WO2021102420A1 - Signalisation de l'interféron en tant que biomarqueur du cancer - Google Patents

Signalisation de l'interféron en tant que biomarqueur du cancer Download PDF

Info

Publication number
WO2021102420A1
WO2021102420A1 PCT/US2020/061827 US2020061827W WO2021102420A1 WO 2021102420 A1 WO2021102420 A1 WO 2021102420A1 US 2020061827 W US2020061827 W US 2020061827W WO 2021102420 A1 WO2021102420 A1 WO 2021102420A1
Authority
WO
WIPO (PCT)
Prior art keywords
interferon
cancer
patient
inhibitor
target genes
Prior art date
Application number
PCT/US2020/061827
Other languages
English (en)
Inventor
Caius Gabriel Radu
Evan ABT
Amanda DANN
Timothy Donahue
Alexandra MOORE
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2021102420A1 publication Critical patent/WO2021102420A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • Pancreatic ductal adenocarcinoma is a devastating disease for which new, rationally designed therapies are urgently needed.
  • PD AC Pancreatic ductal adenocarcinoma
  • a dense stromal compartment and an inflammatory, cytokine rich microenvironment are defining characteristics of PD AC tumors.
  • interferons are particularly important as they regulate the expression of hundreds of genes, many of which have established pro- or anti-tumor functions.
  • PD AC In addition to a near universal penetrance of KRAS mutations and a dense stromal component, PD AC is defined by a pro-inflammatory, cytokine-rich tumor microenvironment.
  • interferons IFNs
  • Type I IFNs IFNa, IFN and IFN/.
  • FFNa, IFN and IFN/. Type I IFNs are constitutively produced in the PD AC tumor microenvironment by stromal, immune, and potentially tumor cells (FIG. 1).
  • Type I IFNs One signaling network regulating the production of type I IFNs is the cyclic guanosine monophosphate-adenosine monophosphate synthase (cGAS)/stimulator of IFN genes (STING) pathway which is induced by cytoplasmic single-stranded and double-stranded DNA (ssDNA, dsDNA).
  • Type I IFNs function by binding to specialized receptors, IFNAR1 and IFNAR2, and inducing a JAK1/TYK2 -mediated signaling cascade which results in transcriptional activation of hundreds of IFN-stimulated genes including STAT1 and MX1, canonical surrogate markers of type I IFN signaling.
  • IFNs exert both pro- and anti-tumor effects: IFNs impair cancer cell proliferation in vitro but chronic exposure has been linked with resistance to radiation, chemotherapy and immune checkpoint blockade. Additionally, it remains to be determined if IFN signaling in tumors can be leveraged therapeutically.
  • PD AC tumors undergo extensive metabolic reprogramming that enables them to adapt to chronic nutrient deprivation and also functions as a form of immunosuppressive microenvironmental conditioning.
  • Drivers of metabolic reprogramming in PD AC include oncogenes (KRAS), physiologic factors (hypoxia), and heterotypic cellular interactions with stromal cells and immune cells.
  • Type I IFNs have been linked to the regulation of lipid and energy metabolism in immune and epithelial cells, however, whether and how type I IFN signaling reprograms PD AC metabolism remains to be determined. (Refs.1-18).
  • kits for treating cancer in a patient in need thereof comprising administering to the patient an effective amount of an ATR kinase inhibitor and/or a NAMPT inhibitor; wherein the cancer has increased levels of IFN or IFN signaling pathway activity.
  • kits for treating cancer in a patient in need thereof comprising determining the level of IFN or IFN signaling pathway activity in a sample obtained from a patient; and administering to the patient an effective amount of an ATR kinase inhibitor and/or a NAMPT inhibitor.
  • kits for classifying a cancer in a subject comprising measuring expression levels of a plurality of target genes in RNA from a sample obtained from the patient; comparing expression levels of the plurality of target genes to a control; and classifying the cancer as responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor.
  • the methods further comprise administering to the patient an effective amount of an ATR kinase inhibitor and/or a NAMPT inhibitor.
  • kits for identifying a cancer patient responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor comprising measuring expression levels of a plurality of target genes in a sample obtained from the cancer patient, thereby identifying that the cancer patient is responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor.
  • the methods further comprise administering to the patient an effective amount of an ATR kinase inhibitor and/or a NAMPT inhibitor.
  • FIG. 1 depicts interferon pathways.
  • Interferons are pleiotropic cytokines that modulate multiple aspects of cancer cell biology. Measured intracellular dNTPs vs. estimated dNTPs required for DNA replication in mammalian cells.
  • cGAS cyclic GMP-AMP synthase
  • STING stimulator of interferon genes
  • ISRE interferon-sensitive response element
  • IFNAR interferon-alpha/beta receptor
  • IFNGR interferon-gamma receptor
  • FIG. 2 demonstrates that IFN signaling biomarkers are enriched in PD AC tumors.
  • IHC immunohistochemistry
  • FIGS. 3A-3K demonstrate IFN signaling biomarkers are enriched in PD AC and IFN activates the replication stress response pathway.
  • FIG. 3A presents analysis of IFN response metagene signature in the TCGA PD AC dataset.
  • FIG. 3B are representative immunohistochemistry (IHC) images of primary PD AC samples probed for total STAT1 and plot histoscores from 26 PD AC tumors. Histoscores were calculated as a sum of the intensity of staining (0, negative; 1, weak; 2, median; or 3, strong) multiplied by the percentage of tumor cells at that intensity (0-300 range).
  • IHC immunohistochemistry
  • FIG. 3C presents immunoblot analysis of DANG cells treated ⁇ 100 U/mL IKNb for the indicated timepoints in vitro and lysates prepared from SUIT2 cells grown as subcutaneous tumors in NSG mice. Immunoblot analysis of DANG PD AC cells.
  • FIG. 3D is nLC-MS/MS proteomics/phosphoproteomics analysis of SUIT2 cells treated ⁇ 100 U/mL IKNb for 24 hours. An FDR of 1% was used to identify significantly altered proteins. An FDR of 0.1% was used to identify significantly altered phosphopeptides. KSEA analysis was used to identify significantly-altered phosphoproteins.
  • FIG. 3E is a graph showing ATR substrates identified by KSEA as being significantly altered by IKNb from experiment in FIG. 3D.
  • FIG. 3F is an immunoblot analysis of SUIT2 cells treated with 100 U/mL IRNb for indicated time-points.
  • FIG. 31 is immunoblot analysis of a panel of PDAC cell lines treated ⁇ 100 U/mL IKNb for 24 hours.
  • FIG. 3K are representative images for STAT1 and phospho- CHEK1 S345 IHC analysis of serial sections of PDAC patient tumor samples.
  • FIGS. 4A-4F demonstrate Type I IFN signaling restricts dNTP pools.
  • FIG. 4A illustrates the experimental approach to investigate the effects of IFN signaling on nucleotide metabolism in PDAC cells.
  • FIGS. 4B-C are graphs showing LC-MS/MS analysis of dNTP pools in SUIT2 (B) and YAPC (C) cells treated for 24 hours ⁇ 100 U/mL IKNb in media containing 1 g/L
  • glucose (mean ⁇ SD; n 3).
  • FIG. 4D is a graph summary of nucleotide metabolism genes significantly altered by IRNb treatment as determined by nLC-MS/MS in FIG. ID.
  • FIG. 4A illustrates the experimental approach to investigate the effects of IFN signaling on nucleotide metabolism in PDAC cells.
  • FIGS. 4B-C are graphs showing LC-MS/MS analysis of dNTP pools in SUIT2 (B) and YAPC (C) cells treated for
  • FIG. 4E is an immunoblot analysis of SUIT2 and YAPC cells treated ⁇ 100 U/mL IITMb or ⁇ 10 ng/mL IFNy for 24 hours.
  • FIG. 4F depicts a working model summarizing the interactions between IFN and nucleotide metabolism.
  • FIGS. 5A-5K demonstrate that STING controls IFN signaling and nucleotide metabolism in xenograft tumors.
  • FIG. 5A is a schematic of the regulation of autocrine/paracrine IKNb production by the cGAS/STING signaling pathway.
  • FIG. 5A is a schematic of the regulation of autocrine/paracrine IKNb production by the cGAS/STING signaling pathway.
  • FIG. 5E is immunoblot analysis of STING 1224 TM subcutaneous tumors at the endpoint of experiment in FIG. 5D.
  • FIG. 5G is an immunoblot analysis of DANG STING WT and STING KO tumors at the endpoint of experiment in FIG. 5F.
  • FIG. 5H presents growth curves of SUIT2 TetR; STING 1224 TM LUC orthotopic tumors in NCG mice treated ⁇ DOX measured using bioluminescence (BLI) imaging (mean ⁇ SD.
  • FIG. 51 presents immunoblot analysis of SUIT2 TetR; STING 1224 TM: LUC orthotopic tumors at the endpoint of experiment in FIG. 5H.
  • FIG. 5J is data presenting [ 18 F]FLT PET analysis of SUIT2 TetR; STING 1224 TM subcutaneous tumors.
  • FIG. 5K is data presenting [ 18 F]FDG PET analysis of SUIT2 TetR; STING 4124 TM subcutaneous tumors.
  • FIGS. 6A-6G demonstrate ATR inhibitors synergize with IFN.
  • FIG. 6A represents the high-throughput phenotypic screen evaluating the anti-proliferative effects of 430 protein kinase inhibitors, tested at 7-point dose response, against SUIT2 cells treated ⁇ 100 U/mL IRNb for 72 hours (DDR: DNA damage response; RSR: replication stress response).
  • DDR DNA damage response
  • RSR replication stress response
  • FIG. 6G demonstrates propidium iodide (PI) cell cycle analysis of a panel of PDAC cell lines treated ⁇ 100 U/mL ⁇
  • FIGS. 7A-7C demonstrate ATR inhibitors and IFN synergistically impair de novo nucleotide biosynthesis by down-regulating E2F target genes.
  • FIG. 7A presents immunoblot analysis of PD AC cell lines characterized as sensitive (red) or insensitive (black) to the combination of PTMb and berzosertib (ATRi). Cells were treated for 48 hours ⁇ 100 U/mL IRNb ⁇ 250 nM ATRi.
  • FIGS. 8A-8E demonstrate ATR inhibition impairs the growth of PD AC cells with high interferon signaling.
  • FIG. 8B are representative images from the endpoint of experiment in FIG. 8A.
  • FIG. 8C is a pictorial of the approach to test the interaction between STING activation and ATR inhibition in vivo.
  • FIG. 8D are representative BLI images of tumor bearing mice 21 days following initiation of doxycycline treatment.
  • FIG. 8E is a graph of the fold change in BLI signal on day 21 compared to baseline signal.
  • FIGS. 9A-9C demonstrate analysis of the IFN signature in TCGA, GTEX and CCLE datasets.
  • FIG. 9A is an analysis of the IFN response metagene signature across TCGA and GTEX datasets ordered by fold change in median tissue-matched TCGA/GTEX values (PAAD: pancreatic adenocarcinoma).
  • FIG. 9B presents extended analysis of data in FIG. 9A.
  • FIG. 9C presents heatmap analysis of the IFN response metagene signature in the CCLE pancreatic cancer cell line dataset. Columns represent individual pancreas cancer cell lines.
  • FIGS. 10A-10C represent immunohistochemistry analysis of IFN signaling biomarkers in primary patient specimens.
  • FIGS. 11A-11D demonstrate extended analysis of IFN signaling in PD AC cells and patient samples.
  • FIG. 11A presents immunoblot analysis of a panel of PD AC cell lines treated ⁇ 100 U/mL IFN for 24 hours.
  • FIG. 11B graphically depicts reactome gene ontology analysis of significantly altered proteins following treatment with IFN for 24 hours from FIG. 3D.
  • FIG. 11A presents immunoblot analysis of a panel of PD AC cell lines treated ⁇ 100 U/mL IFN for 24 hours.
  • FIG. 11B graphically depicts reactome gene ontology analysis of significantly altered proteins following treatment with IFN for 24 hours from FIG. 3D.
  • FIGS. 12A-12G demonstrate Type I IFN signaling up-regulates SAMHD1 mediated nucleotide pool phosphohydrolysis and restricts DNA synthesis.
  • FIG. 12A is a chart providing a summary of genes related to nucleotide catabolism significantly altered by IRNb in SUIT2 cells.
  • FIG. 12B presents immunoblot validation of SUIT2 SAMHD1 CRISPR/Cas9 knockout (KO) and dCK KO isogenic cells.
  • FIG. 12C provides the experimental design.
  • FIG. 12A is a chart providing a summary of genes related to nucleotide catabolism significantly altered by IRNb in SUIT2 cells.
  • FIG. 12B presents immunoblot validation of SUIT2 SAMHD1 CRISPR/Cas9 knockout (KO) and dCK KO isogenic cells.
  • FIG. 12C provides the experimental design.
  • FIG. 12F presents time-course immunoblot analysis of IRNb treated SUIT2 cells. For extended treatment studies cells were passaged and media was refreshed every 72 hours. FIG.
  • FIGS. 13A-13F demonstrate nucleoside phosphorylases and kinases mediate nucleoside efflux.
  • FIG. 13A is a schematic overview of dGTP biosynthesis, catabolism and recycling.
  • glucose labeled n+5
  • dG or dC counts were normalized to internal standard counts.
  • FIG. 13C is a schematic representation of the roles of SAMHD1 and nucleoside kinases deoxycytidine kinase (dCK) and thymidine kinase 1 (TK1) in regulating dN efflux in IFN-treated cells.
  • FIG. 13D presents immunoblot validation of TK1 KO SUIT2 cells treated with 100 U/mL IRNb for 24 hours.
  • FIG. 13E provides LC-MS/MS analysis of dT and dC efflux following 24 hours treatment of SUIT2 parental and TK1 KO cells with 100 U/mL IRNb in media containing 1 g/L 1 13 G, I glucose.
  • dRIP deoxyribose-1 -phosphate
  • PNP purine nucleoside phosphorylase.
  • FIGS. 14A-14H demonstrate the cGAS/STING pathway is active in a subset of PD AC cell lines.
  • FIG. 14A shows analysis of STING (TMEM173) transcript levels across TCGA tumor datasets relative to normal tissue (PAAD: pancreatic adenocarcinoma).
  • FIG. 14D provides immunoblot analysis of cGAS and STING expression in a panel of PDAC cell lines.
  • FIG. 14F presents immunoblot analysis of DANG cells following transfection with 10 pg/mL 2’-3’- cGAMP ⁇ 1 pM ruxolitinib (JAKi).
  • FIG. 14G presents immunoblot analysis of DANG cells following transfection with 10 pg/mL cGAMP ⁇ 1 pM JAKi.
  • FIGS. 15A-15G demonstrate tumor cell STING mediates constitutive IFN signaling in PDAC tumors.
  • FIG. 15A Immunoblot analysis of SUIT2 cells treated ⁇ 100 U/mL IEMb for the indicated timepoints in vitro and lysates prepared from SUIT2 cells grown as subcutaneous tumors in NSG mice.
  • FIG. 15B is an immunoblot analysis of SUIT2 TetR-GFP or TetR- STING R248M cells treated ⁇ 50 ng/mL DOX for 72 hours.
  • FIG. 15C is immunoblot validation of DANG parental and STING CRISPR/Cas9 knockout (KO) cells.
  • FIG. 15A Immunoblot analysis of SUIT2 cells treated ⁇ 100 U/mL IEMb for the indicated timepoints in vitro and lysates prepared from SUIT2 cells grown as subcutaneous tumors in NSG mice.
  • FIG. 15B is an immunoblot analysis of SUIT2 TetR-GFP or Te
  • FIG. 15D are images presenting IHC analysis of subcutaneous DANG WT and STING KO xenograft tumors from FIG. 5F.
  • FIG. 15G is immunoblot analysis of protein lysates prepared from HS766T WT and STING KO subcutaneous xenograft tumors.
  • FIGS. 16A-16I demonstrates IFN signaling increases tumor cell [ 18 F]FLT accumulation in vitro and in vivo.
  • FIG. 16A is a schematic of the regulation of FLT accumulation by competition with the endogenous substrate for TK1, thymidine (dT).
  • FIG. 16C presents immunoblot analysis of SUIT2 shC and shTYMP cells treated ⁇ 100 U/mL IRNb for 24 hours.
  • FIG. 16E presents immunoblot analysis of SUIT2 and YAPC cells treated with either 100 U/mL IEMb or 10 ng/mL IFNy for 24 hours.
  • FIG. 16H pictorially represents results of [ 18 F]FLT and [ 18 F]FDT analysis bilateral SUIT2 TetR; STING R248M and SUIT2 TetR; STING ®24 TM tumor-bearing mice treated with DOX.
  • FIG. 16H pictorially represents results of [ 18 F]FLT and [ 18 F]FDT analysis bilateral SUIT2 TetR; STING R248M and SUIT2 TetR; STING ®24 TM tumor-bearing mice treated with DOX.
  • FIGS. 17A-17C illustrate replication stress response inhibitors and IKNb exhibit synergy in PD AC cells.
  • FIG. 17A is a schematic of the replication stress response pathway and related small molecule inhibitors.
  • FIG. 17C is an immunoblot analysis of SUIT2 cells treated with 100 U/mL IFN ⁇ 500 nM berzosertib or 1 mM AZD-6738.
  • FIGS. 18A-18H show IFN and ATR inhibitors synergistically induce DNA damage and apoptosis.
  • FIG. 18A are representative ssDNA immuno-fluorescence microscopy images from experiment in FIG. 6C.
  • FIG. 18B provides representative inflow cytometry plots from experiment in FIG. 6D.
  • FIG. 18C provides representative inflow cytometry plots from experiment in FIG. 6E.
  • FIG. 18D provides cell cycle and immunoblot analysis of SUIT2 cells treated with 100 U/mL IRNb + 500 nM berzosertib (ATRi) ⁇ 5 mM palbociclib (CDK4/6i) as indicated.
  • FIGS. 18E are graphs showing cell cycle analysis of A13A primary PD AC cells treated ⁇ 100 U/mL IEMb ⁇ 500 nM ATRi for 24 hours.
  • FIG. 18G are graphs showing flow cytometry cell cycle analysis of human pancreatic ductal epithelial (HPDE) cell treated ⁇ 100 U/mL IRNb ⁇ 500 nM ATRi for 24 hours.
  • FIGS. 19A-19C show ATR inhibition down-regulates nucleotide metabolism related protein expression in IFN-exposed PD AC cells.
  • FIG. 19A presents immunoblot analysis of SUIT2 cells treated for 48 hours with a titration of berzosertib (ATRi) in the presence of 100 U/mL IRNb.
  • FIG. 19C presents immunoblot analysis of SUIT2 cells treated as indicated in the presence of the proteasome inhibitor MG132.
  • FIGS. 20A-20C demonstrate STING activation sensitizes PD AC cells to ATR inhibition.
  • FIG. 20A presents immunoblot analysis of YAPC STING R248M cells treated ⁇ 50 ng/mL doxy cy dine (DOX) ⁇ 1 mM ruxolintinib (JAKi) ⁇ 100 U/mL PTMb for the indicated timepoints.
  • DOX doxy cy dine
  • JAKi ruxolintinib
  • FIG. 20C is a graph showing IncuCyte live-cell imaging analysis of SUIT2 TetR STING 12248141 cells treated + 50 ng/mL DOX ⁇ 500 nM ATRi ⁇
  • FIGS. 21A-21F demonstrate IRNb and ATR inhibitors synergistically enhance sensitivity to olaparib in PD AC cells.
  • FIG. 21A presents an immunoblot analysis of SUIT2 and DANG PDAC cell lines treated for 24 hours ⁇ 100 U/mL Nb ⁇ 250 nM ATRi.
  • FIG. 21B is an image of crystal violet proliferation analysis of SUIT2 cells treated with 100 U/mL IRNb ⁇ 100 nM ATRi ⁇ 4 mM olaparib for 7 days.
  • FIG. 21A presents an immunoblot analysis of SUIT2 and DANG PDAC cell lines treated for 24 hours ⁇ 100 U/mL Nb ⁇ 250 nM ATRi.
  • FIG. 21B is an image of crystal violet proliferation analysis of SUIT2 cells treated with 100 U/mL IRNb ⁇ 100 nM ATRi ⁇ 4 mM olaparib for 7 days.
  • FIGS. 22A-22C demonstrate SAMHD1 is induced by IRNb in cancer-associated fibroblasts.
  • FIG. 22A is a schematic representation of potential metabolic crosstalk between PD AC cancer cells and PD AC cancer associated fibroblasts (CAFs).
  • FIG. 22B presents an immunoblot of human pancreatic CAFs treated with 100 U/mL IITMb for 24 hours.
  • FIG. 23 provides the resources used as described in Example 3.
  • FIGS. 24A-24F show that type I IFN in the tumor microenvironment reduces NAD(H) levels in PD AC cells.
  • FIGS. 24B-24C Effects of IRNb on NAD(H) levels across a panel of PDAC cell lines. NAD and NADH levels in indicated PDAC cells were measured after 24 h culture with and without 100 U/mL IRNb.
  • FIG. 24F Type I IFN signaling is present in a subset of PDAC tumors.
  • FIGS. 25A-25B show that IKNb elevates the expression of NAD(H) consuming enzymes PARP9, PARP10, and PARP14.
  • FIG. 25A PARP9, PARP10, and PARP14 transcription levels were significantly upregulated after exposure to IRNb.
  • FIG. 25B PARP9, PARPIO, and PARP14 protein levels were measured after exposure to PTMb.
  • Indicated PD AC cells were cultured with 100 U/mL IKNb prior to immunoblot analysis of PARP9, PARPIO, and PARP14 protein levels in whole cell lysates. *, PO.05. ** PO.01. ***, P0.001. ****, P0.0001.
  • FIGS. 26A-26H show PARP9, PARP 10, and P ARP 14 induction by IKNb reduces NAD(H) levels.
  • FIGS. 26A-26B PARP9, PARPIO, and PARP 14 were knocked down by three shRNAs per gene in Pane 03.27 and SUIT2 cells. MX1, PARP9, PARPIO, and PARP 14 protein levels were measured with and without exposure to PTMb 100 U/mL.
  • FIG. 26G subsets of PD AC tumors within the TCGA pancreatic cancer dataset with high and low expression levels of type 1 IFN signaling (STAT1 and MX1) and PARP9, PARPIO, and PARP 14.
  • FIG. 26H PDAC PDX models with high or low levels of PARP9, PARPIO, and PARP14 in tumor sections from PDAC PDX models XWR6, XWR60, XWR8, and XWR200. *, PO.05; **, PO.01; ***, P0.001; ****, P0.0001.
  • FIGS. 27A-27J show type 1 IFN signaling results in NAD(H) consumption through upregulation of PARP9/10/14, increasing PDAC cell dependency onNAMPT and sensitizing them to NAMPT inhibitors (NAMPTi) in vitro.
  • FIGS. 27A-27B IEMb enhanced the NAD(H)- depleting effect of NAMPTi
  • Pane 03.27 and SUIT2 cells were cultured with 100 U/mL IITMb and 8 nM NAMPTi FK866 for 24 hours prior to NAD and NADH measurements.
  • FIGS. 27C- 27D IRNb and NAMPTi inhibited mitochondrial respiration and decreased glycolytic reserve in Pane 03.27 cells.
  • FIG. 27E Western blot demonstrated increased pAMPK expression in combination- treated PDAC cells compared to either treatment alone which is rescued by NR supplementation.
  • SUIT2 cells were incubated +/- 100 U/mL IRNb +/1 8 nM FK866 +/1 500 uM NR for 48 hours.
  • FIG. 27F NAD(H) reduction by IRNb/NAMRT ⁇ suppressed PARP activity in DNA repair. Pane 03.27 cells were exposed to indicated treatments for 48 hours prior to immunoblot analysis of MX1 and PARP.
  • FIG. 27G IKNb enhanced the effect of NAMPTi on inducing DNA damage.
  • Pane 03.27 cells were incubated ⁇ /- 100 U/mL IKNb ⁇ /- 8 nM FK866 ⁇ /- 500 uM NR for 48 hours prior to pH2A.X quantification by flow cytometry.
  • FIG. 27H-27I IRNb enhanced the effect of NAMPTi on inducing apoptosis.
  • Pane 03.27 cells were incubated ⁇ /- 100 U/mL IRNb ⁇ /- 8 nM FK866 ⁇ /- 500 uM NR for 48 hours prior to Annxin V/propidium iodide (PI) quantification by flow cytometry. Apoptosis was quantified by the amount of Annexin V positive cells.
  • FIG. 27J proposed model of NAD depletion induced by inhibition of NAMPT in combination with IRNb signaling, thus blocking salvage of the NAM product of PARP9/10/14.
  • FIGS. 28A-28F show that Type I IFN signaling sensitizes PD AC cells to NAMPT inhibitors (NAMPTi) in vitro.
  • FIGS. 28A-28B PTMb enhances the potency of NAMPTi in both 2D and 3D cultures.
  • PDAC cell lines and primary PDAC cultures (A2.4 and AM1283) were treated with NAMPTi FK866 or LSN3154567 for 72 h with and without 100 U/mL IRNb supplementation. Cell viability was measured by CellTiter-Glo assay and IC50 values were determined using GraphPad Prism 7.
  • FIGS. 28C-28D Cytotoxicity of the combination of IITMb and NAMPTi in PDAC cells was rescued by nicotinamide riboside (NR) supplementation.
  • NR nicotinamide riboside
  • FIGS. 28E IKNb sensitizes cells to NAMPTi in both PDAC mono-culture and co-culture with PDAC cancer associated fibroblasts (CAFs).
  • CAFs PDAC cancer associated fibroblasts
  • SUIT2/GFP cell spheroids with and without CAF/mCherry were treated ⁇ 8 nM FK866 ⁇ 100 U/mL IRNb. Green and red fluorescence was monitored by IncuCyte every 3 h for a 7-day period.
  • FIGS. 28F Representative fluorescence images of spheroids at the experiment endpoint in panel C. *, P .05. **, P .01. ***, PO.OOl. ****, PO.OOOl. ns, not significant.
  • FIGS. 29A-29G show inactivation of type 1 IFN signaling promotes resistance to NAMPT inhibitors.
  • FIGS. 29A-29B profiling of broad panel of PDAC xenograft models for in vivo type 1 IFN signaling based on IHC analyses of type 1 IFN signaling marker MX1.
  • FIG. 29C a loss-of-function PDAC model of autocrine type 1 IFN signaling. PATU8988T cells underwent knock-out of the type 1 IFN receptor. 2 of these KO models were chosen and were exposed to 100 U/mL PTMb supplementation in cell culture for 48 hours, prior to immunoblot analyses of type 1 IFN signaling marker MX1 and PARP9/10/14.
  • FIG. 29A-29G show inactivation of type 1 IFN signaling promotes resistance to NAMPT inhibitors.
  • FIGS. 29A-29B profiling of broad panel of PDAC xenograft models for in vivo type 1 IFN signaling based on IHC analyses
  • FIG. 29D schematic of in vivo experimental design.
  • FIG. 29E curves of bioluminescence intensity of orthotopic PATU8988T WT or IFNAR1 KO-fLUC tumors in mice treated with vehicle control or 10 mg/kg FK866 (daily ip). After confirmation of tumor establishment by bioluminescence imaging
  • 29G treatments with vehicle control or 10 mg/kg FK866 were well tolerated by mice bearing PATU8988T WT or IFNAR1 KO-fLUC orthotopic tumors. *, PO.05. **, PO.01. ***, P0.001. ****, P0.0001. ns, not significant.
  • FIGS. 30A-30H show increased Type I IFN singing downstream of STING activation sensitizes tumors to NAMPT inhibitors.
  • FIG. 30A A gain-of-function PD AC model of doxycycline (DOX)-inducible autocrine type I IFN signaling.
  • SUIT2 cells with a DOX-inducible active STING R284M mutant were exposed to 50 ng/mL DOX in cell culture for 4 days, prior to immunoblot analyses of type I IFN signaling markers.
  • FIG. 30B DOX-induced type I IFN signaling significantly lowered NAD and NADH levels in SUIT2-STING R284M cells.
  • FIG. 30C Schematic of in vivo experimental design.
  • FIG. 30E BLI images of disease progression in indicated experimental groups.
  • FIGS. 30F-30G BLI measurement of liver metastasis of SUIT2-STING R284M -fLUC tumor cells. 5 minutes after luciferin injection, mice were sacrificed and livers were harvested for BLI measurement. Left, BLI images of liver metastasis. Right, quantification of BLI intensity in livers.
  • FIG. 30H Immunoblot analysis of indicated proteins in tumor homogenates. Three representative tumors from each group were included for comparison.
  • FIG. 31 shows the IC50 values of the NAMPT inhibitors FK866 and LSN3154567 in a panel of PD AC cell lines and primary PD AC cells in 2D and 3D culture.
  • the IC50 values are shown as mean ⁇ SD.
  • IFN immunoglobulin
  • interferon refers to a group of signaling proteins made and released by host cells in response to the presence of a virus.
  • IFNs belong to the class of proteins known as cytokines, molecules used for communication between cells to trigger the protective defenses of the immune system that help eradicate pathogens. Interferons are named for their ability to "interfere” with viral replication by protecting cells from virus infections. IFNs also have various other functions: they activate immune cells, such as natural killer cells and macrophages; they increase host defenses by up-regulating antigen presentation by virtue of increasing the expression of major histocompatibility complex (MHC) antigens.
  • MHC major histocompatibility complex
  • IFN IFN-alpha, IFN-beta, IFN-kappa, IFN-delta, IFN-epsilon, IFN-omega, IFN- zeta
  • Type II IFN i.e., IFN-gamma
  • Type III IFN e.g., IFN-lambdal, IFN-lambda2, IFN- lambda3
  • the named protein includes any of the protein’s naturally occurring forms, variants or homologs that maintain the protein transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
  • variants or homologs have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
  • RNA described herein e.g., interferon, STAT1, MX1, PARP9,
  • RNA includes any of the RNA’s naturally occurring forms, variants or homologs that maintain the RNA activity (e.g., within at least 50%, 80%,
  • variants or homologs have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous nucleic acid portion) compared to a naturally occurring form.
  • Pathway refers to a set of system components involved in two or more sequential molecular interactions that result in the production of a product or activity.
  • a pathway can produce a variety of products or activities that can include, for example, intermolecular interactions, changes in expression of a nucleic acid or polypeptide, the formation or dissociation of a complex between two or more molecules, accumulation or destruction of a metabolic product, activation or deactivation of an enzyme or binding activity.
  • the term "pathway” includes a variety of pathway types, such as, for example, a biochemical pathway, a gene expression pathway, a regulatory pathway, or a combination thereof.
  • IFN pathway refers to the intracellular signaling pathway activated when interferon levels are elevated in vivo and/or when interferon binds to its receptor (e.g., Type 1 IFN binds to IFNAR1 and/or IFNAR2) and induces, for example, the JAK1/TYK2 -mediated signaling cascade which results in transcriptional activation of hundreds of IFN-stimulated genes including STAT1 and MX1, canonical surrogate markers of type I IFN signaling. See FIG. 1.
  • the IFN signaling pathway substantially lowers NAD(H) levels through upregulating the expression of PARP9, P ARP 10, and PARP14, which are NAD-consuming enzymes.
  • the IFN pathway is known in the art and described, for example, by Ivashkiv et al,
  • the IFN signaling pathway includes, but is not limited to, genes, RNA, and proteins.
  • IFN pathway gene refers to a gene in the IFN pathway.
  • genes include, for example, PARP9, PARP10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS2, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, PSME1, and SOCS1.
  • the IFN pathway gene comprises STAT1 and/or MX1.
  • the IFN pathway gene comprises PARP9, PARPIO, PARP14, STAT1, MX1, or a combination of two or more thereof.
  • the IFN pathway gene comprises PARP9, PARPIO, PARP14, or a combination of two or more thereof.
  • IFN pathway RNA or “IFN pathway RNA expression sequence” refer to an RNA expression sequence (e.g., mRNA) in the IFN pathway.
  • the IFN pathway RNA is an RNA expression sequence transcribed by an interferon pathway gene.
  • RNA includes, for example, PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the IFN pathway RNA comprises STAT1 and/or MX1. In embodiments, the IFN pathway RNA comprises PARP9, PARPIO, PARP14, STAT1, MX1, or a combination of two or more thereof. In embodiments, the IFN pathway RNA comprises PARP9, PARPIO, PARP14, or a combination of two or more thereof.
  • the term “IFN pathway protein” refers to a protein in the interferon pathway.
  • the IFN pathway protein can be any protein encoded by an IFN pathway gene.
  • the IFN pathway protein is PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1.
  • the IFN pathway protein comprises STAT1 and/or MX1.
  • the IFN pathway protein comprises PARP9, PARPIO, PARP14, STAT1, MX1, or a combination of two or more thereof. In embodiments, the IFN pathway protein comprises PARP9, PARPIO, PARP14, or a combination of two or more thereof.
  • STAT1 and/or MX1 refers to: (i) STAT1, (ii) MX1, or (iii) STAT1 and MX1.
  • activity refers to a value representing the level of expression of all or a subset of genes in a particular pathway.
  • activity level is determined by measuring gene expression in the IFN signaling pathway.
  • a variety of suitable algorithms are available for calculating an activity level based on gene expression data from a plurality of genes.
  • gene expression levels are analyzed using the Adaptive Signature Selection and InteGratioN toolkit (ASSIGN; e.g., Shen et al, 31(11):1745 -53 (2015); available from BioConductor) to calculate an activity level.
  • ASSIGN Adaptive Signature Selection and InteGratioN toolkit
  • gene expression levels are analyzed using Gene Set Variation Analysis (GSVA; e.g., Hanzelmann et al, BMC Bioinformatics, 14:7 (2013)) to calculate an activity level.
  • gene expression levels are analyzed using gene set enrichment analysis (GSEA; e.g., Barbie et al, Nature, 462(7269): 108-112 (2009)) to calculate an activity level.
  • GSEA gene set enrichment analysis
  • expression levels for all genes of a particular signature are collectively expressed as a single activity level value (e.g., a score) for that signature.
  • comparing gene expression values for genes of a signature to a reference is performed by comparing a score for that signature to a reference score.
  • type 1 ISG signature or “type 1 interferon-stimulated gene signature” is used in accordance with its plain and ordinary meaning and refers to the set of genes expressed upon interferon type I signaling. Upon increased interferon levels and/or IFN binding to cell surface receptors, a signal is transmitted through the membrane and into the cell, leading to changes in cellular properties. Interferon-stimulated genes (ISGs) take on a wide range of activities. PRRs, IRFs, and several signal transducing proteins described above such as JAK2, STAT1/2, and IRF9 are present at baseline but are also ISGs and reinforce the IFN response. Many ISGs control viral, bacterial, and parasite infection by directly targeting pathways and functions required during pathogen life cycles.
  • ISGs Interferon-stimulated genes
  • chemokines and chemokine receptors Upregulation of chemokines and chemokine receptors enables cell-to-cell communication, whereas negative regulators of signaling help resolve the IFN-induced state and facilitate the return to cellular homeostasis. Additional ISGs encode for proapoptotic proteins, leading to cell death under certain conditions.
  • Chks34s is used in accordance with its plain and ordinary meaning and refers to CHEK1 protein that is phosphorylated at the serine in position 345.
  • Checkpoint kinase 1 or Chkl also known as CHEK1
  • Chkl coordinates the DNA damage response (DDR) and cell cycle checkpoint response.
  • DDR DNA damage response
  • Activation of Chkl results in the initiation of cell cycle checkpoints, cell cycle arrest, DNA repair and cell death to prevent damaged cells from progressing through the cell cycle.
  • Chkl is regulated by ATR through phosphorylation, forming the ATR-Chkl pathway.
  • This pathway recognizes single strand DNA (ssDNA) which can be a result of UV- induced damage, replication stress and inter-strand cross linking. Chk 1 activation occurs primarily through the phosphorylation of the conserved sites, Ser-317, Ser-345 and less often at Ser-366.
  • ATR and “ATR kinase” and “serine/threonine-protein kinase ATR” and “ataxia telangiectasia and Rad3 -related protein” used in accordance with their plain and ordinary meaning and refer to a serine/threonine-specific protein kinase that plays a role in multiple cellular processes such as glucose metabolism, apoptosis, cell proliferation, transcription and cell migration.
  • ATR kinase inhibitor is used in accordance with their plain and ordinary meaning and refers to a protein or small molecule that inhibits the activity of ATR. In embodiments, the inhibitor reduces the activity of ATR from an indirect or direct interaction.
  • PARP Poly(ADP-ribose) polymerase
  • PARP9 refers to poly(ADP-ribose) polymerase family member 9, which is an enzyme that is encoded by the PARP9 gene, identified by UniProtKB number Q81XQ6.
  • PAPRIO refers to poly(ADP-ribose) polymerase family member 10, which is an enzyme that is encoded by the PARP 10 gene, identified by UniProtKB number UniProtKB number Q53GL7.
  • PAPR14 refers to poly(ADP-ribose) polymerase family member 14, which is an enzyme that is encoded by the PARP14 gene, identified by UniProtKB number Q460N5.
  • PARP inhibitor is used in accordance with their plain and ordinary meaning and refers to a protein or small molecule that inhibits the activity of poly(ADP-ribose) polymerase (PARP). In embodiments, the inhibitor reduces the activity of poly(ADP-ribose) polymerase from an indirect or direct interaction.
  • NAD nicotinamide adenine dinucleotide
  • the kynurenine pathway starts with the catabolism of the amino acid tryptophan that is then converted via two steps to the intermediate kynurenine, which can generate NAD, kynurenic acid, or xanthurenic acid.
  • the Preiss-Handler pathway and the salvage pathway synthesize NAD from pyridine bases.
  • the Preiss-Handler pathway synthesizes NAD from nicotinic acid (NA) in three steps via the intermediate nicotinic acid adenine dinucleotide (NAAD).
  • NAAD nicotinic acid
  • the NAD salvage pathway starts from the recycling of nicotinamide (NAM) to nicotinamide mono nucleotide (NMN) by intracellular nicotinamide phosphoribosyltransferase (NAMPT), followed by the conversion of NMN into NAD via the nicotinamide mononucleotide adenylyltransferases (NMNATs) (Chiarugi et al.
  • NAMPT is the rate-limiting step by which tumor cells utilize NAM in the synthesis of NAD.
  • NAD(H) is consumed and broken down into NAM by the poly(ADP-ribose) polymerase (PARP) family proteins, the sirtuin (SIRT) family proteins, and CD38 (Verdin E. Science 2015;350(6265):1208- 13).
  • PARP poly(ADP-ribose) polymerase
  • SIRT sirtuin
  • CD38 Verdin E. Science 2015;350(6265):1208- 13
  • the reduced form of nicotinamide adenine dinucleotide is referred to as NADH or NAD(H).
  • NAD + The oxidized form of nicotinamide adenine dinucleotide is referred to as NAD + .
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPP 5-phosphoribosyl-l -pyrophosphate
  • NPN nicotinamide mononucleotide
  • PRPP 5-phosphoribosyl-l -pyrophosphate
  • NAMPT is the rate-limiting enzyme in the NAD salvage pathway, a dominant source of NAD in cancer cells.
  • NAMPT inhibitor or “NAMPT inhibitor” or “NAMPTi” is used in accordance with their plain and ordinary meaning and refer to inhibitors of nicotinamide phosphoribosyltransferase (NAMPT).
  • KRAS mutation is used in accordance with its plain and ordinary meaning and refers to a variation or mutation in the KRAS gene.
  • KRAS is a gene that acts as an on/off switch in cell signaling. When it functions normally, it controls cell proliferation. When it is mutated, negative signaling is disrupted. Thus, cells can continuously proliferate, and often develop into cancer. It is called KRAS because it was first identified as an oncogene in Kirsten RAt Sarcoma virus. The viral oncogene was derived from cellular genome. Thus, KRAS gene in cellular genome is called a proto-oncogene. KRAS acts as a molecular on/off switch, using protein dynamics.
  • KRAS upregulates the GLUT1 glucose transporter, thereby contributing to the Warburg effect in cancer cells.
  • KRAS binds to GTP in its active state. It also possesses an intrinsic enzymatic activity which cleaves the terminal phosphate of the nucleotide, converting it to GDP. Upon conversion of GTP to GDP, KRAS is deactivated.
  • TP53 mutation is used in accordance with its plain and ordinary meaning and refers to a variation or mutation in the TP53 gene.
  • the TP53 gene is located on chromosome 17 in humans.
  • TP53 is a nuclear phosphoprotein with sequence-specific DNA binding activity.
  • the TP53 protein is a negative regulator of cell proliferation and a positive regulator of apoptosis in response to DNA damaging agents.
  • TP53 is the most common mutated gene associated with human cancer.
  • Li-Fraumeni syndrome is a multicancer predisposition syndrome that has constitutional TP53 mutations.
  • the terms “disease” or “condition” refer to a state of being or health status of a patient or subject capable of being diagnosed and/or treated with compounds or methods provided herein.
  • the disease may be a cancer.
  • the disease may be pancreatic cancer.
  • cancer refers to all types of cancer, neoplasm or malignant tumors found in mammals (e.g. humans), including leukemias, lymphomas, carcinomas and sarcomas.
  • Examples of cancers that may be diagnosed and/or treated with a compound or method provided herein include brain cancer, glioma, glioblastoma, neuroblastoma, prostate cancer, colorectal cancer, pancreatic cancer, medulloblastoma, melanoma, cervical cancer, gastric cancer, ovarian cancer, lung cancer, cancer of the head, Hodgkin's disease, and Non-Hodgkin's lymphomas.
  • Exemplary cancers that may be diagnosed and/or treated with a compound or method provided herein include cancer of the thyroid, endocrine system, brain, breast, cervix, colon, head & neck, liver, kidney, lung, ovary, pancreas, rectum, stomach, and uterus.
  • Additional examples include, thyroid carcinoma, cholangiocarcinoma, pancreatic adenocarcinoma, skin cutaneous melanoma, colon adenocarcinoma, rectum adenocarcinoma, stomach adenocarcinoma, esophageal carcinoma, head and neck squamous cell carcinoma, breast invasive carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, non-small cell lung carcinoma, mesothelioma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract
  • the cancer is pancreatic cancer. In embodiments, the cancer is metastatic pancreatic cancer. In embodiments, the cancer is pancreatic adenocarcinoma. In embodiments, the cancer is metastatic pancreatic adenocarcinoma. In embodiments, the cancer is pancreatic ductal adenocarcinoma. In embodiments, the cancer is metastatic pancreatic ductal adenocarcinoma.
  • pancreatic ductal adenocarcinoma refers to is an epithelial tumor that arises from the cells of the pancreatic duct or ductules, for which it is named.
  • the pancreatic duct(s) serve as the conduit through which digestive enzymes and bicarbonate ion produced in acinar cells reach the small intestine.
  • Ductal cells and acinar cells together represent the “exocrine” pancreas, from which the vast majority of pancreatic neoplasms arise.
  • metalastasis can be used interchangeably and refer to the spread of a proliferative disease or disorder, e.g., cancer, from one organ or another non-adjacent organ or body part.
  • Metalastatic cancer is also called “Stage IV cancer.” Cancer occurs at an originating site, e.g., pancreas, which site is referred to as a primary tumor, e.g., primary pancreatic cancer. Some cancer cells in the primary tumor or originating site acquire the ability to penetrate and infiltrate surrounding normal tissue in the local area and/or the ability to penetrate the walls of the lymphatic system or vascular system circulating through the system to other sites and tissues in the body.
  • a second clinically detectable tumor formed from cancer cells of a primary tumor is referred to as a metastatic or secondary tumor.
  • the metastatic tumor and its cells are presumed to be similar to those of the original tumor.
  • the secondary tumor at the site of the breast consists of abnormal lung cells and not abnormal breast cells.
  • the secondary tumor in the breast is referred to a metastatic lung cancer.
  • metastatic cancer refers to a disease in which a subject has or had a primary tumor and has one or more secondary tumors.
  • non-metastatic cancer or subjects with cancer that is not metastatic refers to diseases in which subjects have a primary tumor but not one or more secondary tumors.
  • diagnosis refers to an identification or likelihood of the presence of a particular type of cancer or outcome in a subject.
  • prognosis refers to the likelihood or risk of a subject developing a particular outcome or particular event.
  • biological sample encompasses essentially any sample type obtained from a subject that can be used in a diagnostic or prognostic method described herein.
  • the biological sample may be any bodily fluid, tissue or any other suitable sample.
  • the definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof.
  • the definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as cells (e.g., cancer cells), polypeptides, or proteins.
  • biological sample encompasses a clinical sample, but also, includes cells in culture, cell supernatants, cell lysates, blood, serum, plasma, urine, cerebral spinal fluid, biological fluid, and tissue samples.
  • the sample may be pretreated as necessary by dilution in an appropriate buffer solution or concentrated, if desired. Any of a number of standard aqueous buffer solutions, employing one of a variety of buffers, such as phosphate, Tris, or the like, preferably at physiological pH can be used.
  • Biological samples can be derived from patients using well-known techniques such as venipuncture, lumbar puncture, fluid sample such as saliva or urine, or tissue biopsy and the like.
  • the sample is a cancer sample (e.g., containing or suspected of containing cancer cells, such as from a tumor).
  • treating include any approach for obtaining beneficial or desired results in a subject’s condition, including clinical results.
  • beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of the extent of a disease, stabilizing (i.e., not worsening) the state of disease, prevention of a disease’s transmission or spread, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission, whether partial or total and whether detectable or undetectable.
  • Treating” or “treatment” refers to any indicia of success in the therapy or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient’s physical or mental well-being.
  • the treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination, neuropsychiatric exams, and/or a psychiatric evaluation.
  • treatment as used herein includes any cure, amelioration, or prevention of a disease.
  • Treating or “treatment” as used herein includes prophylactic treatment. Treatment may prevent the disease from occurring; inhibit the disease’s spread; relieve the disease’s symptoms, fully or partially remove the disease’s underlying cause, shorten a disease’s duration, or do a combination of these things.
  • the term “treating” and conjugations thereof may include prevention of an injury, pathology, condition, or disease.
  • treating is preventing.
  • treating does not include preventing.
  • Treatment methods include administering to a subject a therapeutically effective amount of an active agent. The administering step may consist of a single administration or may include a series of administrations.
  • the length of the treatment period depends on a variety of factors, such as the severity of the condition, the age of the patient, the concentration of active agent, the activity of the compositions used in the treatment, or a combination thereof. It will also be appreciated that the effective dosage of an agent used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. Changes in dosage may result and become apparent by diagnostic assays (e.g., assays described herein or known in the art). In embodiments, chronic administration may be required. For example, the compositions are administered to the subject in an amount and for a duration sufficient to treat the patient.
  • the term “prevent” refers to a decrease in the occurrence of disease symptoms in a patient.
  • the prevention may be complete (no detectable symptoms) or partial, such that fewer symptoms are observed than would likely occur absent treatment.
  • patient refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of a pharmaceutical composition.
  • Non- limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, and other non-mammalian animals.
  • a subject is human.
  • biomarker refers generally to a protein, polypeptide, RNA, or DNA, the level or concentration of which is associated with a particular biological state.
  • protein marker or “polypeptide marker” refer generally to a protein or polypeptide in which the level or concentration is associated with a particular biological state.
  • RNA marker refers generally to RNA in which the level or concentration is associated with a particular biological state.
  • polypeptide refers to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • detecting the concentrations of naturally occurring protein marker proteins in a biological sample is contemplated for use within diagnostic, prognostic, or monitoring methods disclosed herein.
  • an “effective amount” is an amount sufficient for a compound to accomplish a stated purpose relative to the absence of the compound (e.g. achieve the effect for which it is administered, treat a disease, reduce enzyme activity, increase enzyme activity, reduce a signaling pathway, or reduce one or more symptoms of a disease or condition).
  • An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.”
  • a “reduction” of a symptom or symptoms means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s).
  • a “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms.
  • the full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses.
  • a prophylactically effective amount may be administered in one or more administrations.
  • An “activity decreasing amount,” as used herein, refers to an amount of antagonist required to decrease the activity of an enzyme relative to the absence of the antagonist.
  • a “function disrupting amount,” as used herein, refers to the amount of antagonist required to disrupt the function of an enzyme or protein relative to the absence of the antagonist. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques.
  • administering refers to oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject.
  • Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal).
  • Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial.
  • Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
  • co-administer refers to a composition described herein administered at the same time, prior to, or after the administration of one or more other therapies.
  • the compounds provided herein can be administered alone or can be coadministered to the patient.
  • Co-administration is meant to include simultaneous or sequential administration of the compounds individually or in combination (more than one compound).
  • the preparations can also be combined, when desired, with other active substances.
  • cancer model organism refers to an organism exhibiting a phenotype indicative of cancer, or the activity of cancer causing elements, within the organism.
  • a wide variety of organisms may serve as cancer model organisms, and include for example, cancer cells and mammalian organisms such as rodents (e.g. mouse or rat) and primates.
  • Cancer cell lines are widely understood by those skilled in the art as cells exhibiting phenotypes or genotypes similar to in vivo cancers. Cancer cell lines as used herein includes cell lines from animals (e.g. mice) and from humans.
  • nucleic acid refers to any polymeric form of nucleotides covalently linked together that may have various lengths, either deoxyribonucleotides or ribonucleotides, or analogs, derivatives or modifications thereof.
  • Different polynucleotides may have different three-dimensional structures, and may perform various functions, known or unknown.
  • Non-limiting examples of polynucleotides include a gene, a gene fragment, an exon, an intron, intergenic DNA (including, without limitation, heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, a ribozyme, cDNA, a recombinant polynucleotide, a branched polynucleotide, a plasmid, a vector, isolated DNA of a sequence, isolated RNA of a sequence, a nucleic acid probe, and a primer.
  • Polynucleotides useful in the methods of the disclosure may comprise natural nucleic acid sequences and variants thereof, artificial nucleic acid sequences, or a combination of such sequences.
  • a polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Panels, assays, kits and methods of the present disclosure may include oligonucleotide probes, binding fragments thereof or other types of target-binding agents, which are specific for one or more target RNAs (e.g., an RNA expressed by a target gene).
  • target RNAs e.g., an RNA expressed by a target gene
  • target polynucleotide refers to a nucleic acid molecule or polynucleotide in a starting population of nucleic acid molecules having a target sequence whose presence, amount, and/or nucleotide sequence, or changes in one or more of these, are desired to be determined.
  • target sequence refers to a nucleic acid sequence on a single strand of nucleic acid.
  • the target sequence may be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA, miRNA, rRNA, or others.
  • the target sequence may be a target sequence from a sample or a secondary target such as a product of an amplification reaction.
  • the target polynucleotide is an RNA transcript (or amplification product thereof) of a gene of interest (referred to herein as a “target gene”).
  • oligonucleotide probe or “probe” refers to a polynucleotide used for detecting or identifying its corresponding target polynucleotide in a hybridization reaction by specific hybridization with a corresponding target sequence.
  • a nucleotide probe is hybridizable to one or more target polynucleotides, and preferably specifically hybridizable to one target polynucleotide.
  • Oligonucleotide probes can contain a region that is perfectly complementary to one or more target polynucleotides in a sample, and may optionally contain one or more nucleotides that are not complemented by a corresponding nucleotide in the one or more target polynucleotides in a sample.
  • specific hybridization “specifically hybridizable,” and the like is meant hybridization that is determinative of the presence of the corresponding target polynucleotide, often in a heterogeneous population of polynucleotides, which may include other target polynucleotides recognized by other probes, as well as non-target polynucleotides.
  • the specified oligonucleotide probe binds to a particular target polynucleotide at least two times the background and more typically more than 10 to 100 times background, or higher.
  • Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions as compared to the reference sequence (which does not comprise the additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (e.g., with respect to the reference sequence), and multiplying the result by 100 to yield the percentage of sequence identity.
  • Programs for determining sequence identify are known to those skilled in the art, and include, without limitation, BLAST (as noted above, optionally using default parameters), the Needleman- Wunsch algorithm (e.g. , the EMBOSS Needle aligner available at www.ebi.ac.uk/Tools/psa/emboss_needle/nucleotide.html, optionally with default settings).
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters, or by manual alignment and visual inspection (e.g., NCBI web site http://www.ncbi.nlm.nih.gov/BLAST/ or the like).
  • sequences that are “substantially identical” are at least 80%, 90%, 95%, 99%, or more identical.
  • This definition also refers to, or may be applied to, the complement of a test sequence.
  • the definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. Alignment algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10, 15, 25, or more amino acids or nucleotides in length.
  • amino acid or nucleotide base "position" is denoted by a number that sequentially identifies each amino acid (or nucleotide base) in the reference sequence based on its position relative to the N-terminus (or 5'-end). Due to deletions, insertions, truncations, fusions, and the like that must be taken into account when determining an optimal alignment, in general the amino acid residue number in a test sequence determined by simply counting from the N- terminus will not necessarily be the same as the number of its corresponding position in the reference sequence. For example, in a case where a variant has a deletion relative to an aligned reference sequence, there will be no amino acid in the variant that corresponds to a position in the reference sequence at the site of deletion.
  • antisense nucleic acid refers to a nucleic acid (e.g., DNA or RNA molecule) that is complementary to at least a portion of a specific target nucleic acid and is capable of reducing transcription of the target nucleic acid (e.g. mRNA from DNA), reducing the translation of the target nucleic acid (e.g. mRNA), altering transcript splicing (e.g. single stranded morpholino oligo), or interfering with the endogenous activity of the target nucleic acid.
  • synthetic antisense nucleic acids e.g. oligonucleotides
  • synthetic antisense nucleic acids are generally between 15 and 25 bases in length.
  • antisense nucleic acids are capable of hybridizing to (e.g. selectively hybridizing to) a target nucleic acid.
  • the antisense nucleic acid hybridizes to the target nucleic acid in vitro.
  • the antisense nucleic acid hybridizes to the target nucleic acid in a cell.
  • the antisense nucleic acid hybridizes to the target nucleic acid in an organism.
  • the antisense nucleic acid hybridizes to the target nucleic acid under physiological conditions.
  • Antisense nucleic acids may comprise naturally occurring nucleotides or modified nucleotides such as, e.g., phosphorothioate, methylphosphonate, and anomeric sugar-phosphate, backbone-modified nucleotides.
  • the antisense nucleic acids hybridize to the corresponding RNA forming a double-stranded molecule.
  • the antisense nucleic acids interfere with the endogenous behavior of the RNA and inhibit its function relative to the absence of the antisense nucleic acid.
  • the double-stranded molecule may be degraded via the RNAi pathway.
  • antisense methods to inhibit the in vitro translation of genes is known in the art [88]
  • antisense molecules which bind directly to the DNA may be used.
  • Antisense nucleic acids may be single or double stranded nucleic acids.
  • Non-limiting examples of antisense nucleic acids include siRNAs (including their derivatives or pre-cursors, such as nucleotide analogs), short hairpin RNAs (shRNA), micro RNAs (miRNA), saRNAs (small activating RNAs) and small nucleolar RNAs (snoRNA) or certain of their derivatives or pre cursors.
  • siRNAs including their derivatives or pre-cursors, such as nucleotide analogs
  • shRNA short hairpin RNAs
  • miRNA micro RNAs
  • saRNAs small activating RNAs
  • snoRNA small nucleolar RNAs
  • complement refers to a nucleotide (e.g., RNA or DNA) or a sequence of nucleotides capable of base pairing with a complementary nucleotide or sequence of nucleotides.
  • a complement may include a sequence of nucleotides that base pair with corresponding complementary nucleotides of a second nucleic acid sequence.
  • the nucleotides of a complement may partially or completely match the nucleotides of the second nucleic acid sequence. Where the nucleotides of the complement completely match each nucleotide of the second nucleic acid sequence, the complement forms base pairs with each nucleotide of the second nucleic acid sequence. Where the nucleotides of the complement partially match the nucleotides of the second nucleic acid sequence, only some of the nucleotides of the complement form base pairs with nucleotides of the second nucleic acid sequence.
  • Examples of complementary sequences include coding and a non-coding sequences, wherein the non-coding sequence contains complementary nucleotides to the coding sequence and thus forms the complement of the coding sequence.
  • a further example of complementary sequences are sense and antisense sequences, wherein the sense sequence contains complementary nucleotides to the antisense sequence and thus forms the complement of the antisense sequence.
  • sequences may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing.
  • two sequences that are complementary to each other may have a specified percentage of nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
  • contacting is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including biomolecules or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated; however, the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents that can be produced in the reaction mixture.
  • the term “contacting” may include allowing two species to react, interact, or physically touch, wherein the two species may be a compound as described herein and a protein or enzyme. In embodiments, contacting includes allowing a compound described herein to interact with a protein or enzyme that is involved in a signaling pathway.
  • activation means positively affecting (e.g. increasing) the activity or function of the protein relative to the activity or function of the protein in the absence of the activator.
  • activation means positively affecting (e.g. increasing) the concentration or levels of the protein relative to the concentration or level of the protein in the absence of the activator.
  • the terms may reference activation, or activating, sensitizing, or up-regulating signal transduction or enzymatic activity or the amount of a protein decreased in a disease.
  • activation may include, at least in part, partially or totally increasing stimulation, increasing or enabling activation, or activating, sensitizing, or up-regulating signal transduction or enzymatic activity or the amount of a protein associated with a disease (e.g., a protein which is decreased in a disease relative to a non-diseased control).
  • Activation may include, at least in part, partially or totally increasing stimulation, increasing or enabling activation, or activating, sensitizing, or up- regulating signal transduction or enzymatic activity or the amount of a protein
  • agonist refers to a substance capable of detectably increasing the expression or activity of a given gene or protein.
  • the agonist can increase expression or activity 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a control in the absence of the agonist.
  • expression or activity is 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or higher than the expression or activity in the absence of the agonist.
  • the term “inhibition”, “inhibit”, “inhibiting” and the like in reference to a protein-inhibitor interaction means negatively affecting (e.g. decreasing) the activity or function of the protein relative to the activity or function of the protein in the absence of the inhibitor. In embodiments inhibition means negatively affecting (e.g. decreasing) the concentration or levels of the protein relative to the concentration or level of the protein in the absence of the inhibitor. In embodiments, inhibition refers to reduction of a disease or symptoms of disease. In embodiments, inhibition refers to a reduction in the activity of a particular protein target.
  • inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein.
  • inhibition refers to a reduction of activity of a target protein resulting from a direct interaction (e.g. an inhibitor binds to the target protein).
  • inhibition refers to a reduction of activity of a target protein from an indirect interaction (e.g. an inhibitor binds to a protein that activates the target protein, thereby preventing target protein activation).
  • inhibitors include ATR kinase inhibitors and NAMPT inhibitors.
  • expression includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post- translational modification, and secretion. Expression can be detected using conventional techniques for detecting protein (e.g., ELISA, Western blotting, flow cytometry, immunofluorescence, immunohistochemistry, etc.).
  • gene expression refers to any step in the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but m non-protein coding genes such as transfer RNA (tRNA) or small nuclear RNA (snRNA) genes, the product is a functional RNA.
  • tRNA transfer RNA
  • snRNA small nuclear RNA
  • reference value refers to a value to which a measured quantity is compared.
  • the reference value is used as a standard of comparison in evaluating experimental effects.
  • a reference value is a measurement of a reference sample (e.g., non-cancer cells treated to overexpress a particular gene) as described herein.
  • the reference value is a synthetic quantification standard used as a reference for assay measurements.
  • a reference value is assigned to genes in order to compare measured gene expression levels and make a comparison of whether the measured value is greater, equal, or less than the reference value, which then enables a determination of increased, no change, or decreased expression level of the gene.
  • a reference value is assigned to an activity level representing the collective reference expression levels of several genes (such as genes associated with a particular signature).
  • reference values are pre-determined values, such as from previous measurements for which expression levels were previously measured.
  • a reference value is a control value for a known sample or condition that was previously measured, or is measured in parallel with a test sample.
  • a reference value is a value for a sample from a subject at an earlier time point, to which values a value for a test sample at a later time point may be compared, and which may be measured separately or simultaneously with the test sample.
  • a known sample providing the reference value is a non-cancerous tissue of the same type from which a test cancer cell originated, or a cell line of the same type as a test cancer cell.
  • the reference value represents a difference between two treatment conditions for the known sample (e.g., a measure in the change of an activity level or the expression of one or more genes between a first condition in which a particular signaling pathway was induced, and a second condition in which the particular signaling pathway was not induced).
  • a pathway activity increase or decrease of one standard deviation from the mean is considered significant.
  • the reference value is a reference activity score.
  • a reference activity scores is the result of a weighted average of normalized expression levels for genes in a pathway signature that are linearly combined, and optionally scaled to between zero (0) and one (1).
  • a scaled activity score of more than about 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 0.95, or more of the maximum score indicates an increased activity in the corresponding pathway.
  • an increased activity is indicated by a scaled activity score of more than about 0.5 of the maximum score.
  • a scaled score of about zero (0) represents the activity score for a population of control cells in which the signaling pathway is not induced.
  • a disease e.g. a protein associated disease, such as a cancer (e.g., cancer, inflammatory disease, autoimmune disease, or infectious disease)
  • a disease e.g. cancer, inflammatory disease, autoimmune disease, or infectious disease
  • the disease e.g. cancer, inflammatory disease, autoimmune disease, or infectious disease
  • a symptom of the disease is caused by (in whole or in part) the substance or substance activity or function.
  • a causative agent could be a target for treatment of the disease.
  • the term “whole transcriptome measurement” refers to methods for measuring every mRNA transcript in a sample, or suspected of being in a sample, in order to evaluate the abundance of specific RNA transcripts.
  • Various methods for performing “whole transcriptome measurement” are available. Non-limiting examples include the use of arrays to probe for expression of all known mRNAs associated with a sample (e.g., all human genes), and the use of high-throughput sequencing methodologies to sequence all mRNA in a sample.
  • methodologies for whole transcriptome measurement are directed at identifying all genes expressed in a given sample (e.g., a particular tissue or type of cell), or measuring their expression level.
  • all mRNAs are subjected to a common procedure that does not select for any particular target sequence, but instead non-selectively amplifies and sequences all mRNA using common structural features (e.g., presence of a poly-A tail, or adapter ligation that does not depend on the presence of any particular sequence).
  • common structural features e.g., presence of a poly-A tail, or adapter ligation that does not depend on the presence of any particular sequence.
  • kits for treating cancer in a patient in need thereof comprising administering a therapeutically effective amount of an ATR kinase inhibitor and/or a NAMPT inhibitor to the patient; wherein the cancer has increased levels of interferon.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising administering a therapeutically effective amount of an ATR kinase inhibitor to the patient; wherein the cancer has increased levels of interferon.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising administering a therapeutically effective amount of a NAMPT inhibitor to the patient; wherein the cancer has increased levels of interferon.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising administering a therapeutically effective amount of a PARP inhibitor to the patient; wherein the cancer has increased levels of interferon.
  • the methods comprise administering an effective amount of an ATR kinase inhibitor and a PARP inhibitor.
  • the methods comprise administering to the patient an effective amount of an ATR kinase inhibitor and a NAMPT inhibitor.
  • the methods comprise administering an effective amount of an ATR kinase inhibitor, a NAMPT inhibitor, and a PARP inhibitor.
  • the methods comprise administering an effective amount of a NAMPT inhibitor and a PARP inhibitor.
  • the methods comprise administering to the patient an effective amount of a NAMPT inhibitor and interferon-beta.
  • the cancer has an increased level of interferon relative to a control.
  • the interferon is an interferon protein.
  • the interferon is an interferon RNA.
  • the interferon is Type 1 interferon.
  • the Type 1 interferon is interferon-alpha, interferon-beta, or a combination thereof.
  • the cancer is pancreatic cancer.
  • the pancreatic caner is pancreatic ductal adenocarcinoma.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising determining the level of interferon in a sample obtained from a patient, and administering a therapeutically effective amount of an ATR kinase inhibitor and/or a NAMPT inhibitor to the patient.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising determining the level of interferon in a sample obtained from a patient, and administering a therapeutically effective amount of an ATR kinase inhibitor to the patient.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising determining the level of interferon in a sample obtained from a patient, and administering a therapeutically effective amount of a NAMPT inhibitor to the patient.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising determining the level of interferon in a sample obtained from a patient, and administering a therapeutically effective amount of a PARP inhibitor to the patient.
  • the methods comprise administering an effective amount of an ATR kinase inhibitor and a PARP inhibitor.
  • the methods comprise administering to the patient an effective amount of an ATR kinase inhibitor and a NAMPT inhibitor.
  • the methods comprise administering an effective amount of an ATR kinase inhibitor, a NAMPT inhibitor, and a PARP inhibitor. In embodiments, the methods comprise administering an effective amount of a NAMPT inhibitor and a PARP inhibitor. In embodiments, the methods comprise administering to the patient an effective amount of a NAMPT inhibitor and interferon-beta. In embodiments, the cancer has an increased level of interferon relative to a control.
  • the interferon is an interferon protein.
  • the interferon is an interferon RNA.
  • the interferon is Type 1 interferon. In embodiments, the Type 1 interferon is interferon-alpha, interferon-beta, or a combination thereof.
  • the Type 1 interferon is interferon-alpha. In embodiments, the Type 1 interferon is interferon-beta. In embodiments, the cancer is pancreatic cancer. In embodiments, the pancreatic caner is pancreatic ductal adenocarcinoma.
  • kits for treating cancer in a patient in need thereof comprising administering a therapeutically effective amount of an ATR kinase inhibitor and/or a NAMPT inhibitor to the patient; wherein the cancer has increased levels of interferon signaling pathway activity.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising administering a therapeutically effective amount of an ATR kinase inhibitor to the patient; wherein the cancer has increased levels of interferon signaling pathway activity.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising administering a therapeutically effective amount of a NAMPT inhibitor to the patient; wherein the cancer has increased levels of interferon signaling pathway activity.
  • the methods comprise administering an effective amount of an ATR kinase inhibitor and a PARP inhibitor. In embodiments, the methods comprise administering to the patient an effective amount of an ATR kinase inhibitor and a NAMPT inhibitor. In embodiments, the methods comprise administering an effective amount of an ATR kinase inhibitor, a NAMPT inhibitor, and a PARP inhibitor. In embodiments, the methods comprise administering an effective amount of a NAMPT inhibitor and a PARP inhibitor. In embodiments, the methods comprise administering to the patient an effective amount of a NAMPT inhibitor and interferon-beta. In embodiments, the cancer has an increased level of interferon signaling pathway activity relative to a control.
  • the interferon signaling pathway activity is an interferon pathway protein. In embodiments, the interferon signaling pathway activity is an interferon pathway RNA. In embodiments, the interferon signaling pathway activity is an interferon pathway mRNA. In embodiments, the interferon is Type 1 interferon. In embodiments, the Type 1 interferon is interferon-alpha, interferon-beta, or a combination thereof. In embodiments, the Type 1 interferon is interferon-alpha. In embodiments, the Type 1 interferon is interferon-beta. In embodiments, the cancer is pancreatic cancer. In embodiments, the pancreatic caner is pancreatic ductal adenocarcinoma.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising determining the level of interferon signaling pathway activity in a sample obtained from a patient, and administering a therapeutically effective amount of an ATR kinase inhibitor and/or a NAMPT inhibitor to the patient.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising determining the level of interferon signaling pathway activity in a sample obtained from a patient, and administering a therapeutically effective amount of an ATR kinase inhibitor to the patient.
  • the disclosure provides methods of treating cancer in a patient in need thereof comprising determining the level of interferon signaling pathway activity in a sample obtained from a patient, and administering a therapeutically effective amount of a NAMPT inhibitor to the patient.
  • the methods comprise administering an effective amount of an ATR kinase inhibitor and a PARP inhibitor.
  • the methods comprise administering to the patient an effective amount of an ATR kinase inhibitor and a NAMPT inhibitor.
  • the methods comprise administering an effective amount of an ATR kinase inhibitor, a NAMPT inhibitor, and a PARP inhibitor.
  • the methods comprise administering an effective amount of a NAMPT inhibitor and a PARP inhibitor.
  • the methods comprise administering to the patient an effective amount of a NAMPT inhibitor and interferon-beta.
  • the cancer has an increased level of interferon signaling pathway activity relative to a control.
  • the interferon signaling pathway activity is an interferon pathway RNA.
  • the interferon signaling pathway activity is an interferon pathway mRNA.
  • the interferon signaling pathway activity is an interferon pathway protein.
  • the interferon signaling pathway activity is an interferon pathway protein selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway protein selected from the group consisting of PARP9, PARP 10, PARP 14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway protein selected from the group consisting of PARP9, PARP10, PARP14, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway protein selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, and a combination of two or more thereof.
  • the interferon pathway protein comprises STAT1 and MX1.
  • the interferon pathway protein comprises STAT1.
  • the interferon pathway protein comprises MX1.
  • the interferon pathway protein comprises PARP9.
  • the interferon pathway protein comprises PARPIO.
  • the interferon pathway protein comprises PARP14.
  • the interferon pathway protein comprises PARP9, PARPIO, and PARP14.
  • the interferon pathway protein comprises PARP9, PARPIO, PARP14, STAT1 and MX1.
  • the interferon signaling pathway activity is an interferon pathway RNA selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway RNA selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway RNA selected from the group consisting of PARP9, PARPIO, PARP14, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway RNA selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, MX1, MX2, and a combination of two or more thereof.
  • the interferon pathway RNA comprises STAT1 and MX1.
  • the interferon pathway RNA comprises STATE In embodiments, the interferon pathway RNA comprises MX1.
  • the interferon pathway RNA comprises PARP9.
  • the interferon pathway RNA comprises PARPIO.
  • the interferon pathway RNA comprises PARP14.
  • the interferon pathway RNA comprises PARP9, PARPIO, and PARP14.
  • the interferon pathway RNA comprises PARP9, PARPIO, PARP14, STAT1, and MX1.
  • the cancer has an increased level of interferon signaling pathway activity relative to a control.
  • the interferon is Type 1 interferon.
  • the Type 1 interferon is interferon-alpha, interferon-beta, or a combination thereof.
  • the cancer is pancreatic cancer.
  • the pancreatic caner is pancreatic ductal adenocarcinoma.
  • kits for classifying a cancer in a subject comprising measuring expression levels of a plurality of target genes from a sample obtained from the patient; comparing expression levels of the plurality of target genes to a control; and classifying the cancer as responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor.
  • the disclosure provides methods of classifying a cancer in a subject comprising measuring expression levels of a plurality of target genes from a sample obtained from the patient; comparing expression levels of the plurality of target genes to a control; and classifying the cancer as responsive to treatment with an ATR kinase inhibitor.
  • the methods comprise classifying a cancer in a subject by measuring expression levels of a plurality of target genes from a sample obtained from the patient; comparing expression levels of the plurality of target genes to a control; and classifying the cancer as responsive to treatment with a NAMPT inhibitor.
  • the cancer is classified as responsive to treatment with an ATR kinase inhibitor when the expression levels of the plurality of target genes are increased relative to the control.
  • the cancer is classified as responsive to treatment with a NAMPT inhibitor when the expression levels of the plurality of target genes are increased relative to the control.
  • the plurality of target genes comprise at least 2, 3, or 4 genes selected from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10,
  • the plurality of target genes comprise at least 2, 3, or 4 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARP10, and PARP14.
  • the plurality of target genes comprise PARP9, PARP10, and PARP14.
  • the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, and MX1.
  • the plurality of target genes comprise at least 3 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, and MX1.
  • the plurality of target genes comprise at least 4 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, and MX1.
  • the plurality of target genes comprise PARP9, PARPIO, PARP14, STAT1, and MX1.
  • the plurality of target genes comprise at least STATE In embodiments, the plurality of target genes comprise at least MX1.
  • the plurality of target genes comprise at least STAT1 and MX1.
  • the plurality of target genes comprise at least PARP9.
  • the plurality of target genes comprise at least PARP10. In embodiments, the plurality of target genes comprise at least PARP14.
  • the methods comprise measure RNA expression levels from the plurality of target genes in the sample obtained from the patient. In embodiments, the methods comprise measure mRNA expression levels from the plurality of target genes in the sample obtained from the patient. In embodiments, measuring does not comprise a whole transcriptome measurement. In embodiments, the methods further comprise administering an effective amount of an ATR kinase inhibitor. In embodiments, the methods further comprise administering an effective amount of a PARP inhibitor. In embodiments, the methods further comprise administering an effective amount of an ATR kinase inhibitor and a PARP inhibitor. In embodiments, the methods further comprise administering to the patient an effective amount of a NAMPT inhibitor.
  • the methods further comprise administering to the patient an effective amount of an ATR kinase inhibitor and a NAMPT inhibitor. In embodiments, the methods further comprise administering an effective amount of an ATR kinase inhibitor, a NAMPT inhibitor, and a PARP inhibitor. In embodiments, the methods comprise further administering an effective amount of a NAMPT inhibitor and a PARP inhibitor. In embodiments, the methods further comprise administering to the patient an effective amount of a NAMPT inhibitor and interferon-beta.
  • kits for identifying a subset of cancer patients that would be responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor comprising measuring expression levels of a plurality of target genes from a sample obtained from a patient.
  • the methods of identifying a subset of cancer patients that would be responsive to treatment with an ATR kinase inhibitor comprise measuring expression levels of a plurality of target genes from a sample obtained from a patient.
  • the methods of identifying a subset of cancer patients that would be responsive to treatment with a NAMPT inhibitor comprise measuring expression levels of a plurality of target genes from a sample obtained from a patient.
  • the patient is identified as responsive to treatment with an ATR kinase inhibitor when the expression levels of the plurality of target genes are increased relative to the control. In embodiments, the patient is identified as responsive to treatment with a NAMPT inhibitor when the expression levels of the plurality of target genes are increased relative to the control.
  • the plurality of target genes comprise at least 2, 3, or 4 genes selected from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • the plurality of target genes comprise at least 2, 3, or 4 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10,
  • the plurality of target genes comprise at least 2 or 3 genes selected from the group consisting of PARP9, PARPIO, and PARP14.
  • the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, and MX1.
  • the plurality of target genes comprise at least 3 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, and MX1.
  • the plurality of target genes comprise at least 4 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, and MX1.
  • the plurality of target genes comprise PARP9, PARPIO, PARP14, STAT1, and MX1.
  • the plurality of target genes comprise at least PARP9.
  • the plurality of target genes comprise at least PARPIO.
  • the plurality of target genes comprise at least PARP14.
  • the plurality of target genes comprise at least STAT1.
  • the plurality of target genes comprise at least MX1.
  • the plurality of target genes comprise at least STAT1 and MX1.
  • the methods comprise measure RNA expression levels from the plurality of target genes in the sample obtained from the patient. In embodiments, the methods comprise measure mRNA expression levels from the plurality of target genes in the sample obtained from the patient. In embodiments, measuring does not comprise a whole transcriptome measurement.
  • the presence of a type 1 interferon-stimulated gene (ISG) signature and/or pCHEKs345 indicates the subject would be responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor.
  • the presence of a type 1 interferon-stimulated gene (ISG) signature and/or pCHEKs345 indicates the subject would be responsive to treatment with an ATR kinase inhibitor.
  • the methods further comprise administering an effective amount of an ATR kinase inhibitor. In embodiments, the methods further comprise administering an effective amount of a PARP inhibitor. In embodiments, the methods further comprise administering an effective amount of an ATR kinase inhibitor and a PARP inhibitor. In embodiments, the methods further comprise administering to the patient an effective amount of a NAMPT inhibitor. In embodiments, the methods further comprise administering to the patient an effective amount of an ATR kinase inhibitor and a NAMPT inhibitor.
  • ISG interferon-stimulated gene
  • the methods further comprise administering an effective amount of an ATR kinase inhibitor, a NAMPT inhibitor, and a PARP inhibitor. In embodiments, the methods comprise further administering an effective amount of a NAMPT inhibitor and a PARP inhibitor. In embodiments, the methods further comprise administering to the patient an effective amount of a NAMPT inhibitor and interferon-beta.
  • the sample obtained from a patient is a biological sample selected from, e.g., cells in culture, cell supernatants, cell lysates, blood, serum, plasma, urine, cerebral spinal fluid, biological fluid, and tissue samples.
  • the sample is a cancer sample (e.g., containing or suspected of containing cancer cells, such as from a tumor).
  • determining the level of IFN signaling pathway activity in the sample includes measuring RNA and/or protein expression of interferon-stimulated genes.
  • the RNA is mRNA.
  • Interferon-stimulated genes include one or more of the genes selected from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • Interferon-stimulated genes include one or more of the genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1,
  • Interferon- stimulated genes include one or more of the genes selected from the group consisting of PARP9, PARP 10, and PARP 14.
  • Interferon-stimulated genes include one or more of the genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, and MX1.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway proteins for STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, STAT2, or a combination of two or more thereof.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway proteins for PARP9,
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway proteins for PARP9, PARP 10, PARP 14, or a combination of two or more thereof.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway proteins for PARP9, PARPIO, PARP14, STAT1, MX1, MX2, or a combination of two or more thereof. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for STAT1, MX1, or a combination thereof. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for STAT1 and MX1.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for STAT1. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for MX1. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for PARP9. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for PARP10. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for PARP14.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for MX2. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFIT1. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFI44. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFIT3. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for OAS1.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for OAS3. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for BST2. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFITM1. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFI27.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFI27. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for CXCL10. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFI16. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFI30.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFIH1. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFIT2. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IFITM2. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IRFl.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IRF9. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for IRGM. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for ISG15. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for OAS2. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for PSME1.
  • determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for SOCS1. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA or IFN pathway protein for STAT2. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA and IFN pathway protein. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway RNA. In embodiments, the RNA is mRNA. In embodiments, determining the level of IFN signaling pathway activity in the sample includes determining the level of IFN pathway protein.
  • methods disclosed herein comprise whole transcriptome measurement.
  • whole transcriptome measurement is conducted to evaluate the relative abundance of specific RNA transcripts including an RNA transcript selected from STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2 RNA transcript.
  • whole transcriptome measurement is conducted to evaluate the relative abundance of specific RNA transcripts including an RNA transcript selected from PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2 RNA transcript.
  • whole transcriptome measurement is conducted to evaluate the relative abundance of specific RNA transcripts including an RNA transcript selected from PARP9, PARPIO, and PARP14 RNA transcript.
  • whole transcriptome measurement is conducted to evaluate the relative abundance of PARP9 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of PARPIO RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of PARP14 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of STAT1 RNA transcript and MX1 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of STAT1 RNA transcript, MX1 RNA transcript, PARP9 RNA transcript, PARPIO RNA transcript, PARP14 RNA transcript, or a combination of two or more thereof. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of STAT1 RNA transcript.
  • whole transcriptome measurement is conducted to evaluate the relative abundance of MX1 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of MX2 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFIT1 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFI44 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFIT3 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of OAS1 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of OAS3 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of BST2 RNA transcript.
  • whole transcriptome measurement is conducted to evaluate the relative abundance of IFITM1 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFI27 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of CXCL10 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFI16 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFI30 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFIH1 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFIT2 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IFITM2 RNA transcript.
  • whole transcriptome measurement is conducted to evaluate the relative abundance of IRFl RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IRF9 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of IRGM RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of ISG15 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of OAS2 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of PSME1 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of SOCS1 RNA transcript. In embodiments, whole transcriptome measurement is conducted to evaluate the relative abundance of STAT2 RNA transcript.
  • the methods include measuring the expression levels of a plurality of target genes. In embodiments, measuring expression levels of a plurality of genes does not include a whole transcriptome measurement. In embodiments, the plurality of target genes include at least one gene (e.g., at least 2, 3, 4, or 5 genes) selected from the interferon-stimulated gene signature. In embodiments, the interferon-stimulation gene signature comprises STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10,
  • the interferon-stimulation gene signature comprises STATE In embodiments, the interferon-stimulation gene signature comprises MX1.
  • the interferon-stimulation gene signature comprises STAT1 and MX1.
  • the plurality of target genes include at least one gene (e.g., at least 2, 3, 4, or 5 genes) selected from the interferon-stimulated gene signature.
  • the interferon- stimulation gene signature comprises PARP9, PARP10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, or a combination of two or more thereof.
  • the interferon-stimulation gene signature comprises PARP9, PARP10, PARP14, STAT1, and MX1. In embodiments, the interferon-stimulation gene signature comprises PARP9, PARP10, and PARP14. In embodiments, the interferon-stimulation gene signature comprises PARP9. In embodiments, the interferon-stimulation gene signature comprises PARP10. In embodiments, the interferon-stimulation gene signature comprises PARP14.
  • Measuring gene expression may be accomplished by a number of methods known in the art including but not limited to Northern bloting, Southern bloting, Western bloting, fluorescent in situ hybridization, reverse transcriptase-polymerase chain reaction, serial analysis of gene expression (SAGE), microarray analysis, tiling arrays, NanoString assays and the like.
  • isolated mRNA (or derivatives thereof, such as cDNA) is used in hybridization or amplification assays, examples of which include, but are not limited to,
  • oligonucleotide probe that can hybridize to the mRNA encoded by the gene being detected.
  • the oligonucleotide probe can be, for example, a cDNA, or a portion thereof, such as an oligonucleotide of at least 7, 15, 30, 50, 100, 250, or 500 nucleotides in length and sufficient to specifically hybridize under the assay conditions, and/or under stringent conditions, to the RNA (or corresponding cDNA) of the gene whose expression is to be measured.
  • polynucleotide probes are attached to a solid support forming an array, with one or more polynucleotide probes targeting each of the RNA (or corresponding cDNA) of the genes whose expression are to be measured.
  • RNA obtained from a sample is converted to complementary DNA (cDNA) in a hybridization reaction, which optionally may be further amplified prior to measuring expression (e.g., by PCR amplification).
  • RNA from a sample is measured without conversion to cDNA, and/or without amplification prior to measuring expression.
  • the plurality of target genes represent an ISG signature and include at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, or 20 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 1 gene selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 2 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 3 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 4 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 5 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 6 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 7 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 8 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 9 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 10 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 11 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 12 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 13 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 14 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 15 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 16 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 17 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 18 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 19 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 20 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 21 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 22 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 23 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 24 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 25 genes selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least STAT1.
  • the plurality of target genes includes at least MX1.
  • the plurality of target genes includes at least STAT1 and MX1.
  • the plurality of target genes represent an ISG signature and include at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, or at least 25 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 1 gene selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 2 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 3 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 4 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 5 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 6 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 7 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 8 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 9 genes selected from the group consisting of PARP9,
  • the plurality of target genes includes at least 10 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 11 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 12 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 13 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 14 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 15 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 16 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 17 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 18 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 19 genes selected from the group consisting of PARP9, P ARP 10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 20 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 21 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 22 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 23 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 24 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 25 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 26 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least 27 genes selected from the group consisting of PARP9, PARPIO, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes PARP9, P ARP 10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, and SOCS1.
  • the plurality of target genes includes at least PARP9.
  • the plurality of target genes includes at least PARP10.
  • the plurality of target genes includes at least PARP14.
  • the plurality of target genes includes at least PARP9 and PARP10.
  • the plurality of target genes includes at least PARP9 and PARP14. In embodiments, the plurality of target genes includes at least PARP10 and PARP14. In embodiments, the plurality of target genes includes at least PARP9, P ARP 10, and PARP14. In embodiments, the plurality of target genes includes at least PARP9, P ARP 10, and STAT1. In embodiments, the plurality of target genes includes at least PARP9, PARP14, and STAT1. In embodiments, the plurality of target genes includes at least P ARP 10, PARP14, and STAT1. In embodiments, the plurality of target genes includes at least PARP9, PARP10, PARP14, and STAT1.
  • the plurality of target genes includes at least PARP9, PARP10, and MX1. In embodiments, the plurality of target genes includes at least PARP9, PARP14, and MX 1. In embodiments, the plurality of target genes includes at least PARP10, PARP14, and MX. In embodiments, the plurality of target genes includes at least PARP9, PARP10, PARP14, and MX 1. In embodiments, the plurality of target genes includes at least PARP9, PARP10, STAT1, and MX1. In embodiments, the plurality of target genes includes at least PARP9, PARP14, STAT1, and MX 1. In embodiments, the plurality of target genes includes at least PARP10, PARP14, STAT1, and MX. In embodiments, the plurality of target genes includes at least PARP9, PARP10, PARP14, STAT1, and MX. In embodiments, the plurality of target genes includes at least PARP9, PARP10, PARP14, STAT1, and MX 1.
  • the method further includes determining an expression level in the cancer of one or more additional genes, RNA, or proteins.
  • the additional genes, RNA, or proteins are selected from cGAS, STING, or a combination thereof.
  • the additional genes, RNA, or proteins are selected from cGAS and STING.
  • the additional genes, RNA, or proteins comprise cGAS.
  • the additional genes, RNA, or proteins comprise STING.
  • determining an activity level in the one or more pathways includes determining measures of expression levels of genes in cGAS and/or STING.
  • the ATR kinase inhibitors described herein are co-administered with PARP inhibitors. In embodiments, the ATR kinase inhibitors described herein are co administered with NAMPT inhibitors. In embodiments, the ATR kinase inhibitors described herein are co-administered with one or more anticancer agents to treat cancer (e.g., pancreatic cancer). In embodiments, the ATR kinase inhibitors described herein are co-administered with interferon. In embodiments, the ATR kinase inhibitors described herein are co-administered with one or more compounds selected from the group consisting of PARP inhibitors, NAMPT inhibitors, and interferon.
  • the ATR kinase inhibitors described herein are co administered with interferon alfa-2a; interferon alfa-2b; interferon alfa-nl; interferon alfa-n3; interferon beta- la; interferon gamma- lb, or a combination of two or more thereof.
  • the ATR kinase inhibitors described herein are co-administered with a PARP inhibitor and an interferon.
  • the ATR kinase inhibitors described herein are co administered with a PARP inhibitor and an interferon selected from the group consisting of interferon alfa-2a; interferon alfa-2b; interferon alfa-nl; interferon alfa-n3; interferon beta-la; interferon gamma- lb, or a combination of two or more thereof.
  • the cancer has an increased level of interferon relative to a control.
  • the interferon is an interferon protein.
  • the interferon is an interferon RNA.
  • the interferon is Type 1 interferon.
  • the Type 1 interferon is interferon-alpha, interferon-beta, or a combination thereof.
  • the cancer is pancreatic cancer.
  • the pancreatic caner is pancreatic ductal adenocarcinoma.
  • the NAMPT inhibitors described herein are co-administered with PARP inhibitors. In embodiments, the NAMPT inhibitors described herein are co-administered with ATR kinase inhibitors. In embodiments, the NAMPT inhibitors described herein are co administered with one or more anticancer agents to treat cancer (e.g., pancreatic cancer). In embodiments, the NAMPT inhibitors described herein are co-administered with one or more compounds selected from the group consisting of PARP inhibitors, ATR kinase inhibitors, and interferon. In embodiments, the NAMPT inhibitors described herein are co-administered with interferon.
  • the NAMPT inhibitors described herein are co-administered with interferon-beta. In embodiments, the NAMPT inhibitors described herein are co-administered with interferon alfa-2a; interferon alfa-2b; interferon alfa-nl; interferon alfa-n3; interferon beta- la; interferon gamma-lb, or a combination of two or more thereof. In embodiments, the NAMPT inhibitors described herein are co-administered with a PARP inhibitor and an interferon. In embodiments, the NAMPT inhibitors described herein are co-administered with a PARP inhibitor and interferon-beta.
  • the NAMPT inhibitors described herein are co-administered with a PARP inhibitor and an interferon selected from the group consisting of interferon alfa-2a; interferon alfa-2b; interferon alfa-nl; interferon alfa-n3; interferon beta- la; interferon gamma- lb, or a combination of two or more thereof.
  • the cancer has an increased level of interferon relative to a control.
  • the interferon is an interferon protein.
  • the interferon is an interferon RNA.
  • the interferon is Type 1 interferon.
  • the Type 1 interferon is interferon-alpha, interferon-beta, or a combination thereof.
  • the cancer is pancreatic cancer.
  • the pancreatic caner is pancreatic ductal adenocarcinoma.
  • the ATR kinase inhibitor used in the methods described herein, including all embodiments thereof, can be any known in the art.
  • the ATR kinase inhibitor is berzosertib, 2-(aminomethyl)-6-[4,6-diamino-3-[4-amino-3,5-dihydroxy-6- (hydroxymethyl)oxan-2-yl]oxy-2-hydroxycyclohexyl]oxyoxane-3,4,5-triol (also known as VE- 821), ceralasertib, schisandrin B, 4-cyclohexylmethoxy-2,6-diamino-5-nitrosopyrimidine (also known as NU6027), dactolisib, (R)-4-(2-(lH-indol-4-yl)-6-(l-(methylsulfonyl)cyclopropyl) pyrimidin-4-yl)-3-methylmorpholine (also known
  • the ATR kinase inhibitor is berzosertib, VE-821, ceralasertib, schisandrin B, NU6027, dactolisib, AZ20, caffeine, wortmannin, an analog of any one of the foregoing, or a pharmaceutically acceptable salt of any one of the foregoing.
  • the ATR kinase inhibitor is berzosertib.
  • the ATR kinase inhibitor is ceralasertib.
  • the ATR kinase inhibitor is schisandrin B.
  • the ATR kinase inhibitor is dactolisib.
  • the ATR kinase inhibitor is caffeine. In embodiments, the ATR kinase inhibitor is wortmannin. In embodiments, the ATR kinase inhibitor is VE-821. In embodiments, the ATR kinase inhibitor is NU6027. In embodiments, the ATR kinase inhibitor is AZ20. In embodiments, the ATR kinase inhibitor is BAY 1895344.
  • the NAMPT inhibitor used in the methods described herein, including all embodiments thereof, can be any known in the art.
  • the ATR kinase inhibitor is daporinad (also known as FK866 or AP0866), 4- [5 -methyl-4- [[(4-methylphenyl)sulfonyl] methyl] -2-oxazolyl]-/V-(3-pyridinylmethyl)benzamide (also known as STF-118804), N-(4-((3,5- difluorophenyl)sulfonyl)benzyl)imidazo[l,2-a]pyridine-6-carboxamide (also known as GNE- 617), N-[[4-[[3-(trifluoromethyl)phenyl]sulfonyl]phenyl]-methyl]-lH-pyrazolo[3,4-b]pyridine- 5-carboxamide (also known as GNE-618), (lZ,2E)-3
  • the NAMPT inhibitor is daporinad. In embodiments, the NAMPT inhibitor is STF-118804. In embodiments, the NAMPT inhibitor is GNE-617. In embodiments, the NAMPT inhibitor is KPT-9274. In embodiments, the NAMPT inhibitor is GMX1778. In embodiments, the NAMPT inhibitor is GP 78. In embodiments, the NAMPT inhibitor is STF 31. In embodiments, the NAMPT inhibitor is SBI-797812. In embodiments, the NAMPT inhibitor is LSN3154567. In embodiments, the NAMPT inhibitor is OT-82. In embodiments, the NAMPT inhibitor is CB30865. In embodiments, the NAMPT inhibitor is GNE-618. In embodiments, the NAMPT inhibitor is CB300919. In embodiments, the NAMPT inhibitor is LSN3154567 and/or daporinad.
  • the PARP inhibitor used in the methods described herein, including all embodiments thereof, can be any known in the art.
  • the PARP inhibitor is niraparib, olaparib, rucaparib, talazoparib, vekauoarub, pamiparib, ll-methoxy-2-((4-methylpiperazin-l-yl)methyl)- 4,5,6,7-tetrahydro-lH-cyclopenta[a]pyrrolo[3,4-c]carbazole-l,3(2H)-dione (also known as CEP 9722), 10-((4-Hydroxypiperidin-l-yl)methyl)chromeno[4,3,2-de]phthalazin-3(2H)-one (also known as E7016), or an analog of any one of the foregoing.
  • the PARP inhibitor is niraparib. In embodiments, the PARP inhibitor is olaparib. In embodiments, the PARP inhibitor is rucaparib. In embodiments, the PARP inhibitor is talazoparib. In embodiments, the PARP inhibitor is vekauoarub. In embodiments, the PARP inhibitor is pamiparib. In embodiments, the PARP inhibitor is CEP 9722. In embodiments, the PARP inhibitor is E7016.
  • the patient can be administered any additional anti-cancer agent.
  • the additional anti-cancer agent is any anti-cancer agent used to treat pancreatic cancer.
  • the additional anti-cancer agent is any anti-cancer agent used to treat pancreatic ductal adenocarcinoma.
  • the additional anti-cancer drug is capecitabine, erlotinib, everolimus, fluorouracil, gemcitabine, irinotecan, leucovorin, mitomycin, nab-paclitaxel, olaparib, oxabplatin, pembrolizumab, sunitinib, or a combination of two or more thereof.
  • the methods further comprise administering to the patient radiation therapy or proton beam therapy.
  • the compounds described herein e.g., ATR kinase inhibitors, NAMPT inhibitors, PARP inhibitors, anti-cancer agents can be in the form of pharmaceutically acceptable salts.
  • pharmaceutically acceptable salts is meant to include salts of the compounds that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein.
  • base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent.
  • Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt.
  • acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent.
  • Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric, tartaric, oxalic, methanesulfonic, and the like.
  • inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic,
  • salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunoric acids and the like (see, for example, Berge et ak, “Pharmaceutical Salts”, Journal of Pharmaceutical Science, 1977, 66, 1-19).
  • Certain specific compounds of the present disclosure contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts.
  • the neutral forms of the compounds can be regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner.
  • the parent form of the compound may differ from the various salt forms in certain physical properties, such as solubility in polar solvents.
  • the present disclosure provides compounds, which are in a prodrug form.
  • Prodrugs of the compounds described herein are those compounds that readily undergo chemical changes under physiological conditions to provide the compounds of the present disclosure.
  • Prodrugs of the compounds described herein may be converted in vivo after administration.
  • prodrugs can be converted to the compounds of the present disclosure by chemical or biochemical methods in an ex vivo environment, such as, for example, when contacted with a suitable enzyme or chemical reagent.
  • Certain compounds of the present disclosure can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are encompassed within the scope of the present disclosure.
  • Certain compounds of the present disclosure may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present disclosure and are intended to be within the scope of the present disclosure.
  • the cancer is an adenocarcinoma.
  • the cancer has a KRAS mutation, a TP53 mutation, or a combination thereof.
  • the cancer has a KRAS mutation.
  • the cancer has a TP53 mutation.
  • the cancer has a KRAS mutation and a TP53 mutation.
  • the cancer has a KRAS mutation, a TP53, mutation, BRCA1 mutation, a BRCA2 mutation, a CDKN2A mutation, a SMAD4 mutation, a MLL3 mutation, a TGFBR2 mutation, an ARID1 A mutation, a SF3B1 mutation, a PALB2 mutation, a NTRK mutation, or a combination of two or more thereof.
  • the cancer has a BRCA mutation.
  • the cancer has a BRCA1 mutation.
  • the cancer has a BRCA2 mutation.
  • the cancer has a CDKN2A mutation.
  • the cancer has a SMAD4 mutation.
  • the cancer hasa MLL3 mutation.
  • the cancer has a TGFBR2 mutation. In embodiments, the cancer has an ARID1A mutation. In embodiments, the cancer has a SF3B1 mutation. In embodiments, the cancer has a PALB2 mutation. In embodiments, the cancer has a NTRK mutation.
  • the cancer is pancreatic cancer.
  • the pancreatic cancer has a KRAS mutation, a TP53 mutation, or a combination thereof.
  • the pancreatic cancer has a KRAS mutation.
  • the pancreatic cancer has a TP53 mutation.
  • the pancreatic cancer has a KRAS mutation and a TP53 mutation.
  • the pancreatic cancer has a KRAS mutation, a TP53, mutation, BRCA1 mutation, a BRCA2 mutation, a CDKN2A mutation, a SMAD4 mutation, a MLL3 mutation, a TGFBR2 mutation, an ARID 1 A mutation, a SF3B1 mutation, a PALB2 mutation, a NTRK mutation, or a combination of two or more thereof.
  • the pancreatic cancer has a BRCA mutation.
  • the pancreatic cancer has a BRCA1 mutation.
  • the pancreatic cancer has a BRCA2 mutation.
  • the pancreatic cancer has a CDKN2A mutation.
  • the pancreatic cancer has a SMAD4 mutation. In embodiments, the pancreatic cancer has a MLL3 mutation. In embodiments, the pancreatic cancer has a TGFBR2 mutation. In embodiments, the pancreatic cancer has an ARID 1 A mutation. In embodiments, the pancreatic cancer has a SF3B1 mutation. In embodiments, the pancreatic cancer has a PALB2 mutation. In embodiments, the pancreatic cancer has a NTRK mutation.
  • the cancer is pancreatic ductal adenocarcinoma.
  • the pancreatic ductal adenocarcinoma has a KRAS mutation, a TP53 mutation, or a combination thereof.
  • the pancreatic ductal adenocarcinoma has a KRAS mutation.
  • the pancreatic ductal adenocarcinoma has a TP53 mutation.
  • the pancreatic ductal adenocarcinoma has a KRAS mutation and a TP53 mutation.
  • the pancreatic ductal adenocarcinoma has a KRAS mutation, a TP53, mutation, BRCA1 mutation, a BRCA2 mutation, a CDKN2A mutation, a SMAD4 mutation, a MLL3 mutation, a TGFBR2 mutation, an ARID 1 A mutation, a SF3B 1 mutation, a PALB2 mutation, a NTRK mutation, or a combination of two or more thereof.
  • the pancreatic ductal adenocarcinoma has a BRCA mutation.
  • the pancreatic ductal adenocarcinoma has a BRCA1 mutation.
  • the pancreatic ductal adenocarcinoma has a BRCA2 mutation. In embodiments, the pancreatic ductal adenocarcinoma has a CDKN2A mutation. In embodiments, the pancreatic ductal adenocarcinoma has a SMAD4 mutation. In embodiments, the pancreatic ductal adenocarcinoma has a MLL3 mutation. In embodiments, the pancreatic ductal adenocarcinoma has a TGFBR2 mutation. In embodiments, the pancreatic ductal adenocarcinoma has an ARID 1 A mutation.
  • the pancreatic ductal adenocarcinoma has a SF3B1 mutation. In embodiments, the pancreatic ductal adenocarcinoma has a PALB2 mutation. In embodiments, the pancreatic ductal adenocarcinoma has a NTRK mutation.
  • the dosage and frequency (single or multiple doses) of the active agents (e.g., ATR kinase inhibitor, NAMPT inhibitor, PARP inhibitor) administered to a subject can vary depending upon a variety of factors, for example, whether the mammal suffers from another disease, and its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated (e.g. symptoms of cancer and severity of such symptoms), kind of concurrent treatment, complications from the disease being treated or other health-related problems.
  • Other therapeutic regimens or agents can be used in conjunction with the methods described herein. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art.
  • the effective amount can be initially determined from cell culture assays.
  • Target concentrations will be those concentrations of active agents that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art.
  • effective amounts of active agents for use in humans can also be determined from animal models.
  • a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals.
  • the dosage in humans can be adjusted by monitoring effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.
  • Dosages of the active agents may be varied depending upon the requirements of the patient.
  • the dose administered to a patient should be sufficient to affect a beneficial therapeutic response in the patient over time.
  • the size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the art. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the active agents. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached. Dosage amounts and intervals can be adjusted individually to provide levels of the active agents effective for the particular clinical indication being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.
  • an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient.
  • This planning should involve the careful choice of active agents by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects.
  • the active agent is administered to a patient at an amount of about 0.1 mg/kg to about 500 mg/kg.
  • the ATR kinase inhibitor and/or NAMPT inhibitor is administered to a patient in an amount of about 0.5 mg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg/kg, 50 mg/kg, 60 mg/kg, 70 mg/kg, 80 mg/kg, 90 mg/kg, 100 mg/kg, 200 mg/kg, or 300 mg/kg.
  • the amount is referred to as "mg/kg,” the amount is milligram per kilogram body weight of the subject being administered with the active agents.
  • the active agent is administered to a patient in an amount from about 1 mg to about 1,000 mg per day, as a single dose, or in a dose administered two or three times per day.
  • compositions comprisingthe active agents and a pharmaceutically acceptable excipient.
  • the provided compositions are suitable for formulation and administration in vitro or in vivo. Suitable carriers and excipients and their formulations are described in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005).
  • “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions of the disclosure without causing a significant adverse toxicological effect on the patient.
  • Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer’s, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethy cellulose, polyvinyl pyrrolidine, and colors, and the like.
  • Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the disclosure.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the disclosure.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the disclosure.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents
  • Solutions of the active compounds as free base or pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.
  • compositions can be delivered via intranasal or inhalable solutions or sprays, aerosols or inhalants.
  • Nasal solutions can be aqueous solutions designed to be administered to the nasal passages in drops or sprays.
  • Nasal solutions can be prepared so that they are similar in many respects to nasal secretions.
  • the aqueous nasal solutions usually are isotonic and slightly buffered to maintain a pH of 5.5 to 6.5.
  • antimicrobial preservatives similar to those used in ophthalmic preparations and appropriate drug stabilizers, if required, may be included in the formulation.
  • Various commercial nasal preparations are known and can include, for example, antibiotics and antihistamines.
  • Oral formulations can include excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
  • oral pharmaceutical compositions will comprise an inert diluent or edible carrier, or they may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food.
  • the active compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • the percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 1 to about 75% of the weight of the unit.
  • the amount of active compounds in such compositions is such that a suitable dosage can be obtained.
  • aqueous solutions for parenteral administration in an aqueous solution, for example, the solution should be suitably buffered and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • Aqueous solutions in particular, sterile aqueous media, are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion.
  • Sterile injectable solutions can be prepared by incorporating the active compounds in the required amount in the appropriate solvent followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium.
  • Vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredients, can be used to prepare sterile powders for reconstitution of sterile injectable solutions.
  • the preparation of more, or highly, concentrated solutions for direct injection is also contemplated.
  • DMSO can be used as solvent for extremely rapid penetration, delivering high concentrations of the active agents to a small area.
  • compositions of compounds can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.
  • the composition can be in unit dosage form.
  • the preparation is subdivided into unit doses containing appropriate quantities of the active component.
  • the compositions can be administered in a variety of unit dosage forms depending upon the method of administration.
  • unit dosage forms suitable for oral administration include, but are not limited to, powder, tablets, pills, capsules and lozenges.
  • the increased level interferon or interferon pathway activity is determined by calculating the H-score for the increased level interferon or interferon pathway activity.
  • the H-score may be calculated for membrane interferon receptor.
  • the H score may be calculated for tumor cells.
  • the increased level interferon or interferon pathway activity may have an H-score.
  • an “H-score” or “Histoscore” is a numerical value determined by a semi-quantitative method commonly known for immunohistochemically evaluating proteins and protein expression in biological samples, such as tumor samples.
  • the H- score may be calculated using the following formula: [1 x (% cells 1+) + 2 x (% cells 2+) + 3 x (% cells 3+)].
  • the H-score is calculated by determining the percentage of cells having a given staining intensity level (i.e., level 1+, 2+, or 3+ from lowest to highest intensity level), weighting the percentage of cells having the given intensity level by multiplying the cell percentage by a factor (e.g., 1, 2, or 3) that gives more relative weight to cells with higher-intensity membrane staining, and summing the results to obtain a H-score.
  • a factor e.g. 1, 2, or 3
  • H-scores range from 0 to 300. Further description on the determination of H-scores in tumor cells can be found in Hirsch et al, J Clin Oncol, 21:3798-3807 (2003)) and John et al, Oncogene 28:S14-S23 (2009)).
  • the H-score of a cancer cell is determined.
  • the H-score of a non cancer cell is determined.
  • the non-cancer cell is a stromal cell.
  • the H-score of a cancer cell and a non-cancer cell is determined.
  • the increased level interferon or interferon pathway activity has an H- score of at least 1 (e.g., 5, 10, 20, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 230, 240, 250, 260, 270, 280, 290, 300).
  • the increased level interferon or interferon pathway activity has an H- score of about 5.
  • the increased level interferon or interferon pathway activity has an H-score of about 10.
  • the increased level interferon or interferon pathway activity has an H-score of about 15. In embodiments, the increased level interferon or interferon pathway activity has an H-score of about 20. In embodiments, the increased level interferon or interferon pathway activity has an H-score of about 25. In embodiments, the elevated level of interferon or interferon pathway activity has an H-score of about 30. In embodiments, the increased level interferon or interferon pathway activity has an H-score of about 35. In embodiments, the increased level interferon or interferon pathway activity has an H-score of about 40. In embodiments, the increased level interferon or interferon pathway activity has an H- score of about 45. In embodiments, the increased level interferon or interferon pathway activity has an H-score of about 50.
  • methods described herein may include detecting a level of interferon signaling pathway activity with a specific binding agent (e.g., an agent that binds to a protein or nucleic acid molecule).
  • a specific binding agent e.g., an agent that binds to a protein or nucleic acid molecule.
  • exemplary binding agents include an antibody or a fragment thereof, a detectable protein or a fragment thereof, a nucleic acid molecule such as an oligonucleotide- polynucleotide comprising a sequence that is complementary to patient genomic DNA, mRNA or a cDNA produced from patient mRNA, or any combination thereof.
  • an antibody is labeled with detectable moiety, e.g., a fluorescent compound, an enzyme or functional fragment thereof, or a radioactive agent.
  • an antibody is detectably labeled by coupling it to a chemiluminescent compound.
  • the presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of chemical reaction.
  • particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
  • a specific binding agent is an agent that has greater than 10-fold, preferably greater than 100-fold, and most preferably, greater than 1000-fold affinity for the target molecule as compared to another molecule.
  • specific is used to indicate that other biomolecules present in the sample do not significantly bind to the binding agent specific for the target molecule.
  • the level of binding to a biomolecule other than the target molecule results in a binding affinity which is at most only 10% or less, only 5% or less only 2% or less or only 1% or less of the affinity to the target molecule, respectively.
  • a preferred specific binding agent will fulfill both the above minimum criteria for affinity as well as for specificity.
  • an antibody has a binding affinity (e.g., Kd) in the low micromolar (lO -6 ), nanomolar (10 7 -10 9 ), with high affinity antibodies in the low nanomolar (10 9 ) or pico molar (10 12 ) range for its specific target ligand.
  • a binding affinity e.g., Kd
  • lO -6 micromolar
  • nanomolar 10 7 -10 9
  • high affinity antibodies in the low nanomolar (10 9 ) or pico molar (10 12 ) range for its specific target ligand.
  • the present subject matter provides a composition comprising a binding agent, wherein the binding agent is attached to a solid support, (e.g., a strip, a polymer, a bead, a nanoparticle, a plate such as a multiwell plate, or an array such as a microarray).
  • a nucleic acid probe attached to a solid support such as a microarray
  • a nucleic acid in a test sample may be amplified (e.g., using PCR) before or after the nucleic acid to be measured is hybridized with the probe.
  • RT-PCR reverse transcription polymerase chain reaction
  • a probe on a solid support is used, and mRNA (or a portion thereof) in a biological sample is converted to cDNA or partial cDNA and then the cDNA or partial cDNA is hybridized to a probe (e.g., on a microarray), hybridized to a probe and then amplified, or amplified and then hybridized to a probe.
  • a strip may be a nucleic acid-probe coated porous or non-porous solid support strip comprising linking a nucleic acid probe to a carrier to prepare a conjugate and immobilizing the conjugate on a porous solid support.
  • the support or carrier comprises glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, and magnetite.
  • the carrier can be either soluble to some extent or insoluble for the purposes of the disclosure.
  • the support material may have any structural configuration so long as the coupled molecule is capable of binding to a binding agent (e.g., an antibody).
  • the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod.
  • the surface may be flat such as a plate (or a well within a multiwell plate), sheet, or test strip. The skilled artisan will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.
  • a solid support comprises a polymer, to which an agent is chemically bound, immobilized, dispersed, or associated.
  • a polymer support may be, e.g., a network of polymers, and may be prepared in bead form (e.g., by suspension polymerization).
  • the location of active sites introduced into a polymer support depends on the type of polymer support. In aspects, in a swollen-gel-bead polymer support the active sites are distributed uniformly throughout the beads, whereas in a macroporous-bead polymer support they are predominantly on the internal surfaces of the macropores.
  • the solid support e.g., a device, may contain a interferon signaling pathway activity binding agent.
  • detection is accomplished using an ELISA or Western blot format.
  • the binding agent comprises an nucleic acid (e.g., a probe or primers that are complementary for mRNA or cDNA), and the detecting step is accomplished using a polymerase chain reaction (PCR) or Northern blot format, or other means of detection.
  • PCR polymerase chain reaction
  • a probe or primer is about 10-20, 15-25, 15-35, 15-25, 20-80, 50-100, or 10-100 nucleotides in length, e.g., about 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, or 100 nucleotides in length or less than about 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, or 100 nucleotides in length.
  • assaying means using an analytic procedure to qualitatively assess or quantitatively measure the presence or amount or the functional activity of a target entity.
  • assaying the level of a compound means using an analytic procedure (such as an in vitro procedure) to qualitatively assess or quantitatively measure the presence or amount of the compound.
  • the cells in a biological sample are lysed to release a protein or nucleic acid.
  • a protein or nucleic acid Numerous methods for lysing cells and assessing protein and nucleic acid levels are known in the art.
  • cells are physically lysed, such as by mechanical disruption, liquid homogenization, high frequency sound waves, freeze/thaw cycles, with a detergent, or manual grinding.
  • detergents include Tween 20, Triton X- 100, and sodium dodecyl sulfate.
  • assays for determining the level of a protein include HPLC, LC/MS, ELISA, Immunoelectrophoresis, Western blot, immunohistochemistry, and radioimmuno assays.
  • assays for determining the level of an mRNA include Northern blotting, RT-PCR, RNA sequencing, and qRT-PCR.
  • the tumor sample can be obtained by a variety of procedures, such as surgical excision, aspiration or biopsy.
  • the tissue sample may be sectioned and assayed as a fresh specimen; alternatively, the tissue sample may be frozen for further sectioning.
  • the tissue sample is preserved by fixing and embedding in paraffin or the like.
  • determining the expression level of a gene comprises detecting and quantifying RNA transcribed from that gene or a protein translated from such RNA.
  • the RNA includes mRNA transcribed from the gene, and/or specific spliced variants thereof and/or fragments of such mRNA and spliced variants.
  • raw expression values are normalized by performing quantile normalization relative to the reference distribution and subsequent log 10-transformation.
  • the reference distribution is generated by pooling reported (i.e., raw) counts for the test sample and one or more control samples (preferably at least 2 samples, more preferably at least any of 4, 8 or 16 samples) after excluding values for technical (both positive and negative control) probes and without performing intermediate normalization relying on negative (background-adjusted) or positive (synthetic sequences spiked with known titrations).
  • oligonucleotides in kits are capable of specifically hybridizing to a target region of a polynucleotide, such as for example, an RNA transcript or cDNA generated therefrom.
  • specific hybridization means the oligonucleotide forms an anti parallel double-stranded structure with the target region under certain hybridizing conditions, while failing to form such a structure with non-target regions when incubated with the polynucleotide under the same hybridizing conditions.
  • the composition and length of each oligonucleotide in the kit will depend on the nature of the transcript containing the target region as well as the type of assay to be performed with the oligonucleotide and is readily determined by the skilled artisan.
  • the disclosure provides a computer product comprise a machine-readable medium storing instructions that, when executed by at least one programmable processor, cause the at least one programmable processor to perform operations comprising the methods described herein, including all embodiments thereof.
  • the disclosure provides a computer program product comprising a machine-readable medium storing instructions that, when executed by at least one programmable processor, cause the at least one programmable processor to perform operations comprising the method of classifying a cancer in a patient by (a) measuring expression levels of a plurality of target genes in RNA from a sample obtained from the patient, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15
  • the disclosure provides a computer program product comprising a machine-readable medium storing instructions that, when executed by at least one programmable processor, cause the at least one programmable processor to perform operations comprising the method of identifying a cancer patient responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor, the method comprising measuring expression levels of a plurality of target genes in a sample obtained from the cancer patient, wherein the plurality of target genes comprise at least 2 genes from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • the disclosure provides a system comprising computer hardware configured to perform operations comprising the methods described herein, including all embodiments thereof.
  • the system comprising computer hardware configured to perform operations comprising the method of classifying a cancer in a patient by (a) measuring expression levels of a plurality of target genes in RNA from a sample obtained from the patient, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, P ARP 10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2; (b) comparing expression levels of the plurality of target genes to a control; and (c) classifying the cancer as responsive to treatment with an ATR kinase inhibitor and/or a
  • the system comprising computer hardware configured to perform operations comprising the method of identifying a cancer patient responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor, the method comprising measuring expression levels of a plurality of target genes in a sample obtained from the cancer patient, wherein the plurality of target genes comprise at least 2 genes from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • the disclosure provides computer-implemented methods comprising the methods described herein, including all embodiments thereof.
  • the disclosure provides computer-implemented methods comprising the method of classifying a cancer in a patient by (a) measuring expression levels of a plurality of target genes in RNA from a sample obtained from the patient, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2; (b) comparing expression levels of the plurality of target genes to a control; and (c) classifying the cancer as responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor.
  • the disclosure provides computer-implemented methods comprising the method of identifying a cancer patient responsive to treatment with an ATR kinase inhibitor and/or a NAMPT inhibitor, the method comprising measuring expression levels of a plurality of target genes in a sample obtained from the cancer patient, wherein the plurality of target genes comprise at least 2 genes from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • the disclosure provides computer control systems that are programmed to implement the methods of the disclosure, including all embodiments thereof.
  • a computer system can be programmed or otherwise configured to implements methods of the disclosure, including all embodiments thereof.
  • the computer system can be integral to implementing methods provided herein, which may be otherwise difficult to perform in the absence of the computer system.
  • the computer system can be an electronic device of a user or a computer system that is remotely located with respect to the electronic device.
  • the electronic device can be a mobile electronic device.
  • the computer system can be a computer server.
  • the computer system includes a central processing unit (CPU, also "processor” and “computer processor”), which can be a single core or multi-core processor, or a plurality of processors for parallel processing.
  • the computer system also includes memory or memory location (e.g., random-access memory, read-only memory, flash memory), electronic storage unit (e.g., hard disk), communication interface (e.g., network adapter) for communicating with one or more other systems, and peripheral devices, such as cache, other memory, data storage and/or electronic display adapters.
  • the memory, storage unit, interface and peripheral devices are in communication with the CPU through a communication bus, such as a motherboard.
  • the storage unit can be a data storage unit (or data repository) for storing data.
  • the computer system can be operatively coupled to a computer network ("network") with the aid of the communication interface.
  • the network can be the internet, an internet and/or extranet, or an intranet and/or extranet that is in communication with the internet.
  • the network in some cases is a telecommunication and/or data network.
  • the network can include one or more computer servers, which can enable distributed computing, such as cloud computing.
  • the network in some cases with the aid of the computer system, can implement a peer-to-peer network, which may enable devices coupled to the computer system to behave as a client or a server.
  • the CPU can execute a sequence of machine-readable instructions, which can be embodied in a program or software.
  • the instructions may be stored in a memory location, such as the memory.
  • the instructions can be directed to the CPU, which can subsequently program or otherwise configure the CPU to implement methods of the present disclosure. Examples of operations performed by the CPU can include fetch, decode, execute, and writeback.
  • the CPU can be part of a circuit, such as an integrated circuit. One or more other components of the system can be included in the circuit. In some cases, the circuit is an application specific integrated circuit (ASIC).
  • ASIC application specific integrated circuit
  • the storage unit can store files, such as drivers, libraries and saved programs.
  • the storage unit can store user data, e.g., user preferences and user programs.
  • the computer system in some cases can include one or more additional data storage units that are external to the computer system, such as located on a remote server that is in communication with the computer system through an intranet or the internet.
  • the computer system can communicate with one or more remote computer systems through the network.
  • the computer system can communicate with a remote computer system of a user (e.g., patient, healthcare provider, or service provider).
  • remote computer systems include personal computers (e.g., portable PC), slate or tablet PC's (e.g., Apple® iPad, Samsung® Galaxy Tab), telephones, Smart phones (e.g., Apple® iPhone, Android-enabled device, Blackberry®), or personal digital assistants.
  • the user can access the computer system via the network.
  • Methods as described herein can be implemented by way of machine (e.g., computer processor) executable code stored on an electronic storage location of the computer system, such as, for example, on the memory or electronic storage unit.
  • the memory can be part of a database.
  • the machine executable or machine readable code can be provided in the form of software.
  • the code can be executed by the processor.
  • the code can be retrieved from the storage unit and stored on the memory for ready access by the processor.
  • the electronic storage unit can be precluded, and machine-executable instructions are stored on memory.
  • the code can be pre-compiled and configured for use with a machine having a processer adapted to execute the code, or can be compiled during runtime.
  • the code can be supplied in a programming language that can be selected to enable the code to execute in a precompiled or as-compiled fashion.
  • aspects of the systems and methods provided herein can be embodied in programming.
  • Various aspects of the technology may be thought of as “products” or “articles of manufacture” typically in the form of machine (or processor) executable code and/or associated data that is carried on or embodied in a type of machine readable medium.
  • Machine-executable code can be stored on an electronic storage unit, such as memory (e.g., read-only memory, random-access memory, flash memory) or a hard disk.
  • “Storage” media can include any or all of the tangible memory of the computers, processors or the like, or associated modules thereof, such as various semiconductor memories, tape drives, disk drives and the like, which may provide non-transitory storage at any time for the software programming. All or portions of the software may at times be communicated through the Internet or various other telecommunication networks. Such communications, for example, may enable loading of the software from one computer or processor into another, for example, from a management server or host computer into the computer platform of an application server.
  • another type of media that may bear the software elements includes optical, electrical and electromagnetic waves, such as used across physical interfaces between local devices, through wired and optical landline networks and over various air-links.
  • a machine readable medium such as computer-executable code, may take many forms, including but not limited to, a tangible storage medium, a carrier wave medium or physical transmission medium.
  • Non-volatile storage media include, for example, optical or magnetic disks, such as any of the storage devices in any computer(s) or the like, such as may be used to implement the databases, etc.
  • Volatile storage media include dynamic memory, such as main memory of such a computer platform.
  • Tangible transmission media include coaxial cables; copper wire and fiber optics, including the wires that comprise a bus within a computer system.
  • Carrier-wave transmission media may take the form of electric or electromagnetic signals, or acoustic or light waves such as those generated during radio frequency (RF) and infrared (IR) data communications.
  • RF radio frequency
  • IR infrared
  • Computer-readable media therefore include for example: a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD or DVD-ROM, any other optical medium, punch cards paper tape, any other physical storage medium with patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cartridge, a carrier wave transporting data or instructions, cables or links transporting such a carrier wave, or any other medium from which a computer may read programming code and/or data. Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.
  • the computer system can include or be in communication with an electronic display that comprises a user interface (UI) for providing, for example, genetic information, such as an identification of disease-causing alleles in single individuals or groups of individuals.
  • UI user interface
  • Examples of UI's include, without limitation, a graphical user interface (GUI) and web-based user interface (or web interface).
  • Methods and systems of the present disclosure can be implemented by way of one or more algorithms.
  • An algorithm can be implemented by way of software upon execution by the central processing unit.
  • the algorithm can, for example, prioritize a set of two or more target genes in RNA based on an expression level of the target genes in the RNA and a control.
  • the medium, method, and system disclosed herein comprise one or more softwares, servers, and database modules, or use of the same.
  • software modules may be created by techniques known to those of skill in the art using machines, software, and languages known to the art.
  • the software modules disclosed herein may be implemented in a multitude of ways.
  • a software module comprises a file, a section of code, a programming feature, a programming structure, or combinations thereof.
  • a software module may comprise a plurality of files, a plurality of sections of code, a plurality of programming features, a plurality of programming structures, or combinations thereof.
  • the one or more software modules comprises a web application, a mobile application, and/or a standalone application.
  • Software modules may be in one computer program or application. Software modules may be in more than one computer program or application. Software modules may be hosted on one machine. Software modules may be hosted on more than one machine. Software modules may be hosted on cloud computing platforms. Software modules may be hosted on one or more machines in one location. Software modules may be hosted on one or more machines in more than one location.
  • the medium, method, and system disclosed herein comprise one or more databases, such as the phenotypic and/or genotypic-associated database described herein, or use of the same.
  • the database are used for expression levels of a plurality of target genes.
  • Suitable databases include, by way of non-limiting examples, relational databases, non-relational databases, feature oriented databases, feature databases, entity- relationship model databases, associative databases, and XML databases.
  • a database is internet-based.
  • a database is web-based.
  • a database is cloud computing-based.
  • a database may be based on one or more local computer storage devices.
  • an anticancer agent is used in accordance with its plain ordinary meaning and refers to a composition (e.g. compound, drug, antagonist, inhibitor, modulator) having antineoplastic properties or the ability to inhibit the growth or proliferation of cells.
  • an anti-cancer agent is a chemotherapeutic.
  • an anti-cancer agent is an agent identified herein having utility in methods of treating cancer.
  • an anti-cancer agent is an agent approved by the FDA or similar regulatory agency of a country other than the USA, for treating cancer. Examples of anti-cancer agents include, but are not limited to, MEK (e.g. MEK1, MEK2, or MEK1 and MEK2) inhibitors (e.g.
  • alkylating agents e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, nitrogen mustards (e.g., mechloroethamine, cyclophosphamide, chlorambucil, meiphalan), ethylenimine and methylmelamines (e.g., hexamethly melamine, thiotepa), alkyl sulfon
  • alkylating agents e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, nitrogen mustards (e.g., mechloroethamine, cyclophosphamide, chlorambuci
  • Taxol.TM i.e. paclitaxel
  • Taxotere.TM compounds comprising the taxane skeleton, Erbulozole (i.e. R-55104), Dolastatin 10 (i.e. DLS-10 and NSC-376128), Mivobulin isethionate (i.e. as CI-980), Vincristine, NSC-639829, Discodermolide (i.e. as NVP- XX-A-296), ABT-751 (Abbott, i.e. E-7010), Altorhyrtins (e.g. Altorhyrtin A and Altorhyrtin C), Spongistatins (e.g.
  • Epothilone E Epothilone F
  • Epothilone B N-oxide Epothilone A N-oxide
  • 16-aza-epothilone B Epothilone B
  • 21-aminoepothilone B i.e. BMS-310705
  • 21 -hydroxy epothilone D i.e. Desoxyepothilone F and dEpoF
  • 26-fluoroepothilone Auristatin PE (i.e. NSC-654663), Soblidotin (i.e. TZT-1027), LS-4559-P (Pharmacia, i.e.
  • LS-4577 LS-4578 (Pharmacia, i.e. LS- 477-P), LS-4477 (Pharmacia), LS-4559 (Pharmacia), RPR-112378 (Aventis), Vincristine sulfate, DZ-3358 (Daiichi), FR-182877 (Fujisawa, i.e. WS-9885B), GS-164 (Takeda), GS-198 (Takeda), KAR-2 (Hungarian Academy of Sciences), BSF-223651 (BASF, i.e.
  • ILX-651 and LU-223651 SAH-49960 (Lilly/Novartis), SDZ-268970 (Lilly/Novartis), AM-97 (Armad/Kyowa Hakko), AM-132 (Armad), AM-138 (Armad/Kyowa Hakko), IDN-5005 (Indena), Cryptophycin 52 (i.e. LY-355703), AC-7739 (Ajinomoto, i.e. AVE-8063A and CS- 39.HC1), AC-7700 (Ajinomoto, i.e.
  • T-900607 RPR-115781 (Aventis), Eleutherobins (such as Desmethyleleutherobin, Desaetyleleutherobin, lsoeleutherobin A, and Z-Eleutherobin), Caribaeoside, Caribaeolin, Halichondrin B, D-64131 (Asta Medica), D-68144 (Asta Medica), Diazonamide A, A-293620 (Abbott), NPI-2350 (Nereus), Taccalonolide A, TUB-245 (Aventis), A-259754 (Abbott), Diozostatin, (-)-Phenylahistin (i.e.
  • NSCL-96F03-7 D-68838 (Asta Medica), D-68836 (Asta Medica), Myoseverin B, D-43411 (Zentaris, i.e. D-81862), A-289099 (Abbott), A-318315 (Abbott), HTI-286 (i.e.
  • SPA-110, trifluoroacetate salt) (Wyeth), D-82317 (Zentaris), D-82318 (Zentaris), SC- 12983 (NCI), Resverastatin phosphate sodium, BPR-OY-007 (National Health Research Institutes), and SSR-250411 (Sanofi)), steroids (e.g., dexamethasone), finasteride, aromatase inhibitors, gonadotropin-releasing hormone agonists (GnRH) such as goserelin or leuprolide, adrenocorticosteroids (e.g., prednisone), progestins (e.g., hydroxyprogesterone caproate, megestrol acetate, medroxyprogesterone acetate), estrogens (e.g., diethlystilbestrol, ethinyl estradiol), antiestrogen (e.g., tamoxifen), androgens (e
  • gefitinib Iressa TM
  • erlotinib Tarceva TM
  • cetuximab ErbituxTM
  • lapatinib TykerbTM
  • panitumumab VectibixTM
  • vandetanib CaprelsaTM
  • afatinib/BIBW2992 CI-1033/canertinib, neratinib/HKI-272, CP- 724714, TAK-285, AST-1306, ARRY334543, ARRY-380, AG-1478, dacomitinib/PF299804, OSI-420/desmethyl erlotinib, AZD8931, AEE788, pebtinib/EKB-569, CUDC-101, WZ8040, WZ4002, WZ3146, AG-490, XL647, PD153035, BMS-599626), sorafenib, imatinib, sunitinib
  • the term “about” means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, the term “about” means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to +/- 10% of the specified value. In embodiments, about means the specified value.
  • Embodiment PI A method of treating cancer in a patient in need thereof, the method comprising administering to the patient an effective amount of an ATR kinase inhibitor; wherein the cancer has an increased level of interferon or interferon signaling pathway activity.
  • Embodiment P2 The method of Embodiment PI, wherein the cancer has an increased level of interferon, and wherein the interferon is an interferon protein or an interferon RNA.
  • Embodiment P3 The method of Embodiment PI, wherein the cancer has an increased level of interferon signaling pathway activity, wherein the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, I
  • Embodiment P4 The method of Embodiment P3, wherein the interferon pathway protein or the interferon pathway RNA is STAT1, MX1, or a combination thereof.
  • Embodiment P5. A method of treating cancer in a patient in need thereof, the method comprising: (i) determining the level of interferon or interferon signaling pathway activity in a sample obtained from a patient; and (ii) administering to the patient a therapeutically effective amount of an ATR kinase inhibitor.
  • Embodiment P6 The method of Embodiment P5, wherein the method comprises determining the level of interferon in the sample.
  • Embodiment P7 The method of Embodiment P6, wherein the interferon is an interferon protein or an interferon RNA.
  • Embodiment P8 The method of any one of Embodiments P5 to P7, wherein the method comprises determining the level of interferon signaling pathway activity in the sample.
  • Embodiment P9 The method of Embodiment P8, wherein determining the level of interferon signaling pathway activity in the sample comprises determining the level of interferon pathway RNA or interferon pathway protein for STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, or a combination of two or more thereof.
  • Embodiment P10 The method of Embodiment P9, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for STATE
  • Embodiment P 11 The method of Embodiment P9 or P 10, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for MX1.
  • Embodiment P12 The method of any one of Embodiments PI to PI 1, wherein the interferon is Type 1 interferon.
  • Embodiment P13 The method of Embodiment PI 2, wherein the Type 1 interferon is interferon-alpha, interferon-beta, or a combination thereof.
  • Embodiment P14 The method of any one of Embodiments PI to P13, wherein the cancer has an increased level of interferon or interferon signaling pathway activity relative to a control.
  • Embodiment P15 The method of any one of Embodiments PI to PI 4, wherein the cancer has a KRAS mutation, a TP53 mutation, or a combination thereof.
  • Embodiment P16 The method of any one of Embodiments PI to P15, wherein the cancer is pancreatic cancer.
  • Embodiment PI 7 The method of Embodiment PI 6, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.
  • Embodiment P18 The method of any one of Embodiments PI to P17, wherein the ATR kinase inhibitor is berzosertib, VE-821, ceralasertib, schisandrin B, NU6027, dactolisib, AZ20, caffeine, or wortmannin.
  • the ATR kinase inhibitor is berzosertib, VE-821, ceralasertib, schisandrin B, NU6027, dactolisib, AZ20, caffeine, or wortmannin.
  • Embodiment PI 9 The method of Embodiment PI 8, wherein the ATR kinase inhibitor is berzosertib.
  • Embodiment P20 The method of any one of Embodiments PI to P19, further comprising administering to the patient a therapeutically effective amount of a PARP inhibitor.
  • Embodiment P21 The method of Embodiment P20, wherein the PARP inhibitor is niraparib, olaparib, rucaparib, talazoparib, vekauoarub, pamiparib, CEP 9722, or E7016.
  • Embodiment P22 The method of Embodiment P21, wherein the PARP inhibitor is olaparib.
  • Embodiment P23 A method of classifying a cancer in a patient, the method comprising: (a) measuring expression levels of a plurality of target genes in RNA from a sample obtained from the patient, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2; (d) comparing expression levels of the plurality of target genes to a control; and (e) classifying the cancer as responsive to treatment with an ATR kinase inhibitor.
  • Embodiment P24 The method of Embodiment P23, wherein the cancer is classified as responsive to treatment with an ATR kinase inhibitor when the expression levels of the plurality of target genes are increased relative to the control.
  • Embodiment P25 A method of identifying a cancer patient responsive to treatment with an ATR kinase inhibitor, the method comprising measuring expression levels of a plurality of target genes in a sample obtained from the cancer patient, wherein the plurality of target genes comprise at least 2 genes from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • Embodiment P26 The method of Embodiment P25, wherein the patient is identified as responsive to treatment with an ATR kinase inhibitor when the expression levels of the plurality of target genes are increased relative to a control.
  • Embodiment P27 The method of any one of Embodiments P23 to P26, wherein further comprising identifying the presence of a type 1 interferon-stimulated gene signature, pCHEKs345, or a combination thereof in a sample obtained from the cancer patient.
  • Embodiment P28 The method of Embodiment P27, wherein the patient is identified as responsive to treatment with an ATR kinase inhibitor when the presence of the type 1 interferon-stimulated gene signature, pCHEKs345, or the combination thereof is identified.
  • Embodiment P29 The method of any one of Embodiments P23 to P28, wherein the plurality of target genes comprises STAT1 and MX1.
  • Embodiment P30 The method of any one of Embodiments P23 to P29, wherein the plurality of target genes comprise at least 3 genes.
  • Embodiment P31 The method of Embodiment P30, wherein the plurality of target genes comprise at least 4 genes.
  • Embodiment P32 The method of any one of Embodiments P23 to P31, wherein measuring does not comprise a whole transcriptome measurement.
  • Embodiment P33 The method of any one of Embodiments P23 to P32, wherein the cancer is pancreatic cancer.
  • Embodiment P34 The method of Embodiment P33, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.
  • Embodiment P35 The method of any one of Embodiments P23 to P34, further comprising administering to the patient an effective amount of ATR kinase inhibitor.
  • Embodiment P36 The method of Embodiment P35, wherein the ATR kinase inhibitor is berzosertib, VE-821, ceralasertib, schisandrin B, NU6027, dactolisib, AZ20, caffeine, wortmannin, or an analog of any one of the foregoing.
  • the ATR kinase inhibitor is berzosertib, VE-821, ceralasertib, schisandrin B, NU6027, dactolisib, AZ20, caffeine, wortmannin, or an analog of any one of the foregoing.
  • Embodiment P37 The method of any one of Embodiments P23 to P36, further comprising administering to the patient an effective amount of a PARP inhibitor
  • Embodiment P38 The method of Embodiment P37, wherein the PARP inhibitor is niraparib, olaparib, rucaparib, talazoparib, vekauoarub, pamiparib, CEP 9722, or E7016.
  • Embodiment P39 A computer program product comprising a machine-readable medium storing instructions that, when executed by at least one programmable processor, cause the at least one programmable processor to perform operations comprising the method of any one of Embodiments P23 to P34.
  • Embodiment P40 A system comprising computer hardware configured to perform operations comprising the method of any one of Embodiments P23 to P34.
  • Embodiment P41 A computer-implemented method comprising the method of any one of Embodiments P23 to P34.
  • Embodiment N A method of treating cancer in a patient in need thereof, the method comprising administering to the patient an effective amount of a NAMPT inhibitor; wherein the cancer has an increased level of interferon or interferon signaling pathway activity.
  • Embodiment N2 The method of Embodiment Nl, wherein the cancer has an increased level of interferon signaling pathway activity, wherein the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of PARP9, PARP10, PARP14, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of PARP9, PARP10, PARP14, and a combination of two or more thereof.
  • Embodiment N3 The method of Embodiment N2, wherein interferon pathway protein or the interferon pathway RNA is PARP9.
  • Embodiment N4 Embodiment N3.
  • Embodiment N5 The method of any one of Embodiments N2 to N4, wherein interferon pathway protein or the interferon pathway RNA is PARP14.
  • Embodiment N6 The method of Embodiment Nl, wherein the cancer has an increased level of interferon.
  • Embodiment N7 A method of treating cancer in a patient in need thereof, the method comprising: (i) determining the level of interferon or interferon signaling pathway activity in a sample obtained from a patient; and (ii) administering to the patient a therapeutically effective amount of a NAMPT inhibitor.
  • Embodiment N8 The method of Embodiment N7, wherein the method comprises determining the level of interferon signaling pathway activity in the sample.
  • Embodiment N9 The method of Embodiment N8, wherein determining the level of interferon signaling pathway activity in the sample comprises determining the level of interferon pathway RNA or interferon pathway protein for PARP9, P ARP 10, PARP14, or a combination of two or more thereof.
  • Embodiment N10 The method of Embodiment N9, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for PARP9.
  • Embodiment Nil The method of Embodiment N9 or Nl 0, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for P ARP 10.
  • Embodiment N12 The method of Embodiment N9, N10, orNll, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for PARP14.
  • Embodiment Nl 3. The method of any one of Embodiments Nl to N12, wherein the interferon is Type 1 interferon.
  • Embodiment N14 The method of Embodiment Nl 3, wherein the Type 1 interferon is interferon-alpha, interferon-beta, or a combination thereof.
  • Embodiment N15 The method of any one of Embodiments N1 to N14, wherein the cancer has an increased level of interferon or interferon signaling pathway activity relative to a control.
  • Embodiment N16 The method of any one of Embodiments N1 to N15, wherein the cancer has a BRCA mutation, a KRAS mutation, a TP53 mutation, or a combination thereof.
  • Embodiment N17 The method of any one of Embodiments N1 to N16, wherein the cancer is pancreatic cancer.
  • Embodiment N18 The method of Embodiment N17, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.
  • Embodiment N19 The method of any one of Embodiments N1 to N18, wherein the NAMPT inhibitor is daporinad, GNE-617, GNE-618, KPT-9274, CHS-828, GPP 78, STF 31, SBI-797812, LSN3154567, OT-82, CB30865, CB300919, or a combination of two or more of the foregoing.
  • Embodiment N20 The method of Embodiment N19, wherein the NAMPT inhibitor is daporinad or LSN3154567.
  • Embodiment N21 A method of classifying a cancer in a patient, the method comprising: (a) measuring expression levels of a plurality of target genes in RNA from a sample obtained from the patient, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARP10, and PARP14; (d) comparing expression levels of the plurality of target genes to a control; and (e) classifying the cancer as responsive to treatment with a NAMPT inhibitor.
  • Embodiment N22 The method of Embodiment N21 , wherein the cancer is classified as responsive to treatment with the NAMPT inhibitor when the expression levels of the plurality of target genes are increased relative to the control.
  • Embodiment N23 A method of identifying a cancer patient responsive to treatment with a NAMPT inhibitor, the method comprising measuring expression levels of a plurality of target genes in a sample obtained from the cancer patient, wherein the plurality of target genes comprise at least 2 genes from the group consisting of PARP9, PARP10, and PARP14.
  • Embodiment N24 The method of Embodiment N23, wherein the patient is identified as responsive to treatment with the NAMPT inhibitor when the expression levels of the plurality of target genes are increased relative to a control.
  • Embodiment N25 The method of any one of Embodiments N21 to N24, further comprising identifying the presence of a type 1 interferon-stimulated gene signature, pCHEKs345, or a combination thereof in a sample obtained from the cancer patient.
  • Embodiment N26 The method of Embodiment N25, wherein the patient is identified as responsive to treatment with the NAMPT inhibitor when the presence of the type 1 interferon- stimulated gene signature, pCHEKs345, or the combination thereof is identified.
  • Embodiment N27 The method of any one of Embodiments N21 to N26, wherein the plurality of target genes comprise PARP9 and PARP10.
  • Embodiment N28 The method of any one of Embodiments N21 to N26, wherein the plurality of target genes comprise PARP9 and PARP14.
  • Embodiment N29 The method of any one of Embodiments N21 to N26, wherein the plurality of target genes comprise PARP10 and PARP14.
  • Embodiment N30 The method of any one of Embodiments N21 to N26, wherein the plurality of target genes comprise PARP9, PARP10, and PARP14.
  • Embodiment N31 The method of any one of Embodiments N21 to N30, wherein the cancer is pancreatic cancer.
  • Embodiment N32 The method of Embodiment N31 , wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.
  • Embodiment N33 The method of any one of Embodiments N21 to N32, further comprising administering to the patient an effective amount of a NAMPT inhibitor.
  • Embodiment N34 The method of Embodiment N33, wherein the NAMPT inhibitor is daporinad, GNE-617, GNE-618, KPT-9274, CHS-828, GPP 78, STF 31, SBI-797812,
  • Embodiment N35 The method of Embodiment N33, wherein the NAMPT inhibitor is daporinad or LSN3154567.
  • Embodiment N36 The method of any one of Embodiments N1-N20 and N33-N35, further comprising administering to the patient an effective amount of interferon-beta.
  • Embodiment N37 A computer program product comprising a machine-readable medium storing instructions that, when executed by at least one programmable processor, cause the at least one programmable processor to perform operations comprising the method of any one of Embodiments N21 to N32.
  • Embodiment N38 A system comprising computer hardware configured to perform operations comprising the method of any one of Embodiments N23 to N34.
  • Embodiment N39 A computer-implemented method comprising the method of any one of Embodiments N21 to N32.
  • Embodiments 1 to 79 are identical to Embodiments 1 to 79.
  • Embodiment 1 A method of treating cancer in a patient in need thereof, the method comprising administering to the patient an effective amount of an ATR kinase inhibitor, an
  • NAMPT inhibitor or a combination thereof; wherein the cancer has an increased level of interferon or interferon signaling pathway activity.
  • Embodiment 2 The method of claim 1, comprising administering to the patient an effective amount of an ATR kinase inhibitor.
  • Embodiment 3 The method of claim 1, comprising administering to the patient an effective amount of an NAMPT inhibitor.
  • Embodiment 4 The method of claim 1, comprising administering to the patient an effective amount of an ATR kinase inhibitor and an NAMPT inhibitor.
  • Embodiment 5 The method of any one of claims 1 to 4, wherein the cancer has an increased level of interferon, and wherein the interferon is an interferon protein or an interferon RNA.
  • Embodiment 6 The method of any one of claims 1 to 4, wherein the cancer has an increased level of interferon signaling pathway activity, wherein the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of PARP9, PARP10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of PARP9, PARP10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, I
  • Embodiment 7 The method of any one of claims 1 to 4, wherein the cancer has an increased level of interferon signaling pathway activity, wherein the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRFl, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, I
  • Embodiment 8 The method of claim 7, wherein the interferon pathway protein or the interferon pathway RNA is STAT1, MX1, or a combination thereof.
  • Embodiment 9 The method of any one of claims 1 to 4, wherein the cancer has an increased level of interferon signaling pathway activity, wherein the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of PARP9, P ARP 10, PARP14, and a combination of two or more thereof.
  • Embodiment 10 The method of any one of claims 1 to 4, wherein the cancer has an increased level of interferon signaling pathway activity, wherein the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, and a combination of two or more thereof.
  • the interferon signaling pathway activity is an interferon pathway protein or an interferon pathway RNA selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, and a combination of two or more thereof.
  • Embodiment 11 A method of treating cancer in a patient in need thereof, the method comprising determining the level of interferon or interferon signaling pathway activity in a sample obtained from a patient; and administering to the patient a therapeutically effective amount of an ATR kinase inhibitor, an NAMPT inhibitor, or a combination thereof.
  • Embodiment 12 The method of claim 11, comprising administering to the patient an effective amount of the ATR kinase inhibitor.
  • Embodiment 13 The method of claim 11, comprising administering to the patient the effective amount of an NAMPT inhibitor.
  • Embodiment 14 The method of claim 11, comprising administering to the patient the effective amount of an ATR kinase inhibitor and an NAMPT inhibitor.
  • Embodiment 15 The method of any one of claims 11 to 14, wherein the method comprises determining the level of interferon in the sample.
  • Embodiment 16 The method of any one of claims 11 to 14, wherein the method comprises determining the level of interferon in the sample.
  • Embodiment 17 The method of any one of claims 11 to 14, wherein the method comprises determining the level of interferon signaling pathway activity in the sample.
  • Embodiment 18 The method of claim 17, wherein determining the level of interferon signaling pathway activity in the sample comprises determining the level of interferon pathway RNA or interferon pathway protein for PARP9, PARP10, PARP14, STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, or a combination of two or more thereof.
  • Embodiment 19 The method of claim 17, wherein determining the level of interferon signaling pathway activity in the sample comprises determining the level of interferon pathway RNA or interferon pathway protein for STAT1, STAT2, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, or a combination of two or more thereof.
  • Embodiment 20 The method of claim 17, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for STATE
  • Embodiment 21 The method of claim 17, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for MX1.
  • Embodiment 22 The method of claim 17, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for PARP9, P ARP 10, PARP14, or a combination of two or more thereof.
  • Embodiment 23 The method of claim 17, wherein determining the level of interferon signaling pathway activity in the sample comprising determining the level of interferon pathway RNA or interferon pathway protein for PARP9, PARP10, PARP14, STAT1, MX1, or a combination of two or more thereof.
  • Embodiment 24 The method of any one of claims 1 to 23, wherein the interferon is Type 1 interferon.
  • Embodiment 25 The method of claim 24, wherein the Type 1 interferon is interferon- alpha, interferon-beta, or a combination thereof.
  • Embodiment 26 The method of any one of claims 1 to 25, wherein the cancer has an increased level of interferon or interferon signaling pathway activity relative to a control.
  • Embodiment 27 The method of any one of claims 1 to 26, wherein the cancer has a BRCA mutation, a KRAS mutation, a TP53 mutation, or a combination thereof.
  • Embodiment 28 The method of any one of claims 1 to 27, wherein the cancer is pancreatic cancer.
  • Embodiment 29 The method of claim 28, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.
  • Embodiment 30 The method of any one of claims 1, 2, 4-12, and 14-29, wherein the ATR kinase inhibitor is berzosertib, 2-(aminomethyl)-6-[4,6-diamino-3-[4-amino-3,5- dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-hydroxycyclohexyl]oxyoxane-3,4,5-triol, ceralasertib, schisandrin B, 4-cyclohexylmethoxy-2,6-diamino-5-nitrosopyrimidine, dactolisib, (R)-4-(2-(lH-indol-4-yl)-6-(l-(methylsulfonyl)cyclopropyl)pyrimidin-4-yl)-3- methylmorpholine, caffeine, wortmannin, or 2-[(3R)-3-methyl-4-morpholinyl]-4-(l-(l-(
  • Embodiment 31 The method of claim 30, wherein the ATR kinase inhibitor is berzosertib.
  • Embodiment 32 The method of any one of claims 1, 3-11, and 13-29, wherein the NAMPT inhibitor is daporinad, 4-[5-methyl-4-[[(4-methylphenyl)sulfonyl]methyl]-2-oxazolyl]- /V-(3-pyridinylmethyl)benzamide, N-(4-((3,5-difluorophenyl)sulfonyl)benzyl)imidazo[l,2- a]pyridine-6-carboxamide, N-[[4-[[3-(trifluoromethyl)phenyl]sulfonyl]phenyl]methyl]-lH- pyrazolo[3,4-b]pyridine-5-carboxamide, (lZ,2E)-3-(6-aminopyridin-2-yl)-N-((5-(4-(4,4- difluoropiperidine-l-carbonyl)phenyl)-7-(
  • Embodiment 33 The method of claim 32, wherein the NAMPT inhibitor is daporinad or 2-hydroxy-2-methyl-N-[l,2,3,4-tetrahydro-2-[2-(3-pyridinyloxy)acetyl]-6-isoquinolinyl]-l- propanesulfonamide.
  • Embodiment 34 The method of any one of claims 1 to 33, further comprising administering to the patient a therapeutically effective amount of a PARP inhibitor.
  • Embodiment 35 The method of claim 34, wherein the PARP inhibitor is niraparib, olaparib, rucaparib, talazoparib, vekauoarub, pamiparib, ll-methoxy-2-((4-methylpiperazin-l- yl)methyl)-4,5,6,7-tetrahydro-lH-cyclopenta[a]pyrrolo[3,4-c]carbazole-l,3(2H)dione, or 10-((4- Hydroxypiperidin-l-yl)methyl)chromeno[4,3,2-de]phthalazin-3(2H)one.
  • the PARP inhibitor is niraparib, olaparib, rucaparib, talazoparib, vekauoarub, pamiparib, ll-methoxy-2-((4-methylpiperazin-l- yl)methyl)-4,5,6,7-tetrahydro-lH
  • Embodiment 36 The method of claim 35, wherein the PARP inhibitor is olaparib.
  • Embodiment 37 A method of classifying a cancer in a patient, the method comprising: (a) measuring expression levels of a plurality of target genes in RNA from a sample obtained from the patient, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2; (b) comparing expression levels of the plurality of target genes to a control; and (c) classifying the cancer as responsive to treatment with an ATR kinase inhibitor.
  • Embodiment 38 The method of claim 37, wherein the cancer is classified as responsive to treatment with an ATR kinase inhibitor when the expression levels of the plurality of target genes are increased relative to the control.
  • Embodiment 39 A method of classifying a cancer in a patient, the method comprising: (a) measuring expression levels of a plurality of target genes in RNA from a sample obtained from the patient, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2; (b) comparing expression levels of the plurality of target genes to a control; and (c) classifying the cancer as responsive to treatment with an ATR kinase inhibitor, an NAMPT inhibitor, or a combination thereof.
  • Embodiment 40 The method of claim 39, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • Embodiment 41 The method of any one of claims 37 to 40, wherein the plurality of target genes comprise STAT1 and MX1.
  • Embodiment 42 The method of claim 39, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARP10, and PARP14.
  • Embodiment 43 The method of claim 39, wherein the plurality of target genes comprise at least 2 genes selected from the group consisting of PARP9, PARP10, PARP14, STAT1, and MX1.
  • Embodiment 44 The method of any one of claims 39 to 43, comprising classifying the cancer as responsive to treatment with an ATR kinase inhibitor, a NAMPT inhibitor, or a combination thereof when the expression levels of the plurality of target genes are increased relative to the control.
  • Embodiment 45 The method of claim 44, comprising classifying the cancer as responsive to treatment with a NAMPT inhibitor.
  • Embodiment 46 The method of claim 44, comprising classifying the cancer as responsive to treatment with an ATR kinase inhibitor.
  • Embodiment 47 The method of claim 44, comprising classifying the cancer as responsive to treatment with an ATR kinase inhibitor and a NAMPT inhibitor.
  • Embodiment 48 A method of identifying a cancer patient responsive to treatment with an ATR kinase inhibitor, the method comprising measuring expression levels of a plurality of target genes in a sample obtained from the cancer patient, wherein the plurality of target genes comprise at least 2 genes from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • Embodiment 49 The method of claim 48, wherein the patient is identified as responsive to treatment with an ATR kinase inhibitor when the expression levels of the plurality of target genes are increased relative to a control.
  • Embodiment 50 A method of identifying a cancer patient responsive to treatment with an ATR kinase inhibitor, a NAMPT inhibitor, or a combination thereof, the method comprising measuring expression levels of a plurality of target genes in a sample obtained from the cancer patient, wherein the plurality of target genes comprise at least 2 genes from the group consisting of PARP9, P ARP 10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • the plurality of target genes comprise at least 2 genes from the group consisting of PARP9, P ARP 10, PARP14, STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CX
  • Embodiment 51 The method of claim 50, wherein the plurality of target genes comprise at least 2 genes from the group consisting of STAT1, MX1, MX2, IFIT1, IFI44, IFIT3, OAS1, OAS3, BST2, IFITM1, IFI27, CXCL10, IFI16, IFI30, IFIH1, IFIT2, IFITM2, IRF1, IRF9, IRGM, ISG15, OAS2, PSME1, SOCS1, and STAT2.
  • Embodiment 52 The method of any one of claims 48 to 51, wherein the plurality of target genes comprise STAT1 and MX1.
  • Embodiment 53 The method of claim 50, wherein the plurality of target genes comprise at least 2 genes from the group consisting of PARP9, PARP10, and PARP14.
  • Embodiment 54 The method of claim 50, wherein the plurality of target genes comprises PARP9, PARP10, PARP14, STAT1, and MX1.
  • Embodiment 55 The method of any one of claims 50 to 54, wherein the patient is identified as responsive to treatment with an ATR kinase inhibitor, a NAMPT inhibitor, or a combination thereof when the expression levels of the plurality of target genes are increased relative to a control.
  • Embodiment 56 The method of any one of claims 48 to 55, further comprising identifying the presence of a type 1 interferon-stimulated gene signature, pCHEKs345, or a combination thereof in a sample obtained from the cancer patient.
  • Embodiment 57 The method of claim 55, wherein the patient is identified as responsive to treatment with an ATR kinase inhibitor when the presence of the type 1 interferon- stimulated gene signature, pCHEKs345, or the combination thereof is identified.
  • Embodiment 58 The method of claim 55, wherein the patient is identified as responsive to treatment with a NAMPT inhibitor when the presence of the type 1 interferon- stimulated gene signature, pCHEKs345, or the combination thereof is identified.
  • Embodiment 59 The method of any one of claims 37 to 58, wherein the plurality of target genes comprise at least 3 genes.
  • Embodiment 60 The method of claim 59, wherein the plurality of target genes comprise at least 4 genes.
  • Embodiment 61 The method of any one of claims 37 to 60, wherein measuring does not comprise a whole transcriptome measurement.
  • Embodiment 62 The method of any one of claims 37 to 61, wherein the cancer has a BRCA mutation, a KRAS mutation, a TP53 mutation, or a combination thereof.
  • Embodiment 63 The method of any one of claims 37 to 61, wherein the cancer is pancreatic cancer.
  • Embodiment 64 The method of claim 63, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.
  • Embodiment 65 The method of any one of claims 37 to 64, further comprising administering to the patient an effective amount of ATR kinase inhibitor.
  • Embodiment 66 The method of claim 65, wherein the ATR kinase inhibitor is berzosertib, 2-(aminomethyl)-6-[4,6-diamino-3-[4-amino-3,5-dihydroxy-6- (hydroxymethyl)oxan-2-yl]oxy-2-hydroxycyclohexyl]oxyoxane-3,4,5-triol, ceralasertib, schisandrin B, 4-cyclohexylmethoxy-2,6-diamino-5-nitrosopyrimidine, dactolisib, (R)-4-(2-(lH- indol-4-yl)-6-(l-(methylsulfonyl)cyclopropyl)pyrimidin-4-yl)-3-methylmorpholine, caffeine, wortmannin, or 2-[(3R)-3-methyl-4-morpholinyl]-4-(l-methyl-lH-pyrazol-5-
  • Embodiment 67 The method of claim 65, wherein the ATR kinase inhibitor is berzosertib.
  • Embodiment 68 The method of any one of claims 37 to 67, further comprising administering to the patient an effective amount of a NAMPT inhibitor.
  • Embodiment 69 The method of claim 68, wherein the NAMPT inhibitor is daporinad, 4-[5-methyl-4-[[(4-methylphenyl)sulfonyl]methyl]-2-oxazolyl]-/V-(3- pyridinylmethyl)benzamide, N-(4-((3,5-difluorophenyl)sulfonyl)benzyl)imidazo[l,2-a]pyridine-
  • 6-carboxamide N-[[4-[[3-(trifluoromethyl)phenyl]sulfonyl]phenyl]methyl]-lH-pyrazolo[3,4- b]pyridine-5-carboxamide, (lZ,2E)-3-(6-aminopyridin-2-yl)-N-((5-(4-(4,4-difluoropiperidine-l- carbonyl)phenyl)-7-(4-fluorophenyl)benzofuran-2-yl)methyl)acrylimidic acid, N-[6-(4- chlorophenoxy)hexyl]-N'-cyano-N"-4-pyridinyl-guanidine, N-[l,l'-biphenyl]-2-yl-4-(3- pyridinyl)-lH-l,2,3-triazole-l-octanamide, 4-[[[[[4-(l,l-dimethylethyl
  • Embodiment 70 The method of claim 68, wherein the NAMPT inhibitor is daporinad or 2-hydroxy-2-methyl-N-[l,2,3,4-tetrahydro-2-[2-(3-pyridinyloxy)acetyl]-6-isoquinolinyl]-l- propanesulfonamide.
  • Embodiment 71 The method of any one of claims 37 to 70, further comprising administering to the patient a therapeutically effective amount of a PARP inhibitor.
  • Embodiment 72 The method of claim 71, wherein the PARP inhibitor is niraparib, olaparib, rucaparib, talazoparib, vekauoarub, pamiparib, ll-methoxy-2-((4-methylpiperazin-l- yl)methyl)-4,5,6,7-tetrahydro-lH-cyclopenta[a]pyrrolo[3,4-c]carbazole-l,3(2H)dione, or 10-((4- hydroxypiperidin-l-yl)methyl)chromeno[4,3,2-de]phthalazin-3(2H)one.
  • the PARP inhibitor is niraparib, olaparib, rucaparib, talazoparib, vekauoarub, pamiparib, ll-methoxy-2-((4-methylpiperazin-l- yl)methyl)-4,5,6,7-tetrahydro-l
  • Embodiment 73 The method of claim 71, wherein the PARP inhibitor is olaparib.
  • Embodiment 74 A computer program product comprising a machine-readable medium storing instructions that, when executed by at least one programmable processor, cause the at least one programmable processor to perform operations comprising the method of any one of claims 11 to 73.
  • Embodiment 75 A computer program product comprising a machine-readable medium storing instructions that, when executed by at least one programmable processor, cause the at least one programmable processor to perform operations comprising the method of any one of claims 37 to 64.
  • Embodiment 76 A system comprising computer hardware configured to perform operations comprising the method of any one of claims 11 to 73.
  • Embodiment 77 A system comprising computer hardware configured to perform operations comprising the method of any one of claims 37 to 64.
  • Embodiment 78 A computer-implemented method comprising the method of any one of claims 11 to 73.
  • Embodiment 79 A computer-implemented method comprising the method of any one of claims 37 to 64
  • Example 1 IFN signaling in PD AC tumors
  • nucleotides are particularly important as they are required for a variety of biological processes including nucleic acid (RNA and DNA) biosynthesis.
  • RNA and DNA nucleic acid
  • a balanced and sufficient supply of deoxyribonucleotide (dNTP) pools is essential to sustain pancreatic ductal adenocarcinoma (PD AC) cell proliferation and is maintained by the coordinated activity of de novo biosynthetic and salvage pathways.
  • dNTP deoxyribonucleotide
  • the KRAS oncogene is an established positive regulator of de novo nucleotide biosynthesis and pharmacological inhibition of pyrimidine biosynthesis using dihydroorotate dehydrogenase (DHODH) inhibitors has been proposed as a treatment strategy for PD AC (Ref. 19). Additionally, inhibition of lysosome function has been shown to restrict dNTP pools in PD AC cells by limiting aspartate availability, which is critically required for the de novo synthesis of both pyrimidine and purine nucleotides (Ref. 20). To resolve the DNA replication stress that results from dNTP insufficiency, cancer cells rely on the replication stress response signaling pathway (Ref. 21).
  • telangiectasia and Rad3-related protein initiates a signaling cascade which slows DNA replication by suppressing origin firing, promotes replication fork stabilization and activates the G2/M checkpoint (Ref. 22).
  • ATR has been shown to promote nucleotide biosynthesis and salvage via activation of rate-limiting enzymes in these pathways: ribonucleotide reductase (RNR) and deoxycytidine kinase (dCK) (Ref. 23).
  • RNR ribonucleotide reductase
  • dCK deoxycytidine kinase
  • ATR is recruited and activated by replication protein A (RPA)-bound single stranded DNA, which can arise at stalled replication forks and also occurs following DNA end resection during the early stages of homologous recombination for DNA double strand break repair.
  • RPA replication protein A
  • CHEK1 an established substrate of ATR, serves to inhibit cyclin- dependent kinase (CDK) activity through the inhibition of the phosphatase CDC25A.
  • ATR inhibitors berzosertib and ceralasertib are currently being evaluated in clinical trials in combination with chemotherapy, DNA damaging therapy (PARP inhibitors) or immunotherapy (immune checkpoint blockade) for multiple cancer types including PDAC (Ref. 22). Additionally, ATR inhibitors may be particularly effective for the treatment of tumor cells with oncogenic signaling driven by activation KRAS mutations and mutant TP53. ATR has been shown to mitigate DNA damage triggered by mutant RAS activation in tumor cells (Refs. 24- 25). Mutant TP53 has been implicated in similar phenotypes (Ref. 26). The links between other hallmarks of PDAC, including cytokine signaling, and the replication stress response pathway remain unexplored. Despite the marked enrichment of interferon (IFN) signaling in PDAC tumors, its impact on tumor cell signaling, metabolism and response to therapy is poorly understood.
  • IFN interferon
  • IFN signaling is constitutive in a subset of PD AC tumors
  • Type I IFNs are produced by epithelial and immune cells and have been linked to the regulation of cancer cell proliferation, apoptosis and immune-recognition via the transcriptional regulation of effector IFN-stimulated genes (Ref. 8).
  • pancreatic adenocarcinoma ranks among cancers exhibiting the greatest increase in transcript enrichment of a previously defined IFN response signature relative to organ specific normal tissue controls (normalized for CD4-positive cell infiltration as previously described; FIGS. 1A-1B) (Refs. 27- 28).
  • a subset of PD AC tumors in the TCGA collection exhibit a particularly high enrichment of genes contained within this signature with a correlation observed amongst these genes (FIG.
  • IFN-stimulated gene expression in a subset of xenograft tumors is low expression or impaired activity of IFN receptors or downstream kinases, a characteristic of some tumor cells and an established mechanism of acquired resistance to immune checkpoint blockade (Refs. 29-30).
  • KSEA Kinase substrate enrichment analysis
  • ATR activation is a compensatory response to replication stress, caused by any obstacle to DNA replication, and results in decreased proliferation and cell cycle arrest in S- phase (Ref. 21). Consistently, data showed that IFN treatment resulted in both impaired proliferation (FIG. 3F) and induced S-phase arrest in SUIT2 cells (FIG. 3G). This analysis was expanded to a panel of PDAC cell lines and observed varying degrees of IFN-induced pCHEKls345 (FIG. 31). A similar pattern of heterogeneity was observed in the induction of S- phase accumulation (FIG. 3J). pCHEKl induction appears to predict IFN-induced S-phase arrest in this panel.
  • An established cause of replication stress is an insufficient or imbalanced supply of the substrates for DNA replication (dNTPs) (Ref. 21).
  • a targeted LC-MS/MS approach was applied to: (i) evaluate IRNb-induced alterations in total dNTP abundance and (ii) evaluate the contribution of stable isotope
  • IFN treatment triggers in a decrease in dCTP, dTTP, dATP and dTTP pools in both SUIT2 and YAPC cells (FIGS. 4B-4C).
  • DHFR dihydrofolate reductase
  • TYMS thymidylate synthase
  • SAMHD1 emerged as a potential mediator of IFN-induced replication stress as it has been previous linked to the regulation of cell cycle progression and functions as a central mediator of dNTP homeostasis by catalyzing the phosphohydrolysis of dNTP to deoxyribonucleosides (dN) which are effluxed into the environment (Refs. 34-35).
  • SAMHD1 has been shown to possess a novel moonlighting function which is to promote DNA repair by acting as a molecular scaffold for CtIP at replication forks (Ref. 35).
  • dCK knockout decreased dCTP pools and increased dC efflux at baseline and amplified IFN-induced dCTP pool depletion and dC efflux.
  • dCK knockout did not influence dATP pool alterations induced by IFN.
  • the purine nucleosides dA and dG produced by SAMHD1 -mediated dNTP phosphohydrolysis can either be recycled by dCK or catabolized by the combined actions of ADA and PNP. It was reasoned that the inability to detect dA nucleoside efflux in SUIT2 cells is because of its rapid catabolism by these enzymes (FIG. 4A). Results showed that
  • dCK can accept dC, dA and dG
  • salvage of thymidine requires the nucleoside kinase thymidine kinase 1 (TK1).
  • TK1 nucleoside kinase thymidine kinase 1
  • the cGAS/STING pathway drives autocrine type I IFN signaling in PD AC tumors
  • IFN signaling biomarker enrichment The observation that patient-derived and cell xenograft PDAC tumors exhibited IFN signaling biomarker enrichment suggested that tumor cells produce IFN as IFN is species- restricted.
  • type I IFN production can be initiated downstream of cytosolic nucleic acid sensor activation triggered by pathogen or mis-localized self DNA (FIG. 1).
  • cytosolic nucleic acid sensor activation triggered by pathogen or mis-localized self DNA (FIG. 1).
  • cGAS cyclic GMP-AMP synthase
  • STING stimulator of interferon genes
  • cGAS and STING promoters are generally hypo-methylated in PDAC and STING is transcriptionally up-regulated in PDAC tumors compared to normal pancreas (FIG. 6A) (Ref. 38).
  • IHC staining of the PDAC tissue microarray used in these studies revealed detectable STING expression in tumor cells at varying levels in >90% of samples, a finding consistent with a previous report (FIG. 6B) (Ref. 39).
  • cGAMP transfection triggered rapid phosphorylation of IRF3si39, which is mediated by TBK1 downstream of STING-dependent cGAMP sensing, and phosphorylation of STAT1 which was temporally followed by induction of STAT1 and MX1 protein expression (FIGS. 6F-6G). Additionally, cGAMP transfection triggered secretion of IRNb protein into culture supernatants in STING- proficient DANG cells (FIG. 6H).
  • MX1 and STAT1 were expressed at low levels in xenograft tumors derived from STING pathway -inactive SUIT2 cells (FIG. 7A).
  • IFN signaling modulates PDAC cell proliferation and nucleotide metabolism in vivo
  • HS766T which stably express a firefly luciferase (fLUC)-linked IFN stimulated response element (ISRE) reporter to non-invasively track type I IFN signaling activity in xenograft PDAC tumors.
  • fLUC firefly luciferase
  • ISRE IFN stimulated response element
  • TYMP is a key metabolic enzyme which degrades dT into thymine and 2-deoxy-alpha-D-ribose 1- phosphate and depletes free dT pools (FIG. 8A).
  • TYMP has also been identified as a positive regulator of angiogenesis by promoting the growth and proliferation of endothelial cells (Ref. 44). Both thymidine and [ 18 F]FLT require phosphorylation by thymidine kinase 1 (TK1) for their intracellular accumulation, however, the affinity of dT for TK1 greatly exceeds that of [ 18 F]FLT 43 . [ 18 F]FLT is not a substrate for TYMP but its accumulation is a surrogate marker of its activity: [ 18 F]FLT accumulation is a function of both TK1 expression and dT levels (which are mediated by TYMP).
  • TK1 thymidine kinase 1
  • IFNy type II IFN elicited similar induction of TYMP in SUIT2 cells and that YAPC cells are deficient for TYMP at baseline and in the presence of either PTNb or IFNy
  • FIG. 8E Data showed that IFNs induced [ 18 F]FLT uptake in a TYMP-dependent manner (FIG. 8F) and that IFN did not enhance [ 18 F]FLT uptake in TYMP-deficient YAPC cells (FIG. 8G).
  • the replication stress response pathway is a collateral dependency triggered by IFN signaling in a subset of PD AC cells
  • a high- throughput 430 compound chemical genomics screen was applied using SUIT2 cells treated ⁇ IFN (FIG. 6A).
  • Inhibitors of key replication stress response effectors including ATR (ceralasertib) and CHEK1 (LY2603618, PF-477736 and AZD-7762), scored among top hits and exhibited significantly increased activity in SUIT2 cells treated with IRNb.
  • JAK kinase inhibitors (LY278544, tofacitinib and ruxolitinib) which block type I IFN signaling abrogated the anti-proliferative effects of IPNb in our screen.
  • the replication stress response pathway is initiated by ATR which phosphorylates and activates downstream effectors CHEK1 and WEE1 in response to any obstacle to DNA replication.
  • Small molecule inhibitors of these kinases have entered clinical trials in various cancers combined with genotoxic chemotherapy, PARP inhibitors or immunotherapy (FIG.
  • Type I IFN and ATR signaling collaboratively control PD AC cell nucleotide metabolism
  • ATR has been demonstrated to promote RRM2 protein stability by preventing its phosphorylation on T33 by CDK1 which positively regulates its degradation mediated by the SCF C ch "
  • IRNb primarily restricts dNTP abundance by initiating nucleotide and nucleoside catabolism whereas ATR inhibition limits dNTP biosynthesis via down-regulation of the expression of anabolic genes, including both de novo pathway genes and nucleoside salvage kinases. This down-regulation is likely mediated by ATRi-mediated impairment of E2F1 transcription factor activity.
  • Results showed similar synergy between STING activation and berzosertib in this model using 2D cultures (FIG. 12B). Signaling through JAK is essential for this synergy as supplementation with ruxolitinib restored the proliferation of combination treated cells (FIG. 12C).
  • SUIT2 TetR fLuc cells were engineered with either the STINGR248M transgene, an ATR targeting shRNA, or the combination. These cells were injected into the pancreas of NCG mice and tumor burden was monitored using bioluminescence imaging following doxycycline treatment.
  • ATR inhibitors have progressed into phase I and phase II clinical trials in combination with chemotherapy, radiation or PARP inhibitors.
  • DNA repair by homologous recombination (HR) is required for resolution of PARP inhibitor-induced DNA damage and thus PARP inhibitors have been shown to be particularly effective against HR-deficient tumors such as BRCAl/2-deficient breast and pancreatic cancer (Ref. 6).
  • mediators of HR including BRCA1 and CtIP are known targets of E2F1 and down-regulated by ATRi in PD AC cells (FIG. 13A). It was reasoned that IFN/ATRi treatment would induce a HR-deficient like cellular state and serve as an effective approach to sensitive PD AC cells to PARP inhibitors.
  • IFNs reprogram nucleotide metabolism in PDAC cancer-associated fibroblasts
  • CAFs cancer associated fibroblasts
  • CAF and macrophage-derived nucleosides have been shown to influence the activity of anti- metabolite chemotherapy gemcitabine by competing with dCK for phosphorylation (Ref. 50).
  • nucleosides can be utilized as a nutrient source in PDAC cells.
  • IRNb signaling sensitizes PDAC cells to the clinically viable combination of small molecule ATR and PARP inhibitors.
  • chronic inflammation is a hallmark feature of PD AC tumors. This low grade inflammatory response observed has been termed “para-inflammation” and is a defined transcriptional signature resembling a type I IFN response (Ref. 28).
  • para-inflammation is a defined transcriptional signature resembling a type I IFN response (Ref. 28).
  • PDAC ranks highest in terms of para-inflammation signature enrichment which is a negative prognostic factor in this disease (Ref. 28).
  • Type I IFN production is induced by the activation of cytosolic or endosomal pathogen sensing pathways including the cGAS-STING pathway which initiates type I IFN production in epithelial, stromal, endothelial and immune cells in response to accumulation of cytosolic ssDNA and dsDNA.
  • the cGAS- STING pathway is tightly regulated by transcriptional and post-translational mechanisms and indirectly by proteins which control the levels of cytosolic ssDNA and dsDNA, including SAMHD1, TREX1, and RPA/RAD51 (Ref. 52).
  • Aicardi-Goutieres Syndrome an early onset inflammatory disorder characterized and aberrantly high systemic levels of type I IFNs.
  • germ- line STING gain of function mutations have been associated with a lupus-like autoimmune disease in humans (Ref. 53).
  • STING agonists are being evaluated as immune stimulating anti-cancer vaccines and analogs of the endogenous STING ligand 2’-3’-cGAMP which overcome its susceptibility to hydrolysis by ENPP1 are in development (Ref. 54-55) Interestingly, covalent STING inhibitors have also been described and may be useful tools to reprogram cytokine signaling in inflamed PDAC tumors (Ref. 56).
  • cGAS and/or STING are down-regulated in various cancers, including colorectal cancer and melanoma, and thus this pathway has been classified as tumor suppressive (Ref. 57, 58).
  • cGAS and STING down-regulation appear to be primarily mediated by epigenetic mechanisms and treatment with DNA de-methylating agents can restore pathway functionality in some cases.
  • PDAC is an exception as cGAS and STING exhibit decreased promoter methylation in patient samples (Ref. 38). Consistently, STING expression in PDAC appears to be elevated compared to normal pancreas and STING has previously been shown to be expressed extensively in both the cancer cell and stromal compartments of tumors, a finding confirmed in this study (Ref. 39). It has been proposed that tumors exhibiting low cGAS-STING expression may be especially vulnerable to oncolytic virus therapy.
  • IFNs have been shown to exert both pro- and anti-tumor functions in vitro, IFNs are well studied for their ability to restrict cancer cell proliferation.
  • IFN regulated genes also have been investigated in the context of a IFN DNA damage resistance gene expression signature (IRDS) which is associated with resistance to chemotherapy and radiation (Ref. 10).
  • IRDS IFN DNA damage resistance gene expression signature
  • chronic IFN pathway agonism has been associated with resistance to immune checkpoint blockade (Ref. 61). It is possible that constitutive STING- driven IFN signaling is a mechanism by which PDAC cells condition an immunosuppressive microenvironment. In this model, tumor cells in the PDAC microenvironment may hijack the pro-tumor functions of IFNs and mitigate their anti-tumor effects by activating compensatory signaling and metabolic pathways (i.e. ATR and dCK).
  • IFN signaling Tumor cell vulnerabilities elicited by IFN signaling have not been systematically evaluated. However, IFN treatment has been shown to amplify the cytotoxic effects of MEK inhibitors in a subset of melanoma cell lines exhibiting low basal IFN signaling pathway activity (Ref. 62). In addition, multiple groups have independently demonstrated that IFN signaling induces a collateral dependency on ADAR to prevent dsRNA-mediated proliferation inhibition driven by PKR activity, a finding that is limited by the current lack of clinically viable ADAR inhibitors (Refs. 63-64). Experiments herein identified an additional dependency driven by IFN signaling that is immediately actionable.
  • SAMHD1 The K312 residue in SAMHD1 is essential for its dNTPase function, whereas T592, which is phosphorylated by cyclin-dependent kinases (CDKs), is critical for its role in end resection (Ref. 35).
  • CDKs cyclin-dependent kinases
  • IFN signaling has been reported to regulate metabolism in macrophages and dendritic cells however, the impact of IFNs on tumor cell metabolism has not yet been systematically evaluated (Refs. 18, 66-67).
  • IFNs Early work on IFNs demonstrated that they influence nucleotide metabolism nucleic acid biosynthesis in tumor cells and here we build on this foundation and characterize molecular mediators of this phenotype (Ref. 68).
  • dT catabolism has been identified as a stress response to starvation in cancer cells which provides carbon for glycolysis via the actions of TYMP and DR5P aldolase (DERA) (Ref. 69).
  • IFN may promote this process and catabolized nucleotides and nucleosides serve as a carbon source for other biochemical processes to fuel PD AC cell progression.
  • the restriction of thymidine pools resulting from IFN-induced up-regulation of TYMP can be leveraged using [ 18 F]FLT PET/CT. It was anticipated that [ 18 F]FLT PET would have utility as a pharmacodynamic biomarker for STING agonists as well as other IFN-stimulating immunotherapies such as immune checkpoint blockade.
  • IFNs may also play an important role in regulating the landscape and composition of the metabolic synapse between tumor cells and immune cells (Ref. 16).
  • Evidence for the competition between cancer cells and immune cells for nucleosides in tumor microenvironment is provided by the observation that nucleoside kinases and transporters, such as dCK, uridine-cytidine kinase 2 (UCK2) and SLC29A1 are up-regulated in T-cells following activation (Refs. 70-72).
  • purine efflux triggered by IFN signaling may have local immunosuppressive effects (Ref. 73).
  • Findings herein have high translational significance as ATR inhibitors and IFN- inducing therapies (such as immune checkpoint blockade and TLR agonists) are being evaluated in the clinic.
  • ATR inhibition has been shown to enhance the efficacy of immune checkpoint blockade in pre-clinical models (Ref. 77).
  • Drugs Stocks were prepared in DMSO or H2O and diluted fresh in cell culture media for treatments.
  • Live cell imaging For live cell imaging cells were plated at 2xl0 3 cells / well in either ultra-low attachment or treated flat-bottom clear 96-well plates. After 24-72 hour treatments were added and cell proliferation was tracked using the IncuCyte Zoom live-cell imaging system. Images were acquired at 3 hour intervals over the indicated time periods. [0412] LC-MS/MS DNA measurements: Cells were transferred into DMEM without glucose and supplemented with 10% dialyzed FBS containing the following labeled substrates: precursors for de novo [ 13 C 6 ]glucose at 11 mM and [ 13 Cio, 15 N2]dT at 5 mM.
  • Genomic DNA was extracted using the Quick-gDNA MiniPrep kit and hydrolyzed to nucleosides using the DNA Degradase Plus kit following manufacturer-supplied instructions.
  • 50 pL of water was used to elute the DNA into 1.5 mL microcentrifuge tubes.
  • a nuclease solution (5 pL; 10X buffer/DNA Degradase PlusTM/water, 2.5/1/1.5, v/v/v) was added to 20 pL of the eluted genomic DNA in an HPLC injector vial. The samples were incubated overnight at 37°C.
  • the effluent from the column was directed to the Agilent Jet Stream ion source connected to the triple quadrupole mass spectrometer (Agilent 6460) operating in the multiple reaction monitoring (MRM) mode using previously optimized settings.
  • the peak areas for each nucleosides and nucleotides (precursor fragment ion transitions) at predetermined retention times were recorded using the software supplied by the instrument manufacturer (Agilent MassHunter).
  • RT-PCR Total RNA was isolated from cells using the Zymo Quick-RNA MiniPrep kit. Reverse transcription was performed using the High Capacity cDNA Reverse Transcription kit (Life Technologies). Quantitative PCR was performed using EvaGreen qPCR Master Mix (Lamda Biotech). RNA expression values were normalized and calculated as relative expression to control. Primers used are reported in FIG. 23.
  • Immunohistochemistry Formalin-fixed, paraffin-embedded tumor samples were incubated at 60°C for 1 hour, deparaffmized in xylene, and rehydrated with graded alcohol washes. Slides were then boiled in 0.01 M sodium citrate buffer for 15 minutes followed by quenching of endogenous peroxidase with 3% hydrogen peroxide for antigen retrieval. After 1 hour of blocking with 5% donkey serum at room temperature, primary antibodies were added and incubated overnight at 4°C. Biotin-conjugated anti-rabbit secondary antibody (1:500 Jackson Labs) was added and developed using Elite Vectastain ABC kit.
  • Membranes were washed with TBST-T and incubated with HRP -linked secondary antibodies prepared at a 1:2500 dilution in 5% nonfat dry milk in TBS-T. HRP was activated by incubating membranes by incubating membranes with mixture of SuperSignal Pico and SuperSignal Femto ECL reagents (100:1 ratio). Exposure of autoradiography film was used for detection.
  • Tumor tissue homogenization Snap-frozen tumor tissue was transferred to Omni Hard Tissue homogenization vials. 750 pi of tissue Lysis buffer spiked with lx protease and phosphatase inhibitor cocktails were added to each vial. Vials were homogenized using an Omni Bead Ruptor Elite (8 cycles of 15 seconds on, 30 seconds off, speed 8) chilled to 4°C. Tissue homogenates were cleared by centrifugation at 12,000xg for 10 minutes at 4°C. Cleared lysates were normalized using the BCA method and prepared for immunoblot analysis as described for cell culture samples.
  • Flow cytometry All flow cytometry data were acquired on five-laser BD LSRII, and analyzed using FlowJo software.
  • AnnexinV/PI Treated PD AC cells were washed with PBS and incubated with
  • AnnexinV and propidium iodide diluted in lx Annexin binding buffer were assembled using lx AnnexinV and propidium iodide diluted in lx Annexin binding buffer.
  • EdU PD AC cells were pulsed with 10 mM EdU for 2 hour, washed twice with PBS, and released in fresh media containing 5 mM deoxyribonucleosides. Cells were collected 4 hour following release in fresh media, fixed with 4% paraformaldehyde and permeabilized using saponin perm/wash reagent (Invitrogen), and then stained with azide-AlexaFluor 647 by Click reaction. The total DNA content was assessed by staining with FxCycle-Violet at 1 pg/mL final concentration. The cell cycle durations were calculated using equations for multiple time-point measurements according to previously published methods (CITE).
  • pH2A.Xsi 39 Cells were harvested, fixed, permeabilized with cytofix/cytoperm for 15 minutes on ice, prior to staining with a phospho-Histone H2A.Xsi 39 antibody conjugated to FITC (1:800 dilutions in perm/wash) for 20 minutes at room temperature shielded from light. Subsequently, cells were washed and stained with 0.5 mL of DAPI for DNA content before analysis.
  • Protein kinase inhibitor phenotypic screen A library of 430 protein kinase inhibitors (SelleckChem Cat. L1200) was arrayed in polypropylene 384-well plates at 200x concentrations covering a 7-point concentration range (corresponding to lx concentrations: 5mM, 1.65mM, 550nM, 185nM, 61.5nM, 20.6nM, 6.85nM). 25m1 per well of growth media with or without 200 U/mL IFN supplementation (for a final concentration of 100 U/mL) was plated in opaque- white 384-well plates using a BioTek multidrop liquid handler.
  • Composite IKNb synergy scores for each test compound were defined as the sum of the Synergy Score (% proliferation inhibition observed - % proliferation inhibition expected) between IKNb and individual protein kinase inhibitor concentrations across the 7-point concentration range.
  • Z factor scores for individual assay plates were calculated using eight positive and eight negative control wells on each plate. All plates gave a Z factor > 0.5.
  • CRISPR/Cas9 knockout cell line generation All gRNA sequences were cloned into LentiCrisprV2. Lipofectamine 3000 was used to transfect PDAC cells with 1 pg/ml gRNA- specific LentiCrisprV2 vectors. Following puromycin selection cells were singly cloned.
  • shRNA knockdown cell line generation For generation of stable knockdown cell lines PDAC cells were transduced with lentivirus harvested from HEK293FT cells in the presence of polybrene. Following transduction cells underwent antibiotic selection and knockdown efficiency was confirmed using immunoblot analysis. For virus production lentivirval vectors and packaging plasmids (psPAX2, pMD2G) at a 2: 1 : 1 ratio were transfected into FT293 cells using polyethylenimine. Lenti virus-containing supernatants were filtered through a 0.45 pm filter prior to use.
  • Bioluminescence Imaging Mice were anesthetized with 2% isoflurane prior to intraperitoneal injection of 100 pi (50 mg/mL) D-luciferin. Images were acquired on an IVIS 100 Bioluminescence Imaging scanner 10 minutes after D-luciferin administration.
  • PnNb ELISA Cells were plated at 250k cells/well in treated 24-well tissue culture plates and allowed to seed overnight. 2’-3’-cGAMP was completed with Lipofectamine3000 in Optimem at a 1:1:2 cGAMP:lipofectamine3000:Optimem ratio. Before transfection cells were washed with PBS, 400 pL of culture media was added to each well and 100 pL of complexed 2’-3’cGAMP was added drop-wise for a final concentration of 25 pg/mL. Media was collected, centrifuged for 4 m at 450xg at 4C at indicated time points. ELISA analysis was performed per manufacturer’s instructions.
  • IFN intratumoral interferon
  • Pancreatic ductal adenocarcinoma is the major type of pancreatic cancer with a median overall survival of less than one year (1).
  • PDAC pancreatic ductal adenocarcinoma
  • studies have profiled its extensively reprogrammed metabolic network and characterized its extreme tumor microenvironment (2-5). These studies have identified PDAC cells’ dependence on glycolysis (2,6), lipogenesis (2,7), glutamine metabolism (8,9), alanine metabolism, and tricarboxylic acid cycle/oxidative phosphorylation (10,11).
  • Strategies targeting each of these specific metabolic pathways have been attempted but have not been successfully translated into clinical therapeutics.
  • all of these re-wired metabolic pathways rely on nicotinamide adenine dinucleotide (NAD), or its reduced form NADH, as co-factors.
  • NAD nicotinamide adenine dinucleotide
  • NAMPT inhibitors showed promising potency in a variety of pre-clinical tumor models including pancreatic cancer (15-18).
  • Two NAMPT inhibitors, FK866 (19) and CHS-828 (20,21) have been tested in clinical trials, where lack of objective responses and dose-limiting toxicity suggest it is necessary to identify subsets of tumors with high sensitivity to NAMPT inhibition.
  • Multiple studies have examined intracellular factors that affect cancer cell sensitivity to NAMPT inhibition, such as NAMPT levels (22), nicotinic acid phosphoribosyltransferase (NAPRT) levels (23), PPM1D mutations (15), and CD38 levels (24).
  • PARP9/10/14 catalyze the transfer of a single unit of ADP ribose to their targets, a process referred to as monoADP-ribosylation (MARylation) (25).
  • MARylation monoADP-ribosylation
  • Type I IFN in the tumor microenvironment reduces NAD(H) levels in PDAC cells.
  • IITMb also significantly reduced NADH, the reduced form of NAD, in our panel of PDAC cell lines (again with the exception of Hs 766T). It is important to note that while IITMb reduced the total abundance of NAD(H), it did not significantly affect the NAD/NADH ratio.
  • IHC immunohistochemistry
  • PTN ⁇ b increases the expression of NAD(H) consuming enzymes PARP9, PARP10, and PARP14, leading to a reduction in cellular NAD(H) levels.
  • IFNs signal by stimulating the expression of certain genes, known as interferon- stimulated genes (ISGs) (31).
  • ISGs interferon- stimulated genes
  • PTMb reduced NAD(H) levels through upregulating the expression of genes for NAD(H) consuming enzymes.
  • NAD(H) consumption via upregulation of PARP9/10/14 results in increased dependency of these tumors on NAMPT, therefore sensitizing them to NAMPT inhibition.
  • NAMPT mediates the rate-limiting step in the NAD(H) salvage pathway, which is the dominant source of NAD(H) supply in cancer cells and most normal tissues (13).
  • type I IFN signaling which increases NAD(H) consumption through upregulating PARP9/10/14 expression, increases the dependency of these tumors on NAMPT to recycle NAM and regenerate NAD(H), thus sensitizing them to treatment with NAMPT inhibitors.
  • NAMPTi NAMPT inhibitor
  • NAD(H) is a co factor of complex I for mitochondrial respiration and glyceraldehyde-3-P dehydrogenase (GPDA) and lactate dehydrogenase (LDH) in glycolysis.
  • GPDA glyceraldehyde-3-P dehydrogenase
  • LDH lactate dehydrogenase
  • OCR mitochondrial oxygen consumption rate
  • ECAR extracellular acidification rate
  • NAD(H) depletion is DNA damage, because the activities of the critical DNA repair enzymes in the PARP and Sirtuin families are NAD(H) dependent.
  • the NAD(H)-dependent PARP and Sirtuin families are critical players in DNA repair (32,33).
  • PARP family activity can be monitored by measuring PAR abundance (34). PAR abundance was substantially reduced by IRNb and NAMPTi and this reduction was rescued by NR supplementation (FIG. 27F). We observed that IRNb and NAMPTi together increased H2A.X phosphorylation, a marker of DNA damage, which was also rescued by NR supplementation (FIG. 27G).
  • IRNb and NAMPTi together inhibited the invasion of PD AC cells, whereas neither PTMb nor NAMPTi significantly affected PD AC cell invasion as single agents, and at the molecular level, IRNb and NAMPTi down-regulated the protein levels of epithelial cell markers E-cadherin and N- cadherin.
  • PD AC is characterized by the presence of abundant desmoplastic stroma primarily composed of cancer-associated fibroblasts (CAFs), which support PD AC cell survival and chemoresistance (36-39). Therefore, we tested the effect of the IRNb /NAMPTi combination side-by-side on the growth of spheroids with SUIT2/GFP cancer cells alone and spheroids with both SUIT2/GFP cancer cells and CAF/mCherry stromal cells. In both spheroid models, the PTNb /NAMPTi combination suppressed spheroid growth better than either PTNb or NAMPTi alone (FIGS. 28E-28F). Taken together, our results indicate that the presence of IITNb sensitizes PD AC cells to the cytotoxicity of NAMPTi in an NAD(H)-dependent manner.
  • CAFs cancer-associated fibroblasts
  • Type I IFN production by cancer cells is frequently driven by the activation of STING due to genomic instability (40).
  • STING due to genomic instability
  • DOX doxycycline
  • mice were randomized to either a vehicle control or DOX-containing diet (to activate type I IFN signaling) and also to be treated with either a vehicle control or NAMPTi (FIG. 30C).
  • DOX diet to activate type I IFN signaling
  • NAMPTi a vehicle control or NAMPTi
  • PDAC tumors with type I IFN signaling (DOX diet) and treated with NAMPTi were significantly smaller than IFN-negative (control diet) tumors treated with NAMPTi, as well as smaller than tumors with type I IFN signaling alone (FIGS. 30D-30E).
  • NAMPTi and type I IFN signaling together resulted in a decreased number and size of liver metastases (FIGS. 30F-30G), a common feature of clinical PDAC.
  • the dosage of NAMPTi we used was well tolerated by the animals.
  • Immunoblot analyses of tumor homogenates revealed activation of autocrine type I IFN signaling and expression of PARP9/10/14 in samples collected from animals on DOX-diet (FIG. 30H). Our results indicate that NAMPTi is more effective in suppressing both tumor growth and liver metastases of PDAC tumors with active type I IFN signaling.
  • IFNs interferons
  • type I IFNs can be produced by multiple cell types in the PD AC tumor microenvironment, including tumor cells themselves with autocrine circuitries (31,51). While the signaling and immunomodulatory effects of type I IFNs have been described, their impact on tumor cell metabolism remains poorly understood. In this study, we identified an effect of type I IFN, which is present in a subset of PD AC tumors, on reducing tumor cell NAD(H) levels and sensitizing PD AC cells to NAMPTi through stimulating the expression of PARP9, P ARP 10, and PARP14.
  • PARP1 and PARP2 are the founding members in the PARP family and have been extensively studied for their DNA repair activity. Compared to PARP1 and PARP2, the roles of PARP9, PARP 10, and PARP 14 are less well characterized. Our data showed that silencing of PARP9, PARPIO, or PARP14 partially rescued IRNb-induced NAD(H) reduction. Both PARP 10 and PARP 14 have broad spectra ADP-ribosylation substrates identified in protein microarrays (52), which are consistent with their NAD(H) consumption in our observations. In contrast, PARP9 lacks catalytic activity (53), but it interacts with other PARP family members, and regulate their expression and activity (54).
  • PARP9 also promotes cellular response to IFNs (54). These indirect effects of PARP9 may explain our observation that PARP9 silencing reduced IFN -induced NAD(H) consumption.
  • Previous clinical trials of NAMPTi for cancer treatment suggest that its clinical success requires the identification of cancer subsets with high sensitivity to NAD(H) reduction. While the salvage pathway for NAD(H) supply has been extensively studied and explored for cancer treatment, the significance of NAD(H) consumption has not yet been comprehensively examined.
  • SUIT2, T3M4 and PATU 8988T were purchased from Research Resource Identifiers (RRIDs). All cells were between passages 3 and 20 and cultured in DMEM with 10% FBS and 1% Penicillin/Streptomycin at 37 °C in 5% C02 incubator. Cells were routinely authenticated and checked for Mycoplasma contamination using the MycoAlert kit (Lonza).
  • Antibodies and drugs Vinculin (#3901S), MX1 (#37849S), STAT1 (#14994S), pH2A.X Serl39(#9718S), STING (#13647S), CD38 (#14637S), E-cadherin (#3195S), N-cadherin (#14215S), AMPKa (#5832), pAMPKa Thrl72 (#2535), anti-rabbit secondary antibody HRP (#7074S) and anti-mouse secondary antibody (#7076S) were purchased from Cell Signaling Technology.
  • IL-10 (#200-10), LIF(#300-05) and PDGF (#100-13A) were purchased from PeproTech.
  • FK866 (E) - Daporinad, #HY-50876) was purchased from Med Chem Express (MCE). Nicotinamide riboside (#23132) was purchased from Cayman Chemical.
  • NAD/NADH Assay NAD/NADH levels were measured by the NAD/NADH-Glo Assay (Promega, #G9071) was used.
  • Cells were seeded in 96-well plates (2D culture) or poly(2- hydroxyethyl methacrylate)-coated (20 mg/ml in 95% ethanol, Sigma, #P3932) 96-well plates (3D culture) for 24 h. Then cells were lysed with 50 i.iL of D-PBS and 50 i.iL of 0.2 N NaOH solution with 1% DTAB. The lysates were centrifuged at 4 °C 14,000 g and the supernatant was collected.
  • a BCA Protein Assay Kit (Pierce, #23227) was used to measure the protein concentration of the lysates.
  • 20 i.iL lysate was added to 384-well plate (Greiner bio-one, #781098), treated with 10 i.iL 0.4 N HCL and heat quenched at 60 °C for 15 min. This was then neutralized with 10 i.iL Trizma base solution. NADH samples alone were heat quenched in the same manner as the NAD samples, followed by the addition of 20 i.iL HCL/Trizma solution. An equal volume of NAD/NADH-Glo Detection Reagent was added to each well and incubated at room temperature for 30 min.
  • the luminescence was measured by Synergy HI Hybrid Multi-Mode Reader (BioTek). The sample NAD/NADH levels based on luminescence intensity were calculated based on the NAD/NADH standard curves. The final data (i.imol NAD(H)/g protein) were adjusted based on BCA results.
  • pH2A.X assay Cells were harvested, fixed, and permeabilized with cytofix/cytoperm (BD biosciences, #554722) for 15 min on ice, and then stained with a phospho-Serl39 H2A.X antibody conjugated to fluorochrome FITC (EMD Millipore, #05-636, 1:800 dilutions in perm/wash) at room temperature in the dark for 20 min. Finally, cells were washed and then stained with 0.5 mL of DAPI (Invitrogen, #D1306) for DNA content before the acquisition of data by flow cytometry. 5-ethynyl2-deoxyuridine (EdU) cell cycle profiling.
  • cytofix/cytoperm BD biosciences, #554722
  • fluorochrome FITC EMD Millipore, #05-636, 1:800 dilutions in perm/wash
  • Pane 03.27 cells were pulsed with 10 mM EdU (Invitrogen) for 2 h, washed twice with PBS, and then released in fresh media containing 5 mM deoxyribonucleosides. 4 h following release in fresh media, the cells were collected and then fixed with 4% paraformaldehyde. They were permeabilized using saponin perm/wash reagent (Invitrogen). Cells were then stained with azide-Alexa Fluor 647 by Click reaction (Invitrogen; Click-iT EdU Flow cytometry kit, #C10634). Total DNA content was assessed by staining with FxCycle-Violet (Invitrogen, #F10347) at 1 pg/mL final concentration.
  • Flow cytometry data were acquired on five-laser LSRII cytometers (BD), and analyzed using FlowJo software (Tree Star). The cell cycle durations were then calculated using equations for multiple time-point measurements according to previously published methods (60).
  • PD AC cells labeled with GFP were seeded at 1,000 cells / well and CAF cells labeled with mCherry at 8,000 cells / well. Drugs were added after 72 h incubation, and the IncuCyte Zoom live-cell imaging system was used to track cell proliferation. Images were taken with white light, green fluorescence, and red fluorescence were taken every 3 hours for 5 days. Proliferation was measured using a combination of the size of the cell spheroids and the total measured green and red fluorescence at each time point.
  • PARP9 shRNA oligonucleotides (shPARP9 (SEQ ID NO: 1) and (SEQ ID NO:2); (SEQ ID NO:3) and (SEQ ID NO:4), (SEQ ID NO:5) and (SEQ ID NO:6) PARP10 shRNA oligonucleotides (shRNAlO (SEQ ID NO:7) and (SEQ ID NO:8); (SEQ ID NO:9) and (SEQ ID NO: 10); (SEQ ID NO: 11) and (SEQ ID NO: 12) and PARP14 shRNA oligonucleotides (shP ARP 14 (SEQ ID NO : 13) and (SEQ ID NO : 14) and (SEQ ID NO : 15) and (SEQ ID NO : 16); (SEQ ID NO: 17) and (SEQ ID NO: 18) were annealed and ligated into pENTR/Hl/TO vector (Invitrogen
  • Resulting shRNA constructs were recombined into pLentipuro/BLOCK-iT-DEST using Gateway LR Clonase II (Invitrogen #11791-020).
  • Recombinant lentiviruses were packaged in 293T cells by co-transfecting each of lentivirus plasmid with packaging vectors containing the gag/pol, rev and vsvg genes.
  • Lentivirus was harvested 48 hours after transfection and added to subconfluent Panc0327 and SUIT2 cells with polybrene for 16 hours. After 48hr cells were selected in puromycin for 1 week.
  • TetR Tet repressor
  • IFN receptor knock out Three sgRNA sites were designed for the IFNAR1 gene.
  • the recombinant plasmids of Lenti viral vector2-IFNARl -sgRNA were constructed.
  • the constructed vectors were transfected into PATU8988T and SUIT2-mSTING cells with Lipofectamine 3000.
  • RNA expression values were normalized and calculated as relative expression to control.
  • Primer sequences used for qRT-PCR for each gene are as follows: SIRT1 (Forward primer (FP)-(SEQ ID NO:21), Reverse Primer (RP)- (SEQ ID NO:22); SIRT2 (FP-(SEQ ID NO:23), RP-(SEQ ID NO:24); SIRT3 (FP-(SEQ ID NO:25), RP- (SEQ ID NO:26); SIRT4 (FP-(SEQ ID NO:27), RP-(SEQ ID NO:28); SIRT5 (FP-(SEQ ID NO:29), RP-(SEQ ID NO:30); SIRT6 (FP-(SEQ ID NO:31), RP-(SEQ ID NO:32); SIRT7 (FP- (SEQ ID NO:33), RP-(SEQ ID NO:34); PARP1 (FP-(SEQ ID NO:35), RP-(SEQ ID NO:36); PARP2 (FP-(SEQ ID NO:37), RP-(SEQ ID NO:38); PAR
  • NCG mice (NOD-Prkdc em26Cd52 I12rg em26Cd22 /NjuCrl) were purchased from Charles River. Mice used for orthotopic implantation were males 6 to 8 weeks of age.
  • 3D anchorage-independent culture CellTiter-Glo analysis cells were plated at lxlO 3 cells / in 50 pi / well in white opaque 384-well plates previously coated with poly-HEMA and treated as described. Following incubation, 50 pi of 3D CellTiter-Glo reagent (Diluted 1 :5 in dPBS) was added to each well. The plates were then shaken using a BioTek microplate reader for 5 min and then incubated at room temperature for 25 min, after which luminescence was measured using a BioTek microplane luminescence reader.
  • 3D CellTiter-Glo reagent Diluted 1 :5 in dPBS
  • SEQ ID NO: 62 CCATTTCGATTGACGTGTGGC

Abstract

L'invention concerne, entre autres, des procédés de traitement du cancer avec des inhibiteurs de l'ATR kinase et/ou des inhibiteurs de la NAMPT, comprenant, par exemple, des méthodes de traitement de cancers qui ont un niveau accru d'activité de la voie de signalisation de l'interféron ou de l'interféron. L'invention concerne des procédés de traitement du cancer chez un patient en ayant besoin, comprenant la détermination du niveau d'activité de la voie de signalisation de l'IFN ou de l'IFN dans un échantillon prélevé sur un patient ; et l'administration au patient d'une quantité efficace d'un inhibiteur de l'ATR kinase et/ou d'un inhibiteur de la NAMPT.
PCT/US2020/061827 2019-11-22 2020-11-23 Signalisation de l'interféron en tant que biomarqueur du cancer WO2021102420A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962939337P 2019-11-22 2019-11-22
US62/939,337 2019-11-22

Publications (1)

Publication Number Publication Date
WO2021102420A1 true WO2021102420A1 (fr) 2021-05-27

Family

ID=75981721

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/061827 WO2021102420A1 (fr) 2019-11-22 2020-11-23 Signalisation de l'interféron en tant que biomarqueur du cancer

Country Status (1)

Country Link
WO (1) WO2021102420A1 (fr)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150140123A1 (en) * 2012-06-13 2015-05-21 Merck Patent Gmbh Protein expression analyses for identifying genotoxic compounds
WO2015104292A2 (fr) * 2014-01-07 2015-07-16 Biomedical Research Foundation Of The Academy Of Athens Composés utilisables en vue du traitement ou de la prévention d'affections cancéreuses
US20160169901A1 (en) * 2014-12-10 2016-06-16 The Trustees Of Columbia University In The City Of New York Methods for diagnosis of cutaneous t-cell lymphoma
US20160313300A1 (en) * 2013-12-06 2016-10-27 Celgene Corporation Methods for determining drug efficacy for the treatment of diffuse large b-cell lymphoma, multiple myeloma, and myeloid cancers
US20180135134A1 (en) * 2015-05-08 2018-05-17 President And Fellows Of Harvard College Targeted selection of patients for treatment with cortistatin derivatives
US20190153542A1 (en) * 2009-01-07 2019-05-23 Myriad Genetics, Inc. Cancer biomarkers
WO2019165372A1 (fr) * 2018-02-26 2019-08-29 President And Fellows Of Harvard College Compositions de modulateurs et/ou de mutants de parp14 et leur utilisation thérapeutique
WO2019173456A1 (fr) * 2018-03-06 2019-09-12 Board Of Regents, The University Of Texas System Biomarqueurs de réponse au stress de réplication pour réponse d'immunothérapie

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190153542A1 (en) * 2009-01-07 2019-05-23 Myriad Genetics, Inc. Cancer biomarkers
US20150140123A1 (en) * 2012-06-13 2015-05-21 Merck Patent Gmbh Protein expression analyses for identifying genotoxic compounds
US20160313300A1 (en) * 2013-12-06 2016-10-27 Celgene Corporation Methods for determining drug efficacy for the treatment of diffuse large b-cell lymphoma, multiple myeloma, and myeloid cancers
WO2015104292A2 (fr) * 2014-01-07 2015-07-16 Biomedical Research Foundation Of The Academy Of Athens Composés utilisables en vue du traitement ou de la prévention d'affections cancéreuses
US20160169901A1 (en) * 2014-12-10 2016-06-16 The Trustees Of Columbia University In The City Of New York Methods for diagnosis of cutaneous t-cell lymphoma
US20180135134A1 (en) * 2015-05-08 2018-05-17 President And Fellows Of Harvard College Targeted selection of patients for treatment with cortistatin derivatives
WO2019165372A1 (fr) * 2018-02-26 2019-08-29 President And Fellows Of Harvard College Compositions de modulateurs et/ou de mutants de parp14 et leur utilisation thérapeutique
WO2019173456A1 (fr) * 2018-03-06 2019-09-12 Board Of Regents, The University Of Texas System Biomarqueurs de réponse au stress de réplication pour réponse d'immunothérapie

Similar Documents

Publication Publication Date Title
US11220477B2 (en) Modulators of the eIF2alpha pathway
TWI660739B (zh) 使用布魯頓氏酪胺酸激酶抑制劑之治療及免疫療法
TWI586354B (zh) 布魯頓氏酪胺酸激酶（ｂｒｕｔｏｎ'ｓ ｔｙｒｏｓｉｎｅ ｋｉｎａｓｅ ）抑制劑之組合及其用途
US20230285498A1 (en) Treatments for cancers having kras mutations
AU2015296010A1 (en) Biomarkers for predicting response of DLBCL to treatment with a BTK inhibitor
AU2017249226B2 (en) Methods of treating cancer
CN105073115A (zh) 布鲁顿氏酪氨酸激酶抑制剂和cyp3a4抑制剂的组合
US11612604B2 (en) Methods of treating cancer with PLK4 inhibitors
AU2019260793B2 (en) Methods for treating testicular and ovarian adrenal rest tumors
US10308596B2 (en) HDAC8 inhibitors for treating cancer
WO2021102420A1 (fr) Signalisation de l'interféron en tant que biomarqueur du cancer
WO2018148598A1 (fr) Compositions pour le traitement du cancer du sein
EP4017857A1 (fr) Inhibiteurs de mettl 16 et leurs utilisations
US20230175072A1 (en) 3 flap okazaki fragments and uses thereof
CN110430882A (zh) 治疗癌症的方法
US20240011036A1 (en) Prevention or treatment of wasting syndrome
US11225665B2 (en) P38 map kinase inhibitors
WO2022183069A9 (fr) Élaboration d'une thérapie ciblant le prmt pour améliorer l'efficacité du médicament ciblant l'egfr dans un nsclc
WO2023018985A1 (fr) Nouveaux inhibiteurs à petites molécules de pus7 et leurs utilisations
US20210085786A1 (en) Combination treatment of chemoresistant cancers
WO2020232445A1 (fr) Modulateurs des voies de biosynthèse des nucléotides de pyrimidine
CN116916900A (zh) 用于治疗膀胱癌的低氧诱导因子-2（α）抑制剂

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20890446

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20890446

Country of ref document: EP

Kind code of ref document: A1