WO2021102624A1 - Médicaments à base de protéines covalentes développés par l'intermédiaire d'agents thérapeutiques réactifs activés par la proximité (perx) - Google Patents

Médicaments à base de protéines covalentes développés par l'intermédiaire d'agents thérapeutiques réactifs activés par la proximité (perx) Download PDF

Info

Publication number
WO2021102624A1
WO2021102624A1 PCT/CN2019/120572 CN2019120572W WO2021102624A1 WO 2021102624 A1 WO2021102624 A1 WO 2021102624A1 CN 2019120572 W CN2019120572 W CN 2019120572W WO 2021102624 A1 WO2021102624 A1 WO 2021102624A1
Authority
WO
WIPO (PCT)
Prior art keywords
fsy
human
mutant
cells
amino acid
Prior art date
Application number
PCT/CN2019/120572
Other languages
English (en)
Inventor
Qian Wang
Original Assignee
Hangzhou Branch Of Technical Institute Of Physics And Chemistry, Chinese Academy Of Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hangzhou Branch Of Technical Institute Of Physics And Chemistry, Chinese Academy Of Sciences filed Critical Hangzhou Branch Of Technical Institute Of Physics And Chemistry, Chinese Academy Of Sciences
Priority to CN201980068498.6A priority Critical patent/CN113179631A/zh
Priority to PCT/CN2019/120572 priority patent/WO2021102624A1/fr
Publication of WO2021102624A1 publication Critical patent/WO2021102624A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/107—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
    • C07K1/113—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides without change of the primary structure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • This application generally relates to a proximity-enabled reactive therapeutics (PERx) approach to generate a covalent protein drug, and mutant proteins which contain one latent bioreactive unnatural amino acid (Uaa) and are useful for covalent protein drugs developed via proximity-enabled reactive therapeutics (PERx) . More specifically, the application relates to a mutant PD-1 containing a fluorosulfate-L-tyrosine (FSY) , a method for preparing the same, and the use of the mutant PD-1.
  • PERx proximity-enabled reactive therapeutics
  • Covalent bonding between drug and target offers multiple desirable features over noncovalent interactions of conventional drugs, including increased biochemical efficiency and potency, prolonged duration of action outlasting the drug pharmacokinetics, improved therapeutic index with reduced dosage and dosing frequency, complete inactivation of target, and opportunity to inhibit intractable targets 3, 4 .
  • almost 30%of the marketed drugs targeting enzymes act via a covalent mechanism, and targeted covalent inhibition is increasingly applied to a broader range of targets that are challenging to address with noncovalent drugs 5, 4 .
  • Small molecule covalent drugs provide multiple desirable therapeutic properties over noncovalent ones for treating challenging diseases.
  • the potential of covalent protein drugs remains largely unexplored due to protein’s inability to bind target covalently.
  • the therapeutic potential of covalent protein drugs remains largely untapped. Protein drugs would be more suitable for covalent mode of action than small molecule drugs.
  • a major concern for small molecule covalent drugs is off-target reactivity 1 , which can be minimized in covalent protein drugs, because proteins have larger size and generally higher specificity for targets than small molecules.
  • the key to develop covalent small molecule drugs has been to strike the right balance between reactivity and selectivity 4 .
  • mutant proteins which are capable of interacting through covalent interactions with natural amino acids on target proteins expressed on diseased cells such as tumor cells.
  • the present application has an objective to prepare mutant proteins which are capable of interacting through covalent interactions with natural amino acids on target proteins expressed on the tumors.
  • the mutant proteins can be used to develop covalent protein drugs.
  • PERx Proximity-Enabled Reactive Therapeutics
  • Fig. 1 a Proximity-Enabled Reactive Therapeutics (PERx) strategy to develop covalent protein drugs (Fig. 1) .
  • PERx Proximity-Enabled Reactive Therapeutics
  • Fig. 1 a latent bioreactive unnatural amino acid (Uaa) is introduced into a protein drug, which Uaa has low chemical reactivity and remains inert inside the protein and in cells.
  • the bioreactive Uaa will selectively react with a natural residue of the target promoted by proximity-enabled reactivity 8 , forming a covalent linkage between the drug and the target.
  • the inventors genetically incorporated the latent bioreactive Uaa, fluorosulfate-L-tyrosine (FSY) 9 , into human programmed cell death protein 1 (PD-1) , and showed that the resultant PD-1 (FSY) covalently bound with its natural ligand PD-L1 in vitro, on cell surface, and in tumor tissues in vivo.
  • PD-1 human programmed cell death protein 1
  • the PD-1 (FSY) was found to enhance the functional activity of human native T cells and to inhibit tumor growth in humanized mouse models with significantly higher efficacy, showing anti-tumor effects equivalent to that of a therapeutic anti-PD-L1 monoclonal antibody, highlighting the therapeutic efficacy contributed by the covalent linkage.
  • the present disclosure relates to a proximity-enabled reactive therapeutics (PERx) approach to generate a covalent protein drug, comprising: incorporating a latent bioreactive unnatural amino acid (Uaa) into a protein drug to generate a mutant protein drug, wherein the mutant protein drug, upon drug-target binding, reacts with a target natural residue of its target protein via proximity-enabled reactivity, thus allowing the covalent binding of the protein drug with its target.
  • PERx proximity-enabled reactive therapeutics
  • Uaa is genetically incorporated into the protein drug, for example, by introducing an amber stop codon (TAG) at a desired site in a nucleotide sequence encoding wide-type protein of the protein drug, with the aid of a mutant aminoacyl-tRNA synthetase (aaRS) specific for Uaa, which is evolved to incorporate Uaa in response to the TAG codon.
  • TAG amber stop codon
  • aaRS mutant aminoacyl-tRNA synthetase
  • the Uaa is FSY (fluorosulfate-L-tyrosine) , which is genetically incorporated into the protein drug by introducing an amber stop codon (TAG) at a desired site in a nucleotide sequence encoding wide-type protein of the protein drug, with the aid of genes for orthogonal tRNA Pyl /FSYRS pair, which is evolved to incorporate FSY in response to the TAG codon.
  • TAG amber stop codon
  • the protein drug may be one member of an immunologic checkpoint, and its target, i.e., the other member of the immunologic checkpoint, may be a protein expressing on the surface of tumor cells.
  • the immunologic checkpoint may be selected from, but not limited to, PD-1/PD-L1, CTLA-4/CD80 (CD86) , 4-1BB/ligand, OX40/ligand, GITR/ligand, LAG-3/ligand, TIM-3/ligand, and so on.
  • the mutant protein drug is a mutant PD-1 (FSY) containing one FSY (fluorosulfate-L-tyrosine) in its amino acid sequence, wherein the mutant PD-1 (FSY) is capable of specifically reacting with one target natural amino acid residue selected from Tyr, His, or Lys in proximity in its target PD-L1 via a click chemistry sulfur-fluoride exchange (SuFEx) .
  • FSY mutant PD-1
  • FSY fluorosulfate-L-tyrosine
  • the present disclosure relates to a mutant human PD-1 (FSY) containing one FSY (fluorosulfate-L-tyrosine) in its amino acid sequence.
  • FSY human PD-1
  • the FSY residue in the mutant PD-1 is capable of specifically reacting with one target natural amino acid residue selected from Tyr, His, or Lys in proximity in its target PD-L1 via a click chemistry sulfur-fluoride exchange (SuFEx) .
  • Use of FSY will generate a covalent linkage between PD-1 (FSY) and PD-L1, creating an irreversible antagonist possessing infinite affinity that is unreachable with any high affinity mutants evolved through natural amino acid mutagenesis.
  • the FSY is introduced in human PD-1 at one of the following sites: 75, 77 or 129 (numbering according to the amino acid sequence of wide-type human PD-1, i.e., NCBI accession number: NP_005009.2) , targeting Lys124, Lys124, and His69 of PD-L1, respectively.
  • the FSY was introduced in human PD-1 at site 75 or 129, preferably at site 129.
  • the FSY residue is incorporated into the ectodomain of human PD-1 by expressing in host cells a PD-1 gene containing an amber stop codon (TAG) introduced at a desired site together with genes for orthogonal tRNA Pyl /FSYRS pair, which is evolved to incorporate FSY in response to the TAG codon.
  • TAG amber stop codon
  • the host cells may be selected from, but not limited to, E. coli cells, yeast cells, mammalian cells (e.g., CHO cells) , or insect cells.
  • the mutant human PD-1 can specifically covalently bind with human PD-L1 in vitro, with human PD-L1 physiologically expressed on the surface of live cancer cells, and with human PD-L1 in tumor tissue in vivo.
  • the mutant human PD-1 (FSY) exhibits no covalent crosslinking with mouse PD-L1, although human PD-1 is known to cross-bind with mouse PD-L1. Therefore, the mutant human PD-1 (FSY) has high target specificity and low off-target effect.
  • the mutant human PD-1 can significantly enhance T cell activation by blocking PD-1/PD-L1 interaction.
  • the T cell activation effect of human PD-1 (FSY) was comparable to that of Atezolizumab applied at the same molar concentrations.
  • the mutant human PD-1 can reach the same antitumor effect as Atezolizumab administrated in the same molar quantities, but the mass quantities of PD-1 (FSY) needed is one tenth of Atezolizumab.
  • the present disclosure relates to a method for genetically incorporating FSY into PD-1, comprising:
  • the host cells are E. coli, and the agent for inducing protein expression is IPTG.
  • the PD-1 is human PD-1.
  • amber stop codon is introduced at one site selected from sites 75, 77 or 129 of human PD-1.
  • the PD-1 gene containing an amber stop codon is represented by any one of SEQ ID NOs: 16-18.
  • the tRNA Pyl is represented by SEQ ID NO: 19.
  • the FSYRS refers to a mutant pyrrolysyl-tRNA synthetase (PylRS) specific for FSY.
  • the FSYRS is represented by SEQ ID NO: 20 and is a mutant Methanosarcina mazei PylRS.
  • the present disclosure relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of a mutant protein containing a latent bioreactive unnatural amino acid (Uaa) and a pharmaceutically acceptable carrier and/or excipient.
  • Uaa latent bioreactive unnatural amino acid
  • the present disclosure relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of mutant PD-1 (FSY) and a pharmaceutically acceptable carrier and/or excipient.
  • the FSY was introduced in PD-1 at one of the following sites: 75, 77 or 129 (numbering according to the amino acid sequence of wide-type PD-1) .
  • the FSY was introduced in PD-1 at site 75 or 129, preferably at site 129.
  • the pharmaceutical composition is used to prevent and/or treat PD-L1 related diseases, for example, melanoma, renal cell carcinoma, head and neck cancer, cervical cancer, glioblastoma, bladder cancer, oesophageal cancer, breast cancer, hepatocellular carcinoma, Hodgkin lymphoma, and mediastinal large B-cell lymphoma.
  • PD-L1 related diseases for example, melanoma, renal cell carcinoma, head and neck cancer, cervical cancer, glioblastoma, bladder cancer, oesophageal cancer, breast cancer, hepatocellular carcinoma, Hodgkin lymphoma, and mediastinal large B-cell lymphoma.
  • the present disclosure relates to use of a mutant protein containing a latent bioreactive unnatural amino acid (Uaa) in manufacture of a pharmaceutical composition for prevention and/or treatment of diseases including cancers.
  • a latent bioreactive unnatural amino acid Uaa
  • the present disclosure relates to use of mutant PD-1 (FSY) in manufacture of a pharmaceutical composition for prevention and/or treatment of PD-L1 related diseases, for example, melanoma, renal cell carcinoma, head and neck cancer, cervical cancer, glioblastoma, bladder cancer, oesophageal cancer, breast cancer, hepatocellular carcinoma, Hodgkin lymphoma, and mediastinal large B-cell lymphoma.
  • PD-L1 related diseases for example, melanoma, renal cell carcinoma, head and neck cancer, cervical cancer, glioblastoma, bladder cancer, oesophageal cancer, breast cancer, hepatocellular carcinoma, Hodgkin lymphoma, and mediastinal large B-cell lymphoma.
  • the pharmaceutical composition is packaged into a kit.
  • the present disclosure relates to a kit, comprising an effective amount of a mutant protein containing a latent bioreactive unnatural amino acid (Uaa) and a pharmaceutically acceptable carrier and/or excipient.
  • a kit comprising an effective amount of a mutant protein containing a latent bioreactive unnatural amino acid (Uaa) and a pharmaceutically acceptable carrier and/or excipient.
  • the kit comprises an effective amount of mutant PD-1 (FSY) and a pharmaceutically acceptable carrier and/or excipient.
  • FSY mutant PD-1
  • the present disclosure relates to a method for prevention and/or treatment of diseases including cancers in a subject, comprising: administrating to the subject a pharmaceutical composition comprising an effective amount of a mutant protein containing a latent bioreactive unnatural amino acid (Uaa) and a pharmaceutically acceptable carrier and/or excipient.
  • a pharmaceutical composition comprising an effective amount of a mutant protein containing a latent bioreactive unnatural amino acid (Uaa) and a pharmaceutically acceptable carrier and/or excipient.
  • the present disclosure relates to a method for prevention and/or treatment of PD-L1-related diseases in a subject, comprising: administrating to the subject a pharmaceutical composition comprising an effective amount of mutant PD-1 (FSY) and a pharmaceutically acceptable carrier and/or excipient.
  • a pharmaceutical composition comprising an effective amount of mutant PD-1 (FSY) and a pharmaceutically acceptable carrier and/or excipient.
  • the present application has the following advantages:
  • the PERx strategy can be used for developing covalent protein drugs with improved efficacy and half-life in vivo;
  • the PERx strategy can be used for developing covalent protein drugs from small protein molecules
  • the covalent protein drugs have low dosage and low frequency due to their improved efficacy and half-life in vivo;
  • the PERx strategy is used to modify one member of immunologic checkpoints, e.g., PD-1/PD-L1, CTLA-4/CD80 (CD86) , 4-1BB/ligand, OX40/ligand, GITR/ligand, LAG-3/ligand, TIM-3/ligand, and so on, and thus, the modified protein (e.g., PD-1) can specifically bind its target ligand (e.g., PD-L1) which is expressed on the surface of tumor cells.
  • the modified protein e.g., PD-1
  • target ligand e.g., PD-L1
  • Figure 1 shows the principle of PERx for developing covalent protein drugs.
  • a latent bioreactive Uaa is genetically incorporated into the protein drug, which, upon drug-target binding, reacts with a target natural residue of the target protein via proximity-enabled reactivity, thus allowing the covalent binding of the protein drug with its target.
  • Figure 2 shows genetic incorporation of the latent bioreactive Uaa FSY into PD-1.
  • Figure 3 shows the covalent bonding between PD-1 (FSY) and its ligand PD-L1 via proximity-enabled reactivity of the latent bioreactive Uaa FSY.
  • Figure 4 shows that PD-1 (FSY) did not covalently crosslink with mouse PD-L1 expressed on mouse thymus and spleen cells.
  • PD-1 (WT) and PD-1 (FSY) were separately incubated with mouse cells, and the samples were lysed and analyzed with Western blot using primary antibody specific for mouse PD-L1.
  • Figure 5 shows that PD-1 (FSY) increased T cell proliferation and INF- ⁇ production in vitro after allogeneic stimulation.
  • Figure 6 shows that PD-1 (FSY) inhibited tumor growth more effectively than PD-1 (WT) in PBMC-tumor xenograft mouse model.
  • Figure 7 shows the phenotypic characteristics of mature human dendritic cells derived from monocytes. Increased expression of CD83, CD86, HLA-DC, and PD-L1 on mature DC differentiated from monocytes induced with GM-CSF and IL-4, and activated with TNF- ⁇ and LPS. Non-stained CD83, CD86, HLA-DR, and PD-L1 were used as control.
  • FIG 8 shows that PD-1 (FSY) increased T cell proliferation in vitro after allogeneic stimulation.
  • the mean fluorescence intensity (MFI) of CFSE in CD3 + T cells treated with indicated reagents were measured and compared.
  • the decrease of CFSE fluorescence intensity indicates cell division and proliferation.
  • PD-1 (FSY) showed highly significant enhancement of T cell proliferation than PD-1 (WT) at concentrations of 50 nM and 250 nM, reaching the same enhancement level as antibody atezolizumab.
  • n 4; ns, not significant; ****P ⁇ 0.0001; one-way ANOVA followed by Tukey’s multiple comparison test.
  • covalent protein drugs refers to a therapeutic protein capable of interacting with its targets through covalent bonding.
  • Uaa unnatural amino acid
  • Uaa may be modified natural amino acids, for example, fluorosulfate-L-tyrosine (FSY) is a modified tyrosine.
  • FSY fluorosulfate-L-tyrosine
  • PERx proximity-enabled reactive therapeutics
  • PERx refers to a mutant protein drug containing a latent bioreactive unnatural amino acid (Uaa) , wherein the Uaa in the mutant protein drug can specifically react with one target natural residue of the target protein of the mutant protein drug, so that a covalent binding of the protein drug with its target is formed.
  • Uaa latent bioreactive unnatural amino acid
  • PD-1 Programmed Death 1
  • Ig gene superfamily Agata et al. (1996) bit Immunol 8: 765-72) and is an inhibitory member of the immunoglobulin super-family with homology to CD28. It is expressed on T cells, activated B cells, and myeloid cells (Agata et al, supra; Okazaki et al (2002) Curr. Opin. Immunol. 14: 391779-82; Bennett et al.
  • PD-1 was discovered through screening for differential expression in apoptotic cells (Ishida et al (1992) EMBO J 11: 3887-95) .
  • Alternative names or synonyms for PD-1 include PDCD1, PD1, CD279 and SLEB2, et al.
  • Representative amino acid sequence of human PD-1 is disclosed under the NCBI accession number: NP_005009.2, and the representative nucleic acid sequence encoding the human PD-1 is shown under the NCBI accession number: NM_005018.2.
  • PD-L1 refers to programmed cell death ligand 1 (PD-L1, see, for example, Freeman et al. (2000) J. Exp. Med. 192: 1027) .
  • Alternative names or synonyms for PD-L1 include PDCD1L1, PDL1, B7H1, CD274 and B7-H, and the like.
  • Representative amino acid sequence of human PD-L1 is disclosed under the NCBI accession number: NP_054862.1, and the representative nucleic acid sequence encoding the human PD-L1 is shown under the NCBI accession number: NM_014143.3.
  • PD-L1 is expressed in placenta, spleen, lymph nodes, thymus, heart, fetal liver, and is also found on many tumor or cancer cells. PD-L1 binds to its receptor PD-1 or B7-1, which is expressed on activated T cells, B cells and myeloid cells. The binding of PD-L1 and its receptor induces signal transduction to suppress TCR-mediated activation of cytokine production and T cell proliferation. Accordingly, PD-L1 plays a major role in suppressing immune system during particular events such as pregnancy, autoimmune diseases, tissue allografts, and is believed to allow tumor or cancer cells to circumvent the immunological checkpoint and evade the immune response.
  • PD-L1 is abundant in a variety of human cancers (Dong et al (2002) Nat. Med 8: 787-9) .
  • vector refers to a nucleic acid vehicle which can have a polynucleotide inserted therein.
  • the vector allows for the expression of the protein encoded by the polynucleotide inserted therein, the vector is called an expression vector.
  • the vector can have the carried genetic material elements expressed in a host cell by transformation, transduction, or transfection into the host cell.
  • Vectors are well known by a person skilled in the art, including, but not limited to plasmids, phages, cosmids, artificial chromosome such as yeast artificial chromosome (YAC) , bacterial artificial chromosome (BAC) or P1-derived artificial chromosome (PAC) ; phage such as ⁇ phage or M13 phage and animal virus.
  • the animal viruses that can be used as vectors include, but are not limited to, retrovirus (including lentivirus) , adenovirus, adeno-associated virus, herpes virus (such as herpes simplex virus) , pox virus, baculovirus, papillomavirus, papova virus (such as SV40) .
  • a vector may comprise multiple elements for controlling expression, including, but not limited to, a promoter sequence, a transcription initiation sequence, an enhancer sequence, a selection element and a reporter gene.
  • a vector may comprise origin of replication.
  • host cell refers to a cellular system which can be engineered to generate proteins, protein fragments, or peptides of interest.
  • Host cells include, without limitation, cultured cells, e.g., mammalian cultured cells derived from rodents (rats, mice, guinea pigs, or hamsters) such as CHO, BHK, NSO, SP2/0, YB2/0; or human tissues or hybridoma cells, yeast cells, and insect cells, and cells comprised within a transgenic animal or cultured tissue.
  • the term encompasses not only the particular subject cell but also the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not be identical to the parent cell, but are still included within the scope of the term “host cell. ”
  • subject includes any human or nonhuman animal, preferably humans.
  • cancer refers to any or a tumor or a malignant cell growth, proliferation or metastasis-mediated, solid tumors and non-solid tumors such as leukemia and initiate a medical condition.
  • treatment refers generally to treatment and therapy, whether of a human or an animal, in which some desired therapeutic effect is achieved, for example, the inhibition of the progress of the condition, and includes a reduction in the rate of progress, a halt in the rate of progress, regression of the condition, amelioration of the condition, and cure of the condition.
  • Treatment as a prophylactic measure i.e., prophylaxis, prevention
  • treating may refer to dampen or slow the tumor or malignant cell growth, proliferation, or metastasis, or some combination thereof.
  • treatment includes removal of all or part of the tumor, inhibiting or slowing tumor growth and metastasis, preventing or delaying the development of a tumor, or some combination thereof.
  • an effective amount pertains to that amount of an active compound, or a material, composition or dosage from comprising an active compound, which is effective for producing some desired therapeutic effect, commensurate with a reasonable benefit/risk ratio, when administered in accordance with a desired treatment regimen.
  • prevent refers to preventing or delaying the onset of the disease, or preventing the manifestation of clinical or subclinical symptoms thereof.
  • pharmaceutically acceptable means that the vehicle, diluent, excipient and/or salts thereof, are chemically and/or physically is compatible with other ingredients in the formulation, and the physiologically compatible with the recipient.
  • apharmaceutically acceptable carrier and/or excipient refers to a carrier and/or excipient pharmacologically and/or physiologically compatible with a subject and an active agent, which is well known in the art (see, e.g., Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995) , and includes, but is not limited to pH adjuster, surfactant, adjuvant and ionic strength enhancer.
  • the pH adjuster includes, but is not limited to, phosphate buffer;
  • the surfactant includes, but is not limited to, cationic, anionic, or non-ionic surfactant, e.g., Tween-80;
  • the ionic strength enhancer includes, but is not limited to, sodium chloride.
  • Plasmid pET-26b-PD1 was generated by cloning the human PD-1 (hPD-1) IgV domain encoding gene (residues 32-160, Cys93 was replaced with Ser (C93S) to aid protein stability 28 ) into pET-26b vector with a carboxyl-terminal 6x Histidine tag (SEQ ID NO: 15 and 22) . Briefly, the DNA for hPD-1 IgV domain (32-160, C93S) was amplified with following primer pair, PD-1 WT-F and PD-1 WT-R, by Q5 High-Fidelity DNA Polymerases (NEB, cat. No.
  • PD-1 WT-F GTTAGACTcatatgTGGAATCCGCCGACCTTTAGC (SEQ ID NO: 1)
  • PD-1 WT-R ACTGctcgagCGGACTAGGACTCGGATGTGCG (SEQ ID NO: 2)
  • the following primer pairs were respectively used to perform overlapping PCR with Q5 High-Fidelity DNA Polymerases and using plasmid pET-26b-PD1 (WT) as the template.
  • the amplified PCR product was digested with NdeI-HF and XhoI-HF, and then ligated into the precut pET-26b vector to afford plasmid pET-26b-PD-1 (D77TAG) or pET-26b-PD-1 (A129TAG) .
  • D77-F1 CCTCATATGTGGAATCCGCCGACCTTTAGC (SEQ ID NO: 3)
  • D77-R1 GGTCTGGTTGCTCGGGCTCATGC (SEQ ID NO: 4)
  • D77-F2 CCCGAGCAACCAGACCTAGAAACTGGCCGCCTTTCC (SEQ ID NO: 5)
  • D77-R2 TTAGCAGCCGGATCTCAGTGGTGG (SEQ ID NO: 6)
  • A129-F1 (same as D77-F1) : CCTCATATGTGGAATCCGCCGACCTTTAGC (SEQ ID NO: 3)
  • A129-R1 TGCAGGCTAATGGCGCCGCACAGATAG (SEQ ID NO: 7)
  • A129-F2 GGCGCCATTAGCCTGTAGCCGAAAGCCCAGATTAAG (SEQ ID NO: 8)
  • A129-R2 (same as D77-R2) : TTAGCAGCCGGATCTCAGTGGTGG (SEQ ID NO: 6)
  • the following primer pair was used to perform site-directed mutagenesis on plasmid pET-26b-PD1 (WT) using the Fast site-directed mutagenesis kit (Tiangen, KM101) .
  • Plasmid pET-26b-PD-L1 was generated by cloning the human PD-L1 IgV domain encoding gene (residues 19-134) into plasmid pET-26b. Briefly, the hPD-L1 IgV domain (19-134) was amplified with the following primer pair from plasmid pUC57-Kan-hPD-L1 IgV domain (19-134) , which was codon optimized and synthetized by GENEWIZ (China, Suzhou) . The PCR product was digested with NdeI-HF and XhoI-HF, and then ligated into the precut pET-26b vector.
  • PD-L1-F TTCCATATGTTTACCGTTACCGTG (SEQ ID NO: 11)
  • PD-L1-R GAACTCGAGGTACGGGGCAT (SEQ ID NO: 12)
  • Plasmid pET-26b-PD-L1 (H69A) was generated by performing site-directed mutagenesis on plasmid pET-26b-PD-L1 (WT) using the following primer pair and the Fast site-directed mutagenesis kit (Tiangen, KM101) .
  • H69A-F CATTCAGTTTGTGGCCGGCGAAGAAGATCTG (SEQ ID NO: 13)
  • H69A-R CAGATCTTCTTCGCCGGCCACAAACTGAATG (SEQ ID NO: 14)
  • Plasmids pET-26b-PD1 (WT) , pET-26b-PD-L1 (WT) , and pET-26b-PD-L1 (H69A) were separately transformed into E. coli BL21 (DE3) electro-competent cells.
  • Plasmid pET-26b-PD-1 (Q75TAG) , pET-26b-PD-1 (D77TAG) , or pET-26b-PD-1 (A129TAG) was each co-transform with plasmid pEvol-FSYRS 29 into E. coli BL21 (DE3) electro-competent cells.
  • transformed bacteria were cultured at 37 °C in 2xYT media with 50 ⁇ g/mL kanamycin and induced with 1 mM IPTG when OD 600 reached 0.8.
  • FSY FSY into proteins
  • transformed bacteria were cultured at 37 °C in 2xYT media with 50 ⁇ g/mL kanamycin and 34 ⁇ g/mL chloramphenicol and induced with 1 mM IPTG, 0.2%arabinose, and 1mM FSY when OD 600 reached 0.8.
  • bacteria were collected by centrifugation at 7000 rpm for 5 min at 4°C.
  • the cell pellets were re-suspended in 10 mL lysis buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 0.5%TritonX-100, lysozyme 1 mg/mL, DNase 0.1mg/mL, and protease inhibitors) per gram of bacteria wet weight.
  • the cell suspension was lysed at 4 °C for 30 min by shaking, and subsequently sonicated with Sonic Dismembrator (Fisher Scientific, 30%output, 3 min, 1 sec off, 1 sec on) in an ice-water bath.
  • Inclusion bodies were recovered by centrifugation of the cell lysate at 20,000 g for 20 min at 4 °C, and then re-suspended in inclusion body 1 st wash buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 10 mM EDTA) . The resuspended solution was centrifugated again at 20,000 g for 20 min at 4 °C, and re-suspended in inclusion body 2 nd wash buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl) .
  • the resuspended solution was then centrifugated at 20,000 g for 20 min at 4°C, and re-suspended in inclusion body solubilization buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 8 M urea) , followed by stirring at 4 °Covernight. Solubilized fraction was clarified by centrifugation at 30,000 g for 30 min at 4 °C. Appropriate volume of Ni-NTA agarose beads (QIAGEN, cat. No. 30210) were added into the supernatant and incubated at 4 °C for 30 min by shaking.
  • the mixture was loaded in a column and washed with wash buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 8 M urea, 4 mM imidazole) in 10 column volume.
  • wash buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 8 M urea, 4 mM imidazole) in 10 column volume.
  • the protein was eluted with elution buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 8 M urea, 300 mM imidazole) and diluted below 0.1 mg/mL with dilution buffer (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, 8 M urea) .
  • UFC900324, MWCO 3 kDa) to concentrate and exchange buffer into PBS (pH 7.3) (for cells and animal experiments) or 20 mM Tris-HCl, pH 8.0, 200 mM NaCl (for in vitro protein crosslinking experiments) three times.
  • Protein concentration was measured by nanodrop (Thermo Fisher) based on its molecular weight and extinction coefficient.
  • WT molecular weight
  • extinction coefficient 14.11
  • PD-L1 molecular weight
  • extinction coefficient 17.55.
  • the refolded proteins were stored at -80 °C.
  • Latent bioreactive Uaas can be genetically incorporated into proteins via the expansion of the genetic code, which specifically react with target natural amino acid residues in proximity 8 10 .
  • the latent bioreactive Uaa FSY is nontoxic to cells and remains inert after being incorporated into proteins 9 .
  • FSY is able to react with natural amino acid residues Tyr, His, and Lys in proximity via the click chemistry sulfur-fluoride exchange (SuFEx) (Fig. 2A) .
  • the inventors reasoned that introducing such a latent bioreactive Uaa into protein drugs at the binding interface would enable the protein drug to covalently bind with its target.
  • the PD-1/PD-L1 immunologic checkpoint was chosen to test this idea.
  • PD-1 is a transmembrane receptor modulating the activity of T cells.
  • PD-L1 is a ligand of PD-1 and often overexpressed in different tumors 11 .
  • the PD-1/PD-L1 interaction inhibits T-lymphocyte proliferation, release of cytokines, and cytotoxicity, resulting in exhaustion and apoptosis of tumor-specific T cells 12, 13 . Therefore, blockage of PD-1/PD-L1 interaction can reverse the dampened antitumor immune response, and several monoclonal antibodies have been generated to target the PD-1/PD-L1 axis for treating cancer 14, 15, 16, 17 .
  • antibodies have inherent limitations including poor tissue/tumor penetrance and adverse Fc-effector functions that deplete immune cells, and for each cancer tested a certain percentage of patients do not respond to existing PD-1/PD-L1 antibody treatment 18, 19 .
  • Alternative non-antibody therapeutics with smaller molecular weights are thus being sought 20, 21 .
  • ectodomain of PD-1 has been engineered to possess high affinity for PD-L1 and used as competitive antagonist of PD-L1 19, 22 .
  • These high affinity PD-1 antagonists showed mixed success in syngeneic mouse models only, and require the extra appendage of Ig domains for in vivo half-life and efficiency.
  • Use of FSY will generate a covalent linkage between PD-1 and PD-L1, creating an irreversible antagonist possessing infinite affinity that is unreachable with any high affinity mutants evolved through natural amino acid mutagenesis.
  • FSY was incorporated into the ectodomain of human PD-1 by expressing in E. coli cells the PD-1 gene containing the amber stop codon (TAG) introduced at the desired site together with the genes for the orthogonal tRNA Pyl /FSYRS pair, which is evolved to incorporate FSY in response to the TAG codon 9 .
  • PD-1 mutant proteins were purified using affinity chromatography and refolded (Fig. 2C, 2D) . Mass spectrometric analysis of the mutant protein confirmed that FSY was incorporated into PD-1 at the TAG-specified position in high fidelity (Fig. 2E) .
  • Purified and refolded PD-1 (WT) , PD-1 (Q75FSY) , PD-1 (D77FSY) , or PD-1 (A129FSY) was incubated with PD-L1 (WT) or PD-L1 (H69A) at the molar ratio of 1: 1 in PBS buffer at 37 °C for 6 h.
  • the amount of PD-L1 was 4 ⁇ g.
  • 5x reduced loading buffer (CWBio, cat. No. CW0027) was added into the incubation and heated at 100 °C for 10 min. These samples were then separated by 15%SDS-PAGE gel followed by staining with Coomassie brilliant blue.
  • the PD-1 (FSY) and PD-1 (FSY) /PD-L1 crosslinked protein samples were digested with trypsin. Digested peptides were analyzed with an in-line EASY-spray source and nano-LC UltiMate 3000 high-performance liquid chromatography system (Thermo Fisher) interfaced with Elite mass spectrometer (Thermo Fisher) . An EASY-Spray PepMap C18 Columns (50 cm; particle size, 2 ⁇ m; pore size, Thermo Fisher) was used to separate peptides using gradient of 2%-40%buffer B (80%acetonitrile, 20%H 2 O, 0.1%formic acid) at flow rate 300 nL/min.
  • Thermo Fisher EASY-Spray PepMap C18 Columns (50 cm; particle size, 2 ⁇ m; pore size, Thermo Fisher) was used to separate peptides using gradient of 2%-40%buffer B (80%acetonit
  • H460 cells (5x10 5 , purchased from CAS Cell Bank, cat. No. SCSP-584) and U-87 cells (5x10 5 , purchased from CAS Cell Bank, cat No. TCHu138) were seeded in 6-well plates and cultured with RPMI-1640 [+10%FBS (Gibco, cat. No. 10099-141) and 1: 100 penicillin–streptomycin (Gibco, cat. No. 15140-122] or DMEM (+10%FBS and 1: 100 penicillin-streptomycin) , respectively. After 6 h, PD-1 (WT) or PD-1 (FSY) was added into culture media in final volume of 800 ⁇ L.
  • WT PD-1
  • FSY PD-1
  • cells were dissociated with 0.25%trypsin-EDTA (Gibco, cat. No. 25200-056) , collected, and lysed by adding 100 ⁇ L RIPA (Beyotime, cat. No. P0013C) with 1x protease inhibitor cocktail (Cell Signaling Technology, cat. No. 5872) followed by ultrasonication. Protein concentration was quantified using the BCA protein assay kit (Beyotime, cat. No. P0010) . The samples were then heated at 100 °C for 10 min after adding 5x reduced loading buffer (CWBio, cat. No. CW0027) .
  • RIPA Beyotime, cat. No. P0013C
  • 1x protease inhibitor cocktail Cell Signaling Technology, cat. No. 5872
  • the denatured samples were analyzed by electrophoresis in 12%SDS-PAGE followed by Western blot using the primary antibody anti-human PD-L1 (Abcam, cat. No. ab213524; 1: 1000) and the internal standard anti- ⁇ -actin (Abcam, cat. No. ab179467; 1: 3000) and the secondary antibody anti-rabbit IgG (Cell Signaling Technology, cat. No. 7074S; 1: 3000) .
  • the protein bands were developed by chemiluminescence (Bio-rad, cat. No. 1705062) .
  • PD-1 PD-1
  • thymus and spleen were separated from BALB/C mice and then grinded by syringes.
  • the obtained cells were re- suspended in DPBS and filtered through 40 ⁇ m filter (Corning, cat. No. 352340) and spun down.
  • These single cells (1x10 6 ) were then seeded into a 6-well plate and cultured in RPMI-1640 containing 10%FBS (Gibco, cat. No. 10099-141) and 1: 100 penicillin-streptomycin (Gibco, cat. No. 15140-122) .
  • PBS, PD-1 (WT) , or PD-1 (FSY) was added into the wells to a final volume of 800 ⁇ L. After incubation for 12 h, cells were harvested for Western blot analysis using procedures similar for H460 and U-87 cells described above.
  • the primary antibody was anti-mouse PD-L1 (Proteintech, cat. No. 66248-1-Ig; 1: 2000) and the secondary antibody was anti-mouse IgG (CST, cat. No. 7076S; 1: 3000) .
  • the primary anti- ⁇ -actin antibody (Abcam, cat. No. ab179467, 1: 3000) and the secondary antibody anti-rabbit IgG (Cell Signaling Technology, cat. No. 7074S, 1: 3000) were used to detect ⁇ -actin as the internal standard.
  • H460 or U-87 cells (2x10 6 ) were resuspended with 200 ⁇ L DPBS and respectively injected into the flank of 6-8-week-old male M-NSG mice (NOD-Prkdc -/- -IL2rg -/Y , Shanghai Model Organisms, China, cat. No. NM-NSG-001) .
  • tumor size was about 4x4 mm 2 .
  • PD-1(WT) or PD-1 (FSY) was injected through tail vein or into the skin site near the tumor. After 3 h, mice were sacrificed, and tumors were harvested. The tumors were added with 200 ⁇ L RIPA (Beyotime, cat.
  • PD-1 WT human PD-1
  • PD-1 (A129FSY) was hereafter referred as PD-1 (FSY) for simplicity.
  • PD-1 (FSY) was hereafter referred as PD-1 (FSY) for simplicity.
  • PD-1 (FSY) covalently targeted the proximal His69 of human PD-L1
  • the inventors generated the PD-L1 (H69A) mutant with His69 mutated to Ala, and found it did not form covalent complex with PD-1 (FSY) (Fig. 3B) .
  • the inventors analyzed the incubation product of PD-1 (FSY) with PD-L1 using high- resolution mass spectrometry, which unambiguously indicated that FSY of PD-1 specifically reacted with the His69 of PD-L1 (Fig. 3C) .
  • PD-1 PD-1 (FSY) was incubated with H460 cells (a human large cell lung cancer cell line) or U87 cells (a human primary glioblastoma cell line) , which both express PD-L1 on cell surface. After incubation, cells were lysed and the lysate analyzed with Western blot (Fig. 3D) .
  • PD-1 (WT) did not crosslink with PD-L1
  • PD-1 (FSY) covalently crosslinked with the endogenous full-length PD-L1 on both cancer cells, and the crosslinking efficiency increased with the concentration of PD-1 (FSY) applied.
  • PD-1 PD-1
  • SSG immunodeficient NOD scid gamma
  • PD-1 (WT) again did not yield any crosslinking with PD-L1
  • PD-1 (FSY) clearly presented covalent crosslinking with PD-L1 in both tumors and through both injection methods, with the crosslinking efficiency increasing with the dose of PD-1 (FSY) injected.
  • Human PD-1 is known to cross-bind with mouse PD-L1 22 .
  • the inventors thus tested if the human PD-1 (FSY) of the present invention could covalently crosslink with mouse PD-L1 on mouse cell surface.
  • Immune cells from mouse thymus and spleen were dissociated and incubated with PD-1 (WT) and PD-1 (FSY) . After incubation and Western blot analysis using similar procedures, no covalent crosslinking of PD-1 (FSY) with mouse PD-L1 was detected (Fig. 4A) .
  • Homology alignment of human and mouse PD-L1 amino acid sequences indicates that the target His69 of human PD-L1 corresponds to Ala69 of mouse PD-L1 (Fig.
  • MLR Mixed lymphocyte reaction
  • Fresh PBMCs were isolated from the peripheral blood of healthy donors by Ficoll (GE Healthcare, cat. No. 17-5442-02) gradient centrifugation. Monocytes were enriched from PBMCs using CD14 microbeads (Miltenyi, cat. No. 130-050-201) . Purified CD14 + monocytes were cultured in RPMI-1640 containing 10%FBS (Gibco, cat. No. 10099-141) , 1: 100 penicillin-streptomycin (Gibco, cat. No. 15140-122) , 100 ng/mL GM-CSF (Peprotech, cat. No. 300-03) , and 50 ng/mL IL-4 (Peprotech, cat. No.
  • CD3 + T cells were enriched from allogeneic PBMCs of the healthy donors by CD3 microbeads (Miltenyi, cat. No. 130-097-043) .
  • CD3 + T cells (1x10 7 ) were labeled with 2 ⁇ M CFSE (eBioscience, cat. No. 65-0850-84) in 1 mL PBS for 15 min at 37 °C; the labeling was stopped by adding 3 mL cold FBS and then washed with cold PBS twice.
  • Mature DC were seeded in 96-well round-bottom plates.
  • PBS, PD-1, or Atezolizumab (CrownBio, cat. No. E4543-T1901) was added into the wells.
  • the CFSE labeled T cells (1x10 5 ) were then added into the wells and co-cultured with the allogeneic DC for 5 days.
  • 30 ⁇ L fresh medium was replenished into every well.
  • cells were collected, stained with anti-human CD3 (BD Pharmingen, cat. No. 561812) , and examined for T cell proliferation using flow cytometry and gating for CD3 + T cells.
  • Culture supernatants were harvested to measure INF- ⁇ concentration using an ELISA kit (Invitrogen, cat. No. 88-7316-76) .
  • Flow cytometry data were analyzed with software Flowjo_V10.
  • PD-1 PD-1
  • MLR mixed lymphocyte reaction
  • the mature DCs were separately treated with PD-1 (FSY) , PD-1 (WT) , or Atezolizumab (an FDA-approved anti-PD-L1 monoclonal antibody for treating cancer) 25 for 2 hours, and then co-cultured with allogeneic CD3 + T cells that were purified from the peripheral blood of healthy donors and pre-stained with the carboxyfluorescein succinimidyl ester (CFSE) dye for monitoring T cell proliferation. After co-culturing for 5 days, flow cytometry was used to analyze CFSE positive CD3 + T cells (Fig. 5A) .
  • CFSE carboxyfluorescein succinimidyl ester
  • PD-1 As shown in the PBS control, co-culturing with DCs increased T cell proliferation, indicated by the increase of CFSE positive cells with CFSE intensity lower than the parental population (CFSE low ) (Fig. 5B, Fig. S2) .
  • PD-1 (WT) did not increase T cell proliferation at concentrations of 50 nM and 250 nM.
  • PD-1 (FSY) elicited a significant dose dependent enhancement of T cell proliferation at both concentrations.
  • the T cell activation effect of PD-1 (FSY) was comparable to that of Atezolizumab applied at the same molar concentrations.
  • cytokine interferon ⁇ released by T cells in the culture were measured with ELISA (Fig. 5C) .
  • PD-1 (WT) did not increase INF- ⁇ production at concentration of 50 nM, and had a moderate increase (0.77 fold) at 250 nM.
  • PD-1 (FSY) elicited a marked increase of INF- ⁇ production (3.4 fold) at concentration of 50 nM, and a further increase to 4.1-fold at 250 nM.
  • the effect on INF- ⁇ production of PD-1 (FSY) is again comparable to that of Atezolizumab.
  • PBMC peripheral blood mononuclear cells
  • 3 ⁇ g/mL anti-CD3 antibody (BD pharmingen, cat. No. 555329) coated in the 12-well flat plate and 1 ⁇ g/mL anti-CD28 antibody (BD pharmingen, cat. No. 555725) and cultured in RPMI-1640 containing 10%FBS, 1: 100 penicillin-streptomycin (Gibco, cat. No. 15140-122) , 100 IU/mL IL-2 (PeproTech, cat. No. AF-200-02-500) , and 2 mM glutamine (Gibco, cat. No. 25030-081) .
  • penicillin-streptomycin (Gibco, cat. No. 15140-122)
  • 100 IU/mL IL-2 (PeproTech, cat. No. AF-200-02-500)
  • 2 mM glutamine (Gibco, cat. No. 25030-081) .
  • the cell mixture was injected into the flank of the 6-8 week old male M-NSG mice (NOD-Prkdc -/- -IL2rg -/Y , Shanghai Model Organisms, China, cat. No. NM-NSG-001) .
  • PBS, 22 ⁇ g PD-1 (WT) , 22 ⁇ g PD-1 (FSY) , or 200 ⁇ g atezolizumab was administered through tail intravenous injection after 3 h and every 6 days (on day 6, 12, 18, 24, 30, 36, 42) .
  • 11 ⁇ g PD-1 (FSY) or 100 ⁇ g atezolizumab was administered through tail intravenous injection after 3 h and every 3 days (on day 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42) .
  • tumor length was close to 15 mm, and mice were sacrificed for analyses.
  • PD-1 PD-1
  • FSY PD-1
  • the inventors sought to evaluate its antitumor activity in vivo. Since PD-1 (FSY) was covalently specific to human PD-L1 but not to mouse PD-L1, the inventors did not use syngeneic immune competent mouse models but resorted to immune deficient mouse models reconstituted with human immune cells, which are more predictive preclinical models for onco-immunotherapy 26 . In contrast, two high affinity mutants of human PD-1 previously reported both cross-bind with mouse PD-L1, and their antitumor effect was evaluated for inhibiting mouse PD-L1 in mouse models with a fully murine immune system only 19, 22 .
  • the inventors co-implanted the immunodeficient NSG mouse with a mixture of human tumor H460 cells and human PBMCs.
  • Human PBMCs were activated with anti-CD3 and CD28 antibodies for 3 days and then co-cultured with H460 cells for 7 days (Fig. 6A) .
  • a mixture of these PBMCs with H460 (ratio 1: 4) were subcutaneously injected into the flanks of immunodeficient NSG mice.
  • PD-1 proteins or Atezolizumab were subsequently administrated via intravenous tail injection every 3 days (for low dose) or every 6 days (for high dose) . Tumor growth was monitored for 44 days. As expected, the tumors of vehicle-treated mice (PBS control) grew rapidly.
  • the dissected tumors at day 44 are shown in Fig. 6D and their weights compared in Fig. 6E. PD-1 (FSY) -treated tumors were significantly lower in weight than those treated with PD-1 (WT) (P ⁇ 0.001) , and were comparable to those treated with Atezolizumab.
  • Atezolizumab in Patients with Locally Advanced and Metastatic Urothelial Carcinoma Who Have Progressed Following Treatment with Platinum-Based Chemotherapy: a Single-Arm, Multicentre, Phase 2 Trial. Lancet 2016, 387 (10031) , 1909–1920.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne une approche utilisant des agents thérapeutiques réactifs, activés par la proximité (PERx), afin de générer des médicaments à base de protéines covalentes. Un acide aminé bioréactif latent FSY a été incorporé dans la protéine 1 de mort cellulaire programmée humaine (PD-1), qui a réagi sélectivement avec une histidine proximale de PD-L1 humaine lors de la liaison, permettant une liaison irréversible de PD-1 avec PD-L1 in vitro, sur des cellules cancéreuses et dans une tumeur murine. Lorsqu'elle est administrée dans des modèles de souris humanisées, la PD-1 covalente (FSY) présente un effet anti-tumoral robuste sur la PD-1 de type sauvage, ce qui permet d'obtenir une efficacité thérapeutique équivalente à l'atézolizumab anticorps monoclonal thérapeutique, approuvé par la FDA. L'approche PERx devrait fournir un procédé général qui permettrait de convertir des protéines d'interaction en médicaments à base de protéines covalentes afin d'obtenir une efficacité thérapeutique élevée.
PCT/CN2019/120572 2019-11-25 2019-11-25 Médicaments à base de protéines covalentes développés par l'intermédiaire d'agents thérapeutiques réactifs activés par la proximité (perx) WO2021102624A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201980068498.6A CN113179631A (zh) 2019-11-25 2019-11-25 通过临近使能反应疗法开发的共价蛋白质药物
PCT/CN2019/120572 WO2021102624A1 (fr) 2019-11-25 2019-11-25 Médicaments à base de protéines covalentes développés par l'intermédiaire d'agents thérapeutiques réactifs activés par la proximité (perx)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2019/120572 WO2021102624A1 (fr) 2019-11-25 2019-11-25 Médicaments à base de protéines covalentes développés par l'intermédiaire d'agents thérapeutiques réactifs activés par la proximité (perx)

Publications (1)

Publication Number Publication Date
WO2021102624A1 true WO2021102624A1 (fr) 2021-06-03

Family

ID=76129021

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2019/120572 WO2021102624A1 (fr) 2019-11-25 2019-11-25 Médicaments à base de protéines covalentes développés par l'intermédiaire d'agents thérapeutiques réactifs activés par la proximité (perx)

Country Status (2)

Country Link
CN (1) CN113179631A (fr)
WO (1) WO2021102624A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023122753A1 (fr) * 2021-12-22 2023-06-29 Enlaza Therapeutics, Inc. Anticorps de réticulation
WO2023208081A1 (fr) * 2022-04-28 2023-11-02 Shenzhen Bay Laboratory Fluorosulfate substitué et son utilisation
WO2024097831A1 (fr) * 2022-11-02 2024-05-10 The Regents Of The University Of California Protéines bioréactives contenant des acides aminés non naturels

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115762662A (zh) * 2022-11-30 2023-03-07 苏州创腾软件有限公司 基于图神经网络的特定靶标药物生成方法、装置和MaxFlow平台

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104803865A (zh) * 2004-12-22 2015-07-29 Ambrx公司 含有非天然氨基酸和多肽的组合物、涉及非天然氨基酸和多肽的方法以及其用途
WO2019173760A1 (fr) * 2018-03-08 2019-09-12 The Regents Of The University Of California Compositions bioréactives et leurs procédés d'utilisation

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201805963D0 (en) * 2018-04-11 2018-05-23 Avacta Life Sciences Ltd PD-L1 Binding Affirmers and Uses Related Thereto

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104803865A (zh) * 2004-12-22 2015-07-29 Ambrx公司 含有非天然氨基酸和多肽的组合物、涉及非天然氨基酸和多肽的方法以及其用途
WO2019173760A1 (fr) * 2018-03-08 2019-09-12 The Regents Of The University Of California Compositions bioréactives et leurs procédés d'utilisation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
WANG NANXI, YANG BING, FU CAIYUN, ZHU HE, ZHENG FENG, KOBAYASHI TOMONORI, LIU JUN, LI SHANSHAN, MA CHENG, WANG PENG G., WANG QIAN,: "Genetically Encoding Fluorosulfate-l-tyrosine To React with Lysine, Histidine, and Tyrosine via SuFEx in Proteins in Vivo", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 140, no. 15, 30 March 2018 (2018-03-30), pages 4995 - 4999, XP055816028, ISSN: 0002-7863, DOI: 10.1021/jacs.8b01087 *
YANG BING, WANG NANXI, SCHNIER PAUL D., ZHENG FENG, ZHU HE, POLIZZI NICHOLAS F., ITTUVEETIL AVINASH, SAIKAM VARMA, DEGRADO WILLIAM: "Genetically Introducing Biochemically Reactive Amino Acids Dehydroalanine and Dehydrobutyrine in Proteins", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 141, no. 19, 30 April 2019 (2019-04-30), pages 7698 - 7703, XP055816032, ISSN: 0002-7863, DOI: 10.1021/jacs.9b02611 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023122753A1 (fr) * 2021-12-22 2023-06-29 Enlaza Therapeutics, Inc. Anticorps de réticulation
WO2023208081A1 (fr) * 2022-04-28 2023-11-02 Shenzhen Bay Laboratory Fluorosulfate substitué et son utilisation
WO2024097831A1 (fr) * 2022-11-02 2024-05-10 The Regents Of The University Of California Protéines bioréactives contenant des acides aminés non naturels

Also Published As

Publication number Publication date
CN113179631A (zh) 2021-07-27

Similar Documents

Publication Publication Date Title
Li et al. Developing covalent protein drugs via proximity-enabled reactive therapeutics
KR102427192B1 (ko) 항-인간 4-1bb 항체 및 그의 용도
CN111094345B (zh) 具有人结构域的抗b细胞成熟抗原嵌合抗原受体
AU2021351815B2 (en) Screening and antitumor use of kras mutation specific t cell receptor
WO2021102624A1 (fr) Médicaments à base de protéines covalentes développés par l'intermédiaire d'agents thérapeutiques réactifs activés par la proximité (perx)
KR102309950B1 (ko) 체크포인트 억제제 이중특이적 항체
US20240117068A1 (en) Antigen binding proteins specifically binding mage-a
JP2021521776A (ja) Ｍａｇｅ−ｂ２特異性を有するｔ細胞受容体およびその使用
WO2013185552A1 (fr) Récepteur antigénique chimérique indépendant à double signal et son utilisation
KR20190025855A (ko) 개선된 입양 t-세포 요법
KR20180016321A (ko) 프로그램화된 세포 사멸 단백질 리간드-1 (pd-l1)에 대한 항체 및 이의 용도
US11925679B2 (en) H3.3 CTL peptides and uses thereof
US20180230219A1 (en) Vegfr-2 car immune cells to treat cancers
EP4209503A1 (fr) Mutant d'il-2 et son utilisation
US20220118069A1 (en) H3.3 ctl peptides and uses thereof
KR20180016320A (ko) 프로그램화된 세포 사멸 단백질(pd-1)에 대한 신규 항체 및 이의 용도
JP2024512470A (ja) Ｔ細胞調節ポリペプチド及びその使用方法
JP2021536256A (ja) 修飾ｔ細胞に対する条件的活性型キメラ抗原受容体
CN112533629A (zh) 结合使用il-10药剂与嵌合抗原受体细胞疗法的组合物和方法
IL303629A (en) Recombinant CD3 binding proteins and their use
CN113195526A (zh) 针对过继性t细胞疗法中的突变myd88l265p蛋白表位的特异性t细胞受体
EP3882271A2 (fr) Anticorps anticancéreux convertible en cellules t régulatrices inductibles par ifn-gamma (irtca) et ses utilisations
EP4047021A1 (fr) Anticorps bispécifique ox40/pd-l1
EP4101862A1 (fr) Protéine de fusion antitumorale, son procédé de préparation et son utilisation
CN111714618B (zh) T细胞和高亲和力pd-1融合蛋白的组合

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19954215

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19954215

Country of ref document: EP

Kind code of ref document: A1