies for targeted tumor therapy. As the isozyme of ppGalNAc-T enzyme has not been found in bacteria or yeast so far, ppGalNAc-T enzyme has become the rate-limiting factor for the rapid synthesis of protein initial O-GalNAc glycosylation in vitro and the large-scale production of O-GalNAc sugar chains. , The development and preparation of ppGalNAc-T enzyme with stable activity and high yield is of great significance to fill the technical defects of protein O-sugar chain synthesis and the subsequent use of enzyme engineering to improve the production of glycosylation tool enzymes. At present, the ppGalNAc-T enzyme is mainly obtained through eukaryotic expression and purification systems, such as human-derived model cells HEK293, insect cells SF9, SF21. In 2002, Guo, J.M. et al. used insect cells Sf21 to express and purify the active ppGalNAc-T12 enzyme. In 2003, Zhang, Y. et al. used Sf21 cells to express and purify the active ppGalNAc-T13 enzyme. The advantage of using the eukaryotic expression purification system to obtain the ppGalNAc-T enzyme is that the purified glycosyltransferase retains the original post-translational modification and does not require codon optimization. However, the disadvantage is that the secretion is low, the cost of expression cell culture is high, and the mass production of glycosyltransferase cannot be realized. Therefore, a low-cost, high-efficiency, and large-scale prokaryotic expression system for the production of active ppGalNAc-T enzyme is established. For the subsequent application of ppGalNAc-T enzyme to the production of recombinant protein drugs, the level of O-GalNAc glycosylation is controlled and the potency of recombinant protein drugs is improved. , And the development of glycosylation tool enzymes are of great significance.

The expression of eukaryotic proteins in prokaryotic systems usually results in misfolding, formation of inclusion bodies, and insolubility of the expressed protein due to differences in species codons and differences in protein maturation systems. This phenomenon also exists in the ppGalNAc-T enzyme expressed in Escherichia coli. Therefore, mass production of ppGalNAc-T enzyme with enzymatic activity in bacteria has defects in technical feasibility. S. Saribas et al. used an in vitro refolding method to obtain active ppGalNAc-T2, but this method is complicated to operate and the steps are cumbersome, and it is impossible to directly obtain soluble and highly active ppGalNAc-T2 enzyme from E. coli. (CN 101151367A). In 2015, Jennifer Lauber et al. first expressed the active ppGalNAc-T enzyme in bacteria. The system uses two co-expression plasmids composed of polycistrons, expressing three molecular chaperones and ppGalNAc-T2 enzyme successively, using EnPresso Medium B produces ppGalNAc-T2 enzyme in Shuffle T7 host strain. The disadvantage of this system is that the expression system is complex and multiple expression plasmids are used; the medium composition is complicated, the raw material is expensive, and the overall yield is low.

Summary of the invention

In view of the above-mentioned shortcomings of the prior art, the purpose of the present invention is to provide a prokaryotic expression system for the expression of N-acetylgalactosamine transferase, and further provide a method for expressing N-acetylgalactosamine transferase. The method for preparing N-acetylgalactosamine transferase by the prokaryotic expression system of the enzyme is used to solve the problems in the prior art.

In order to achieve the above and other related purposes, one aspect of the present invention provides a prokaryotic expression vector for expressing N-acetylgalactosamine transferase. The expression vector includes a ppGalNAc-T protein expression cassette and a PDI protein expression cassette.

In some embodiments of the present invention, the ppGalNAc-T protein is of human origin.

In some embodiments of the present invention, the ppGalNAc-T protein is selected from ppGalNAc-T1 protein, ppGalNAc-T2 protein, ppGalNAc-T3 protein, ppGalNAc-T4 protein, ppGalNAc-T5 protein, ppGalNAc-T6 protein, ppGalNAc-T7 protein , PpGalNAc-T8 protein, ppGalNAc-T9 protein, ppGalNAc-T10 protein, ppGalNAc-T11 protein, ppGalNAc-T12 protein, ppGalNAc-T13 protein, ppGalNAc-T14 protein, ppGalNAc-T15 protein, ppGalNAc-T16 protein, TppGalNAc protein , PpGalNAc-T18 protein, ppGalNAc-T19 protein, ppGalNAc-T20 protein.

In some embodiments of the present invention, the amino acid sequence of the ppGalNAc-T protein includes the sequence shown in SEQ ID NO:2.

In some embodiments of the invention, the PDI protein is of human origin.

In some embodiments of the present invention, the amino acid sequence of the PDI protein includes the sequence shown in SEQ ID NO:4.

In some embodiments of the present invention, the expression vector further includes a Mistic protein expression cassette, and the Mistic is derived from Bacillus subtilis.

In some embodiments of the present invention, the amino acid sequence of the Mistic protein includes the sequence shown in SEQ ID NO:6.

In some embodiments of the present invention, the ppGalNAc-T protein expression cassette and/or PDI protein expression cassette and/or Mistic protein expression cassette include the same promoter.

In some embodiments of the present invention, the expression vector is a multi-gene co-expression vector.

In some embodiments of the present invention, the expression vector is constructed by pRSFDuet-1 vector.

Another aspect of the present invention provides a prokaryotic expression system for expressing N-acetylgalactosamine transferase, the expression system including the above-mentioned prokaryotic expression vector.

In some embodiments of the present invention, the host cell of the prokaryotic expression system is selected from strains with an intracellular oxidizing environment.

In some embodiments of the present invention, the host cell of the prokaryotic expression system is selected from Escherichia coli, preferably selected from Rosetta-gami2.

Another aspect of the present invention provides a method for preparing N-acetylgalactosamine transferase, which includes the following steps: culturing the prokaryotic expression system described above, thereby expressing N-acetylgalactosamine transferase, and purifying and isolating the N-acetylgalactosamine transferase. -Acetylgalactosamine transferase.

Description of the drawings

Figure 1A shows a schematic diagram of the catalytic form of the ppGalNAc-T enzyme.

Figure 1B shows a schematic diagram of structural analysis of human ppGalNAc-T2 protein (RefSeq Accession Number: Q10471).

Figure 1C shows a schematic diagram of the structure analysis of human PDI protein (RefSeq Accession Number: P07237).

Figure 1D shows a schematic diagram of the plasmid construction strategy of Example 1 of the present invention.

Figure 1E shows a schematic diagram of the plasmid construction strategy of Example 1 of the present invention.

Figure 2A shows a schematic diagram of gel electrophoresis results after double digestion of pRSFDuet-1 plasmid and double digestion of PDI target fragment.

Figure 2B shows a schematic diagram of the gel electrophoresis result of ligating the PDI fragment into the pRSFDuet-1 plasmid after double digestion with the above endonuclease, the Mistic target fragment and the Recombinant ppGalNAc-T2 target fragment.

Figure 2C shows a schematic diagram of the gel electrophoresis result of the Recombinant ppGalNAc-T2 target fragment after double digestion.

Figure 2D shows a schematic diagram of the gel electrophoresis result of ligating the PDI fragment into the pRSFDuet-1 plasmid after double digestion with the above endonuclease, and the Full Length ppGalNAc-T2 target fragment after double digestion.

Figure 2E shows a schematic diagram of the gel electrophoresis result after the connection of the Mistic target fragment and the Full Length ppGalNAc-T2 target fragment.

Figure 3A shows a schematic diagram of the result of Coomassie Brilliant Blue staining in Example 2 of the present invention.

FIG. 3B shows a schematic diagram of the Western Blot result of Example 2 of the present invention.

Figure 4A shows a schematic diagram of the results of Coomassie Brilliant Blue staining and Western Blot in Example 3 of the present invention.

4B shows a schematic diagram of the results of Coomassie Brilliant Blue staining and Western Blot in Example 3 of the present invention.

FIG. 5A shows a schematic diagram of the Western Blot result of Example 4 of the present invention.

Figure 5B shows a schematic diagram of the results of Coomassie Brilliant Blue staining in Example 4 of the present invention.

Fig. 6 is a schematic diagram showing the HPLC spectrum before and after the enzyme activity reaction of the O-glycopeptide of each polypeptide in Example 5 of the present invention.

Figure 7 shows a schematic diagram of the mass spectrometry detection results of the Muc5AC and APP polypeptides modified by O-glycosylation in Example 5 of the present invention.

Figure 8 is a schematic diagram showing the results of detection of lectin imprints in Example 6 of the present invention.

Detailed ways

In order to make the purpose, technical solutions, and beneficial technical effects of the present invention clearer, the present invention will be further described in detail below in conjunction with embodiments. Those familiar with this technology can easily understand the other advantages and advantages of the present invention from the content disclosed in this specification. effect.

After extensive research, the inventors of the present invention provided a simpler prokaryotic expression vector and expression system for expressing N-acetylgalactosamine transferase. The expression vector and expression system can use a universal medium and pass through After expression and purification, a large number of ppGalNAc-T enzymes with enzymatic activity can be obtained, and subsequent in vitro protein initial O-GalNAc glycosylation and synthesis of O-glyco-modified glycopeptides/glycoproteins can be quickly performed in vitro. On this basis, the present invention has been completed. .

The first aspect of the present invention provides a prokaryotic expression vector for expressing N-acetylgalactosamine transferase. The expression vector includes a ppGalNAc-T protein expression cassette and a PDI protein expression cassette. The inventors of the present invention found that the expression of ppGalNAc-T enzyme in a prokaryotic expression system often causes misfolding or expression in inclusion bodies, etc., while in a single prokaryotic expression plasmid of ppGalNAc-T enzyme, human PDI (Protein Disulfide Isomerase (protein disulfide bond isomerase) can help the formation of protein disulfide bond isomerization. It not only helps the protein to fold correctly in E. coli, but also promotes protein solubility, and solves the problem of protein expression in inclusion bodies.

In the prokaryotic expression vector for expressing N-acetylgalactosamine transferase provided by the present invention, the ppGalNAc-T protein is usually of human origin, and preferably may be a recombinant ppGalNAc-T protein, so that it can be suitable for prokaryotic expression system. The ppGalNAc-T protein may be selected from various members of its enzyme family (for example, ppGalNAc-T protein family), for example, the ppGalNAc-T protein may be ppGalNAc-T1 protein, ppGalNAc-T2 protein, ppGalNAc-T3 protein, ppGalNAc-T4 protein, ppGalNAc-T5 protein, ppGalNAc-T6 protein, ppGalNAc-T7 protein, ppGalNAc-T8 protein, ppGalNAc-T9 protein, ppGalNAc-T10 protein, ppGalNAc-T11 protein, ppGalNAc-T12 protein, TppGal ppGalNAc-T14 protein, ppGalNAc-T15 protein, ppGalNAc-T16 protein, ppGalNAc-T17 protein, ppGalNAc-T18 protein, ppGalNAc-T19 protein, or ppGalNAc-T20 protein, etc. In a specific embodiment of the present invention, the ppGalNAc-T protein may be ppGalNAc-T2 protein. In another specific embodiment of the present invention, the amino acid sequence of the ppGalNAc-T protein includes the sequence shown in SEQ ID NO: 2. In another specific embodiment of the present invention, the nucleic acid coding sequence of the ppGalNAc-T protein includes the sequence shown in SEQ ID NO:1.

In the prokaryotic expression vector for expressing N-acetylgalactosamine transferase provided by the present invention, the PDI protein is of human origin, preferably a recombinant PDI protein, so that it can be applied to a prokaryotic expression system. In another specific embodiment of the present invention, the amino acid sequence of the PDI protein includes the sequence shown in SEQ ID NO:4. In another specific embodiment of the present invention, the nucleic acid coding sequence of the PDI protein includes the sequence shown in SEQ ID NO: 3.

In the prokaryotic expression vector for expressing N-acetylgalactosamine transferase provided by the present invention, the expression vector may also include a Mistic protein expression cassette. The inventors of the present invention found that the simultaneous co-expression of Mistic protein in a single prokaryotic expression plasmid of ppGalNAc-T enzyme can improve the solubility of the protein. Specifically, it can help the transmembrane protein to insert into the E. coli cell membrane, thereby achieving protein solubility. Solve the difficulty of protein expression in inclusion bodies. The Mistic protein is usually derived from Bacillus subtilis. In another specific embodiment of the present invention, the amino acid sequence of the Mistic protein is shown in SEQ ID NO: 6. In another specific embodiment of the present invention, the coding sequence of the Mistic protein includes the sequence shown in SEQ ID NO: 5.

In the prokaryotic expression vector for expressing N-acetylgalactosamine transferase provided by the present invention, the expression vector is usually a prokaryotic expression vector, more specifically, it can be a bacterial expression vector, preferably an E. coli expression vector. The expression vector is usually a multi-gene co-expression vector, that is, each protein expression cassette (for example, ppGalNAc-T protein expression cassette and/or PDI protein expression cassette and/or Mistic protein expression cassette) can all be located in a single expression vector. In a specific embodiment of the present invention, the expression vector is constructed by pRSFDuet-1 vector.

In the prokaryotic expression vector for expressing N-acetylgalactosamine transferase provided by the present invention, the ppGalNAc-T protein expression cassette and/or the PDI protein expression cassette and/or the Mistic protein expression cassette may each include a promoter respectively , Multiple protein expression cassettes can also share a promoter. In a specific embodiment of the present invention, both the ppGalNAc-T protein expression cassette and the PDI protein expression cassette may include a promoter, and ppGalNAc-T may be regulated by the promoters in the ppGalNAc-T protein expression cassette and the PDI protein expression cassette respectively. Protein and PDI protein expression. In another specific embodiment of the present invention, the expression vector includes a Mistic protein expression cassette and a ppGalNAc-T protein expression cassette that are sequentially connected, and the Mistic protein expression cassette may include a first promoter, so that it can be expressed by Mistic protein. The promoter in the frame simultaneously regulates the expression of the Mistic protein and the ppGalNAc-T protein, the PDI protein expression frame may include a second promoter, and the promoter in the PDI protein expression frame may regulate the expression of the PDI protein.

In the prokaryotic expression vector for expressing N-acetylgalactosamine transferase provided by the present invention, when multiple promoters are included in the expression vector, these promoters can be the same, which can be induced by a single condition Simultaneous expression of ppGalNAc-T protein and/or PDI protein and/or Mistic protein, for example, the ppGalNAc-T protein expression cassette and/or PDI protein expression cassette and/or Mistic protein expression cassette include the same promoter. Those skilled in the art can adjust the selection of the promoter in the expression vector. For example, the promoter can be T7promoter, Sp6promoter, trp promoter, etc.

The second aspect of the present invention provides a prokaryotic expression system for expressing N-acetylgalactosamine transferase, which includes the prokaryotic expression vector provided in the first aspect of the present invention. The host cell of the prokaryotic expression system may generally be a bacterial cell, more specifically an E. coli cell, and a strain with an intracellular oxidizing environment is required. In a specific embodiment of the present invention, the host cell of the prokaryotic expression system may be Rosetta-gami2. The Rosetta-gami 2 host strain combines the advantages of Rosetta 2 and Origami 2 strains. The intracellular thioredoxin reductase trxB and glutathione reductase gor genes have been mutated. When the heterologous protein is expressed in E. coli , Can alleviate codon preference and enhance the formation of disulfide bonds in the cytoplasm. The Rosetta-gami 2 host strain also carries a chloramphenicol-resistant pRARE2 plasmid, which can provide 7 rare tRNAs and can increase the expression level of proteins containing rare codons.

The third aspect of the present invention provides a preparation method of N-acetylgalactosamine transferase, including the following steps: cultivating the prokaryotic expression system provided by the second aspect of the present invention, thereby expressing N-acetylgalactosamine transferase, and purifying The N-acetylgalactosamine transferase is isolated. In the preparation method, it is necessary to select a suitable medium and culture under conditions suitable for the growth of the host cell. When the host cell grows to a suitable cell density, use a suitable method (such as temperature conversion or chemical induction) to induce selection Promoter, culture the cells for a period of time. The N-acetylgalactosamine transferase in the above method can be expressed in the cell, on the cell membrane, or secreted out of the cell. In a specific embodiment of the present invention, a universal medium can be used to induce expression of the prokaryotic expression system, and the applicable universal medium can be TB medium, LB medium, and the like. In a specific embodiment of the present invention, IPTG can be used to induce expression in the prokaryotic expression system, the time for inducing expression can be 4-24h, 4-8h, 8-12h, or 12-24h, and the concentration of inducing expression can be 0.01 ~1mM, 0.01~0.05mM, 0.05~0.1mM, 0.1~0.2mM, 0.2~0.4mM, 0.4~0.6mM, 0.6~0.8mM, or 0.8~1mM. If necessary, the physical, chemical, and other characteristics can be used to separate and purify the recombinant protein through various separation methods. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with protein precipitation agent (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultra-centrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

The prokaryotic expression vector and prokaryotic expression system for expressing N-acetylgalactosamine transferase provided by the present invention use a single plasmid for co-expression and a host cell with an intracellular oxidizing environment, and express through a conventional general medium. The system and operation method are simple, one-step expression and purification, no subsequent operations such as refolding, and the yield of ppGalNAc-T2 enzyme obtained is better than that of human-derived HEK 293T cell line expressing and purified ppGalNAc-T2 enzyme. In addition, the ppGalNAc-T2 enzyme obtained by the expression of this system has good activity. It reacts completely to EA2 polypeptide in 15 minutes, and to Muc5AC polypeptide in 60 minutes. It can react 69.2% to APP-peptide2 in 2 hours. APP-peptide3 can react 24.2% in 2 hours.

The following examples further illustrate the invention of the present application, but they do not limit the scope of the present application.

Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related fields in the technical field. Conventional technology. These technologies have been fully explained in the existing literature. For details, see Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel, etc., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHOD IN ENZYMOLOGY, Academic Press, San Diego; Wolfe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, IN Vol. Chromatin (PMWassarman and APWolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol.119, Chromatin Protocols (PBBecker, ed.) Humana Press, Totowa, 1999, etc.

The reagent information involved in the embodiment is specifically as follows:

The human ppGalNAc-T2 gene and PDI gene were synthesized in General Biosystems (Anhui) Co., Ltd.;

KOD DNA polymerase, Ligation High ligase, etc. were purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.;

Restriction endonucleases were purchased from New England Biolabs;

Gel recovery, PCR product purification and plasmid extraction kits, IPTG and antibiotics were purchased from Shanghai Shenggong;

DH5α competent cells were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.;

Ni-NTA

Resin, pRSFDuet-1 vector, Rosetta-gaimi2 (pLysS) expression strain were purchased from Millipore;

UDP-GalNAc was purchased from Sigma-Aldrich;

EA2-FAM polypeptide, Muc5AC-FAM polypeptide, APP-peptide2-FAM polypeptide, APP-peptide3-FAM polypeptide were synthesized in Gill Biochemical Co., Ltd. (Shanghai);

The human recombinant P53 protein was expressed in BL21 Escherichia coli, and PCR primer synthesis and sequencing were performed in Shanghai Parsono Biotechnology Co., Ltd.

Example 1

Construction of pYZL2 plasmid:

(1) Establishment of human ppGalNAc-T2 enzyme and human PDI nucleotide sequence:

The catalytic form of the ppGalNAc-T enzyme is shown in Figure 1A. The structure of the human ppGalNAc-T2 protein (RefSeq Accession Number: Q10471) was analyzed on the UniProt website (Figure 1B), and the codons were optimized to make it suitable for E. coli expression. After the codon optimization of human ppGalNAc-T2 (ie The nucleotide sequence of Recombinant ppGalNAc-T2) is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2. The structure of the human PDI protein (RefSeq Accession Number: P07237) was analyzed (Figure 1C), and its N-terminal signal peptide (PDIΔSP, aa:18-508) was truncated, and the codons were optimized to make it suitable for E. coli expression. The optimized nucleotide sequence of the source PDI codon is shown in SEQ ID NO: 3, and the amino acid sequence is shown in SEQ ID NO: 4.

(2) Construction of pYZL2 plasmid:

The nucleotide sequence of Bacillus subtilis Mistic is shown in SEQ ID NO: 5, and the amino acid sequence is shown in SEQ ID NO: 6; designed according to the multiple cloning site of pRSFDuet-1 and the DNA sequence of ppGalNAc-T2, PDI, and Mistic Primer:

Full Length ppGalNAc-T2 (corresponding to RefSeq Accession Number: Q10471 above) upstream primer:

5’CGCGGATCCATGCGTCGCCGTAGTC 3’ (SEQ ID NO: 7)

Full length ppGalNAc-T2 downstream primer:

5’GGCTGGTCGACCTACTGCTG 3’ (SEQ ID NO: 8)

Recombinant ppGalNAc-T2 (corresponding to the above RefSeq Accession Number: 52-571 of Q10471

Amino acid fragment) upstream primer:

5’CGCGGATCCAAGAAGAAGGA 3’ (SEQ ID NO: 9)

Recombinant ppGalNAc-T2 downstream primer:

5’GGCTGGTCGACCTACTGCTG 3’ (SEQ ID NO: 10)

PDI upstream primer: 5’AAAGATATCGATGGATGCACC 3’ (SEQ ID NO: 11)

PDI downstream primer: 5’CGGGGTACCTTACAGTTCATC 3’ (SEQ ID NO: 12)

Mistic upstream primer: 5’CGCGGATCCATGTTTTGTAC 3’ (SEQ ID NO: 13)

Mistic downstream primer: 5’GGCTGGTCGACCTGCTGTTC 3’ (SEQ ID NO: 14)

Plasmid construction was carried out according to the plasmid construction strategy in the attached figure: the synthesized ppGalNAc-T2, PDI and Mistic DNA sequence were used as templates, and the target fragment was amplified by PCR. The PCR reaction conditions were: 94°C for 2min; 94°C for 15s, 52°C for 30s, 68℃2min, 38 cycles; 68℃10min; Mistic target fragments were digested with EcoR I and Nhe I; Full Length ppGalNAc-T2 and Recombinant ppGalNAc-T2 target fragments were digested with BamH I and Sal I; PDI target fragments After EcoR V and Kpn I double digestion, the PDI fragment was ligated into the pRSFDuet-1 plasmid after double digestion with the above endonuclease, and then ligated into the insert protein (human ppGalNAc-T2). The construction strategy is shown in Figure 1D and Figure 1E, and the ligation reaction conditions are:

The name of the constructed expression plasmid is: pYZL2

The name of the specific inserted protein (human ppGalNAc-T2) is:

human Recombinant ppGalNAc-T2 (hRT2), that is, the above-mentioned Recombinant ppGalNAc-T2 target fragment;

Mistic human Recombinant ppGalNAc-T2 (MishRT2), N-terminal to C-terminal includes the above-mentioned Mistic target fragment and the above-mentioned Recombinant ppGalNAc-T2 target fragment connected in sequence;

human Full Length ppGalNAc-T2 (hFLT2), that is, the above-mentioned Full Length ppGalNAc-T2 target fragment;

Mistic human Full Length ppGalNAc-T2 (MishFLT2), N-terminal to C-terminal includes the above-mentioned Mistic target fragment and the above-mentioned Full Length ppGalNAc-T2 target fragment connected in sequence.

The gel electrophoresis diagram of the plasmid construction process is shown in Figure 2, where Figure 2A is a schematic diagram of the gel electrophoresis results of pRSFDuet-1 plasmid double digestion and PDI target fragment double digestion; Figure 2B is the ligation of the PDI fragment into the The gel electrophoresis results of the pRSFDuet-1 plasmid, the Mistic target fragment and the Recombinant ppGalNAc-T2 target fragment after double digestion with the above endonucleases; Figure 2C shows the result of double digestion of the Recombinant ppGalNAc-T2 target fragment. Schematic diagram of the gel electrophoresis results after digestion; Figure 2D shows the gel electrophoresis results of ligation of the PDI fragment into the pRSFDuet-1 plasmid, Full Length ppGalNAc-T2 after double digestion with the above endonucleases. Schematic diagram; Figure 2E is a schematic diagram of the gel electrophoresis results of the Mistic target fragment and the Full Length ppGalNAc-T2 target fragment after ligation and double enzyme digestion.

Transform E. coli DH5α competent cells by the heat shock method of the above 4 plasmids, spread them on LB/Kan ⁺ (kanamycin 50μg/ml) plates for selection, and overnight at 37°C for selection and culture; select single bacteria After shaking the bacteria, the plasmid was extracted and sequenced for verification.

Example 2

Screening of high expression human ppGalNAc-T2 enzyme plasmid:

(1) Construction of four human ppGalNAc-T2 enzyme prokaryotic expression strains:

The above four pYZL2 plasmid heat shock methods were used to transform E. coli Rosetta-gami 2 (pLysS) competent cells and spread on LB/Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml, Screening was carried out on the plate (34μg/ml of streptomycin, 50μg/ml of streptomycin, 10μg/ml of tetracycline), and cultured overnight at 37°C. Obtain the following expression strains:

Rosetta-gami 2(pLysS)::hRT2(RG2::hRT2);

Rosetta-gami2(pLysS)::MishRT2(RG2::MishRT2);

Rosetta-gami2(pLysS)::hFLT2(RG2::hFLT2);

Rosetta-gami2(pLysS)::MishFLT2(RG2::MishFLT2);

(2) Small-scale induced expression and screening of four human ppGalNAc-T2 enzyme prokaryotic expression strains:

Pick RG2::hRT2, RG2::MishRT2, RG2::hFLT2, RG2::MishFLT2 from the refrigerator at -80℃, and inoculate 10ml Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml , Chloramphenicol 34μg/ml, streptomycin 50μg/ml, tetracycline 10μg/ml) LB liquid medium, 37℃220rpm overnight culture.

Take 100μl of bacterial solution and inoculate 10ml Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml, chloramphenicol 34μg/ml, streptomycin 50μg/ml, tetracycline 10μg/ ml) TB liquid medium, shake at 220 rpm at 37°C to OD600 = 0.6-0.8.

Shake at 16°C at 220 rpm for 1 hour, add IPTG to a final concentration of 0.2 mM, and induce expression at 16°C at 220 rpm for 24 hours.

Collect the bacteria by centrifugation at 8000g for 5min, add 1ml of Lysis Buffer A (25mM Tris-HCl(pH 8.0), 150mM NaCl), sonicate for 30min, centrifuge at 14000g for 30min at 4℃, discard the precipitate, collect the lysate supernatant for Coomassie Brilliant Blue staining ( Figure 3A) and Western Blot (Figure 3B). As shown in Figure 3, the four human ppGalNAc-T2 enzymes were successfully expressed in prokaryotic cells. Under the same culture conditions, the expression levels of the four ppGalNAc-T2 enzymes were hRT2>MishFLT2 >MishRT2>hFLT2.

Example 3

Optimization of ppGalNAc-T2 enzyme induced expression conditions:

(1) Exploring the time when IPTG induces expression:

Pick RG2::hRT2 glycerol bacteria from -80℃ refrigerator and inoculate 10ml Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml, chloramphenicol 34μg/ml, streptomycin 50μg/ml, Tetracycline (10μg/ml) LB liquid medium was cultured overnight at 37°C and 220rpm.

Take 100μl of bacterial solution and inoculate 10ml Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml, chloramphenicol 34μg/ml, streptomycin 50μg/ml, tetracycline 10μg/ ml) TB liquid medium, shake at 220 rpm at 37°C to OD600 = 0.6-0.8.

Shake the bacteria at 16°C at 220 rpm for 1 hour, add IPTG to a final concentration of 0.2 mM, and induce expression at 16°C at 220 rpm for 0, 2, 4, 6, 8, 12, 16, 24 hours.

Centrifuge at 8000g for 5min to collect the bacteria, add 1ml of Lysis Buffer A (25mM Tris-HCl(pH 8.0), 150mM NaCl), sonicate for 30min, centrifuge at 14000g for 30min at 4℃, discard the precipitate, collect the lysate supernatant for Coomassie Brilliant Blue staining, And Western Blot detection, the results are shown in Figure 4A (in the figure, anti-T2 is anti-ppGalNAc-T2 antibody, purchased from Sigma-Aldrich company, article number HPA011222, anti-His is anti-His tag antibody, purchased from Abmart, Product number M20001M, the same below), as shown in Figure 4A, as the induction time increases, the expression level of hRT2 gradually increases.

(2) Exploring the induced expression concentration of IPTG:

Pick RG2::hRT2 glycerol bacteria from -80℃ refrigerator and inoculate 10ml Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml, chloramphenicol 34μg/ml, streptomycin 50μg/ml, Tetracycline (10μg/ml) LB liquid medium was cultured overnight at 37°C and 220rpm.

Take 100μl of bacterial solution and inoculate 10ml Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml, chloramphenicol 34μg/ml, streptomycin 50μg/ml, tetracycline 10μg/ ml) TB liquid medium, shake at 220 rpm at 37°C to OD600 = 0.6-0.8.

Shake the bacteria at 16°C at 220 rpm for 1 hour, add IPTG to a final concentration of 0, 0.01, 0.05, 0.1, 0.2, 0.5, 1 mM, and induce expression at 16°C at 220 rpm for 24 hours.

Centrifuge at 8000g for 5min to collect the bacteria, add 1ml of Lysis Buffer A (25mM Tris-HCl(pH 8.0), 150mM NaCl), sonicate for 30min, centrifuge at 14000g for 30min at 4℃, discard the precipitate, collect the lysate supernatant for Coomassie Brilliant Blue staining, Western Blot detection was performed, and the results are shown in Figure 4B. It can be seen from Figure 4B that hRT2 can be expressed under induction conditions of various concentrations.

Example 4

Purification of highly expressed human ppGalNAc-T2 enzyme:

(1) A large amount of induced expression of hRT2:

Pick RG2::hRT2 glycerol bacteria from -80℃ refrigerator and inoculate 10ml Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml, chloramphenicol 34μg/ml, streptomycin 50μg/ml, Tetracycline (10μg/ml) LB liquid medium was cultured overnight at 37°C at 220 rpm.

Take 4ml of bacterial solution and inoculate 400ml Kan ⁺ /Cam ⁺ /Str ⁺ /Tet ⁺ (kanamycin 50μg/ml, chloramphenicol 34μg/ml, streptomycin 50μg/ml, tetracycline 10μg/ ml) TB liquid medium, shake at 220 rpm at 37°C to OD600 = 0.6-0.8.

Shake at 16°C at 220 rpm for 1 hour, add IPTG to a final concentration of 0.2 mM, and induce expression at 16°C at 220 rpm for 24 hours.

The cells were collected by centrifugation at 8000g for 5min, 60ml of Lysis Buffer A (25mM Tris-HCl (pH 8.0), 150mM NaCl) was added, the cells were broken at 600Bar for 5min, and centrifuged at 14000g for 30min at 4℃. The precipitate was discarded and the lysed supernatant was collected for protein purification.

(2) Nickel column purification of hRT2:

Add 2ml Ni-NTA to the affinity chromatography column

Resin(Millipore);

Wash with 5 column volumes of ultrapure water, add 5 column volumes of Wash Buffer (25mM Tris-HCl (pH8.0); 150mM NaCl; 10mM imidazole) for column equilibration;

Then add 60ml of the above lysis supernatant. Wash the column with 5 ml of Lysis Buffer A containing 20, 50, 100, 200, 400, 600, 800, and 2000 mM imidazole, respectively, and collect them in a 15-ml centrifuge tube.

Take 10μl each for SDS-PAGE electrophoresis; Coomassie brilliant blue staining, and Western Blot detection, the results are shown in Figure 5A, where WCL means (Whole Cell Lysate, whole cell lysate), FL means (Flow through, flow through) liquid). It can be seen that under gradient elution conditions, hRT2 can be effectively purified, and a higher concentration of hRT2 can be obtained in the 50-400 mM imidazole eluate.

(3) Concentration of hRT2 protein by ultrafiltration:

The ultrafiltration tube (Millipore, 50ml, 30k) was added with 10ml ultrapure water in advance and centrifuged at 4000g for 5min.

Add 50-400mM components to the ultrafiltration tube one by one, and centrifuge at 4000g for 15min at 4℃;

Add 1ml of Lysis Buffer A to dilute the imidazole, centrifuge at 4000g for 15 minutes, and repeat more than 10 times (at this time, the theoretical concentration of imidazole drops below 2mM).

A total of 200μl hRT2 was obtained for the preparation of O-glycopeptide or O-glycoprotein and SDS-PAGE electrophoresis (0.01ul, 0.02ul, and 0.05ul product were added respectively), and Coomassie brilliant blue staining was performed. The results are shown in Figure 5B (BSA For the control concentration), the yield of recombinant ppGalNAc-T2 is calculated as shown in Table 1.

Table 1

Example 5

Preparation of O-glycopeptide:

EA2-FAM polypeptide (SEQ ID NO: 15), Muc5AC-FAM polypeptide (SEQ ID NO: 16), APP-peptide2-FAM polypeptide (SEQ ID NO: 17), APP-peptide3-FAM polypeptide (SEQ ID NO: 18) ) Synthesized in Shanghai Jier Biochemical Co., Ltd. O-glycopeptide enzyme activity reaction system:

Pro Thr Thr Asp Ser Thr Thr Pro Ala Pro Thr Thr Lys-5, 6FAM (SEQ ID NO: 15)

Ser Ala Pro Thr Thr Ser Ser Thr Thr Ser Ala Pro Thr Lys-5,6FAM (SEQ ID NO: 16)

Ala Met Ser Gln Ser Leu Leu Lys Thr Thr Gln Glu Pro Leu Ala Lys (SEQ ID NO: 17)

Arg Val Pro Thr Thr Ala Ala Ser Thr Pro Asp Ala Val Asp Lys (SEQ ID NO: 18)

The ppGalNAc-T enzyme used in the above table was prepared in Example 4, and the reaction system was incubated at 37°C for 30 min.

Add 80ul ultrapure water to the above reaction product, and automatically inject 40ul to C18 analytical column (COSMOSIL 5C18-AR-II, 4.6×250mm) through reverse-phase HPLC (Shimadzu, Kyoto, Japan) . O-glycopeptide detection method:

HPLC mobile phase is solution A: H2O+0.05% TFA; solution B: CH3CN+0.05% TFA; HPLC separation conditions: 0-16min, 20%-28%B; 16-18min, 28-80%B; 18- 23min, 80%B; 23-25min, 80%-20%B; 25-30min, 20%B; flow rate: 1ml/min, fluorescence detector excitation wavelength 495nm, emission wavelength 520nm. The HPLC spectra of the O-glycopeptide of each polypeptide before and after the enzyme activity reaction are shown in Figure 6. It can be seen from Figure 6 that compared to the system without the ppGalNAc-T enzyme, the system containing the ppGalNAc-T enzyme has obvious O -Enzymatic reaction of glycopeptides.

O-glycopeptide glycosylation site mass spectrometry detection, Quadrupole-Time-of Flight Mass Spectrometer (Bruker Daltonics, Germany), the secondary fragmentation mode is CID, the energy range is 60-100%; Orbitrap Fusion( Thermo Fisher, USA), the secondary fragmentation mode is EThcD, the ETD activation time is 150ms, and the HCD energy range is 15%. The mass spectrometry results of the O-glycosylated Muc5AC and APP polypeptides are shown in Figure 7. It can be seen from Figure 7 that Muc5AC and APP polypeptides were successfully synthesized into O-glycopeptides after the above-mentioned enzymatic reaction.

Example 6

Preparation of O-glycoprotein:

(1) Expression and purification of human recombinant p53 protein:

The human p53 protein (SEQ ID NO: 19) is recombined into the pET28a prokaryotic expression vector, which is a pET28a-p53 prokaryotic expression plasmid, and the human p53 protein has a His tag at its N end. The pET28a-p53 plasmid heat shock method transforms E. coli BL21 competent cells, spreads them on Kan ⁺ (kanamycin 50μg/ml) plates for selection, and cultures them overnight at 37°C to obtain pET28a-p53 expression strains.

Pick pET28a-p53 glycerol bacteria from the -80°C refrigerator and inoculate it in 10ml Kan ⁺ (kanamycin 50μg/ml) LB liquid medium, and cultivate overnight at 37°C at 220 rpm. Take 2.5ml of bacterial solution and inoculate it in 250ml Kan ⁺ (kanamycin 50μg/ml) LB liquid medium at a ratio of 1:100, shake at 37℃ 220rpm to OD600=0.6-0.8. Shake at 16℃ 220rpm for 1h, IPTG was added to a final concentration of 0.2mM, and the expression was induced at 16°C at 220rpm for 22h. The cells were collected by centrifugation at 8000g for 5min, 60ml of Lysis Buffer A (25mM Tris-HCl (pH 8.0), 150mM NaCl) was added, and the cells were broken under high pressure at 600Bar for 5min, and centrifuged at 14000g at 4°C for 30min. The precipitate was discarded and the lysed supernatant was collected for protein purification.

Add 2ml Ni-NTA to the affinity chromatography column

Resin (Millipore), wash with 5 column volumes of ultrapure water, add 5 column volumes of Wash Buffer (25mM Tris-HCl (pH8.0); 150mM NaCl; 10mM imidazole) for column equilibration, and then add 60ml of the above lysis Supernatant. Wash the column with 2ml each of Lysis Buffer A containing 20, 50, 100, 200, 400, 600, 800, 2000 mM imidazole, and collect them in 15 ml centrifuge tubes.

The ultrafiltration tube (Millipore, 0.5ml, 10k) was added with 0.5ml ultrapure water in advance and centrifuged at 4000g for 5min. Add the 50-200mM components to the ultrafiltration tube in turn, centrifuge at 14000g at 4°C for 15min; add 0.5ml Lysis Buffer A to dilute the imidazole, centrifuge at 144000g for 15min, repeat more than 10 times (at this time the theoretical concentration of imidazole drops below 2mM). A total of 100μl of human recombinant p53 protein was obtained.

(2) O-glycoprotein reaction system:

The ppGalNAc-T enzyme used in the above table was prepared in Example 4, and the reaction system was incubated at 37° C. for 12 h.

(3) Detection method of O-glycoprotein:

O-glycoprotein is detected using lectin imprinting. The above reaction system was separated by electrophoresis in 10% SDS-PAGE, and then transferred to a nitrocellulose membrane (NC membrane). The NC membrane loaded with O-glycoprotein was blocked in a PBS solution containing 3% BSA for 1 h at room temperature, and then in a clove agglutinin (VVA-HRP, purchased from EY Laboratories) containing 1 ng/μl horseradish peroxidase fusion. Incubate in PBS solution (Cat. No. H-4601) for 1 hour at room temperature, and then wash 3 times with PBS solution containing 0.1% tween-20. The washed NC membrane reacts with ECL luminescent substrate at room temperature for 1 min. ECL luminescent signal uses AI600 (GE Healthcare) , China) for picture collection, and then the NC membrane loaded with O-glycoprotein was blocked in a TBS solution containing 3% BSA for 1 h at room temperature, and then it was exposed to 1ng/μl protein antibody (p53antibody, purchased from Santa Cruz, catalog number -126) TBS solution incubate at room temperature for 1h, and wash 3 times in TBS solution containing 0.1% tween-20. The washed NC membrane is incubated for 1h at room temperature with a secondary antibody containing 0.1ng/μl DyLight 680 fusion. The 0.1% tween-20 TBS solution was washed twice, and the TBS solution was washed once. The washed NC membrane was collected by Odyssey (LI-COR, USA). The results are shown in FIG. 8. It can be seen from Fig. 8 that, in the reaction system containing the ppGalNAc-T enzyme, O-glycoprotein was clearly produced in the reaction system containing the ppGalNAc-T enzyme, compared to the reaction system not containing the ppGalNAc-T enzyme.

In summary, the present invention effectively overcomes various shortcomings in the prior art and has a high industrial value.

The above-mentioned embodiments only exemplarily illustrate the principles and effects of the present invention, but are not used to limit the present invention. Anyone familiar with this technology can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes made by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed in the present invention should still be covered by the claims of the present invention.

Claims (10)

1. A prokaryotic expression vector for expressing N-acetylgalactosamine transferase. The expression vector includes a ppGalNAc-T protein expression frame and a PDI protein expression frame.
2. The prokaryotic expression vector of claim 1, wherein the ppGalNAc-T protein is of human origin;

   And/or, the ppGalNAc-T protein is selected from ppGalNAc-T1 protein, ppGalNAc-T2 protein, ppGalNAc-T3 protein, ppGalNAc-T4 protein, ppGalNAc-T5 protein, ppGalNAc-T6 protein, ppGalNAc-T7 protein, ppGalNAc-T8 Protein, ppGalNAc-T9 protein, ppGalNAc-T10 protein, ppGalNAc-T11 protein, ppGalNAc-T12 protein, ppGalNAc-T13 protein, ppGalNAc-T14 protein, ppGalNAc-T15 protein, ppGalNAc-T16 protein, ppGalNAc-T17-T18 Protein, ppGalNAc-T19 protein, or ppGalNAc-T20 protein;

   And/or, the amino acid sequence of the ppGalNAc-T protein includes the sequence shown in SEQ ID NO: 2.
3. The prokaryotic expression vector of claim 1, wherein the PDI protein is of human origin;

   And/or, the amino acid sequence of the PDI protein includes the sequence shown in SEQ ID NO: 4.
4. The prokaryotic expression vector of claim 1, wherein the expression vector further comprises a Mistic protein expression cassette, the Mistic is derived from Bacillus subtilis, and the amino acid sequence of the Mistic protein includes SEQ ID NO: 6 shows the sequence.
5. The prokaryotic expression vector of claim 4, wherein the ppGalNAc-T protein expression cassette and/or PDI protein expression cassette and/or Mistic protein expression cassette comprise the same promoter.
6. The prokaryotic expression vector of claim 1, wherein the expression vector is a multi-gene co-expression vector;

   And/or, the expression vector is constructed from pRSFDuet-1 vector.
7. A prokaryotic expression system for expressing N-acetylgalactosamine transferase, said expression system comprising the prokaryotic expression vector according to any one of claims 1 to 6.
8. 8. The prokaryotic expression system of claim 7, wherein the host cell of the prokaryotic expression system is selected from strains with an intracellular oxidizing environment.
9. The prokaryotic expression system according to claim 8, wherein the host cell of the prokaryotic expression system is selected from Escherichia coli, preferably selected from Rosetta-gami2.
10. A preparation method of N-acetylgalactosamine transferase, comprising the steps of: culturing the prokaryotic expression system according to any one of claims 7-9, thereby expressing N-acetylgalactosamine transferase, and purifying and separating the prokaryotic expression system. Said N-acetylgalactosamine transferase.

Images