WO2021080975A1 - Compositions and methods for reducing cholesterol levels - Google Patents

Abstract

A recombinant vector having an expression cassette comprising an engineered nucleic acid sequence encoding a functional human low-density lipoprotein receptor (hLDLR) is provided. The functional hLDLR protein is a wild type or a modified hLDLR comprising three amino acid substitutions (i.e., L318D, K809R and C818A). A recombinant adeno-associated viral particle (rAAV) is also provided comprising a capsid and a vector genome packaged therein, wherein the vector genome comprises an engineered nucleic acid sequence encoding a functional hLDLR. The capsid may be an AAV8 capsid, an AAV3B capsid, or an AAV38 variant capsid. Further provided are pharmaceutical compositions comprising a recombinant vector or an rAAV and a pharmaceutical acceptable carrier, as well as uses and methods using the recombinant vector, rAAV or composition in lowering cholesterol and/or treating familial hypercholesterolemia.

Description

COMPOSITIONS AND METHODS FOR REDUCING CHOLESTEROL LEVELS

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

This invention was made with government support under a grant number P01-HL059407 awarded by the National Heart, Lung, and Blood Institute (NHLBI) of the National Institutes of Health (NIH). The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

Familial hypercholesterolemia (FH) is a life-threatening disorder caused by mutations in genes that affect LDL receptor (LDLR) function (Goldstein et al. Familial hypercholesterolemia, in The Metabolic and Molecular Bases of Inherited Disease, C.R. Scriver, et al., Editors. 2001, McGraw-Hill Information Services Company: New York. p. 2863-2913 (2001)). It is estimated that >90% of patients with molecularly confirmed FH carry mutations in the gene encoding for the LDLR (LDLR, MIM 606945). The remainder of the patients carry mutations on three additional genes: APOB (MIM 107730) encoding apolipoprotein (apo) B, PCSK9 (MIM 607786) encoding proprotein convertase subtilisin/kexin type 9, and LDLRAP1 (MIM 695747) encoding LDLR adapter protein 1.

Patients with one abnormal allele, heterozygous FH (heFH or HeFH) have moderate elevations in plasma LDL and suffer from premature coronary artery disease (CAD), whereas homozygous FH patients (hoFH or HoFH) have high plasma cholesterol ranging between 500 and 1200 mg/dl. See, for example, Parihar RK, et al. Homozygous familial hypercholesterolemia. Indian J Endocrinol Metab. 2012 Jul;16(4):643-5.

The available options for treating FH are limited. Statins are considered the first line for pharmacological treatment. Even at maximal doses, only a 10-25% reduction in LDL-cholesterol (LDL-C) plasma levels is observed in most patients (Marais et al. Atherosclerosis, 2008. 197(1): p. 400-6 (2008); and Raal et al. Atherosclerosis, 2000. 150(2): p. 421-8 (2000)). The addition of the cholesterol absorption inhibitor, ezetimibe, to statin therapy may result in a further 10-20% reduction in LDL-C levels (Gagne et al. Circulation, 2002. 105 (21): p. 2469-2475 (2002)). Use of other cholesterol lowering medications, including bile acid sequestrants, niacin, fibrates, and probucol have been used successfully in the pre-statin era and can be considered to achieve further LDL-C reduction; however, their use is limited by tolerability and drug availability. Several non-pharmacological options have also been tested over the years, for example, portacaval shunting which is now considered as nonviable, orthotopic liver transplantation having a high risk of post-transplantation surgical complications and mortality, and lipoprotein apheresis which requires frequent repetition and intravenous access.

Expression and function of hepatic LDLR has been under intensive study and multiple pathways have been revealed within the cell. LDLR transcription is regulated by the sterol response element binding proteins (SREBPs), and HMG coA reductase inhibitors (statins) activate SREBPs by inhibiting cholesterol synthesis within hepatocytes (Blumenthal RS, Am Heart J. 2000;139:577-583). Additionally, pro-protein convertase subtilisin kexin 9 (PCSK9) was discovered based on human genetics gain-of- function mutations that caused high LDL-C levels (Abifadel M, et al., Nat Genet. 2003;34:154-156) and loss-of-function mutations that caused low LDL-C levels (Cohen J, et al., Nat Genet. 2005;37:161-1653), leading to the development of a new class of cholesterol lowering drugs based on the inhibition of PCSK9 (Fitzgerald K, et al, Lancet. 2014;383:60-68; Giugliano RP, et al, Lancet. 2012; 380:2007-2017). Further, Zelcher et al. demonstrated the degradation of LDLR by IDOL (inducible degrader of LDLR) (Zelcher N, et al., Science. 2009; 325:100-104). As an E3 ubiquitin ligase, IDOL was induced following activation of liver X receptors (LXRs) and subsequently interacted with the cytoplasmic tail of LDLR in mediating receptor ubiquitination and degradation.

Possibility of correcting the defective LDLR using gene therapy approaches have been studied. See, for example, WO 2015/164778 describing a recombinant adeno-associated viral particle (rAAV) expressing an engineered hLDLR variant which is designed to avoid degradation by PCSK9 and/or IDOL; WO 2017/100682 as well as WO 2018/152485 providing a replication deficient rAAV delivering a hLDLR gene to liver cells of human patients diagnosed with HoFH; Greig JA, et al. (Hum Gene Ther Clin Dev. 2017 Mar) showing AAV8.TBG.hLDLR vector- associated toxicity in chow-fed wild-type and LDLR^+/ Rhesus Macaques;28(l):39-50; Greig JA, et al. (Hum Gene Ther Clin Dev. 2017 Mar;28(l):28-38) providing a nonclinical pharmacology/toxicology study of AAV8.TBG.hLDLR in a mouse model of HoFH; Somanathan S, et al. (Circ Res. 2014 Aug 29; 115(6):591-9) showing that AAV vectors expressing LDLR gain-of-function variants demonstrated increased efficacy in mouse models of FH; and Chen SJ, et al. (Hum Gene Ther Clin Dev. 2013 Dec;24(4): 154-60) revealing biodistribution of AAV8 vectors expressing hLDLR in a mouse model of HoFH..

However, compositions and methods useful for more effectively lowering cholesterol in subjects (particularly those having FH), are still needed.

SUMMARY OF THE INVENTION

Compositions, regimens and methods of gene therapy are provided herein for reducing the level of cholesterol (such as low -density lipoprotein (LDL)) in a subject having or suspected of having a disease associated with impaired hLDLR function, such as familial hypercholesterolemia (FH).

In one aspect, provided is a recombinant adeno-associated viral particle (rAAV) comprising an AAV capsid and a vector genome packaged therein. The vector genome comprises inverted terminal repeats (ITRs) and an engineered nucleic acid sequence encoding at least a signal peptide and a functional human low-density lipoprotein receptor (hLDLR) under control of regulatory sequences which direct the hLDLR expression. In one embodiment, the functional hLDLR protein comprises an amino acid sequence of amino acid (aa) 22 to aa 860 of SEQ ID NO: 1 (wild type hLDLR). In another embodiment, the functional hLDLR protein comprises an amino acid sequence of aa 22 to aa 860 of SEQ ID NO: 2 (hLDLR having L318D, K809R and C818A). In a further embodiment, the engineered hLDLR coding sequence comprises a sequence of nucleotide (nt) 64 to nt 2580 of SEQ ID NO: 3 or a sequence sharing 95% to 99.9% identity thereto (such as, nt 64 to nt 2580 of SEQ ID NO: 4). In yet a further embodiment, the engineered nucleic acid sequence comprises SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the vector selected is a viral or non-viral vector suitable for delivery of the vector genome to a liver cell. In certain embodiments, the vector genome comprises a liver-specific promoter. In certain embodiments, the vector is an rAAV comprising an AAV capsid selected from AAV3B.AR2.08 or AAV3B.AR2.16 and the vector genome. In certain embodiments, the AAV capsid is AAV8.

Also provided are recombinant vectors and production systems for producing an rAAV as disclosed along with pharmaceutical compositions comprising an rAAV as disclosed and a formulation buffer.

In another aspect, provided is a method for reducing cholesterol (such as LDL) level in a subject, or for treating a subject having or suspected of having familial hypercholesterolemia, or for treating a disease associated with abnormal hLDLR (for example, reduced hLDLR activity). The method comprises administrating an effective amount of an rAAV as disclosed to the subject. In one embodiment, the method further comprises treating the subject with an immunosuppressant prior to, concurrently with or post the rAAV administration.

Other aspects and advantages of the invention will be readily apparent from the following detailed description of the invention.

BRIEF DESCRIPTION OF THE FIGURES

FIGs. 1A to 1C illustrate the plasmids for producing AAV.TBG.PI.hLDLR.RBG (FIG. 1A), AAV.TBG.IVS2.hLDLR011.bGH (FIG. IB) and AAV.TBG.IVS2.hLDLR011.triple.bGH (FIG. 1C), respectively.

FIGs. 2A to 2F provide graphs showing LDL levels of NHPs treated with the indicated rAAVs and as further detailed in Example 2. FIG 2A provides results for AAV8.hLDLR. FIG 2B provides results for AAV3B-AR2.16.hLDLR. FIG 2C provides results for AAV3B.hLDLR011 -triple. AAV2D provides results for AAV3B-AR2.16.hLDLR011. FIG 2E provides results for A AV3B-AR2 08 hLDLROI 1-triple. FIG 2F provides results for AAV3B- AR2.16.hLDLR011-triple.

FIGs. 3A to 3F provide graphs showing ALT levels of NHPs treated with the indicated rAAVs and steroid as further detailed in Example 2. FIG 3 A provides results for AAV8.hLDLR. FIG 3B provides results for AAV3B-AR2.16.hLDLR. FIG 3C provides results for AAV3B.hLDLR011-triple. AAV3D provides results for AAV3B-AR2.16.hLDLR011. FIG 3E provides results for A AV3B-AR2 08 hLDLROI 1-triple. FIG 3F provides results for AAV3B- AR2.16.hLDLR011-triple.

FIGs. 4A to 4F provide graphs showing AST levels of NHPs treated with the indicated rAAVs and steroid as further detailed in Example 2. FIG 4A provides results for AAV8.hLDLR. FIG 4B provides results for AAV3B-AR2.16.hLDLR. FIG 4C provides results for AAV4B.hLDLR011-triple. AAV4D provides results for AAV3B-AR2.16.hLDLR011. FIG 4E provides results for A AV3B-AR2 08 hLDLROI 1-triple. FIG 4F provides results for AAV3B- AR2.16.hLDLR011-triple.

FIGs. 5A to 5C provide graphs showing PCSK9 levels of NHPs treated with the indicated rAAVs as further detailed in Example 2. FIG 5A provides results for AAV8. FIG 5B provides results for AAV3B.AR2.08. hLDLROI 1-triple. FIG 5C provides results for AAV3B- AR02.16.hLDLLR011-triple. FIGs. 6A to 6C provide vector genome copies (GC) of the hLDLR expression cassette and mRNA relative expression in livers of the indicated NHPs. FIG. 6A provides a close look of two dose variants performed in monkeys with a therapeutic gene (hLDLR) for liver gene therapy and plotted at day 18. FIGs. 6B and 6C show plotted ratio levels of Vector GC over diploid genome (FIG 6B) and LDLR mRNA (FIG 6C) expression over relative expression at day 18, day 83 or 88 (where indicated), and day 120. Overall, two of the AAV3B variants that showed promising performance in the monkey barcode evaluation were chosen to pack human LDLR gene and evaluated in monkeys through i.v. injection. Liver biopsy was performed and the vector genome copies from the biopsy samples were measured by qPCR. The vector genome copies of the two variants are higher than AAV3B, indicating they are good capsid candidates for liver gene therapy.

FIG. 7A to 7F provide time course results using the mouse model as described in Example 2, serum LDL (FIG. 7A and 17F), vector genome copies (GC) in liver (FIG. 7B), LDLR mRNA (FIG. 7C), and LDLR protein (FIG. 7D). FIG 7E shows percent change in LDL cholesterol levels relative to baseline levels. Total liver lysate proteins from different time points were separated by WES system and probed for hLDLR expression. ERp72 expression was used as a loading control. FIG 7F shows percent change in LDL cholesterol levels relative to retreatment levels over time.

FIGs. 8A to 8C provide a comparison of expression levels between the mouse model (DKO) measured at day 14 post-injection and the non-human primate (NHP) model measured at day 18 post-injection in liver (GC, FIG 8A), LDL RNA (FIG 8B), and serum LDL (FIG 8C).

FIGs. 9A -9C show evaluation of different codon optimized LDLR variants in male DKO mice. AAV8-codon optimized LDLR reduces LDL cholesterol in the serum 14 days after the gene transfer in the male DKO mice. Percent change in the serum LDL cholesterol levels is normalized with baseline values. Male DKO mice (n=5 per group) systemically administrated (i.v.) with 1 X 10¹⁰ GC/kg hLDLR or hLDLR variants. Data expressed as Means ± STD. * p<0.05, **** p<0.0001 (FIG. 9A). FIG. 9B shows non-HDL cholesterol levels plotted as a percent of baseline at day 14 after administered dose of 4 x 10¹¹ GC/kg. FIG. 9C shows a schematic illustration of AAV vectors for different human LDLR transgene.

FIGs. 10A to 10E show a dosage effect of different hLDLR variants in the efficacy of LDL reduction in DKO mice. Mice were systemically administrated (i.v.) with 1 X 10¹¹, 3 X 10¹¹ and 1 X 10¹² GC/kg hLDLR or hLDLR variants. FIG. 10A and FIG. 10F show percent change in the serum LDL cholesterol at 14 days after the gene transfer as compared to baseline levels. FIG. 10B shows LDL level of female DKO mice on day 14 post injection. See Example 2 for details. FIG. IOC show western blot evaluating LDLR protein level in liver of male animals on day 28 post injection and quantification thereof. FIG. 10D shows LDLR mRNA levels on day 28 post injection in male DKO mice treated with lx 10¹² GC/kg of the rAAV. FIG. 10E shows percent change in the serum LDL cholesterol at 28 days after the gene transfer.

FIG. 11 shows number of genome copies of the hLDLR expression cassette at day 28 in mice treated with the rAAV comprising the IVS intron and the engineered hLDLROl 1. triple coding sequence. The non-human primates are identified on the x axis by dose and gender (M= male, F=female). Detailed description can be found in Example 2.

FIGs. 12A to 12F show an impact of hPCSK9 on the Efficacy of LDL Reduction in Male DKO Mice. Male DKO mice (n=5 per group) were systemically administered (i.v.) 1 x 10¹¹ and 3 x 10¹¹ GC/kg AAV8. hLDLR or AAV8.hLDLR variants along with 2 x 10¹¹ GC/kg of AAV9.hPCSK9 vector. LDL cholesterol levels were measured in the serum collected from the mice before and 14 days and 28 days after gene transfer. FIG 12A shows level of hPCSK9 expressed in male DKO mice at 14 and 28 days after the gene transfer. FIG 12B and FIG 12C shows percent change in day 14 LDL cholesterol levels relative to baseline levels in mice that received 1 x 10¹¹ and 3 x 10¹¹ GC/kg AAV8.hLDLR or AAV8.hLDLR variants. FIG 12D and FIG 12E shows percent change in day 28 LDL cholesterol levels relative to baseline levels. FIG 12F shows results from a study in which total liver lysate proteins were separated by WES system and probed for hLDLR expression. Tubulin and ERp72 expression was used as a loading control. Representative blots are shown in the lower panel, and quantitative analysis is presented in the upper panel.

FIGs. 13A to 13 E show an impact of hIDOL on the Efficacy of LDL Reduction in Male DKO Mice. Male DKO mice (n=5 per group) were systemically administrated (i.v.) with 1 x 10¹¹ and 3 x 10¹¹ GC/kg AAV8.hLDLR or AAV8.hLDLR variants along with 5 x 10¹² GC/kg of AAV9.hIDOL vector. LDL cholesterol levels were measured in the serum collected from the mice before and at 14,28 days after gene transfer. FIGS 13A and FIG 13B show percent change in day 14 LDL cholesterol levels relative to baseline levels in mice that received 1 x 10¹¹ GC/kg and 3 x 10¹¹ GC/kg AAV8.hLDLR or AAV8.hLDLR variants. FIG 13C and FIG 13D show percent change day 28 LDL cholesterol levels relative to baseline levels. FIG 13E shows results when total liver lysate proteins were separated by WES system and probed for hLDLR expression. ERp72 expression was used as a loading control. Representative blots are shown in the lower panel, and quantitative analysis is presented in the upper panel. Data expressed as Means ± STD. ** p<0.01, *** pO.OOl.

FIG 14A to 14B show a comparison of efficacy of LDL reduction in male and female DKO mice. Male and female DKO mice (n=5 per group) are transduced with 3 x 10¹¹ GC/kg AAV8 vector expressing wild type hLDLR and different codon optimized hLDLR variants. LDL cholesterol levels are measured at 28 days after the gene transfer. FIG 26A shows the percent change in the serum LDL cholesterol levels relative to baseline values. FIG 26B shows the relative LDLR mRNA expression.

DETAILED DESCRIPTION OF THE INVENTION

Non-naturally-occurring, artificial, synthetic, and/or engineered nucleic acid sequences encoding a functional human low-density lipoprotein receptor (hLDLR) are provided, along with expression cassettes, vector genomes, recombinant vectors, recombinant adeno-associated viral particles (rAAVs) and methods delivering and/or expressing the engineered nucleic acid sequence in a liver cell (such as a hepatocyte) of a subject having or suspected of having an impaired low- density lipoprotein receptor (LDLR) function.

In one embodiment, the functional hLDLR protein is a wild type hLDLR protein which comprises an amino acid sequence of amino acid (aa) 22 to aa 860 of SEQ ID NO: 1. In another embodiment, the functional hLDLR protein is a modified hLDLR variant having three amino acid substitutions L318D, K809R and C818A comprising an amino acid sequence of aa 22 to aa 860 of SEQ ID NO: 2. In a further embodiment, the engineered hLDLR coding sequence comprises a sequence of nucleotide (nt) 64 to nt 2580 of SEQ ID NO: 3 or a sequence sharing 95% to 99.9% identity thereto (such as, nt 64 to nt 2580 of SEQ ID NO: 4). In yet a further embodiment, the engineered nucleic acid sequence comprises SEQ ID NO: 3 or SEQ ID NO: 4.

In one embodiment, the rAAV is suitable for delivery the vector genome into a liver cell, for example, via a liver-specific promoter and/or an AAV capsid having a liver tropism. In one embodiment, the liver-specific promoter is a thyroxine binding globulin (TBG) promoter. In certain embodiments, this may be the human TBG promoter. In a further embodiment, the TBG promoter comprises a sequence of nt 415 to nt 874 of SEQ ID NO: 5 or 6. In certain embodiments, the TBG promoter may be a hybrid promoter based on the human TBG promoter and microglobin/bikunin enhancer. In another embodiment, a liver-specific promoter and/or an AAV capsid having a liver tropism is used in order to minimize delivery of a vector genome as disclosed herein and/or expression of a functional hLDLR as disclosed herein to a non-liver cell. In a further embodiment, the vector genome comprises a nucleic acid sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the rAAV capsid is an AAV3B variant as disclosed herein, including but not limited to AAV3B.AR2.08 or AAV3B.AR2.16. In one embodiment, the rAAV capsid is AAV3B.AR2.08. In a further embodiment, an AAV3B.AR2.08 capsid is an AAV capsid comprising a heterogenous population of vp 1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 26. Additionally or alternatively, an AAV3B.AR2.08 capsid is an AAV capsid comprising a heterogenous population of vpl proteins which are the product of a nucleic acid sequence of SEQ ID NO: 27. In another embodiment, the rAAV capsid is AAV3B.AR02.16. In a further embodiment, an AAV3B.AR2.16 capsid is an AAV capsid comprising a heterogenous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 40. Additionally or alternatively, an AAV3B.AR2.16 capsid is an AAV capsid comprising a heterogenous population of vp 1 proteins which are the product of a nucleic acid sequence of SEQ ID NO: 41.

For example, for the treatment of familial hypercholesterolemia (FH, such as homozygous FH or heterozygous FH), a subject (such as, a human patient) is administrated with an effective amount of an rAAV comprising an AAV capsid and an engineered nucleic acid sequence encoding at least a signal peptide and a functional hLDLR protein under control of regulatory sequences which direct the hLDLR expression. In one embodiment, the engineered nucleic acid sequence encodes a functional hLDLR protein and comprises SEQ ID NO: 3 or a sequence at least 95% identical thereto. In another embodiment, the engineered nucleic acid sequence encodes a functional hLDLR protein and comprises SEQ ID NO: 4 or a sequence at least 95% identical thereto.

After administration of an rAAV as disclosed herein, the subject has one or more of the following: (a) an increased hLDLR expression in liver (in the messenger RNA (mRNA) level and/or protein level); (b) an increased hLDLR functional activity in liver; (c) a reduced cholesterol (for example, low-density lipoprotein (LDL)) level; (d) a delayed disease progression; (e) a milder symptom and/or less symptoms associated with the disease; (f) less dependency on other FH treatment(s) if necessary as a co-therapy (including but not limited to, lower amount and/or less treatment frequency of one or more of statins, ezetimibe, other cholesterol lowering medications, or lipoprotein apheresis). In one embodiment, such effect(s) is/are measured by comparing to the corresponding level of the subject prior to the rAAV administration, or the corresponding level or an averaged level of subjects(s) in a corresponding stage of the disease upon progression, or the corresponding level or an averaged level of patient(s) without any treatment, or the corresponding level or an averaged level of patient(s) on another treatment regime.

In one embodiment, the compositions and methods provided herein does not induce an immune response or induces a weaker immune response to the rAAV capsid and/or the expressed functional hLDLR and/or a liver cell expressing the functional hLDLR. Additionally or alternatively, comparing to other gene/cell therapies available, the rAAVs, compositions and methods provided herein is more efficient and requires less vector (i.e., lower dose of rAAV), and thus, is more effective and at a lower cost. In a further embodiment, less and/or milder adverse effect(s) is/are associated with the rAAV, compositions or methods as disclosed herein compared to another gene/cell therapy. For example, less damage to liver is observed in treatment using the rAAV as disclosed, including but not limited to less increase in alanine transaminase (ALT) level and/or aspartate transaminase (AST) level and/or shorter time period of the ALT/AST level being elevated. Such advantageous effects have been described and discussed in the Examples.

Without wishing to be bound by the theory, these advantages of the rAAVs, compositions and methods are due to one or more of the following: use of an nucleic acid sequence engineered to express a functional hLDLR in a liver cell; an encoded hLDLR amino acid variant which is less sensitive to one or more of hLDLR degradation pathways (such as PCSK9 and/or IDOA); or an AAV3B variant capsid having a liver tropism and/or with less immunogenicity.

Compositions, production systems, and methods of making an rAAV as disclosed or compositions comprising the same are also provided. More details about the engineered hLDLR coding sequence(s) and rAAV(s), along with composition comprising the same as well as methods utilizing or making the same, are provided herein. Further, it is noted that, unless specified, one or more embodiments of any component(s), composition(s), regimen(s) and method(s) may apply to another other embodiment(s) of the same or another component(s), composition(s), regimen(s) and method(s). In addition, it is also intended that each of the compositions herein described as useful in the methods, is, in another embodiment, itself an embodiment of the invention. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application. The following is provided for clarity only and are not intended to limit the claimed invention.

“Comprising” is a term meaning inclusive of other components or method steps. When “comprising” is used, it is to be understood that related embodiments include descriptions using the “consisting of’ terminology, which excludes other components or method steps, and “consisting essentially of’ terminology, which excludes any components or method steps that substantially change the nature of the embodiment or invention. It should be understood that while various embodiments in the specification are presented using “comprising” language, under various circumstances, a related embodiment is also described using “consisting of’ or “consisting essentially of’ language.

It is to be noted that the term “a” or “an”, refers to one or more, for example, “an rAAV”, is understood to represent one or more rAAV(s). As such, the terms “a” (or “an”), “one or more,” and “at least one” is used interchangeably herein.

The terms “another”, “first”, “second”, “third”, “fourth”, “fifth” and “sixth” are used throughout this specification as reference terms to distinguish between various forms and components of the compositions and methods, for example, first or second one-letter amino acid (aa) or nucleotide (nt) code.

As used herein, the term “about” means a variability of plus or minus 10 % from the reference given, unless otherwise specified.

As used in the specification, including the examples and figures, an upper or lower case “e” may be used as an abbreviation for an exponent. Thus, for example, “1E13” or “1E+13” is used interchangeably with “1 x 10¹³” and “3E9” or “3E+9” is used interchangeable with “3 x 10⁹”. Other similar abbreviations will be readily understood by one of skill in the art.

As described herein, the terms “reduce” “decrease” “alleviate” “ameliorate” “improve” “delay” “earlier” “low” “high” “mitigate”, any grammatical variation thereof, or any similar terms indication a change, means a variation of about 5 fold, about 2 fold, about 1 fold, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30%, about 20%, about 10%, about 5 % compared to a reference, unless otherwise specified. A. LDLR

In one aspect, provided is a non-naturally occurring, artificial, synthetic, and/or engineered nucleic acid molecule comprising a sequence encoding a functional human low- density lipoprotein receptor (hLDLR) protein. In one embodiment, the engineered nucleic acid sequence further comprises a sequence encoding a signal peptide which is to be conjugated to the N -terminal of the functional hLDLR.

In certain embodiments, a functional hLDLR coding sequence comprises a sequence as reproduced in nucleotide (nt) 64 to nt 2580 of SEQ ID NO: 3. In a further embodiment, the engineered nucleic acid sequence comprises a sequence of the full-length of SEQ ID NO: 3. In one embodiment, the engineered nucleic acid sequence comprises a nucleic acid sequence which is 95 % to 99.9 % identical to nt 64 to nt 2580 of SEQ ID NO: 3 and encodes a functional hLDLR protein. Optionally, the encoded functional hLDLR protein comprises an aa sequence of aa 21 to aa 860 of SEQ ID NO: 1 or aa 21 to aa 860 of SEQ ID NO: 2. In a further embodiment, the nucleic acid sequence sharing 95% to 99.5% identity to nt 64 to nt 2580 of SEQ ID NO: 3 is nt 64 to nt 2580 of SEQ ID NO: 4. In yet a further embodiment, the engineered nucleic acid sequence comprises a nucleic acid sequence which is 95 % to 99.9 % identical to SEQ ID NO: 3 and encodes a functional hLDLR protein, optionally the encoded functional hLDLR protein comprises an aa sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the nucleic acid sequence sharing 95% to 99.5% identity to SEQ ID NO: 3 is SEQ ID NO: 4.

In certain embodiments, the functional hLDLR coding sequence comprises a sequence as reproduced in nucleotide (nt) 64 to nt 2580 of SEQ ID NO: 4. In a further embodiment, the engineered nucleic acid sequence comprises a sequence of SEQ ID NO: 4. In one embodiment, the engineered nucleic acid sequence comprises a nucleic acid sequence which is 95 % to 99.9 % identical to nt 64 to nt 2580 of SEQ ID NO: 4 and encodes a functional hLDLR protein. Optionally, the encoded functional hLDLR protein comprises an aa sequence of aa 21 to aa 860 of SEQ ID NO: 1 or aa 21 to aa 860 of SEQ ID NO: 2. In a further embodiment, the nucleic acid sequence sharing 95% to 99.5% identity to nt 64 to nt 2580 of SEQ ID NO: 4 is nt 64 to nt 2580 of SEQ ID NO: 3. In yet a further embodiment, In another embodiment, the engineered nucleic acid sequence comprises a nucleic acid sequence which is 95 % to 99.9 % identical to SEQ ID NO: 4 and encodes a functional hLDLR protein, optionally the encoded functional hLDLR protein comprises an aa sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the nucleic acid sequence sharing 95% to 99.5% identity to SEQ ID NO: 4 is SEQ ID NO: 3. As used herein, the phrase of “95 % to 99.9 %” refers to at least 95 %, at least 96 %, at least 97 %, at least 98%, at least 99 %, from 95 % to 99.9 %, from 96 % to 99.9 %, from 97 % to 99.9 %, from 98 % to 99.9 %, from 99 % to 99.9 %, from 95 % to 99 %, from 96 % to 99 %, from 97 % to 99 %, from 98 % to 99 %, from 95 % to 98 %, from 96 % to 98 %, from 97 % to 98 %, from 95 % to 97 %, or from 96 % to 97 %, wherein each of the percentage ranges includes the endpoints and the every percentages therebetween. In the embodiments where the upper limit is not identified, 100%, 99.9% or any percentages between 100% and the lower limit may serve as the upper limit.

In certain embodiments, the hLDLR coding sequence in the engineered nucleic acid sequence is less than 99 %, or less than 98 %, or less than 97 %, or less than 96 %, or less than 95 %, or less than 94 %, or less than 93 %, or less than 92 %, or less than 91 %, or less than 90 %, or less than 89 %, or less than 88 %, or less than 87 %, or less than 86 %, or less than 85 %, or less than 84 %, or less than 83 %, or less than 82 %, or less than 81 % identical to a wild type hLDLR coding sequence. In the embodiments where the lower limit is not identified, 0 %, 10%, 20%, 30%, 50%, 50%, 60%, 70%, 80%, or any percentages between 0% and the upper limit may serve as the lower limit.

As used herein, the term “low density lipoprotein receptor” “low-density lipoprotein receptor” “LDL receptor” or “LDLR” refers to a receptor which is capable of binding to low- density lipoprotein (LDL), the major cholesterol-carrying lipoprotein of plasma, and transporting it into cells by endocytosis. In certain embodiments, the term “human LDLR” (i.e., hLDLR) is used interchangeably with LDLR.

A functional hLDLR refers to a hLDLR protein which is a wild type hLDLR, or a hLDLR variant which has about the same function(s) of a wild type hLDLR or with a biological activity of at least about 10% to at least 10 fold, or ranges therebetween, including at least about 20%, at least about 30%, at least about 40%, about 50%, at least 60%, at least 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 100%, up to at least about 1 fold, up to at least about 2 folds, up to at least 3 folds, up to at least 5 folds, up at least 10 folds or more of the biological activity level of a wild-type hLDLR. Such biological activity may include but is not limited to binding to an LDL, uptake of an LDL via endocytosis into a cell (such as a hepatocyte), and/or reducing an LDL level in a biological sample (such as plasm or serum). Methods of measuring the biological activity(ies) can be found in the examples as well as in publications. See, for example, WO 2015/164778, WO 2017/100682, WO 2018/152485 and Benito-Vicente A et al., Int J Mol Sci. 2018 Jun 5; 19(6). pii: E1676. doi: 10.3390/ijms 19061676.

In one embodiment, a functional hLDLR protein comprises an extracellular region (for example, amino acid (aa) 22 to aa 788 of SEQ ID NO: 1 or 2), a transmembrane region (for example aa 789 to aa 810 of SEQ ID NO: 1 or 2) and a cytoplasmic region (for example aa 811 to aa 860 of SEQ ID NO: 1 or 2). In a further embodiment, a functional hLDLR further comprises a signal peptide. However, in certain embodiments, for the ease of understanding and discussion, a signal peptide is excluded when referring to a functional hLDLR.

A wild type (wt) hLDLR protein is a hLDLR protein native to a healthy subject or a subject free of the diseases as discussed herein. This may be alternatively termed “normal” hLDLR protein. A wild type hLDLR may be characterized by the amino acid sequence of SEQ ID NO: 1 or another isoform or polymorph thereof which is not associated with a disease.

Six isoforms have been found as being produced by alternative splicing, including isoform 1 with a Universal Protein Resource (UniProt) identifier: P01130-1 which is reproduced herein as SEQ ID NO: 1, isoform 2 with a UniProt identifier: P01130-2 which is reproduced herein as SEQ ID NO: 52, isoform 3 with a UniProt identifier: P01130-3 which is reproduced herein as SEQ ID NO: 53, isoform 4 with a UniProt identifier: P01130-4 which is reproduced herein as SEQ ID NO: 54, isoform 5 with a UniProt identifier: P01130-5 which is reproduced herein as SEQ ID NO: 55, and isoform 6 with a UniProt identifier: P01130-6 which is reproduced herein as SEQ ID NO: 56. Additional potential isoforms have also been identified, including, H0YMD1 with a UniProt identifier: HOYMDl-1 which is reproduced herein as SEQ ID NO: 57, H0YM92 with a UniProt identifier: H0YM92-1 which is reproduced herein as SEQ ID NO: 58, J3KMZ9 with a UniProt identifier: J3KMZ9-1 which is reproduced herein as SEQ ID NO: 59, and H0YMQ3 with a UniProt identifier: H0YMQ3-1 which is reproduced herein as SEQ ID NO: 60. Each of the sequences is incorporated herein in its entirety by reference. In one embodiment, a wild type hLDLR protein comprises a signal peptide. In another embodiment, no signal peptide is included in a hLDLR. In the embodiments relating to the hLDLR isoforms, the wild type hLDLR may comprises an amino acid sequence of any one of SEQ ID NOs: 1, and 52 to 60, or an amino acid sequence lacking amino acid (aa) 1 to aa 21 of any one of SEQ ID NOs: 1, 52, 53, 54, 55, or 56, or an amino acid sequence lacking aa 1 to aa 24 of SEQ ID NO: 57.

In certain embodiments, the functional hLDLR variant comprises any one of the wild type hLDLR protein with about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20 or more of conservative amino acid substitutions. As used herein, the “conservative amino acid replacement” or “conservative amino acid substitutions” refers to a change, replacement or substitution of an amino acid to a different amino acid with similar biochemical properties (e.g. charge, hydrophobicity and size), which is known by practitioners of the art. Also see, e.g. French et al. What is a conservative substitution? Journal of Molecular Evolution, March 1983, Volume 19, Issue 2, pp 171-175 and YAMPOLSKY et al. The Exchangeability of Amino Acids in Proteins, Genetics. 2005 Aug; 170(4): 1459-1472, each of which is incorporated herein by reference in its entirety.

The term "amino acid substitution" and its synonyms described above are intended to encompass modification of an amino acid sequence by replacement of an amino acid with another, substituting, amino acid. The substitution may be a conservative substitution. It may also be a non-conservative substitution. The term conservative, in referring to two amino acids, is intended to mean that the amino acids share a common property recognized by one of skill in the art. For example, amino acids having hydrophobic nonacidic side chains, amino acids having hydrophobic acidic side chains, amino acids having hydrophilic nonacidic side chains, amino acids having hydrophilic acidic side chains, and amino acids having hydrophilic basic side chains. Common properties may also be amino acids having hydrophobic side chains, amino acids having aliphatic hydrophobic side chains, amino acids having aromatic hydrophobic side chains, amino acids with polar neutral side chains, amino acids with electrically charged side chains, amino acids with electrically charged acidic side chains, and amino acids with electrically charged basic side chains. Both naturally occurring and non-naturally occurring amino acids are known in the art and may be used as substituting amino acids in embodiments. Methods for replacing an amino acid are well known to the skilled in the art and include, but are not limited to, mutations of the nucleotide sequence encoding the amino acid sequence.

Reference to "one or more" herein is intended to encompass the individual embodiments of, for example, 1, 2, 3, 4, 5, 6, or more.

In certain embodiments, a functional hLDLR protein is an engineered variant of a wild type hLDLR with a reduced affinity for PCSK9 and/or IDOL. See, for example, WO2015164778. In one embodiment, a hLDLR variant may be any one of the wild type proteins with one or any combination of the following amino acid substitutions: N295D, H306G, V307D, N309A, D310N, L318H, L318D, L769R, K809R and/or C818A. In a further embodiment, the functional hLDLR protein comprises three amino acid substitutions of L318D, K809R and C818A. In yet a further embodiment, the functional hLDLR protein comprises an amino acid sequence of SEQ ID NO: 2, i.e., the wild type sequence of SEQ ID NO: 1 with three amino acid substitutions of L318D, K809R and C818A.

An amino acid (aa) substitution is described herein in a format of a first one-letter amino acid code (referred to herein as “Xi”) followed by a number (referred to herein as “A”) and then a second one-letter amino acid code (referred to herein as “X2”) (i.e., a format as “X1/VX2”, wherein each of Xi and X2 is a one-letter aa code and N is a positive integer), indicating that a first functional hLDLR aa sequence having an Xi at position N undergoes an aa substitution and results in a second hLDLR sequence having an X2 at position N. As used herein, the position number here (N) is based on the numbering of SEQ ID NO: 1 but identifies aa (N+21) of SEQ ID NO: 1 as N, i.e., the numbering used in identifying position of an aa substitution herein does not take the signal peptide into consideration. For instance, a functional hLDLR protein having a sequence of SEQ ID NO: 1 with an aa substitution of “X1NX2”, means that the functional protein has a sequence of SEQ ID NO: 1 but with the aa Xi at aa (N+21) of SEQ ID NO: 1 changed to aa X2. Another example is SEQ ID NO: 2 is a functional hLDLR protein with three aa substitutions of L318D, K809R and C818A. Additionally, one of skill in the art would understand that, in a situation that the first functional hLDLR aa sequence is not or does not comprise SEQ ID NO: 1, a position N can still be identified based on the numbering of SEQ ID NO: 1 as defined above along with a sequence alignment (1) between SEQ ID NO: 1 and the first sequence, or (2) between SEQ ID NO: 1 and the second sequence, or (3) among the sequences of SEQ ID NO: 1, the first sequence and the second sequence. For instance, SEQ ID NO: 57 with an aa substitution of E240X2 refers to a sequence of SEQ ID NO: 57 with the E at aa 113 of SEQ ID NO: 57 (which corresponds to aa 240 of SEQ ID NO: 1 based on a sequence alignment between SEQ ID NO: 1 and SEQ ID NO: 57) to an aa of X2.

Additionally or alternatively, a functional hLDLR protein is any one of the wild type proteins with one or any combination of the following amino acid substitutions: R236W, G314S, L578S, 177 IF, K790R, K795R, I800A, I800R, Y807A, Q808A, S833A, and S833D. In a further embodiment, a functional hLDLR protein is the native “normal” or “wild-type” hLDLR. In yet a further embodiment, the aa substitution(s) is/are identified on the webpage of uniprot.org/uniprot/P01130.

In certain embodiment, a functional hLDLR may have a transmembrane region of a transmembrane protein (such as a liver cell specific cell surface marker) other than hLDLR. The transmembrane protein may include, but is not limited to, asialoglycoprotein receptor 1, ATP- binding cassette sub-family A member 6, bile salt export pump, multidrug resistance-associated protein 6, or any other ones as identified in Mallanna SK et al. (Stem Cell Reports. 2016 Sep 13;7(3):543-556). See, also, for example, bdbiosciences.com/documents/cd_marker_handbook.pdf and antibodybeyond.com/reviews/cell- markers/stellate-cell-marker.htm.

In certain embodiments, a functional hLDLR protein comprises a signal peptide of the native hLDLR signal peptide (for example, aa 1 to aa 21 of SEQ ID NO: 1 or aa 1 to aa 24 of SEQ ID NO: 57) or is provided with a native hLDLR signal peptide conjugated to the N-terminal of the functional hLDLR. As used herein, a signal peptide (also referred to as signal sequence, targeting signal, localization signal, localization sequence, transit peptide, leader sequence or leader peptide) is a short peptide (usually 16-30 amino acids long) present at the N-terminus of the majority of newly synthesized proteins that are destined towards the secretory pathway. These proteins include those that reside either inside certain organelles (the endoplasmic reticulum,

Golgi or endosomes), secreted from the cell, or inserted into most cellular membranes.

In another embodiment, a functional hLDLR protein comprises a signal peptide other than the native hLDLR signal peptide or is provided along with a signal peptide other than the native hLDLR signal peptide conjugated to the N-terminal of the functional hLDLR. In one embodiment, the signal peptide is suitable for directing the expressed functional hLDLR protein to a cell surface. In a further embodiment, the cell surface is of a liver cell. In yet a further embodiment, the cell surface is of a hepatocyte. Such an exogenous signal peptide is preferably of human origin and may include, e.g., an IL-2 leader peptide or any other signal peptide from a liver cell specific cell surface protein, such as asialoglycoprotein receptor 1, ATP-binding cassette sub-family A member 6, bile salt export pump, multidrug resistance-associated protein 6, or any other ones as identified in Mallanna SK et al. as cited above. See, also, e.g., signalpeptide.de/index.php?m=listspdb_mammalia.

In certain embodiments, the functional protein is truncated of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15 or about 20 amino acids in length at its C-terminal and/or N-terminal.

In certain embodiments, a sequence which is at least 95%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 1 or 2 is selected as the sequence of a functional hLDLR protein. In a further embodiment, the functional protein comprises an amino acid sequence of SEQ ID NO: 1. In another embodiment, the functional protein comprises an amino acid sequence of SEQ ID NO: 2.

The wild type hLDLR protein is encoded by a hLDLR gene (National Centre for Biotechnology Information (NCBI) Gene ID 3949), which has been mapped to the long arm of chromosome 19 (location NC_000019.10 (11089432..11133820)). As used herein, a wild type hLDLR coding sequence refers to a nucleic acid sequence native to a subject and encoding a wild type hLDLR protein, including various transcript variants of hLDLR. Six transcript variants have been identified. See, e.g., genecards.org/cgi- bin/carddisp.pl?gene=LDLR&keywords=ldlr#transcripts. Transcript variant 1 is identified as NCBI Reference Sequence: NM_000527.5 and the coding sequence (CDS) therein is reproduced herein as SEQ ID NO: 61. Transcript variant 2 is identified as NCBI Reference Sequence: NM_001195798.2 and the CDS therein is reproduced herein as SEQ ID NO: 62. Transcript variant 3 is identified as NCBI Reference Sequence: NM_001195799.2 and the CDS therein is reproduced herein as SEQ ID NO: 63. Transcript variant 4 is identified as NCBI Reference Sequence: NM_001195800.2 and the CDS therein is reproduced herein as SEQ ID NO: 64. Transcript variant 6 is identified as NCBI Reference Sequence: NM_001195803.2 and the CDS therein is reproduced herein as SEQ ID NO: 65. Other transcript variants may also be included, for example, transcript variant XI with the NCBI Reference of XM_011528010.2, the CDS in which is reproduced herein as SEQ ID NO: 66, or a transcript variant with any one of the following NCBI References: DC306821.1, DB081391.1, DA008286.1, BM785950.1,

AA292214.1, HM369522.1, S40543.1, S70123.1, AK299038.1, AK296312.1, BT007361.1,

AY114155.1, AK295612.1, AK300313.1, AB209409.1, BC014514.1, BX648281.1, and M28219.1. Each of the sequences is incorporated herein in its entirety by reference.

A "nucleic acid" or a “nucleotide”, as described herein, can be RNA, DNA, or a modification thereof, and can be selected, for example, from a group including: nucleic acid encoding a protein of interest (for example, hLDLR), oligonucleotides, nucleic acid analogues, for example peptide- nucleic acid (PNA), pseudocomplementary PNA (pc-PNA), locked nucleic acid (LNA) etc. In certain embodiments, the terms “nucleotide” “nucleic acid” “nucleotide residue” and “nucleic acid residue” are used interchangeably, referring to a nucleotide in a nucleic acid polymer.

A nucleic acid molecule (RNA or DNA) or a nucleotide therein may be modified or edited. In one embodiment, such modification or edition includes 5' capping, 3' polyadenylation, and RNA splicing. In another embodiment, the modification or edition includes methylation (for example on a A residue resulting in a m⁶A), demethylation (for example, on a m⁶A, optionally via a RNA demethylase, including but not limited to ALKBH5), deamination (for example, from adenosine (A) to inosine (I), optionally via a tRNA-specific adenosine deaminase (ADAT), or from C to U, optionally via a pentatricopeptide repeat (PPR) protein), or amination (for example, from U to C or from G to A).

Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding, decoding, regulation and expression of genes. As used herein, RNA may refer to a CRISPR guide RNA, a messenger RNA (mRNA) which encodes a protein of interest (for example, hLDLR), a mitochondrial RNA, short hairpin RNAi (shRNAi), small interfering RNA (siRNA), a mature mRNA, a primary transcript mRNA (pre-mRNA), a ribosomal RNA (rRNA), a 5.8S rRNA, a 5S rRNA, a transfer RNA (tRNA), a transfer-messenger RNA (tmRNA), an enhancer RNA (eRNA), a small interfering RNA (siRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a Piwi-interacting RNA (piRNA), a tRNA-derived small RNA (tsRNA), a small rDNA-derived RNA (srRNA), a non-coding RNA (ncRNA), long (intergenic) non-coding RNA (lincRNA/lncRNA), a single-stranded RNA (ssRNA), a circular RNA (circRNA), a vault RNA (vRNA/vtRNA), a SmY RNA, a double-stranded RNA (dsRNA), a small Cajal body-specific RNA (scaRNA), an antisense RNA (aRNA/asRNA), a ribonuclease RNA (e.g. RNase P), a non-coding regulatory RNA (e.g. 7SK RNA), RNA-viruses or single stranded DNA.

As used herein, deoxyribonucleic acid (DNA) is a polymeric molecule formed by deoxyribonucleic acid, including, but not limited to, genomic DNA, double-strand DNA, single- strand DNA, DNA packaged with a histone protein, complementary DNA (cDNA which is reverse-transcribed from a RNA), mitochondrial DNA, and chromosomal DNA.

The term “percent (%) identity” , “sequence identity”, “percent sequence identity”, or “percent identical” in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired. Multiple sequence alignment programs are also available for nucleic acid sequences and for calculating the identity thereof. Examples of such programs include, “Clustal W”, “Clustal Omega”, “CAP Sequence Assembly”, “BLAST”, “MAP”, and “MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG Version 6.1. Fasta™ provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference. For example, SEQ ID NO: 3 shares an about 99.93 % identity to SEQ ID NO: 4.

Percent identity may be readily determined for amino acid sequences over the full-length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof or the corresponding nucleic acid sequence coding sequences. A suitable amino acid fragment may be at least about 8 amino acids in length, and may be up to about 700 amino acids. Generally, when referring to “identity”, “homology”, or “similarity” between two different sequences, “identity”, “homology” or “similarity” is determined in reference to “aligned” sequences. “Aligned” sequences or “alignments” refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence.

Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Sequence alignment programs are available for amino acid sequences, e.g., the “Clustal X”, “Clustal Omega” “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999). For example, SEQ ID NO: 2 shares an about 99.65 % identity to SEQ ID NO: 1. As used herein, the phrase of a non-naturally-occurring, artificial, synthetic, and/or engineered nucleic acid sequence or molecule is used interchangeably with the term of an engineered nucleic acid sequence or molecule, referring to a nucleic acid sequence or molecule which does not exist in nature without human efforts and/or comprises at least one artificial edition or modification of a nucleotide therein. Various methods may be utilized in designing, generating and/or producing an engineered sequence as disclosed herein. See, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.

Through this specification, various expression cassettes, vector genomes, vectors, and compositions, are described as containing the functional hLDLR coding sequence. It will be understood that, unless otherwise specified, any of the functional hLDLR proteins as described herein, or an engineered coding sequence therefor, may be similarly engineered into expression cassettes, vector genomes, vectors and compositions.

In certain embodiments, an engineered nucleic acid sequences comprising a sequence encoding a functional hLDLR is an expression cassette. Suitably, an expression cassette is provided which comprises the nucleic acid sequences described herein and regulatory sequence which direct the expression of a functional hLDLR.

In one embodiment, the expression cassette is designed for expression in a human subject. In one embodiment, the expression cassette is designed for expression in liver. In one embodiment, the expression cassette is designed for expression in heart, or muscle or another tissue.

In certain embodiments, the functional hLDLR protein comprises an amino acid sequence of amino acid (aa) 22 to aa 860 of SEQ ID NO: 1 or an amino acid sequence of aa 22 to aa 860 of SEQ ID NO: 2. In a further embodiment, the functional hLDLR coding sequence comprises a sequence of nucleotide (nt) 64 to nt 2580 of SEQ ID NO: 3 or a sequence sharing a 95% to 99.9% identity thereto, such as a sequence of nt 64 to nt 2580 of SEQ ID NO: 3 or a sequence of nt 64 to nt 2580 of SEQ ID NO: 4. In yet a further embodiment, the engineered nucleic acid sequence further comprises a sequence encoding a signal peptide. In one embodiment, the signal peptide comprises a sequence of aa 1 to aa 21 of SEQ ID NO: 1. In a further embodiment, the signal peptide coding sequence comprises nt 1 to nt 63 of SEQ ID NO: 3 or a sequence sharing a 95% to 99.9% identity thereto. In certain embodiments, the expression cassette is suitable for to be delivered to a target cell and expressing a functional hLDLR in the target cell. In one embodiment, the target cell is a liver cell.

As used herein, the term "target cell" refers to any cell in which expression of a functional hLDLR is desired. In certain embodiments, the term "target cell" is intended to reference the cells of the subject being treated for FH. Examples of target cells may include, but are not limited to, a liver cell, a heart cell, a muscle cell, a stem cell, or any other cells in a subject. In certain embodiments, the vector is delivered to a target cell ex vivo. In certain embodiments, the vector is delivered to the target cell in vivo.

In one embodiment, a liver cell refers to a hepatocyte which is a cell of the main parenchymal tissue of the liver. In another embodiment, a liver cell may be an epithelial cell in liver. In yet another embodiment, a liver cell may be a cell of the connective tissue in liver. In one embodiment, a liver cell is a sinusoidal endothelial cell. In another embodiment, a liver cell is a phagocytic Kupffer cell. In yet another embodiment, a liver cell is a hepatic stellate cells which are nonparenchymal cells found in the perisinusoidal space, between a sinusoid and a hepatocyte.

In certain embodiments, the regulatory sequences comprise a promoter. In one embodiment, the promoter is tissue-specific, optionally a liver-specific promoter. In another embodiment, the promoter is specific for inducing expression of a functional hLDLR in a target cell. In a further embodiment, the target cell is a liver cell. In one embodiment, the promoter is a human thyroxine binding globulin (TBG) promoter.

As used herein, the term “expression” refers to the process by which information from a nucleic acid molecule is used in the synthesis of a functional product. In one embodiment, the nucleic acid molecule is an engineered nucleic acid molecule as disclosed herein. In a further embodiment, the functional product may be a protein (for example, a functional hLDLR protein), a peptide, or a nucleic acid polymer (such as an RNA, a DNA or a PNA, for example, a messenger RNA encoding a functional hLDLR protein).

As used herein, an “expression cassette” refers to a nucleic acid polymer which comprises the coding sequences for a functional hLDLR protein and regulatory sequences operably linked thereto which direct expression of a functional hLDLR protein in a target cell.

As used herein, the term "regulatory sequence", or "expression control sequence" refers to nucleic acid sequences, such as initiator sequences, enhancer sequences, and promoter sequences, which induce, repress, or otherwise control the transcription of protein encoding nucleic acid sequences to which they are operably linked.

As used herein, the term "operably linked" to a protein of interest (such as a functional hLDLR) or “sequences which direct expression” of a protein of interest refers to both expression control sequences that are contiguous with the nucleic acid sequence encoding the protein of interest and/or expression control sequences that act in trans or at a distance to control the transcription and expression thereof.

The term "exogenous" as used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the position in which it exists in a chromosome, or host cell. An exogenous nucleic acid sequence also refers to a sequence derived from and inserted into the same target cell or subject, but which is present in a non-natural state, e.g. a different copy number, or under the control of different regulatory elements.

In certain embodiment, a constitutive promoter may be selected. In one embodiment, the promoter is a chicken b-actin promoter. A variety of chicken beta-actin promoters have been described alone, or in combination with various enhancer elements (e.g., CB7 is a chicken beta- actin promoter with cytomegalovirus enhancer elements; a CAG promoter, which includes the promoter, the first exon and first intron of chicken beta actin, and the splice acceptor of the rabbit beta-globin gene; a CBh promoter, SJ Gray et al, Hu Gene Ther, 2011 Sep; 22(9): 1143-1153). Alternatively, other constitutive promoters may be selected.

Suitable promoters may also be selected from a tissue-specific promoter (such as a liver- specific promoter) or an inducible/regulatory promoter. Examples of liver-specific promoters may include, e.g., thyroid hormone-binding globulin (TBG), albumin, Miyatake et al., (1997) J. Virol., 71:5124-32; hepatitis B virus core promoter, Sandig et al., (1996) Gene Ther., 3: 1002-9; or human alpha 1 -antitrypsin, phosphoenolpyruvate carboxykinase (PECK), or alpha-fetoprotein (AFP), Arbuthnot et al., (1996) Hum. Gene Ther., 7: 1503-14). Preferably, such promoters are of human origin.

Alternatively, a regulatable promoter may be selected. See, e.g., WO 2011/126808B2, incorporated by reference herein.

In certain embodiments, the regulatory sequences comprise one or more of a polyadenylation (polyA) sequence, an intron, and an enhancer.

In one embodiment, the regulatory sequence further comprises an enhancer. In one embodiment, the regulatory sequence comprises one enhancer. In another embodiment, the regulatory sequence contains two or more enhancers in tandem. These enhancers may be the same or may be different. For example, an enhancer may include an alpha- 1 mcroglobuliri/bikunin (alpha mic/bik or ABP) enhancer or a CMV enhancer. This enhancer may be present in two copies which are located adjacent to one another. Alternatively, the dual copies of the enhancer may be separated by one or more sequences.

In one embodiment, the regulatory sequence further comprises an intron. In one embodiment, the regulatory sequences comprise a human b-globin intron 2. In another embodiment, the intron is a chicken beta-actin intron. Other suitable introns include those known in the art may by a human b-globulin intron, and/or a commercially available Promega® intron, and those described in WO 2011/126808.

In one embodiment, the regulatory sequence further comprises a polyadenylation signal (polyA). In a further embodiment, the polyA is a rabbit globin poly A. See, e.g. , WO 2014/151341. In another embodiment, the polyA is a bovine growth hormone (bGH) polyA sequence. Alternatively, another polyA, e.g., a human growth hormone (hGH) polyadenylation sequence, an SV40 polyA, or a synthetic polyA may be included in an expression cassette.

In certain embodiments, provided is a vector genome comprising a nucleic acid sequence or an expression cassette as described herein. In one embodiment, the vector genome is suitable for packaged into a vector. In a further embodiment, the vector is a viral vector or a non-viral vector. In yet a further embodiment, the viral vector is an rAAV. In one embodiment, the vector genome comprises a sequence of SEQ ID NO: 5 or SEQ ID NO: 6.

As used herein, a “vector genome” refers to the nucleic acid sequence packaged inside a vector.

A “vector” as used herein is a biological or chemical moiety comprising a nucleic acid sequence (i.e., a vector genome) which can be introduced into an appropriate target cell for replication or expression of said nucleic acid sequence. Examples of a vector includes but not limited to a recombinant virus, a plasmid, Lipoplexes, a Polymersome, Polyplexes, a dendrimer, a cell penetrating peptide (CPP) conjugate, a magnetic particle, or a nanoparticle. In one embodiment, a vector is a nucleic acid molecule into which an exogenous or heterologous or engineered nucleic acid encoding a functional hLDLR protein may be inserted, which can then be introduced into an appropriate target cell. Such vectors preferably have one or more origin of replication, and one or more site into which the recombinant DNA can be inserted. Vectors often have means by which cells with vectors can be selected from those without, e.g., they encode drug resistance genes. Common vectors include plasmids, viral genomes, and "artificial chromosomes". Conventional methods of generation, production, characterization or quantification of the vectors are available to one of skill in the art.

In one embodiment, the vector is a non-viral plasmid that comprises an expression cassette or a vector genome as described, e.g., “naked DNA”, “naked plasmid DNA”, RNA, and mRNA; coupled with various compositions and nano particles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and/or cholesterol-based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su et al, Mol. Pharmaceutics, 2011, 8 (3), pp 774-787; web publication: March 21, 2011; WO2013/182683, WO 2010/053572 and WO 2012/170930, all of which are incorporated herein by reference.

In certain embodiments, the vector described herein is a “replication-defective virus" or a “viral vector” which refers to a synthetic or artificial viral particle in which an expression cassette containing a nucleic acid sequence encoding a functional hLDLR is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be "gutless" - containing only the nucleic acid sequence encoding a functional hLDLR flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication.

As used herein, a viral vector is an rAAV, an adenovirus, a bocavirus, a hybrid AAV/bocavirus, a herpes simplex virus, or a lentivirus.

B. AAV

In one aspect, provided herein is a recombinant adeno-associated viral particle (rAAV) comprising an AAV capsid and a vector genome packaged therein.

The vector genome comprises inverted terminal repeats (ITRs) and an engineered nucleic acid sequence as described herein. In one embodiment, the vector genome comprises an AAV 5 ’ ITR, an expression cassette as described herein, and an AAV 3’ ITR. In one embodiment, the vector genome is as described in Section A of this application and/or in the examples. In one embodiment, the engineered nucleic acid sequence comprises a sequence encoding at least a signal peptide and a functional human low-density lipoprotein receptor (hLDLR) under control of regulatory sequences which direct the hLDLR expression. The functional hLDLR protein is as disclosed herein, for example, comprising an amino acid sequence of amino acid (aa) 22 to aa 860 of SEQ ID NO: 1 or an amino acid sequence of aa 22 to aa 860 of SEQ ID NO: 2. In a further embodiment, the functional hLDLR coding sequence comprises a sequence of nucleotide (nt) 64 to nt 2580 of SEQ ID NO: 3 or a sequence sharing a 95% to 99.9% identity thereto. In one embodiment, the hLDLR coding sequence comprises a sequence of nt 64 to nt 2580 of SEQ ID NO: 3. In another embodiment, the functional hLDLR coding sequence comprises a sequence of nt 64 to nt 2580 of SEQ ID NO: 4.

The ITRs are the genetic elements responsible for the replication and packaging of the genome during vector production and are the only viral cis elements required to generate rAAV.

In one embodiment, the ITRs are from an AAV different than that supplying a capsid. In a preferred embodiment, the ITR sequences from AAV2, or the deleted version thereof ( \ITR). which may be used for convenience and to accelerate regulatory approval. However, ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped. Typically, AAV vector genome comprises an AAV 5’ ITR, a functional hLDLR coding sequences and any regulatory sequences, and an AAV 3 ’ ITR. However, other configurations of these elements may be suitable. A shortened version of the 5’ ITR, termed \ITR. has been described in which the D- sequence and terminal resolution site (trs) are deleted. In other embodiments, the full-length AAV 5’ and 3’ ITRs are used.

In certain embodiments, the signal peptide comprises a sequence of aa 1 to aa 21 of SEQ ID NO: 1. In a further embodiment, the signal peptide coding sequence comprises nt 1 to nt 63 of SEQ ID NO: 3 or a sequence sharing a 95% to 99.9% identity thereto.

In certain embodiments, the rAAV is suitable for delivery the vector genome in a target cell. In a further embodiment, the rAAV is suitable for expressing a functional hLDLR in a target cell. In one embodiment, the target cell is a liver cell.

In certain embodiment, the regulatory sequences are suitable for expressing a functional hLDLR in a target cell. In a further embodiment, the target cell is a liver cell. In one embodiment, the regulatory sequences comprise a promoter. In a further embodiment, the promoter is a liver specific promoter. In yet a further embodiment, the promoter is a Human thyroxine binding globulin (TBG) promoter. In a further embodiment, the TBG promoter comprises a sequence of nt 415 to nt 874 of SEQ ID NO: 5 or 6. In certain embodiments, the regulatory sequences further comprise one or more of a polyadenylation (poly A) sequence, an intron, and an enhancer. In one embodiment, the regulatory sequences comprise multiple enhancers in tandem. In one embodiment, the regulatory sequences comprise an alpha- 1 microglobuliri/bikunin (ABP) enhancer. In a further embodiment, the ABP enhancer comprises a sequence of nt 195 to nt 294 or nt 301 to nt 400 of SEQ ID NO: 5 or 6. Additionally or alternatively, the regulatory sequences comprise a human b-globin intron 2 (IVS2 intron). In a further embodiment, the IVS2 intron comprises a sequence of nt 894 to nt 1465 of SEQ ID NO: 5 or 6. In certain embodiments, the regulatory sequences comprise a bovine growth hormone (bGH) polyA sequence. In a further embodiment, the bGH polyA comprises a sequence of nt 4093 to nt 4307 of SEQ ID NO: 5 or 6. In one embodiment, the vector genome comprises a sequence of SEQ ID NO: 5 or SEQ ID NO:

6. In another embodiment, the vector genome comprises a sequence which is 95 % to 99.9 % identical to SEQ ID NO: 5 or 6, wherein the vector genome comprising a functional hLDLR coding sequence as disclosed herein under control of regulatory sequences which direct expression thereof in a target cell.

In certain embodiments, the AAV capsid have a tropism to a target cell or tissue. In a further embodiment, the target cell may be a liver cell or a non-liver cell, such as a heart cell, or a muscle cell. In another embodiment, the target tissue is a liver tissue or a non-liver tissue, including but not limited to a heart tissue, or a muscle tissue. In one embodiment, the AAV capsid has a liver tropism. Additionally or alternatively, the AAV capsid has a lower immunogenicity compared to an AAV8 capsid and/or an AAV3B capsid. In certain embodiments, the AAV capsid is an AAV3B variant capsid. In one embodiment, the AAV capsid is an AAV3B.AR2.08 capsid. In another embodiment, the AAV capsid is an AAV3B.AR2.16 capsid.

As used herein, the term “immunogenicity” means the ability of a particular substance, such as an antigen or epitope or an antigen or epitope in an AAV capsid or a functional hLDLR protein, to provoke an immune response in a subject (such as a human subject). In other words, immunogenicity is the ability to induce a humoral and/or cell-mediated immune responses, with or without a reduced immune suppression.

In one embodiment, the rAAV as described herein is a self-complementary AAV. “Self complementary AAV” or “scAAV” refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double- stranded DNA template. Upon infection, rather than waiting for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, e.g.,

D M McCarty et al, “Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis”, Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described in, e.g., U.S. Patent Nos. 6,596,535; 7,125,717; and 7,456,683, each of which is incorporated herein by reference in its entirety.

In certain embodiments, the rAAV described herein is nuclease-resistant. Such nuclease may be a single nuclease, or mixtures of nucleases, and may be endonucleases or exonucleases. A nuclease-resistant rAAV indicates that the AAV capsid has fully assembled and protects these packaged genomic sequences from degradation (digestion) during nuclease incubation steps designed to remove contaminating nucleic acids which may be present from the production process. In many instances, the rAAV described herein is DNase resistant.

An AAV capsid is an assembly of a heterogeneous population of vpl, a heterogeneous population of vp2, and a heterogeneous population of vp3 proteins. As used herein when used to refer to vp capsid proteins, the term “heterogeneous” or any grammatical variation thereof, refers to a population consisting of elements that are not the same, for example, having vpl, vp2 or vp3 monomers (proteins) with different modified amino acid sequences.

As used herein, the term “heterogeneous population” as used in connection with vpl, vp2 and vp3 proteins (alternatively termed isoforms), refers to differences in the amino acid sequence of the vpl, vp2 and vp3 proteins within a capsid. The AAV capsid contains subpopulations within the vpl proteins, within the vp2 proteins and within the vp3 proteins which have modifications from the predicted amino acid residues. These subpopulations include, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations comprise at least one, two, three or four highly deamidated asparagines (N) positions in asparagine - glycine pairs and optionally further comprising other deamidated amino acids, wherein the deamidation results in an amino acid change and other optional modifications.

As used herein, a “subpopulation” of vp proteins refers to a group of vp proteins which has at least one defined characteristic in common and which consists of at least one group member to less than all members of the reference group, unless otherwise specified. For example, a “subpopulation” of vpl proteins may be at least one (1) vpl protein and less than all vpl proteins in an assembled AAV capsid, unless otherwise specified. A “subpopulation” of vp3 proteins may be one (1) vp3 protein to less than all vp3 proteins in an assembled AAV capsid, unless otherwise specified. For example, vpl proteins may be a subpopulation of vp proteins; vp2 proteins may be a separate subpopulation of vp proteins, and vp3 are yet a further subpopulation of vp proteins in an assembled AAV capsid. In another example, vpl, vp2 and vp3 proteins may contain subpopulations having different modifications, e.g., at least one, two, three or four highly deamidated asparagines, e.g., at asparagine - glycine pairs.

Unless otherwise specified, highly deamidated refers to at least 45% deamidated, at least 50% deamidated, at least 60% deamidated, at least 65% deamidated, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or up to about 100% deamidated at a referenced amino acid position, as compared to the predicted amino acid sequence at the reference amino acid position. Such percentages may be determined using 20- gel, mass spectrometry techniques, or other suitable techniques.

Without wishing to be bound by theory, the deamidation of at least highly deamidated residues in the vp proteins in the AAV capsid is believed to be primarily non-enzymatic in nature, being caused by functional groups within the capsid protein which deamidate selected asparagines, and to a lesser extent, glutamine residues. Efficient capsid assembly of the majority of deamidation vpl proteins indicates that either these events occur following capsid assembly or that deamidation in individual monomers (vpl, vp2 or vp3) is well-tolerated structurally and largely does not affect assembly dynamics. Extensive deamidation in the VP 1-unique (VPl-u) region (~aa 1-137), generally considered to be located internally prior to cellular entry, suggests that VP deamidation may occur prior to capsid assembly. The deamidation of N may occur through its C-terminus residue’s backbone nitrogen atom conducts a nucleophilic attack to the Asn's side chain amide group carbon atom. An intermediate ring-closed succinimide residue is believed to form. The succinimide residue then conducts fast hydrolysis to lead to the final product aspartic acid (Asp) or iso aspartic acid (IsoAsp). Therefore, in certain embodiments, the deamidation of asparagine (N or Asn) leads to an Asp or IsoAsp, which may interconvert through the succinimide intermediate.

As provided herein, each deamidated N in the VP1, VP2 or VP3 may independently be aspartic acid (Asp), isoaspartic acid (isoAsp), aspartate, and/or an interconverting blend of Asp and isoAsp, or combinations thereof. Any suitable ratio of a- and isoaspartic acid may be present. For example, in certain embodiments, the ratio may be from 10: 1 to 1:10 aspartic to isoaspartic, about 50:50 aspartic: isoaspartic, or about 1:3 aspartic: isoaspartic, or another selected ratio. In certain embodiments, one or more glutamine (Q) may deamidates to glutamic acid (Glu), i.e., a- glutamic acid, g-glutamic acid (Glu), or a blend of a- and g-glutamic acid, which may interconvert through a common glutarinimide intermediate. Any suitable ratio of a- and g- glutamic acid may be present. For example, in certain embodiments, the ratio may be from 10:1 to 1:10 a to g, about 50:50 a: g, or about 1:3 a : g, or another selected ratio.

Thus, an rAAV includes subpopulations within the rAAV capsid of vpl, vp2 and/or vp3 proteins with deamidated amino acids, including at a minimum, at least one subpopulation comprising at least one highly deamidated asparagine. In addition, other modifications may include isomerization, particularly at selected aspartic acid (D or Asp) residue positions. In still other embodiments, modifications may include an amidation at an Asp position.

In certain embodiments, an AAV capsid contains subpopulations of vpl, vp2 and vp3 having at least 1, at least 2, at least 3, at least 4, at least 5 to at least about 25 deamidated amino acid residue positions, of which at least 1 to 10%, at least 10 to 25%, at least 25 to 50%, at least 50 to 70%, at least 70 to 100%, at least 75 to 100%, at least 80-100% or at least 90-100% are deamidated as compared to the encoded amino acid sequence of the vp proteins. The majority of these may be N residues. However, Q residues may also be deamidated.

As used herein, “encoded amino acid sequence” refers to the amino acid which is predicted based on the translation of a known DNA codon of a referenced nucleic acid sequence being translated to an amino acid. The following table illustrates DNA codons and twenty common amino acids, showing both the single letter code (SLC) and three letter code (3LC).

In certain embodiments, an rAAV has an AAV capsid having vpl, vp2 and vp3 proteins having subpopulations comprising combinations of two, three, four, five or more deamidated residues at the positions set forth in the tables provided herein and incorporated herein by reference. Deamidation in the rAAV may be determined using 2D gel electrophoresis, and/or mass spectrometry, and/or protein modelling techniques. Online chromatography may be performed with an Acclaim PepMap column and a Thermo UltiMate 3000 RSLC system (Thermo Fisher Scientific) coupled to a Q Exactive HF with a NanoFlex source (Thermo Fisher Scientific). MS data is acquired using a data-dependent top-20 method for the Q Exactive HF, dynamically choosing the most abundant not-yet-sequenced precursor ions from the survey scans (200-2000 m/z). Sequencing is performed via higher energy collisional dissociation fragmentation with a target value of le5 ions determined with predictive automatic gain control and an isolation of precursors was performed with a window of 4 m/z. Survey scans were acquired at a resolution of 120,000 at m/z 200. Resolution for HCD spectra may be set to 30,000 at m/z200 with a maximum ion injection time of 50 ms and a normalized collision energy of 30. The S-lens RF level may be set at 50, to give optimal transmission of the m/z region occupied by the peptides from the digest. Precursor ions may be excluded with single, unassigned, or six and higher charge states from fragmentation selection. BioPharma Finder 1.0 software (Thermo Fischer Scientific) may be used for analysis of the data acquired. For peptide mapping, searches are performed using a single-entry protein FASTA database with carbamidomethylation set as a fixed modification; and oxidation, deamidation, and phosphorylation set as variable modifications, a 10-ppm mass accuracy, a high protease specificity, and a confidence level of 0.8 for MS/MS spectra. Examples of suitable proteases may include, e.g., trypsin or chymotrypsin. Mass spectrometric identification of deamidated peptides is relatively straightforward, as deamidation adds to the mass of intact molecule +0.984 Da (the mass difference between -OH and -NH2 groups). The percent deamidation of a particular peptide is determined by mass area of the deamidated peptide divided by the sum of the area of the deamidated and native peptides. Considering the number of possible deamidation sites, isobaric species which are deamidated at different sites may co-migrate in a single peak. Consequently, fragment ions originating from peptides with multiple potential deamidation sites can be used to locate or differentiate multiple sites of deamidation. In these cases, the relative intensities within the observed isotope patterns can be used to specifically determine the relative abundance of the different deamidated peptide isomers. This method assumes that the fragmentation efficiency for all isomeric species is the same and independent on the site of deamidation. It will be understood by one of skill in the art that a number of variations on these illustrative methods can be used. For example, suitable mass spectrometers may include, e.g, a quadrupole time of flight mass spectrometer (QTOF), such as a Waters Xevo or Agilent 6530 or an orbitrap instrument, such as the Orbitrap Fusion or Orbitrap Velos (Thermo Fisher). Suitably liquid chromatography systems include, e.g., Acquity UPLC system from Waters or Agilent systems (1100 or 1200 series). Suitable data analysis software may include, e.g., MassLynx (Waters), Pinpoint and Pepfmder (Thermo Fischer Scientific), Mascot (Matrix Science), Peaks DB (Bioinformatics Solutions). Still other techniques may be described, e.g., in X. Jin et al, Hu Gene Therapy Methods, Vol. 28, No. 5, pp. 255-267, published online June 16, 2017.

In addition to deamidations, other modifications may occur do not result in conversion of one amino acid to a different amino acid residue. Such modifications may include acetylated residues, isomerizations, phosphorylations, or oxidations.

Modulation of Deamidation: In certain embodiments, the AAV is modified to change the glycine in an asparagine-glycine pair, to reduce deamidation. In other embodiments, the asparagine is altered to a different amino acid, e.g., a glutamine which deamidates at a slower rate; or to an amino acid which lacks amide groups (e.g., glutamine and asparagine contain amide groups); and/or to an amino acid which lacks amine groups (e.g., lysine, arginine and histidine contain amine groups). As used herein, amino acids lacking amide or amine side groups refer to, e.g., glycine, alanine, valine, leucine, isoleucine, serine, threonine, cystine, phenylalanine, tyrosine, or tryptophan, and/or proline. Modifications such as described may be in one, two, or three of the asparagine-glycine pairs found in the encoded AAV amino acid sequence. In certain embodiments, such modifications are not made in all four of the asparagine - glycine pairs. Thus, a method for reducing deamidation of AAV and/or engineered AAV variants having lower deamidation rates. Additionally, or alternatively one or more other amide amino acids may be changed to a non-amide amino acid to reduce deamidation of the AAV. In certain embodiments, a mutant AAV capsid as described herein contains a mutation in an asparagine - glycine pair, such that the glycine is changed to an alanine or a serine. A mutant AAV capsid may contain one, two or three mutants where the reference AAV natively contains four NG pairs. In certain embodiments, an AAV capsid may contain one, two, three or four such mutants where the reference AAV natively contains five NG pairs. In certain embodiments, a mutant AAV capsid contains only a single mutation in an NG pair. In certain embodiments, a mutant AAV capsid contains mutations in two different NG pairs. In certain embodiments, a mutant AAV capsid contains mutation is two different NG pairs which are located in structurally separate location in the AAV capsid. In certain embodiments, the mutation is not in the VP 1 -unique region. In certain embodiments, one of the mutations is in the VP 1 -unique region. Optionally, a mutant AAV capsid contains no modifications in the NG pairs, but contains mutations to minimize or eliminate deamidation in one or more asparagines, or a glutamine, located outside of an NG pair.

In certain embodiments, a method of increasing the potency of a rAAV vector is provided which comprises engineering an AAV capsid which eliminating one or more of the NGs in the wild-type AAV capsid. In certain embodiments, the coding sequence for the “G” of the “NG” is engineered to encode another amino acid. In certain examples below, an “S” or an “A” is substituted. However, other suitable amino acid coding sequences may be selected.

These amino acid modifications may be made by conventional genetic engineering techniques. For example, a nucleic acid sequence containing modified AAV vp codons may be generated in which one to three of the codons encoding glycine in arginine - glycine pairs are modified to encode an amino acid other than glycine. In certain embodiments, a nucleic acid sequence containing modified arginine codons may be engineered at one to three of the arginine - glycine pairs, such that the modified codon encodes an amino acid other than arginine. Each modified codon may encode a different amino acid. Alternatively, one or more of the altered codons may encode the same amino acid. In certain embodiments, these modified nucleic acid sequences may be used to generate a mutant rAAV having a capsid with lower deamidation than the native AAV3B variant capsid. Such mutant rAAV may have reduced immunogenicity and/or increase stability on storage, particularly storage in suspension form.

Also provided herein are nucleic acid sequences encoding the AAV capsids having reduced deamidation. It is within the skill in the art to design nucleic acid sequences encoding this AAV capsid, including DNA (genomic or cDNA), or RNA (e.g., mRNA). Such nucleic acid sequences may be codon-optimized for expression in a selected system (i.e., cell type) and can be designed by various methods. This optimization may be performed using methods which are available on-line (e.g., GeneArt), published methods, or a company which provides codon optimizing services, e.g., DNA2.0 (Menlo Park, CA). One codon optimizing method is described, e.g., in International Patent Publication No. WO 2015/012924, which is incorporated by reference herein in its entirety. See also, e.g., US Patent Publication No. 2014/0032186 and US Patent Publication No. 2006/0136184. Suitably, the entire length of the open reading frame (ORF) for the product is modified. However, in some embodiments, only a fragment of the ORF may be altered. By using one of these methods, one can apply the frequencies to any given polypeptide sequence and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide. A number of options are available for performing the actual changes to the codons or for synthesizing the codon-optimized coding regions designed as described herein.

Such modifications or synthesis can be performed using standard and routine molecular biological manipulations well known to those of ordinary skill in the art. In one approach, a series of complementary oligonucleotide pairs of 80-90 nucleotides each in length and spanning the length of the desired sequence are synthesized by standard methods. These oligonucleotide pairs are synthesized such that upon annealing, they form double stranded fragments of 80-90 base pairs, containing cohesive ends, e.g., each oligonucleotide in the pair is synthesized to extend 3,

4, 5, 6, 7, 8, 9, 10, or more bases beyond the region that is complementary to the other oligonucleotide in the pair. The single-stranded ends of each pair of oligonucleotides are designed to anneal with the single-stranded end of another pair of oligonucleotides. The oligonucleotide pairs are allowed to anneal, and approximately five to six of these double-stranded fragments are then allowed to anneal together via the cohesive single stranded ends, and then they ligated together and cloned into a standard bacterial cloning vector, for example, a TOPO^® vector available from Invitrogen Corporation, Carlsbad, Calif. The construct is then sequenced by standard methods. Several of these constructs consisting of 5 to 6 fragments of 80 to 90 base pair fragments ligated together, i.e., fragments of about 500 base pairs, are prepared, such that the entire desired sequence is represented in a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and ligated together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector, and sequenced. Additional methods would be immediately apparent to the skilled artisan. In addition, gene synthesis is readily available commercially.

In certain embodiments, AAV capsids are provided which have a heterogeneous population of AAV capsid isoforms (i.e., VP1, VP2, VP3) which contain multiple highly deamidated “NG” positions. In certain embodiments, the highly deamidated positions are in the locations identified below, with reference to the predicted full-length VP1 amino acid sequence. In other embodiments, the capsid gene is modified such that the referenced “NG” is ablated and a mutant “NG” is engineered into another position.

As used herein, the term "target tissue" can refer to any cell or tissue which is intended to be transduced by the subject AAV vector. The term may refer to any one or more of muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (ocular cells), or heart. In one embodiment, the target tissue is liver.

AAV3B VP 1 was aligned with that of 180 other AAVs, and 10 amino acids between 582- 594 were chosen based on their variability among the aligned sequences. In order to maximize the viability of the mutant, degenerate codons were designed with the intention to introduce alternative amino acids appeared in other AAVs at the aligned position. Thus, provided herein are AAV3B variants having mutations in aa 582-594 (of the native AAV3B sequence - SEQ ID NO: 10), encoded by positions nt 1744 to nt 1783 (of the native AAV3B sequence - SEQ ID NO: 11).

Provided herein are novel AAV3B variant VP1, VP2, and VP3 capsid proteins. The full length vpl sequences are set forth in the Sequence Listing: AAV3B.AR2.01 (SEQ ID NO: 12), AAV3B.AR2.02 (SEQ ID NO: 14), AAV3B.AR2.03 (SEQ ID NO: 16), AAV3B.AR2.04 (SEQ ID NO: 18), AAV3B.AR2.05 (SEQ ID NO: 20), AAV3B.AR2.06 (SEQ ID NO: 22), AAV3B.AR2.07 (SEQ ID NO: 24), AAV3B.AR2.08 (SEQ ID NO: 26), AAV3B.AR2.10 (SEQ ID NO: 28), AAV3B.AR2.11 (SEQ ID NO: 30), AAV3B.AR2.12 (SEQ ID NO: 32), AAV3B.AR2.13 (SEQ ID NO: 34), AAV3B.AR2.14 (SEQ ID NO: 36), AAV3B.AR2.15 (SEQ ID NO: 38), AAV3B.AR2.16 (SEQ ID NO: 40), or AAV3B.AR2.17 (SEQ ID NO: 42). In the examples below, AAV3B.AR.08 and AAV3B.AR.16 have been observed to transduce well in human liver (hepatocytes). In one embodiment, an rAAV having an AAV3B.AR.08 capsid and a vector genome encoding hLDLR is provided. In another embodiment, a rAAV having an AAV3B.AR.016 capsid and a vector genome encoding hLDLR is provided.

The AAV capsid consists of three overlapping coding sequences, which vary in length due to alternative start codon usage. These variable proteins are referred to as VP1, VP2 and VP3, with VP 1 being the longest and VP3 being the shortest. The AAV particle consists of all three capsid proteins at a ratio of ~L 1: 10 (VPLVP2:VP3). VP3, which is comprised in VP1 and VP2 at the N-terminus, is the main structural component that builds the particle. The capsid protein can be referred to using several different numbering systems. For convenience, as used herein, the AAV sequences are referred to using VP 1 numbering, which starts with aa 1 for the first residue of VP1. However, the capsid proteins described herein include VP1, VP2 and VP3 (used interchangeably herein with vpl, vp2 and vp3). The numbering of the variable proteins (vp) of the capsids of the invention are as follows:

Nucleotides (nt)

All engineered AAV3B variants: aa vpl - nt 1 to nt 2211; vp2 - nt 412 to nt 2211; vp3 - nt 607 to nt 2211 are identified by their respective SEQ ID Nos and using the native AAV3B as a reference (SEQ ID NO: 10).

Provided herein are engineered AAV3B variants VP1 nucleic acid sequences encoding amino acid si to 736; VP2 nucleic acid sequences encoding aa 138 to 736; and/or VP3 nucleic acid sequences encoding aa 203 to 736 of their respective SEQ ID Nos and using the native AAV3B as a reference (SEQ ID NO: 10). In one embodiment, an AAV3B.AR2.08 VP1 nucleic acid sequence encodes amino acids about 1 to about 736 of SEQ ID NO: 26 (VP1) and also produced the VP2 (amino acids about 138 to about 736) and VP3 proteins (amino acids about 203 to about 736) of SEQ ID NO: 26. In certain embodiments, the AAV3B.AR2.08 VP1 nucleic acid sequence is the full-length of SEQ ID NO: 27, or a sequence at least 90% identical, at least 95%, at least 97%, at least 98% or at least 99% identity over the consecutive nucleotide sequence of about nt 1 to about 2211 of SEQ ID NO: 27. In certain embodiments, the AAV3B.AR2.08 VP2 nucleic acid sequence is the full-length of SEQ ID NO: 27, or a sequence at least 90% identical, at least 95%, at least 97%, at least 98% or at least 99% identity over the consecutive nucleotide sequence of about nt 412 to about 2211 of SEQ ID NO: 27. In certain embodiments, the AAV3B.AR2.08 VP3 nucleic acid sequence is the full-length of SEQ ID NO: 27, or a sequence at least 90% identical, at least 95%, at least 97%, at least 98% or at least 99% identity over the consecutive nucleotide sequence of about nt 607 to about 2211 of SEQ ID NO: 27. In certain embodiments, for sequences having the recited identity to SEQ ID NO: 27, the nucleic acids in the region of nt 1744 to 1783 encode the amino acids at positions 582 to 594 of AAV3B.AR2.08 of SEQ ID NO: 26. In other embodiments, the sequences within the recited identity encode the full-length VP1, VP2 or VP3 of SEQ ID NO: 26.

In another embodiment, a AAV3B.AR2.16 VP1 nucleic acid sequence encodes amino acids about 1 to about 736 of SEQ ID NO: 40 (VP1) and also produced the VP2 (amino acids about 138 to about 736) and VP3 proteins (amino acids about 203 to about 736) of SEQ ID NO: 40. In certain embodiments, the AAV3B.AR2.16 VP1 nucleic acid sequence is the full-length of SEQ ID NO: 41, or a sequence at least 90% identical, at least 95%, at least 97%, at least 98% or at least 99% identity over the consecutive nucleotide sequence of about nt 1 to about 2211 of SEQ ID NO: 41. In certain embodiments, the AAV3B.AR2.16 VP2 nucleic acid sequence is the full-length of SEQ ID NO: 41, or a sequence at least 90% identical, at least 95%, at least 97%, at least 98% or at least 99% identity over the consecutive nucleotide sequence of about nt 412 to about 2211 of SEQ ID NO: 41. In certain embodiments, the AAV3B.AR2.16 VP3 nucleic acid sequence is the full-length of SEQ ID NO: 41, or a sequence at least 90% identical, at least 95%, at least 97%, at least 98% or at least 99% identity over the consecutive nucleotide sequence of about nt 607 to about 2211 of SEQ ID NO: 41. In certain embodiments, an AAV3B.AR.16 nucleic acid sequence encoding SEQ ID NO: 41 is provided for use in producing an AAV capsid and packing a vector genome to form a rAAV3B.AR2.16 rAAV particle. In certain embodiments, the AAV3B.AR2.16 nucleic acid sequence has the sequence of SEQ ID NO: 41 or a sequence at least 90% identical, at least 95%, at least 97%, at least 98% or at least 99% identity thereto. In certain embodiments, for sequences having the recited identity to SEQ ID NO: 41, the nucleic acids in the region of nt 1744 to 1783 encode the amino acids at positions 582 to 594 of AAV3B.AR2.16 of SEQ ID NO: 40. In other embodiments, the sequences within the recited identity encode the full-length VP1, VP2 or VP3 of SEQ ID NO: 40. Amino acids (aa)

All engineered AAV3B variants: aa vpl - aa 1 to aa 736; vp2 - aa 138 to 736; vp3 - aa 203 to 736 are identified by their respective SEQ ID Nos and using the native AAV3B as a reference (SEQ ID NO: 11).

In one embodiment, the AAV3B variant capsid is produced from a nucleic acid sequence encoding the VP1 amino acid sequence of AAV3B.AR2.08 (SEQ ID NO: 26, about amino acid 1 to about amino acid 736), or a sequence having at least 95% identity, at least 97% identity, or at least 99% identity therewith in which the amino acids in positions 582 to 594 of SEQ ID NO: 26 are retained. In certain embodiments, the nucleic acid sequence encoding the VP2-specific amino acid sequence (about amino acid 138 to about amino acid 736) and/or the VP3-specific amino acid sequence (about amino acid 203 to about amino acid 736) is additionally or alternatively used in production. In certain embodiments, an AAV3B variant capsid (AAV3B.AR2.08) comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 26, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 26, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 26.

In another embodiment, the AAV3B variant capsid is produced from a nucleic acid sequence encoding the VP1 amino acid sequence of AAV3B.AR2.16 (SEQ ID NO: 40) , or a sequence having at least 95% identity, at least 97% identity, or at least 99% identity therewith in which the amino acids in positions 582 to 594 of SEQ ID NO: 40 are retained. In certain embodiments, the nucleic acid sequence encoding the VP2-specific amino acid sequence (about amino acid 138 to about amino acid 736) and/or the VP3-specific amino acid sequence (about amino acid 203 to about amino acid 736) is additionally or alternatively used in production.

Particularly desirable rAAV capsids include the engineered AAV3B capsid AAV3B.AR2.08, expressed from the nucleic acid sequence of SEQ ID NO: 26, or a sequence at least 95% identical thereto which encodes the predicted amino acid sequence of AAV3B.AR2.08 (SEQ ID NO: 27). or the engineered AAV3B.AR2.16, expressed from the nucleic acid sequence of SEQ ID NO: 41, or a sequence at least 95% identical thereto which encodes the predicted amino acid sequence of AAV3B.AR2.16 (SEQ ID NO: 40). See, US Patent Application No. 62/924,112, filed October 21, 2019 and US Patent Application No. 63/025,753, filed Mary 15, 2020

In certain embodiments, nucleic acid sequences encoding mutant AAV3B.AR2.08 are provided for generating a suitable capsid, in which one or more residues has been altered in order to decrease deamidation, or other modifications which are identified herein. Such nucleic acid sequences can be used in production of mutant AAV3B.AR2.08 capsids.

In certain embodiments, nucleic acid sequences encoding mutant AAV3B.AR2.16 are provided for generating a suitable capsid, in which one or more residues has been altered in order to decrease deamidation, or other modifications which are identified herein. Such nucleic acid sequences can be used in production of mutant AAV3B.AR2.16 capsids.

However, other engineered AAV3B variants may be selected. Such rAAV comprise at least one of the vpl, vp2 and the vp3 proteins with amino acid sequence of any of AAV3B.AR2.01 (SEQ ID NO: 12), AAV3B.AR2.02 (SEQ ID NO: 14), AAV3B.AR2.03 (SEQ ID NO: 16), AAV3B.AR2.04 (SEQ ID NO: 18), AAV3B.AR2.05 (SEQ ID NO: 20), AAV3B.AR2.06 (SEQ ID NO: 22), AAV3B.AR2.07 (SEQ ID NO: 24), , AAV3B.AR2.10 (SEQ ID NO: 28), AAV3B.AR2.11 (SEQ ID NO: 30), AAV3B.AR2.12 (SEQ ID NO: 32), AAV3B.AR2.13 (SEQ ID NO: 34), AAV3B.AR2.14 (SEQ ID NO: 36), AAV3B.AR2.15 (SEQ ID NO: 38), or AAV3B.AR2.17 (SEQ ID NO: 42). Also provided herein are rAAV comprising AAV capsids encoded by at least one of the vpl, vp2 and the vp3 proteins of any nucleic acid sequence of AAV3B.AR2.01 (SEQ ID NO: 13), AAV3B.AR2.02 (SEQ ID NO: 15), AAV3B.AR2.03 (SEQ ID NO: 17), AAV3B.AR2.04 (SEQ ID NO: 19), AAV3B.AR2.05 (SEQ ID NO: 21), AAV3B.AR2.06 (SEQ ID NO: 23), AAV3B.AR2.07 (SEQ ID NO: 25), AAV3B.AR2.10 (SEQ ID NO: 29), AAV3B.AR2.11 (SEQ ID NO: 31), AAV3B.AR2.12 (SEQ ID NO: 33), AAV3B.AR2.13 (SEQ ID NO: 35), AAV3B.AR2.14 (SEQ ID NO: 37), AAV3B.AR2.15 (SEQ ID NO: 39), , or AAV3B.AR2.17 (SEQ ID NO: 43). See, US Patent Application No. 62/924,112, filed October 21, 2019 and US Patent Application No. 63/025,753, filed Mary 15, 2020.

Optionally, other AAV sources may be selected for the AAV capsid. Suitable capsids include those which enable targeting of the liver (e.g., hepatocytes). For example, as used herein, “AAV 8 capsid” refers to the AAV 8 capsid having the encoded amino acid sequence of GenBank accession:YP_077180, which is incorporated by reference herein, and reproduced in SEQ ID NO: 8, and/or an amino acid sequence encoded by a nucleic acid sequence which is reproduced herein as SEQ ID NO: 9. Some variation from this encoded sequence is encompassed by the present invention, which may include sequences having about 99% identity to the referenced amino acid sequence in GenBank accession: YP_077180; US Patent 7,282,199, US Patent 7,790,449;

US Patent 8,319,480; US Patent 8,962,330; US Patent 8,962,332, (i.e., less than about 1% variation from the referenced sequence). In another embodiment, the AAV8 capsid may have the VP1 sequence of the AAV8 variant described in WO2014/124282 or the sequence described in US 2013/0059732 A1 or US7588772 B2, which are incorporated by reference herein. Methods of generating the capsid, coding sequences therefore, and methods for production of rAAV viral vectors have been described. See, e.g., Gao, et al, Proc. Natl. Acad. Sci. U.S.A. 100 (10), 6081- 6086 (2003), US 2013/0045186A1, and WO 2014/124282. Other rAAV vectors with liver tropism may be selected as sources for capsids of rAAV, optional for the repeat therapy as described herein, including clade E capsids such as, e.g., rhlO, AAVrh64Rl, AAVrh64R2, rh8 (See, e.g., US Published Patent Application No. 2007-0036760-A1; US Published Patent Application No. 2009-0197338-A1; EP 1310571] See also, WO 2003/042397 (AAV7 and other simian AAV), US Patent 7790449 and US Patent 7282199 (AAV8), WO 2005/033321, AAVhu37, and US 7,906,111 (AAV9), WO 2006/110689 and WO 2003/042397 (rhlO), AAV3B; US 2010/0047174 (AAV-DJ). See, also, PCT US20/30273, filed April 28, 2020 (AAVrh90, Clade E). Although less desirable, AAV may be selected. See, e.g., PCT US20/30281, filed April 28, 2020 (rh92, rh93, rh91.93), and PCT US20/30266, filed April 28, 2020. Still other AAV or other parvovirus capsid sources (e.g., bocavirus) may be selected from AAV Clade E or other AAV clades, or other parvovirus capsids.

In one embodiment, a composition is provided which includes a mixed population of recombinant adeno-associated virus (rAAV), each of said rAAV comprising: (a) an AAV capsid comprising about 60 capsid proteins made up of vpl proteins, vp2 proteins and vp3 proteins, wherein the vpl, vp2 and vp3 proteins are: a heterogeneous population of vpl proteins which are produced from a nucleic acid sequence encoding a selected AAV vpl amino acid sequence, a heterogeneous population of vp2 proteins which are produced from a nucleic acid sequence encoding a selected AAV vp2 amino acid sequence, a heterogeneous population of vp3 proteins which produced from a nucleic acid sequence encoding a selected AAV vp3 amino acid sequence, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in the AAV capsid and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (b) a vector genome in the AAV capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non- AAV nucleic acid sequence encoding a product (for example, a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell.

In certain embodiments, the deamidated asparagines are deamidated to aspartic acid, isoaspartic acid, an interconverting aspartic acid/isoaspartic acid pair, or combinations thereof. In certain embodiments, the capsid further comprises deamidated glutamine(s) which are deamidated to (a)-glutamic acid, g-glutamic acid, an interconverting (a)-glutamic acid/ g- glutamic acid pair, or combinations thereof.

In certain embodiments, AAV3B.AR2.08 capsid is selected for use in an rAAV. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 27 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 26. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.08 (SEQ ID NO: 26). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 607 to nt 2211) and the vp3 (nt 412 to nt 2211) of AAV3B.AR2.08 (SEQ ID NO: 27).

In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.08 capsid comprising one or more of: (1) AAV3B.AR2.08 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.08 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 26, vpl proteins produced from SEQ ID NO: 27, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 27 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 26, a heterogeneous population of AAV3B.AR2.08 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 26, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 27, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 27 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 26, a heterogeneous population of AAV3B.AR2.08 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 26, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 27, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 27 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 26; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 26, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 26, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 26, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 26 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.08 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a host cell target cell.

In certain embodiments, an AAV3B.AR2.08 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 26, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 26, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 26.

In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.08 vpl capsid protein is provided in SEQ ID NO: 27. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 27 may be selected to express the AAV3B.AR2.08 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 27. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 26 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 27 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 27 which encodes SEQ ID NO: 26. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 27 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 27 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 26. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 27 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 27 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 26.

In certain embodiments, the nucleic acid sequences encoding mutant AAV3B.AR2.08 are selected for capsid production. Such sequences may have one or more residues has been altered in order to decrease deamidation, or other modifications which are identified herein. Such nucleic acid sequences can be used in production of mutant AAV3B.AR2.08 capsids.

In certain embodiments, a novel isolated AAV3B.AR2.16 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 41 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 40. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.16 (SEQ ID NO: 40). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.16 (SEQ ID NO: 41).

In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.16 capsid comprising one or more of: (1) AAV3B.AR2.16 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.16 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 40, vpl proteins produced from SEQ ID NO: 41, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 41 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 40, a heterogeneous population of AAV3B.AR2.16 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 40, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 41, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 41 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 40, a heterogeneous population of AAV3B.AR2.16 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 40, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 41, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 41 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 40; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 40, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 40, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 40, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 40 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.16 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell.

In certain embodiments, an AAV3B.AR2.16 capsid comprises: a heterogeneous population of vp 1 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 40, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 40, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 40.

In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.16 vpl capsid protein is provided in SEQ ID NO: 41. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 41 may be selected to express the AAV3B.AR2.16 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 41. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 40 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 41 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 41 which encodes SEQ ID NO: 40. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 41 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 41 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 40. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 41 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 41 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 40.

The rAAV and compositions may be generated using nucleic acid sequences encoding mutant AAV3B.AR2.16, in which one or more residues has been altered in order to decrease deamidation, or other modifications which are identified herein. Such nucleic acid sequences can be used in production of mutant AAV3B.AR2.16 capsids.

Although currently less desirable, other suitable AAV3B may be selected. In certain embodiments, an isolated AAV3B.AR2.01 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 13 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 12. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.01 (SEQ ID NO: 12). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.01 (SEQ ID NO: 13).

In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.01 capsid comprising one or more of: (1) AAV3B.AR2.01 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.01 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 12, vpl proteins produced from SEQ ID NO: 13, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 13 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 12, a heterogeneous population of AAV3B.AR2.01 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 12, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 13, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 13 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 12, a heterogeneous population of AAV3B.AR2.01 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 12, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 13, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 13 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 12; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 12, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 12, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 12, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 12 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.01 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell.

In certain embodiments, an AAV3B.AR2.01 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 12, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 12, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 12. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.01 vpl capsid protein is provided in SEQ ID NO: 13. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 13 may be selected to express the AAV3B.AR2.01 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 13. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 12 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 13 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 13 which encodes SEQ ID NO: 12. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 13 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 13 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 12. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 13 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 13 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 12.

In certain embodiments, a novel isolated AAV3B.AR2.02 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 15 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 14. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.02 (SEQ ID NO: 14). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) AAV3B.AR2.02 (SEQ ID NO: 15). In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.02 capsid comprising one or more of: (1) AAV3B.AR2.02 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.02 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

14, vpl proteins produced from SEQ ID NO: 15, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 15 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 14, a heterogeneous population of AAV3B.AR2.02 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 14, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 15, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 15 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 14, a heterogeneous population of AAV3B.AR2.02 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 14, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 15, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 15 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 14; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 14, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 14, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 14, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 14 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.02 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell.

In certain embodiments, an AAV3B.AR2.02 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 14, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 14, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 14. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.02 vpl capsid protein is provided in SEQ ID NO: 15. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 15 may be selected to express the AAV3B.AR2.02 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 15. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 14 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 15 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 15 which encodes SEQ ID NO: 14. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 15 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 15 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 14. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 15 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 15 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 14.

In certain embodiments, a novel isolated AAV3B.AR2.03 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 17 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 5. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.03 (SEQ ID NO: 5). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) AAV3B.AR2.03 (SEQ ID NO: 17). In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.03 capsid comprising one or more of: (1) AAV3B.AR2.03 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.03 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

16, vpl proteins produced from SEQ ID NO: 17, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 17 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 16, a heterogeneous population of AAV3B.AR2.03 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 16, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 17, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 17 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 16, a heterogeneous population of AAV3B.AR2.03 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 16, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 17, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 17 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 16; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 16, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 16, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 16, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 16 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.03 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.03 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 16, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 16, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 16. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.03 vpl capsid protein is provided in SEQ ID NO: 17. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 17 may be selected to express the AAV3B.AR2.03 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 17. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 16 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 17 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 17 which encodes SEQ ID NO: 16. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 17 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 17 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 16. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 17 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 17 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 16.

In certain embodiments, a novel isolated AAV3B.AR2.04 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 19 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 18. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.04 (SEQ ID NO: 18). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) AAV3B.AR2.04 (SEQ ID NO: 19). In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.04 capsid comprising one or more of: (1) AAV3B.AR2.04 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.04 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

18, vpl proteins produced from SEQ ID NO: 19, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 19 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 18, a heterogeneous population of AAV3B.AR2.04 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 18, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 19, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 19 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 18, a heterogeneous population of AAV3B.AR2.04 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 18, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 19, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 19 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 18; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 18, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 18, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 18, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 18 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.04 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.04 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 18, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 18, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 18. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.04 vpl capsid protein is provided in SEQ ID NO: 19. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 19 may be selected to express the AAV3B.AR2.04 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 19. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 18 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 19 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 19 which encodes SEQ ID NO: 18. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 19 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 19 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 18. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 19 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 19 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 18.

In certain embodiments, a novel isolated AAV3B.AR2.05 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 21 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 20. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.05 (SEQ ID NO: 20). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) AAV3B.AR2.05 (SEQ ID NO: 21). In a further aspect, a recombinant adeno-associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.05 capsid comprising one or more of: (1) AAV3B.AR2.05 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.05 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

20, vpl proteins produced from SEQ ID NO: 21, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 21 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 20, a heterogeneous population of AAV3B.AR2.05 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 20, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 21, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 21 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 20, a heterogeneous population of AAV3B.AR2.05 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 20, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 21, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 21 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 20; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 20, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 20, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 20, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 20 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.05 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.05 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 20, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 20, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 20.

In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.05 vpl capsid protein is provided in SEQ ID NO: 21. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 21 may be selected to express the AAV3B.AR2.05 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 21. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 20 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 21 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 21 which encodes SEQ ID NO: 20. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 21 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 21 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 20. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 21 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 21 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 20.

In certain embodiments, a novel isolated AAV3B.AR2.06 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 23 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 22. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.06 (SEQ ID NO: 22). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.06 (SEQ ID NO: 23). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.06 capsid comprising one or more of: (1) AAV3B.AR2.06 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.06 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

22, vpl proteins produced from SEQ ID NO: 23, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 23 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 22, a heterogeneous population of AAV3B.AR2.06 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 22, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 23, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 23 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 22, a heterogeneous population of AAV3B.AR2.06 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 22, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 23, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 23 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 22; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 22, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 22, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 22, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 22 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.06 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.06 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 22, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 22, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 22. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.06 vpl capsid protein is provided in SEQ ID NO: 23. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 23 may be selected to express the AAV3B.AR2.06 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 23. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 22 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 23 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 23 which encodes SEQ ID NO: 22. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 23 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 23 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 22. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 23 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 23 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 22.

In certain embodiments, a novel isolated AAV3B.AR2.07 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 25 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 24. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.07 (SEQ ID NO: 24). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.07 (SEQ ID NO: 25). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.07 capsid comprising one or more of: (1) AAV3B.AR2.07 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.07 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

24, vpl proteins produced from SEQ ID NO: 25, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 25 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 24, a heterogeneous population of AAV3B.AR2.07 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 24, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 25, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 25 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 24, a heterogeneous population of AAV3B.AR2.07 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 24, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 25, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 25 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 24; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 24, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 24, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 24, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 24 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.07 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.07 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 24, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 24, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 24. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.07 vpl capsid protein is provided in SEQ ID NO: 25. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 25 may be selected to express the AAV3B.AR2.07 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 25. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 24 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 25 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 25 which encodes SEQ ID NO: 24. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 25 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 25 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 24. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 25 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 25 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 24.

In certain embodiments, a novel isolated AAV3B.AR2.10 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 29 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 28. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.10 (SEQ ID NO: 28). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.10 (SEQ ID NO: 29). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.10 capsid comprising one or more of: (1) AAV3B.AR2.10 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.10 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 28, vpl proteins produced from SEQ ID NO: 29, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 29 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 28, a heterogeneous population of AAV3B.AR2.10 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 28, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 29, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 29 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 28, a heterogeneous population of AAV3B.AR2.10 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 28, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 29, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 29 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 28; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 28, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 28, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 28, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 28 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.10 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.10 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 28, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 28, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 28. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.10 vpl capsid protein is provided in SEQ ID NO: 29. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 29 may be selected to express the AAV3B.AR2.10 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 29. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 28 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 29 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 29 which encodes SEQ ID NO: 28. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 29 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 29 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 28. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 29 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 29 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 28.

In certain embodiments, a novel isolated AAV3B.AR2.11 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 31 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 30. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.11 (SEQ ID NO: 30). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.i l (SEQ ID NO: 31). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.11 capsid comprising one or more of: (1) AAV3B.AR2.11 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.11 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

30, vpl proteins produced from SEQ ID NO: 31, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 31 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 30, a heterogeneous population of AAV3B.AR2.11 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 30, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 31, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 31 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 30, a heterogeneous population of AAV3B.AR2.11 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 30, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 31, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 31 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 30; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 30, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 30, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 30, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 30 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.11 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.11 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 30, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 30, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 30. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.11 vpl capsid protein is provided in SEQ ID NO: 31. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 31 may be selected to express the AAV3B.AR2.11 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 31. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 30 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 31 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 31 which encodes SEQ ID NO: 30. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 31 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 31 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 30. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 31 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 31 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 30.

In certain embodiments, a novel isolated AAV3B.AR2.12 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 33 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 32. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.12 (SEQ ID NO: 32). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.12 (SEQ ID NO: 33). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.12 capsid comprising one or more of: (1) AAV3B.AR2.12 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.12 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

32, vpl proteins produced from SEQ ID NO: 33, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 33 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 32, a heterogeneous population of AAV3B.AR2.12 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 32, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 33, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 33 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 32, a heterogeneous population of AAV3B.AR2.12 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 32, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 33, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 33 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 32; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 32, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 32, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 32, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 32 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.12 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.12 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 32, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 32, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 32. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.12 vpl capsid protein is provided in SEQ ID NO: 33. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 33 may be selected to express the AAV3B.AR2.12 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 33. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 32 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 33 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 33 which encodes SEQ ID NO: 32. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 33 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 33 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 32. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 33 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 33 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 32.

In certain embodiments, a novel isolated AAV3B.AR2.13 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 35 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 34. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.13 (SEQ ID NO: 34). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.13 (SEQ ID NO: 35). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.13 capsid comprising one or more of: (1) AAV3B.AR2.13 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.13 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

34, vpl proteins produced from SEQ ID NO: 35, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 35 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 34, a heterogeneous population of AAV3B.AR2.13 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 34, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 35, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 35 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 34, a heterogeneous population of AAV3B.AR2.13 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 34, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 35, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 35 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 34; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 34, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 34, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 34, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 34 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.13 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.13 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 34, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 34, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 34. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.13 vpl capsid protein is provided in SEQ ID NO: 35. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 35 may be selected to express the AAV3B.AR2.13 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 35. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 34 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 35 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 35 which encodes SEQ ID NO: 34. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 35 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 35 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 34. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 35 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 35 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 34.

In certain embodiments, a novel isolated AAV3B.AR2.14 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 37 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 36. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.14 (SEQ ID NO: 36). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.14 (SEQ ID NO: 37). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.14 capsid comprising one or more of: (1) AAV3B.AR2.14 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.14 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

36, vpl proteins produced from SEQ ID NO: 37, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 37 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 36, a heterogeneous population of AAV3B.AR2.14 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 36, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 37, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 37 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 36, a heterogeneous population of AAV3B.AR2.14 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 36, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 37, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 37 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 36; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 36, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 36, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 36, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 36 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.14 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.14 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 36, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 36, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 36. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.14 vpl capsid protein is provided in SEQ ID NO: 37. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 37 may be selected to express the AAV3B.AR2.14 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 37. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 36 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 37 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 37 which encodes SEQ ID NO: 36. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 37 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 37 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 36. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 37 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 37 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 36.

In certain embodiments, a novel isolated AAV3B.AR2.15 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 39 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 38. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.15 (SEQ ID NO: 38). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.15 (SEQ ID NO: 39). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.15 capsid comprising one or more of: (1) AAV3B.AR2.15 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.15 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

38, vpl proteins produced from SEQ ID NO: 39, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 39 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 38, a heterogeneous population of AAV3B.AR2.15 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 38, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 39, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 39 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 38, a heterogeneous population of AAV3B.AR2.15 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 38, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 39, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 39 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 38; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 38, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 38, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 38, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 38 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.15 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.15 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 38, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 38, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 38. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.15 vpl capsid protein is provided in SEQ ID NO: 39. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 39 may be selected to express the AAV3B.AR2.15 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 39. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 38 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 39 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 39 which encodes SEQ ID NO: 38. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 39 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 39 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 38. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 39 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 39 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 38.

In certain embodiments, a novel isolated AAV3B.AR2.17 capsid is selected. The nucleic acid sequence encoding the AAV is provided in SEQ ID NO: 43 and the predicted encoded amino acid sequence is provided in SEQ ID NO: 42. Provided herein is an rAAV comprising at least one of the vpl (aa 1 to 736), vp2 (aa 138 to 736) and the vp3 (aa 203 to 736) of AAV3B.AR2.17 (SEQ ID NO: 42). Also provided herein are rAAV comprising an AAV capsid encoded by at least one of the vpl (nt 1 to nt 2211), vp2 (nt 412 to nt 2211) and the vp3 (nt 607 to nt 2211) of AAV3B.AR2.17 (SEQ ID NO: 43). In a further aspect, a recombinant adeno- associated virus (rAAV) is provided which comprises: (A) an AAV3B.AR2.17 capsid comprising one or more of: (1) AAV3B.AR2.17 capsid proteins comprising: a heterogeneous population of AAV3B.AR2.17 vpl proteins selected from: vpl proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO:

42, vpl proteins produced from SEQ ID NO: 43, or vpl proteins produced from a nucleic acid sequence at least 70% identical to SEQ ID NO: 43 which encodes the predicted amino acid sequence of aa 1 to 736 of SEQ ID NO: 42, a heterogeneous population of AAV3B.AR2.17 vp2 proteins selected from: vp2 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 42, vp2 proteins produced from a sequence comprising at least nucleotides 412 to 2211 of SEQ ID NO: 43, or vp2 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 412 to 2211 of SEQ ID NO: 43 which encodes the predicted amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 42, a heterogeneous population of AAV3B.AR2.17 vp3 proteins selected from: vp3 proteins produced by expression from a nucleic acid sequence which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 42, vp3 proteins produced from a sequence comprising at least nucleotides 607 to 2211 of SEQ ID NO: 43, or vp3 proteins produced from a nucleic acid sequence at least 70% identical to at least nucleotides 607 to 2211 of SEQ ID NO: 43 which encodes the predicted amino acid sequence of at least about amino acids 203 to 736 of SEQ ID NO: 42; and/or (2) a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 42, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 42, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 42, wherein: the vpl, vp2 and vp3 proteins contain subpopulations with amino acid modifications comprising at least two highly deamidated asparagines (N) in asparagine - glycine pairs in SEQ ID NO: 42 and optionally further comprising subpopulations comprising other deamidated amino acids, wherein the deamidation results in an amino acid change; and (B) a vector genome in the AAV3B.AR2.17 capsid, the vector genome comprising a nucleic acid molecule comprising AAV inverted terminal repeat sequences and a non-AAV nucleic acid sequence encoding a product (such as a functional hLDLR) operably linked to sequences which direct expression of the product in a target cell. In certain embodiments, an AAV3B.AR2.17 capsid comprises: a heterogeneous population of vpl proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 42, a heterogeneous population of vp2 proteins which are the product of a nucleic acid sequence encoding the amino acid sequence of at least about amino acids 138 to 736 of SEQ ID NO: 42, and a heterogeneous population of vp3 proteins which are the product of a nucleic acid sequence encoding at least amino acids 203 to 736 of SEQ ID NO: 42. In certain embodiments, the nucleic acid sequence encoding the AAV3B.AR2.17 vpl capsid protein is provided in SEQ ID NO: 43. In other embodiments, a nucleic acid sequence of 70% to 99.9% identity to SEQ ID NO: 43 may be selected to express the AAV3B.AR2.17 capsid proteins. In certain other embodiments, the nucleic acid sequence is at least about 75% identical, at least 80% identical, at least 85%, at least 90%, at least 95%, at least 97% identical, or at least 99% to 99.9% identical to SEQ ID NO: 43. However, other nucleic acid sequences which encode the amino acid sequence of SEQ ID NO: 42 may be selected for use in producing rAAV capsids. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 43 or a sequence at least 70% to 99% identical, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to SEQ ID NO: 43 which encodes SEQ ID NO: 42. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO: 43 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to about nt 412 to about nt 2211 of SEQ ID NO: 43 which encodes the vp2 capsid protein (about aa 138 to 736) of SEQ ID NO: 42. In certain embodiments, the nucleic acid sequence has the nucleic acid sequence of about nt 607 to about nt 2211 of SEQ ID NO: 43 or a sequence at least 70% to 99.%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, identical to nt SEQ ID NO: 43 which encodes the vp3 capsid protein (about aa 203 to 736) of SEQ ID NO: 42.

As used herein, “tropism” of an AAV refers to the target tissue/cell specificity or preference of a capsid serotype in delivery a vector genome.

Also provided is a recombinant vector for producing an rAAV as disclosed herein. In one embodiment, the recombinant vector is a plasmid.

Further, an rAAV production system is provided useful for producing an rAAV as disclosed herein. The production system comprises a cell culture comprising a nucleic acid sequence encoding an AAV capsid protein, the vector genome, and AAV rep function and helper functions sufficient to permit packaging of the vector genome into the AAV capsid. In one embodiment, the cell culture is a human embryonic kidney 293 cell culture. In another embodiment, the cell culture is a HeLa cell culture or a A549 cell culture. In yet another embodiment, the cell culture is an insect-derived cell lines such as SF-9, in the case of baculovirus production systems.

A variety of suitable cells and cell lines have been described for use in production of AAV. The cell itself may be selected from any biological organism, including prokaryotic (e.g. , bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells. Particularly desirable host cells are selected from among any mammalian species, including, without limitation, cells such as A549, WEHI, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO, WI38, HeLa, a HEK 293 cell (which express functional adenoviral El), Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals including human, monkey, mouse, rat, rabbit, and hamster. In certain embodiments, the cells are suspension-adapted cells. The selection of the mammalian species providing the cells is not a limitation of this invention; nor is the type of mammalian cell, i.e., fibroblast, hepatocyte, tumor cell, etc.

Also provided herein is the host cell which contains a nucleic acid sequence encoding an AAV capsid; a vector genome as described; and a functional rep gene and other sufficient helper functions to permit packaging of the vector genome into the AAV capsid protein. See, for example, WO 2003/042397; WO 2005/033321, WO 2006/110689, US 7588772 B2, W02017160360 A2, each of which is incorporated by reference herein, for details of a functional rep gene and other sufficient helper functions.

For packaging an expression cassette into an rAAV, the ITRs are the only AAV components required in cis in the same construct as the functional hLDLR coding sequence. In one embodiment, the coding sequences for the replication (rep) and/or capsid (cap) are removed from the AAV genome and supplied in trans or by a packaging cell line in order to generate the AAV vector. For example, as described above, a pseudotyped AAV may contain ITRs from a source which differs from the source of the AAV capsid. Additionally or alternatively, a chimeric AAV capsid may be utilized. Still other AAV components may be selected. Sources of such AAV sequences are described herein and may also be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank^®, PubMed^®, or the like.

Other cell culture or system for producing rAAV available to one of skill in the art may be utilized, including without limitation, baculovirus expression system or production via yeast. See, e.g., Robert M. Kotin, Large-scale recombinant adeno-associated virus production. Hum Mol Genet. 2011 Apr 15; 20(R1): R2-R6. Published online 2011 Apr 29. doi:

10.1093/hmg/ddrl41; Aucoin MG et al, Production of adeno-associated viral vectors in insect cells using triple infection: optimization of baculovirus concentration ratios. Biotechnol Bioeng. 2006 Dec 20;95(6): 1081-92; SAMI S. THAKUR, Production of Recombinant Adeno-associated viral vectors in yeast. Thesis presented to the Graduate School of the University of Florida, 2012; Kondratov O et al. Direct Head-to-Head Evaluation of Recombinant Adeno-associated Viral Vectors Manufactured in Human versus Insect Cells, Mol Ther. 2017 Aug 10. pii: S 1525- GO 16( 17)30362-3. doi: 10.1016/j.ymthe.2017.08.003. [Epub ahead of print]; Mietzsch M et al, OneBac 2.0: S© Cell Lines for Production of AAV1, AAV2, and AAV8 Vectors with Minimal Encapsidation of Foreign DNA. Hum Gene Ther Methods. 2017 Feb;28(l): 15-22. doi:

10.1089/hgtb.2016.164.; Li L et al. Production and characterization of a recombinant adeno- associated virus replicative-form genomes: a eukaryotic source of DNA for gene transfer. PLoS One. 2013 Aug l;8(8):e69879. doi: 10.1371/joumal.pone.0069879. Print 2013; Galibert L et al, Latest developments in the large-scale production of adeno-associated virus vectors in insect cells toward the treatment of neuromuscular diseases. J Invertebr Pathol. 2011 Jul;107 Suppl:S80-93. doi: 10.1016/j.jip.2011.05.008; and Kotin RM, Large-scale recombinant adeno-associated virus production. Hum Mol Genet. 2011 Apr 15;20(Rl):R2-6. doi: 10.1093/hmg/ddrl41. Epub 2011 Apr 29.

Conventional methods for characterization or quantification of rAAV are available to one of skill in the art. To calculate empty and full particle content, VP3 band volumes for a selected sample (e.g., in examples herein an iodixanol gradient-purified preparation where # of GC = # of particles) are plotted against GC particles loaded. The resulting linear equation (y = mx+c) is used to calculate the number of particles in the band volumes of the test article peaks. The number of particles (pt) per 20 pL loaded is then multiplied by 50 to give particles (pt)

/mL. Pt/mL divided by GC/mL gives the ratio of particles to genome copies (pt/GC). Pt/mL- GC/mL gives empty pt/mL. Empty pt/mL divided by pt/mL and x 100 gives the percentage of empty particles. Generally, methods for assaying for empty capsids and AAV vector particles with packaged genomes have been known in the art. See, e.g., Grimm et al, Gene Therapy (1999) 6:1322-1330; Sommer et al, Molec. Ther. (2003) 7:122-128. To test for denatured capsid, the methods include subjecting the treated AAV stock to SDS-polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in the buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes, preferably nylon. Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, most preferably the B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Viral. (2000) 74:9281-9293). A secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase. A method for detecting binding is used to semi-quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e. SYPRO ruby or coomassie stains. In one embodiment, the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR). Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using primers and a TaqMan™ fluorogenic probe specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 Sequence Detection System. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the Q-PCR reaction. The cycle threshold (Ct) values obtained from the samples are used to determine vector genome titer by normalizing it to the Ct value of the plasmid standard curve. End-point assays based on the digital PCR can also be used.

In one aspect, an optimized q-PCR method is used which utilizes a broad spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size. The proteinase K buffer may be concentrated to 2 fold or higher. Typically, proteinase K treatment is about 0.2 mg/mL, but may be varied from 0.1 mg/mL to about 1 mg/mL. The treatment step is generally conducted at about 55 °C for about 15 minutes, but may be performed at a lower temperature (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90 °C) and the time extended (e.g., about 20 minutes to about 30 minutes). Samples are then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in the standard assay.

Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods. 2014 Apr;25(2): 115-25. doi: 10.1089/hgtb.2013.131. Epub 2014 Feb 14.

Methods for determining the ratio among vpl, vp2 and vp3 of capsid protein are also available. See, e.g., Vamseedhar Rayaprolu et al, Comparative Analysis of Adeno-Associated Virus Capsid Stability and Dynamics, J Virol. 2013 Dec; 87(24): 13150-13160; Buller RM, Rose JA. 1978. Characterization of adenovirus-associated virus-induced polypeptides in KB cells. J. Virol. 25:331-338; and Rose JA, Maizel JV, Inman JK, Shatkin AJ. 1971. Structural proteins of adenovirus-associated viruses. J. Virol. 8:766-770.

C. miRNA

In certain embodiments, in addition to the functional hLDLR coding sequence, another non- AAV coding sequence may be included into an rAAV, e.g., a peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest. Useful gene products may include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression via target RNA transcript cleavage/degradation or translational repression of the target messenger RNA (mRNA). miRNAs are natively expressed, typically as final 19-25 non-tran slated RNA products miRNAs exhibit their activit ' through sequence- specific interactions with tire 3' untranslated regions (UTR) of target mRNAs. These endogenously expressed miRNAs form hairpin precursors which are subsequently processed into a miRNA duplex, and further into a ‘"mature” single stranded miRNA molecule. This mature miRNA guides a multiprotein complex, miRISC, which identifies target site, e.g., in the 3' UTR regions, of target mRNAs based upon their complementarity to the mature miRNA.

In certain embodiments, the expression cassette further comprises dorsal root ganglion (drg)-specific miRNA detargetting sequences operably linked to the transgene coding sequence. In certain embodiments, the tandem miRNA target sequences are continuous or are separated by a spacer of 1 to 10 nucleic acids, wherein said spacer is not an miRNA target sequence. In certain embodiments, there are at least two drg-specific miRNA sequences located at 3’ to the functional hLDLR coding sequence. In certain embodiments, the start of the first of the at least two drg-specific miRNA tandem repeats is within 20 nucleotides from the 3 ’ end of the hLDLR-coding sequence. In certain embodiments, the start of the first of the at least two drg- specific miRNA tandem repeats is at least 100 nucleotides from the 3’ end of the functional hLDLR coding sequence. In certain embodiments, the miRNA tandem repeats comprise 200 to 1200 nucleotides in length. In certain embodiments, there are at least two drg-specific miRNA target sequences located at 5’ to the functional hLDLR coding sequence. In certain embodiments, at least two drg-specific miRNA target sequences are located in both 5’ and 3’ to the functional hLDLR coding sequence. In certain embodiments, the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is selected from (i) AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 67); (ii) AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 68), (iii) AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 69); or (iv)

AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 70). In certain embodiments, the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 67). In certain embodiments, the miRNA target sequence for the at least first and/or at least second miRNA target sequence for the expression cassette mRNA or DNA positive strand is AGTGAATTCTACCAGTGCCATA (miR182, SEQ ID NO: 68). In certain embodiments, two or more consecutive miRNA target sequences are continuous and not separated by a spacer. In certain embodiments, two or more of the miRNA target sequences are separated by a spacer and each spacer is independently selected from one or more of (A) GGAT ; (B) CACGTG; or (C) GCATGC. In certain embodiments, the spacer located between the miRNA target sequences may be located 3’ to the first miRNA target sequence and/or 5’ to the last miRNA target sequence. In certain embodiments, the spacers between the miRNA target sequences are the same. See, PCT/19/67872, filed December 20, 2019, for “Compositions for DRG-Specific Reduction of Transgene Expression”, now WO 2020/132455, which claims priority to US Provisional Patent Application No. 63/023,593, filed May 12, 2020, and US Provisional US Patent Application No. 62/783,956, filed December 21, 2018, US Provisional Patent Application No. 63/023,594, filed May 12, 2020, US Provisional Patent Application No. 63/038,488, filed June 12, 2020, US Provisional Patent Application No. 63/043,562, filed June 24, 2020, and US Provisional Patent Application No. 63/079,299, filed September 16, 2020, all of which are hereby incorporated by reference in their entireties.

D. Compositions

In one aspect, provided is a pharmaceutical composition comprising a nucleic acid molecule, a recombinant vector, or an rAAV as disclosed herein and a formulation buffer. In one embodiment, the pharmaceutical composition is suitable for co-administering with an immunosuppressant.

In one embodiment, the rAAV is formulated at about 1 x 10⁹ genome copies (GC)/mL to about 1 x 10¹⁴ GC/mL. In a further embodiment, the rAAV is formulated at about 3 x 10⁹ GC/mL to about 3 x 10¹³ GC/mL. In yet a further embodiment, the rAAV is formulated at about 1 x 10⁹ GC/mL to about 1 x 10¹³ GC/mL. In one embodiment, the rAAV is formulated at least about 1 x 10¹¹ GC/mL.

In one embodiment, the formulation buffer comprises one or more of a surfactant, preservative, an excipient, or buffer which dissolves the nucleic acid molecule(s), or recombinant vector(s) or rAAV(s) forming an aqueous suspending liquid. In one the buffer comprises saline, which may be formulated with a variety of buffering solutions. In one embodiment, the buffer is a phosphate-buffered saline (PBS).

Suitably, the formulation is adjusted to a physiologically acceptable pH, e.g., in the range of pH 6 to 8; for intravenous delivery, a pH of 6.8 to about 7.2 may be desired. However, other pHs within the broadest ranges and these subranges may be selected for other route of delivery.

A suitable surfactant, or combination of surfactants, may be selected from among non-ionic surfactants that are nontoxic. In one embodiment, a difunctional block copolymer surfactant terminating in primary hydroxyl groups is selected, e.g., such as Pluronic® F68 [BASF], also known as Poloxamer 188, which has a neutral pH, has an average molecular weight of 8400. Other surfactants and other Poloxamers may be selected, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly (propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly (ethylene oxide)),

SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. These copolymers are commonly named with the letter "P" (for poloxamer) followed by three digits: the first two digits x 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit x 10 gives the percentage polyoxyethylene content. In one embodiment Poloxamer 188 is selected. The surfactant may be present in an amount up to about 0.0005 % to about 0.001% of the suspension. In one embodiment, the rAAV is suspended in an aqueous solution containing 180 mM sodium chloride, 10 mM sodium phosphate, 0.001% Poloxamer 188. In a further embodiment, the pH is about 7.3. The formulation is suitable for use in human subjects and is administered intravenously. In one embodiment, the formulation is delivered via a peripheral vein by infusion over 20 minutes (±5 minutes). However, this time may be adjusted as needed or desired. In one embodiment, the formulation is characterized by an rAAV having a ratio of "empty" to “full” of 1 or less, preferably less than 0.75, more preferably, 0.5, preferably less than 0.3.

Additionally provided is a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a vector comprising a nucleic acid sequence encoding a functional hLDLR as described herein. As used herein, “carrier” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells. In particular, the rAAV vector may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like. In one embodiment, a therapeutically effective amount of said vector is included in the pharmaceutical composition.

The selection of the carrier is not a limitation of the present invention. Other conventional pharmaceutically acceptable carrier, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin. Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water.

In one embodiment, the buffer/carrier includes a component that prevents the rAAV, from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo.

The phrase “pharmaceutically-acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a subject.

As used herein, the term "dosage" or “amount” can refer to the total dosage or amount delivered to the subject in the course of treatment, or the dosage or amount delivered in a single unit (or multiple unit or split dosage) administration.

Also, the replication-defective virus compositions can be formulated in dosage units to contain an amount of replication-defective virus that is in the range of about 1.0 x 10⁹ GC to about 1.0 x 10¹⁶ GC (to treat an average subject of 70 kg in body weight) including all integers or fractional amounts within the range, and preferably 1.0 x 10¹² GC to 1.0 x 10¹⁴ GC for a human patient. In one embodiment, the compositions are formulated to contain at least lxl 0⁹, 2x10⁹, 3xl0⁹, 4xl0⁹, 5xl0⁹, 6xl0⁹, 7xl0⁹, 8xl0⁹, or 9xl0⁹GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least lxlO¹⁰, 2xl0¹⁰, 3xl0¹⁰, 4xl0¹⁰, 5xl0¹⁰, 6xl0¹⁰, 7xl0¹⁰, 8xl0¹⁰, or 9xl0¹⁰ GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least lxlO¹¹, 2xlO^u, 3xl0^u, 4xlO^u, 5xl0^u, 6xlO^u,

7x10¹¹, 8x10¹¹, or 9x10¹¹ GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least lxlO¹²,

2xl0¹², 3xl0¹², 4xl0¹², 5xl0¹², 6xl0¹², 7xl0¹², 8xl0¹², or 9xl0¹² GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least lxlO¹³, 2xl0¹³, 3xl0¹³, 4xl0¹³, 5xl0¹³, 6xl0¹³, 7xl0¹³, 8xl0¹³, or 9x10¹³ GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least lxlO¹⁴, 2xl0¹⁴, 3xl0¹⁴, 4xl0¹⁴, 5xl0¹⁴, 6xl0¹⁴, 7xl0¹⁴, 8xl0¹⁴, or 9xl0¹⁴ GC per dose including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least lxlO¹⁵, 2xl0¹⁵, 3xl0¹⁵, 4xl0¹⁵, 5xl0¹⁵, 6xl0¹⁵, 7xl0¹⁵, 8xl0¹⁵, or 9xl0¹⁵ GC per dose including all integers or fractional amounts within the range. In one embodiment, for human application the dose can range from lxlO¹⁰ to about lxlO¹² GC per dose including all integers or fractional amounts within the range.

The aqueous suspension or pharmaceutical compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes. In one embodiment, the compositions described herein are designed for delivery to subjects in need thereof by intravenous injection. In one embodiment, the pharmaceutical composition is suitable for peripheral vein infusion. In a further embodiment, the compositions described herein is administered by intravenous (i.v.) infusion over a 20 to 30-minute period to achieve therapeutic levels of functional LDLR expression in the liver. In other embodiments, shorter (e.g., 10 to 20 minutes) or longer (e.g., over 30 minutes to 60 minutes) with or without intervening times (e.g., about 45 minutes, or longer) may be selected. In one embodiment, direct delivery to the liver (optionally via intravenous, via the hepatic artery, or by transplant) may be selected. In one embodiment, the pharmaceutical composition is formulated for delivery via intracerebroventricular (ICY), intrathecal (IT), or intracistemal injection. Alternatively, other routes of administration may be selected (e.g., oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intramuscular, subcutaneous, intradermal, and other parenteral routes).

Additionally, provided is a use of a nucleic acid molecule or a recombinant vector or an rAAV or a pharmaceutical composition as disclosed herein for preparing a medicament, such as for treating a disease associated with impaired function of hLDLR.

E. Methods and Uses

In one aspect provided is a method for treating familial hypercholesterolemia or a disease associated with hLDLR. The method comprises administrating an effective amount of a nucleic acid molecule, a recombinant vector, or an rAAV as disclosed herein to a subject in need thereof. In one embodiment, the method comprises administering to a subject a suspension of a rAAV as described herein in a formulation buffer.

The composition(s), method(s), regimen(s), or use(s) provided treats a subject in need with a disease associated with hLDLR, such as FH. In one embodiment, the composition(s), method(s), regimen(s), or use(s) prevents or ameliorates a symptom associated with the disease, and/or delays/halts progression of a symptom.

As used herein, "disease", "disorder" and "condition" are a disease associated with hLDLR, for example impaired function of hLDLR. Such disease includes but is not limited to Familial Hypercholesterolemia (FH), homozygous FH (HoFH), or heterozygous FH (HeFH). In one embodiment, the disease is one or more of the following: elevated cholesterol levels, elevated high-density lipoprotein (HDL), elevated triglycerides, familial hypercholesterolemia, atherosclerosis, coronary artery disease, cardiovascular disease, and/or another lipoprotein metabolic disorder.

As used herein, the term “treatment” or “treating” a disease refers to composition(s) and/or method(s) for the purposes of amelioration of one or more symptoms of the disease, restoration of a desired function of hLDLR, improvement of a biomarker of disease, or facilitation of any treatment(s) for the disease. In some embodiments, the term “treatment” or “treating” is defined as encompassing administering to a subject one or more compositions described herein for the purposes indicated herein. “Treatment” can thus include one or more of reducing onset or progression of the disease, preventing disease, reducing the severity of the disease symptoms, retarding their progression, removing the disease symptoms, delaying progression of disease, or increasing efficacy of therapy in a given subject. In one embodiment, the biomarker is LDL level in a biological sample. Additionally, or alternatively, other biomarkers that can be monitored include, but are not limited to measuring changes in total cholesterol (TC), non-high density lipoprotein cholesterol (non-HDL-C), HDL-C, fasting triglycerides (TG), very low density lipoprotein cholesterol (VLDL-C), lipoprotein(a) (Lp(a)), apolipoprotein B (apoB), fractional catabolic rate (FCR) of LDL apolipoprotein B (apoB), and apolipoprotein A-I (apoA-I) compared to baseline, as well as LDL kinetic studies (metabolic mechanism assessment), and number, size or extent of assessable xanthomas, prior to and after the administration, or combinations thereof. As used herein, an improvement of a disease biomarker refers to bring the biomarker level closer to a healthy control subject or a subject who is free of the disease.

The term “disease-related symptom(s)” or “symptom(s)” refers to symptom(s) found in patients having a disease associated with impaired function of hLDLR as well as in animal models for the disease. Such symptoms include, e.g., decreased or abolished function of hLDLR, reduced cholesterol (such as LDL) level in a biological sample, coronary artery disease (CAD), early onset of cardio vascular disease, atherosclerosis, chest pain with activity, xanthomas which are fatty deposits often found in tendons and on the elbows, buttocks, and knees, cholesterol deposits around the eyelids, xanthomas that occur around the eyes which are known as xanthelasmas, and gray -white cholesterol deposits around the corneas also known as corneal arcus.

As used herein, the phrases “ameliorate a symptom”, “improve a symptom” or any grammatical variants thereof, refer to reversal of a disease-related symptom, a reduction in the severity of a disease-related symptom, showdown or prevention of progression of a disease- related symptom. In one embodiment, the amelioration or improvement refers to the total number of symptoms in a patient after administration of the described composition(s) or use of the described method, which is reduced by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% compared to a control. In another embodiment, the amelioration or improvement refers to the severity or progression of a symptom after administration of the described composition(s) or use of the described method, which is reduced by about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% compared to a control. In one embodiment, the control is the corresponding level before the administration or use. In another embodiment, the control is a patient having a corresponding disease progression. In certain embodiments, the control is an averaged level.

As used herein, “facilitation of any treatment(s)” for a disease or any grammatical variant thereof, refers to a decreased dosage or a lower frequency of a treatment of the disease in a subject other than the composition(s) or method(s) which is/are firstly disclosed in the invention (which is also referred to herein as co-therapy), compared to that of a standard treatment without administration of the described composition(s) and use of the described method(s). Such co therapy may include one or more of the following: statins, ezetimibe, other cholesterol lowering medications, or lipoprotein apheresis. For example, Patients who are candidates for treatment are preferably adults (male or female >18 years of age) diagnosed with HoFH carrying two mutations in the LDLR gene; i.e., patients that have molecularly defined LDLR mutations at both alleles in the setting of a clinical presentation consistent with HoFH, which can include untreated LDL cholesterol (LDL-C) levels, e.g., LDL-C levels >300 mg/dl, treated LDL-C levels, e.g., LDL-C levels <300 mg/dl and/or total plasma cholesterol levels greater than 500 mg/dl and premature and aggressive atherosclerosis. Candidates for treatment include HoFH patients that are undergoing treatment with lipid-lowering drugs, such as statins, ezetimibe, bile acid sequestrants, PCSK9 inhibitors, and LDL and/or plasma apheresis.

In certain embodiments, efficacy of therapy may be measured by a reduction in the frequency of apheresis required by the patient.

In certain embodiments, a “functional hLDLR protein” is a protein which provides the biological function associated with normal hLDLR protein in a human who does not have FH, or an FH-associated disorder. Such function may be assessed using any of the assays described herein, by expression levels, or by another suitable method.

In certain embodiments, efficacy of therapy may be measured by a reduction in the dose of PCSK9 inhibitor required, or by an elimination of the need for such therapy in a patient post the administration/treatment as disclosed herein. In certain embodiments, efficacy of therapy is measured by a reduction in the dose of a statin or bile sequestrant required.

As used herein, the term “subject” or “patient” includes any mammal in need of these methods or compositions, including particularly humans and animal models used for clinical research of the disease. The subject may be male or female. In one embodiment, the subject of these methods and compositions is a human diagnosed with FH such as HoFH or HeFH, or suspected of having FH. In certain embodiments, the human subject of these methods and compositions is a prenatal, a newborn, an infant, a toddler, a preschool, a grade-schooler, a teen, a young adult or an adult. In a further embodiment, the subject of these methods and compositions is a pediatric FH patient.

The term "mammal" or grammatical variations thereof, are intended to encompass a singular "mammal" and plural "mammals," and includes, but is not limited to, humans; primates such as apes, monkeys, orangutans, and chimpanzees; canids such as dogs and wolves; felids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras; food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; wild animals, such as bears, domesticated animals, livestock and laboratory animals. In some preferred embodiments, a mammal is a human.

In one embodiment, the subject is delivered a therapeutically effective amount of a nucleic acid molecule, a recombinant vector, or an rAAV as described herein. As used herein, a “therapeutically effective amount” or an “effective amount” refers to the amount of the composition comprising the nucleic acid sequence encoding a functional hLDLR which delivers and expresses in the target cells an amount of the functional hLDLR sufficient to treat a disease associated with hLDLR (for example, a disease associated with impaired function of hLDLR).

In one embodiment, the dosage of an rAAV is about 1 x 10⁹ GC to about 1 x 10¹⁵ genome copies (GC) per dose (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 10¹² GC to 2.0 x 10¹⁵ GC for a human patient. In another embodiment, the dose is less than about 1 x 10¹⁴ GC/kg body weight of the subject. In specific embodiments, the dose administered to a patient is at least about 1.0 x 10⁹ GC/kg , about 1.5 x 10⁹ GC/kg , about 2.0 x 10⁹ GC/g, about 2.5 x 10⁹ GC/kg , about 3.0 x 10⁹ GC/kg , about 3.5 x 10⁹ GC/kg , about 4.0 x 10⁹ GC/kg , about 4.5 x 10⁹ GC/kg , about 5.0 x 10⁹ GC/kg , about 5.5 x 10⁹ GC/kg , about 6.0 x 10⁹ GC/kg , about 6.5 x 10⁹ GC/kg , about 7.0 x 10⁹ GC/kg , about 7.5 x 10⁹ GC/kg , about 8.0 x 10⁹ GC/kg , about 8.5 x 10⁹ GC/kg , about 9.0 x 10⁹ GC/kg , about 9.5 x 10⁹ GC/kg , about 1.0 x 10¹⁰ GC/kg , about 1.5 x 10¹⁰ GC/kg , about 2.0 x 10¹⁰ GC/kg , about 2.5 x 10¹⁰ GC/kg , about 3.0 x 10¹⁰ GC/kg , about 3.5 x 10¹⁰ GC/kg , about 4.0 x 10¹⁰ GC/kg , about 4.5 x 10¹⁰ GC/kg , about 5.0 x 10¹⁰ GC/kg , about 5.5 x 10¹⁰ GC/kg , about 6.0 x 10¹⁰ GC/kg , about 6.5 x 10¹⁰ GC/kg , about 7.0 x 10¹⁰ GC/kg , about 7.5 x 10¹⁰ GC/kg , about 8.0 x 10¹⁰ GC/kg , about 8.5 x 10¹⁰ GC/kg , about 9.0 x 10¹⁰ GC/kg , about 9.5 x 10¹⁰ GC/kg , about 1.0 x 10¹¹ GC/kg , about 1.5 x 10¹¹ GC/kg , about 2.0 x 10¹¹ GC/kg , about 2.5 x 10¹¹ GC/kg , about 3.0 x 10¹¹ GC/kg , about 3.5 x 10¹¹ GC/kg , about 4.0 x 10¹¹ GC/kg , about 4.5 x 10¹¹ GC/kg , about 5.0 x 10¹¹ GC/kg , about 5.5 x 10¹¹ GC/kg , about 6.0 x 10¹¹ GC/kg , about 6.5 x 10¹¹ GC/kg , about 7.0 x 10¹¹ GC/kg , about 7.5 x 10¹¹ GC/kg , about 8.0 x 10¹¹ GC/kg , about 8.5 x 10¹¹ GC/kg , about 9.0 x 10¹¹ GC/kg , about 9.5 x 10¹¹ GC/kg , about 1.0 x 10¹² GC/kg , about 1.5 x 10¹² GC/kg , about 2.0 x 10¹² GC/kg , about 2.5 x 10¹² GC/kg , about 3.0 x 10¹² GC/kg , about 3.5 x 10¹² GC/kg , about 4.0 x 10¹² GC/kg , about 4.5 x 10¹² GC/kg , about 5.0 x 10¹² GC/kg , about 5.5 x 10¹² GC/kg , about 6.0 x 10¹² GC/kg , about 6.5 x 10¹² GC/kg , about 7.0 x 10¹² GC/kg , about 7.5 x 10¹² GC/kg , about 8.0 x 10¹² GC/kg , about 8.5 x 10¹² GC/kg , about 9.0 x 10¹² GC/kg , about 9.5 x 10¹² GC/kg , about 1.0 x 10¹³ GC/kg , about 1.5 x 10¹³ GC/kg , about 2.0 x 10¹³ GC/kg , about 2.5 x 10¹³ GC/kg , about 3.0 x 10¹³ GC/kg , about 3.5 x 10¹³ GC/kg , about 4.0 x 10¹³ GC/kg , about 4.5 x 10¹³ GC/kg , about 5.0 x 10¹³ GC/kg , about 5.5 x 10¹³ GC/kg , about 6.0 x 10¹³ GC/kg , about 6.5 x 10¹³ GC/kg , about 7.0 x 10¹³ GC/kg , about 7.5 x 10¹³ GC/kg , about 8.0 x 10¹³ GC/kg , about 8.5 x 10¹³ GC/kg , about 9.0 x 10¹³ GC/kg , about 9.5 x 10¹³ GC/kg , or about 1.0 x 10¹⁴ GC/kg body weight or the subject.

A course of treatment may optionally involve repeat administration of the same rAAV or a different vector (e.g., an AAV8, rAAV3B.AR2.08 or an rAAV3B.AR2.16), particularly for those prenatal, newborn, infant, toddler, preschool, grade-schooler, or teen patients. In one embodiment, those non-adult patients undergo an active proliferating of liver cells, thus requiring repeated administration of an rAAV as described herein which is replication defective. In another embodiment, for a non-adult patient having no native functional hLDLR protein, pre-exposure to a functional hLDLR optionally delivered via another rAAV, particular during the prenatal, newborn or infant stages, may induce a better tolerance and lower immunogenicity to the functional hLDLR, leading to a higher efficacy and efficiency.

In one embodiment, the method further comprises the subject receives an immunosuppressive co-therapy. Such immune suppressant co-therapy may be started prior to delivery of an rAAV or a composition as disclosed, e.g., if undesirably high neutralizing antibody levels to the AAV capsid are detected. In certain embodiments, co-therapy may also be started prior to delivery of the rAAV as a precautionary measure. In certain embodiments, immunosuppressive co-therapy is started following delivery of the rAAV, e.g., if an undesirable immune response is observed following treatment.

Immunosuppressants for such co-therapy include, but are not limited to, a glucocorticoid, steroids, antimetabolites, T-cell inhibitors, a macrolide (e.g., a rapamycin or rapalog), and cytostatic agents including an alkylating agent, an anti-metabolite, a cytotoxic antibiotic, an antibody, or an agent active on immunophilin. The immune suppressant may include prednelisone, a nitrogen mustard, nitrosourea, platinum compound, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, an anthracycline, mitomycin C, bleomycin, mithramycin, IL-2 receptor- (CD25-) or CD3-directed antibodies, anti-IL-2 antibodies, ciclosporin, tacrolimus, sirolimus, IFN-b, IFN-g, an opioid, or TNF-a (tumor necrosis factor- alpha) binding agent. In certain embodiments, the immunosuppressive therapy may be started 0, 1, 2, 7, or more days prior to the rAAV administration, or 0, 1, 2, 3, 7, or more days post the rAAV administration. Such therapy may involve a single drug (e.g., prednisolone) or co administration of two or more drugs, the (e.g., prednisolone, micophenolate mofetil (MMF) and/or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after gene therapy administration, at the same dose or an adjusted dose. Such therapy may be for about 1 week (7 days), two weeks, three weeks, about 60 days, or longer, as needed. In certain embodiments, a tacrolimus-free regimen is selected.

In certain embodiments, prior to treatment, the HoFH patient should be assessed for neutralizing antibodies (NAb) to the AAV capsid serotype used to deliver the functional hLDLR coding sequence. Such NAbs can interfere with transduction efficiency and reduce therapeutic efficacy. HoFH patients that have a baseline serum NAb titer < 1:5 (optionally < 1:10), are good candidates for treatment with the rAAV gene therapy protocol as disclosed herein. However, patients with other baseline levels may be selected. Treatment of HoFH patients with titers of serum NAb >1:5 may require a combination therapy, such as transient co-treatment with an immunosuppressant before and/or during treatment with rAAV delivery. Additionally, or alternatively, patients are monitored for elevated liver enzymes, which may be treated with transient immunosuppressant therapy (e.g., if at least about 2x baseline levels of aspartate transaminase (AST) or alanine transaminase (ALT) are observed). Immunosuppressants for such co-therapy include, but are not limited to, steroids, antimetabolites, T-cell inhibitors, and alkylating agents.

As used herein, the term "NAb titer" refers to a measurement of how much neutralizing antibody (e.g., anti-AAV NAb) is produced which neutralizes the physiologic effect of its targeted epitope (e.g., an rAAV). Anti-AAV NAb titers may be measured as described in, e.g., Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses. Journal of Infectious Diseases, 2009. 199(3): p. 381-390, which is incorporated by reference herein. In one embodiment, the rAAV as described herein is administrated once to the subject in need. In another embodiment, the rAAV is administrated more than once to the subject in need.

In one embodiment, a nucleic acid molecule or a recombinant vector or an rAAV is administered to the subject intravenously or via peripheral vein infusion.

In certain embodiments, a kit is provided which includes a concentrated nucleic acid molecule or a recombinant vector or an rAAV as disclosed suspended in a formulation buffer (optionally frozen), dilution buffer, and optional devices and components required for administration. In another embodiment, the kit may include components for intravenous delivery or for peripheral vein infusion. In one embodiment, the kit provides sufficient buffer to allow for injection. Such buffer may allow for about a 1: 1 to a 1:5 dilution of the concentrated vector, or more. In other embodiments, higher or lower amounts of buffer or sterile water are included to allow for dose titration and other adjustments by the treating clinician. In still other embodiments, one or more components of the device are included in the kit. Suitable dilution buffer is available, such as, a saline, a phosphate buffered saline (PBS) or a glycerol/PBS.

In one embodiment, cholesterol (for example, LDL) level in a biological sample of the subject is decreased after the administration of the rAAV or vector.

As used herein, the term “biological sample” refers to any cell, biological fluid or tissue. Suitable samples for use in this invention may include, without limitation, whole blood, leukocytes, fibroblasts, serum, urine, plasma, saliva, bone marrow, cerebrospinal fluid, amniotic fluid, and skin cells. Such samples may further be diluted with saline, buffer or a physiologically acceptable diluent. Alternatively, such samples are concentrated by conventional means.

In one embodiment, a disease symptom of the subject is ameliorated after administration of the rAAV or vector or nucleic acid molecule. In one embodiment, the disease progression is delayed or halted after administration of the rAAV or nucleic acid molecule.

EXAMPLES

The following examples are illustrative only and are not intended to limit the present invention.

Example 1 - rAAVs

The following rAAVs were designed, produced and tested. a. AAV8.TBG.PI.hLDLR.rBG (comprises vector genome of SEQ ID NO: 7) b. AAV3B-AR2.16.TBG.PI.hLDLR.rBG (comprises vector genome of SEQ ID NO:

7) c. AAV3B-AR2.16.TBG.IVS2.hLDLR01 l.bGH (comprises vector genome of SEQ ID NO: 5) d. AAV3B-AR2.16.TBG.IVS2.hLDLR011-triple.bGH (comprises vector genome of SEQ ID NO: 6) e. AAV3B-AR2.08. TBG.IVS2.hLDLR011-triple.bGH (comprises vector genome of SEQ ID NO: 6) f. AAV3B.TBG.IVS2.hLDLR011-triple.bGH (comprises vector genome of SEQ ID

NO: 6)

The rAAVs are named after its capsid and vector genome in a format of “capsid. vector genome”. An AAV capsid may be an “AAV8”, “AAV3B-AR2.08” or “AAV3B-AR2.16” capsid. The vector genomes are further noted based on their promoter, intron, hLDLR coding sequence and polyA sequence separated by

As used herein, “TBG” indicates a TBG promoter. “PI” refers to a chimeric intron with Genbank # U47121 (Promega Corporation, Madison, Wisconsin), while “IVS2” means a human b-globin intron 2. The term “rBG” provides a rabbit beta-globin polyadenylation signal in the rAAV while bGH stands for a polyadenylation signal from the bovine growth hormone.

With respect to the LDLR coding sequence, “hLDLR” or “LDLR” indicates that the coding sequence is the human wild-type coding sequence encoding a wild-type hLDLR protein; “hLDLROll” or “LDLR011” indicates the engineered coding sequence encoding a wild-type hLDLR protein; and “hLDLROl 1 -triple” or “hLDLRO 11.triple” or “LDLRO 11.trip” means the engineered coding sequence encoding a hLDLR protein with three amino acid substitutions, i.e., L318D/ K809R/C818A.

When referring to a vector genome or an rAAV particle without specifying a capsid, a similar format is used as the following: “AAV.promoter(optional).intron(optional).hLDLR coding sequence. polyA(optional)”.

Additionally, plasmids for producing the rAAVs are illustrated in FIGs. 1A to 1C.

Example 2 - Isolation and characterization of a rAAV for treating hypercholesterolemia Based on the performances of the capsids in the liver tissues as further discussed in Example 3 as well as their production yields, AAV3B.AR2.08 and AAV3B.AR2.16 were selected to further evaluate as a potential treatment of familial hypercholesterolemia (FH, including Heterozygous FH and Homozygous FH).

A. Non-human primates (NHPs) study

Three rAAVs were tested, including AAV8.TBG.PI.hLDLr.rBG.KanR, or AAV3B- AR2.08.TBG.IVS2.hLDLR011(L318D, K809R,C818A).bGH, or AAV3B- AR2.16.TBG.IVS2.hLDLR011(L318D, K809R,C818A).bGH. Each of the rAAVs was injected i.v. to four animals. Two received 2.5 x 10¹³ GC/kg (noted as “high” in the drawings) and 2 received 7.5 x 10¹² GC/kg.

Starting on the day of rAAV administration (day 0), animals received Prednisolone ( 1 mg/kg/day) orally for transient immune suppression. At approximately 8 weeks post vector administration, animals were tapered off Prednisolone by gradual reduction of daily dose. The LDL and PCSK9 levels of injected animals were measured to evaluate the efficacies.

Each animal had at least received 1 liver biopsy on day 18 for the purpose of monitoring the stability of the transgene. The vector genome copies in biopsy samples showed dose dependency. The lower dose of AAV3B-AR2.08 resulted in higher vector genome copies than AAV8 or AAV3B-AR2.16. Two animals in the AAV3B-AR2.16 group, marked with red asterisk (see FIG. 6A and 6B), had 1:5 Neutralizing Antibody (NAb) titer which is considered negative but might impact the efficiency of the gene transfer. When the steroid tapering began, the LDL level among the AAV3B-AR2.08 group started returning to baseline. All 4 animals in the AAV3B-AR2.08 group had received a 2nd biopsy and showed decreased vector GC in liver. See, RA3345 (M) v.s. RA3345-d83 (i.e., RA3345 (M) at day 83) and RA3380 (F) v.s. RA3380-d88 (i.e., RA3380 (F) at day 88), FIG. 6A and 6B.

B. Comparison of the AAV capsids and the hLDLR expression cassettes - non-human primates (NHPs) studies

Each of the six rAAVs described in Example 1 were tested on four NHPs.

AAV8.TBG.PI.hLDLR.rBG

AAV3B-AR2.16.TBG.PI.hLDLR.rBG

AAV3B-AR2.16.TBG.IVS2.hLDLR01 TbGH

AAV3B-AR2.16.TBGTVS2.hLDLR011-triple.bGH

AAV3B-AR2.08.TBGTVS2.hLDLR011-triple.bGH

AAV3B.TBG.IVS2.hLDLR011-triple.bGH One male and one female NHPs received 2.5 x 10¹³ GC/kg (noted as “high” in the drawings, and also referred to as the “high dose” or “higher dose”) or 7.5 x 10¹² GC/kg (which is referred to as the “low dose” or “lower dose”). Doses: 7.5E12 GC/kg, 2.5 E13 GC/kg; 1M/1F for each vector at each dose, total N = 24.

Starting on the day of rAAV administration (day 0), animals received Prednisolone at 1 mg/kg body weight/day orally every day for 8 weeks. Animals were then tapered off Prednisolone by gradual reduction of daily dose.

Livers were biopsied on day 18 and a full necropsy was performed at 4 months post the rAAV administration (day 120). Clinical pathology, levels of cytokines, complements, lipids and T cell responses were also monitored.

More results are shown in FIGs 2A to 8D and further discussed below.

1. Comparison between AAV8 with AAV3B-AR2.16 using rAAV containing the native hLDLR coding sequence.

Upon using the PI intron and the wild-type hLDLR coding sequence, the AAV capsids of AAV8 and AAV3B-2.16 were compared. See, FIGs. 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A.

Experimental result showed that the rAAV particles successfully delivered the vector genome to liver. Briefly, liver samples from the biopsy on day 18 as well as the necropsy on day 120 were evaluated. Genome copies (GC) of the vector genome were normalized by diploid genome and plotted in FIGs. 6A and 6B. Additionally, correlated LDLR mRNA relative expression was plotted (FIG. 6A). A dose dependence was observed, i.e., higher dose lead to more copies of vector in a cell. Although a slight decrease over time in the vector copies was observed in most of the animals, on day 120, the vector genome was not eliminated in any of the animal, suggesting a long-term effect of the rAAV treatment.

Further, a robust expression of the hLDLR protein was found in liver on day 18 post the AAV particle administration shown by western blot (WB), in situ hybridization (ISH) and immunohistochemistry (IHC). On day 120, the expression level of liver LDLR protein was reduced in the animals treated with the AAV8 particles shown by WB, ISH and IHC as well as in the animals treated with high dose of the AAV3B-AR2.16 particles shown by WB. Still, the LDLR expression in liver were observed even on day 120.

The low dose of the AAV 8 particle did not lead to a significant LDL reduction upon administration. Treated with the high dose of the AAV 8 particle, the male animal identified as RA3344 showed an LDL level reduced to a quarter of the starting level on day 0, while the female animal identified as RA3403 had no significant change in its LDL level. See, FIG. 2A. However, both doses of the AAV3B-AR2.16 particle demonstrated its effectiveness shown by a significant reduction in the LDL level upon treatment (see, FIG. 2B), suggesting the AAV3B- AR2.16 capsid is more effective compared to the AAV8 one in delivering an rAAV to liver cells.

Potential toxicity to the liver was further evaluated via measuring animals’

Alanine Aminotransferase (ALT) and Aspartate Aminotransferase (AST) levels. The results are shown in FIGs. 3A, 3B, 4A and 4B. A transient increase after injection was observed in the ALT level of the female animal and in the AST level of both animals treated with high dose of the AAV3B-AR2.16 particle. Male animal treated with high dose of the AAV8 particle also showed a similar increase in its AST level. However, all ALT and AST levels returned to normal, indicating that no long-term liver damage was made.

2. Comparation among the three hLDLR expression cassettes (“hLDLR” vs. “hl_DLR011” vs. “hLDLRO11 .triple”)

Experiments and analysis were performed in order to evaluate the three hLDLR expression cassettes. The AAV3B-AR2.16 capsid was used to deliver a vector genome comprising one of the expression cassettes. Related results are shown in FIGs. 2B, 2D, 2F, 3B, 3D, 3F, 4B, 4D, 4F, 5B, and 5C.

Expression of the hLDLR protein were identified in the liver samples of all groups biopsied on day 18 shown via both ISH and IHC. The IHC images show a positive correlation between the LDLR expression level and the reduction in LDL. More results relating to the LDL level are plotted in FIGs. 2B, 2D and 2F. At the higher dose, compared to the 75% reduction achieved by the wild-type LDLR coding sequence, both of the engineered ones provided a close to 100% reduction upon administration. The lower dose of the rAAV.hLDLROl 1 particle resulted in an about 75% reduction and an about 100% reduction in LDL, while the lower dose of the rAAVhLDLROl 1. triple particle lead to an about 50% reduction and an about 80% reduction. Those data suggested that the engineered hLDLR coding sequences are better candidates in treating hypercholesterolemia compared to the wild type.

With respect to the liver toxicity, advantages of the engineered hLDLR coding sequences over the wild type were observed. A comparably low and stable level of ALT as well as AST was shown in both low and high dose groups of the animals treated with rAAV.hLDLROl 1 or rAAV hLDLROl 1. triple particles. However, high dose of the rAAV particle comprising the wild type hLDLR sequence lead to a transient increase upon administration in the ALT level in one animal and in the AST levels in both animals.

Additionally, PCSK9 levels were also investigated. The data obtained from animals treated with AAV8.hLDLR, or AAV3B-AR208 hLDLROI 1. triple, or AAV3B- AR01.16.hLDLR011.triple is shown in FIGs. 5A to 5C. The LDL level of an animal treated with the AAV8. hLDLR particle followed the change in the PCSK9 level. See, for example, the animal identified as 17C027 from day 14 to day 42. However, such pattern was not found in the other two groups treated with AAV.hLDLROl 1. triple particles. See, for example, the animal identified as RA33289 from day 14 to day 28. This data suggests beneficial effects of the AAV.hLDLROl 1. triple particles. Additionally, a decline in the PCSK9 level up rAAV administration was observed in all three figures, suggesting that PSCK9 responds to the decreased LDL level and/or the increased LDLR level due to the rAAV injection, and thus, may play a negative role in reducing the LDL level if not controlled properly.

3. Comparation among the AAV3B capsid with two AAV3B variants (all containing the hLDLRO11 .triple coding sequence)

The two tested AAV3B variants (i.e., AAV3B.AR2.08 and AAV3B.AR2.16) were further compared to the original AAV3B capsid via using the rAAV particles comprising the hLDLROI l.triple coding sequence. The results can be found in FIGs. 2C, 2E, 2F, 3C, 3E, 3F, 4C, 4E, 4F, 7. The LDLR expression was observed in all treated animals. Compared to the

AAV3B particle, the AAV3B variant particles showed better effects in reducing the LDL level. For example, the LDL in the variant groups reached at a lower level upon treatment and stayed below the pre-treatment level for longer time. Additionally, the ALT level elevated in a sustained manner in the animals treated with the AAV3B particles while the AAV3B variants groups only showed a temporary increase. These results lead to a conclusion that the AAV3B variants are more advantageous over the original AAV3B capsid from the perspective of efficacy as well as safety. 4. Time course results

Interestingly, despite the initial response to the administration, the ALT level and the LDL level shared a similar trend in the animals injected with AAV3B- AR.08.hLDLR01 l.triple. See, FIGs, 2E and 3E. A gradual loss was found, suggesting a clearing mechanism of the hLDLR expression cassette and/or the hLDLR expressing cells.

C. Toxicity study - non-human primates (NHPs) studies

To evaluate the toxicity of this treatment, non-human primates (NHPs) were injected i.v. at a high dose. To study toxicity that might be specific to human hepatocytes, FRG mice were used. As the first step to rule out toxicity not associated with immune response, we intravenously injected high dose (2 x 10¹⁴ GC/kg) of AAV vectors in FRG mice grafted with human hepatocytes from 3 different donors. We selected PHP.eB, a mutant closely resembling the PHP.B reported to have serious acute toxicity in NHP in 2018, and AAV9, the wild type AAV backbone of PHP.eB for the study. We measured the alanine transaminase (ALT), aspartate aminotransferase (AST) and total bilirubin at day -14, day 3 and day 7 following the injection. Compared to the wild type C57B1/6 mice, there were no signs for significant damage to the human hepatocytes in FRG mice.

D. Methods and Materials

Vector construction and production. In order to improve the expression of hLDLR, a Kozak sequence was inserted before the start codon of the original AAV construct containing the WT hLDLR cDNA (C. Lebherz et al., Gene therapy with novel adeno-associated virus vectors substantially diminishes atherosclerosis in a murine model of familial hypercholesterolemia. J Gene Med 6, 663 (Jun, 2004)). Four different engineered cDNA sequences were synthesized and cloned into the AAV plasmids. Further vector engineering was performed on hLDLROl 1 by replacing the PI intron with IVS2 from the human beta globin gene or inserting the WPRE at the 3 ’end of the cDNA. All AAV vectors were produced and tittered by the Penn Vector Core at the University of Pennsylvania as described previously (M. Lock et al, Rapid, simple, and versatile manufacturing of recombinant adeno-associated viral vectors at scale. Hum Gene Ther 21, 1259 (Oct, 2010); M. Lock, M. R. Alvira, S. J. Chen, J. M. Wilson, Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR. Hum Gene Ther Methods 25, 115 (Apr, 2014)).

Animal studies. All animal studies were performed in accordance with protocols approved by Institutional Animal Care and Use Committee (IACUC) of the University of Pennsylvania. LDLR-/-, APOBEC-1-/- double knockout (DKO) mice were maintained on a chow diet at Animal Facility of the Translational Research Laboratories at the University of Pennsylvania. Vectors were injected intravenously via the tail vein at the specified dose. Blood was collected before vector dosing and at specified time points after dosing.

Serum non-HDL cholesterol or LDL-C levels. Serum non-HDL cholesterol levels were measured as previously described (S. H. Kassim et al., Adeno-associated virus serotype 8 gene therapy leads to significant lowering of plasma cholesterol levels in humanized mouse models of homozygous and heterozygous familial hypercholesterolemia. Hum Gene Ther 24, 19 (Jan, 2013)). Serum LDL-C levels were measured by Antech GLP (Morrisville, NC). Data are presented as percentage of baseline levels.

Quantification of vector genomes and transgene mRNA in liver. Vector genomes in liver were quantified by quantitative PCR (TaqMan Universal Master Mix, Applied Biosystems, Foster City, CA) as described previously (P. Bell et al., Analysis of tumors arising in male B6C3F1 mice with and without AAV vector delivery to liver. Mol Ther 14, 34 (Jul, 2006)). RNA isolation and RT-qPCR was performed as described previously (L. Wang et al., Meganuclease targeting of PCSK9 in macaque liver leads to stable reduction in serum cholesterol. Nat Biotechnol 36, 717 (Sep, 2018)).

Immunohistochemical staining and in situ hybridization. Immunohistochemical staining to detect hLDLR protein was performed as previously described (S. H. Kassim et al., Gene therapy in a humanized mouse model of familial hypercholesterolemia leads to marked regression of atherosclerosis. PLoS One 5, el3424 (2010)). In situ hybridization for hLDLROl 1 was performed as previously described using Z-shaped probe pairs binding to hLDLROl 1 (L. Wang et al., Meganuclease targeting of PCSK9 in macaque liver leads to stable reduction in serum cholesterol. Nat Biotechnol 36, 717 (Sep, 2018)).

Statistical analyses. An unpaired Student’s t-test was used for comparison of vector genome copies between female and males, Comparisons between multiple groups for reduction of cholesterol levels or mRNA levels were performed using one-way analysis of variance (ANOVA; Dunnett’s multiple comparison test). All values are expressed as mean ± standard deviation (STD).

E. Time course of LDLR expression in DKO mouse liver

A double knockout LDLR ^Apobec ⁷ mouse model (DKO mouse) of homozygous FH (HoFH) was established. To evaluate the kinetics of IVS.hLDLRO 11 -triple vector for sustainable expression over the period of 120 days, we dosed male DKO mice with i.v. administration of AAV8.IVS.hLDLR011 -triple vector at a high dose of 7.5E12 GC/kg. This is the same dose used as the cohort 2 dose of the current AAV 8 gene therapy trial for HoFH (NCT02651675, A Gene Therapy Study for Homozygous Familial Hypercholesterolemia (HoFH). Clinicaltrials.gov). One day after dosing, LDL-C levels were quickly reduced by 77%, and by day 3, the LDL-C were cleared and barely detectable and remained that way till the end of study (day 120) (FIGs. 7A and 7F). A stable reduction of LDL-C levels in the serum is observed at multiple time points after the gene transfer (FIG 7A and FIG 7E). We harvested liver tissues (n=5 mice/time point) on day 1, 3, 7, 14 and 120 after vector infusion and collected serum samples. Transduction efficiency of hepatocytes are measured by qPCR analysis revealed diploid vector genome copy per cell at day 1 that decreased two-fold at different time points and transgene hLDLR mRNA expression at different time points, showed stable expression (FIG 7B and 7C). We detected a 4-fold reduction of vector genome in liver between day 14 and day 120. On the other hand, hLDLR mRNA expression kept increasing from day 1 till day 14, then decreased on day 120 by 3.6-fold, a rate similar to vector DNA reduction. Compared to Day 1, hLDLR protein expression is 2-3 fold higher (FIG 7D) at days 3, 7, 14 and 120 were the relative expression is analyzed by WES. Liver samples collected at each time point were also subjected to IHC and IHC staining and in situ hybridization (ISH) analysis for detection of LDLR protein and hLDLR DNA and mRNA in liver. Both mRNA and LDLR protein were detectable one day after dosing and kept increasing till day 7 to day 14. On day 120, both IHC and ISH signals were significantly reduced, consistent with the RT-qPCR results (FIGs. 7C). Despite the observation of hLDLR expression cassette being gradually removed, a sustained hLDLR production in both RNA and protein levels along with low LDL level were revealed over the entire observation period until day 120 post rAAV administration. There observations were then compared with NHPs administrated with the low dose of the particles. See, FIGs 8A to 8C.

F. IVS.hLDLRO11 and IVS.hLDLRO11 -triple shows partial resistant to degradation via PCSK9 or IDOL pathways

The liver plays a crucial role in maintaining cholesterol homeostasis, by tightly regulating the LDLR expression and negative feedback mechanism to regulate the plasma cholesterol and maintain intracellular cholesterol homeostasis (Goldstein JL, DeBose-Boyd RA, Brown MS. Protein Sensors for Membrane Sterols. Cell. 2006; 124:35-46). Hepatic LDLR is tightly regulated at the transcriptional level by sterol regulatory element-binding protein (SREBPs) and at the post-transcriptional level by Pro-protein convertase subtilisin/kexin type 9 (PCSK9) pathway and by inducible degrader of LDLR (IDOL) pathway (Zelcer N, Hong C, Boyadjian R, Tontonoz P. Lxr regulates cholesterol uptake through idol-dependent ubiquitination of the ldl receptor. Science. 2009; 325:100-104, [PubMed: 19520913]). SREBPs control the regulation of both PCSK9 and LDLR expression, which primarily affects the statin treatment. Statins reduced the LDL-C indirectly by increasing the LDLR over-expression, and its effect is diminished by increased expression of PCSK9 (Statins upregulate PCSk9, the gene encoding the proprotein convertase neural apoptosis-regulated convertase- 1 implicated in familiar hypercholesterolemia. Arterioscler Thromb Vase Biol.2004; 24: 1454-1459. Pubmed: 15178557; Plasma PCSK9 is increased by fenofibrate and atorvastatin in a non-additive fashion in diabetic patients. Atherosclerosis. 2010; 212: 246-251. Pubmed : 2069837). Based on human genetics studies and molecular mapping, the binding interface between PCSK9-LDLR plays a crucial role in the regulation of circulating levels of LDL-C. Thus, PCSK9 becomes therapeutic targets; numerous clinical trials successfully have shown that PCSK9 inhibitors have reduced LDL-C levels up to 70% with an excellent safety profile (N Engl J Med 2014; 370: 1809-1819; J Am Coll Cardiol 2014; 63:2531-2540).

Overexpression of hLDLROl 1 and hLDLROl 1 -triple mutant showed resistance to regulation by PCSK9 or IDOL pathway (FIGs 12A-12E and FIGs 13A-13E) in the presence of hPCSK9 or hIDOL expression vector. For impact of hPCK9 on the efficacy of LDL reduction, male DKO mice is administrated intravenous injection of an AAV9 vector expression human PCSK9 (2X10¹¹ GC/kg) along with the WT-LDLR or hLDLR variants expressing vector at two different doses 1 X 10¹¹ and 3 X 10¹¹ GC/kg. LDL cholesterol levels were measured in the serum collected from the mice before and 14, 28 days after gene transfer. FIG 12A, shows level of hPCSK9 expressed in male DKO mice at 14 and 28 days after the gene transfer. FIG 12B and FIG 12C show percent change in day 14 LDL cholesterol levels relative to baseline levels in mice that received 1 X 10¹¹ and 3 X 10¹¹ GC/kg AAV8.hLDLR or AAV8.hLDLR variants. FIG 12D and FIG 12E show percent change in day 28 LDL cholesterol levels relative to baseline levels. FIG 12F show total liver lysate proteins were separated by WES system and probed for hLDLR expression. Tubulin and ERp72 expression were used as a loading control. Representative blots are shown in the lower panel, and quantitative analysis is presented in the upper panel.

For impact of hIDOL on the Efficacy of LDL Reduction, male DKO mice (n=5 per group) were systemically administrated (i.v.) with 1 X 10¹¹ and 3 X 10¹¹ GC/kg AAV8.hLDLR or AAV8.hLDLR variants along with 5 X 10¹² GC/kg of AAV9.hIDOL vector. LDL cholesterol levels were measured in the serum collected from the mice before and at 14, 28 days after gene transfer. FIG 13A and FIG 13B show percent change in day 14 LDL cholesterol levels relative to baseline levels in mice that received 1 X 10¹¹ and 3 X 10¹¹ GC/kg AAV8.hLDLR or AAV8.hLDLR variants. FIG 13C and FIG 13D show percent change at day 28 of LDL cholesterol levels relative to baseline levels. FIG 13E shows total liver lysate proteins were separated by WES system and probed for hLDLR expression. ERp72 expression was used as a loading control. Representative blots are shown in the lower panel, and quantitative analysis is presented in the upper panel.

Comparison of efficacy of LDL reduction in Male and Female DKO mice -

To evaluate if gene transfer efficiency was different between male and female DKO mice, we measured vector genome copies in the day 28 liver samples from IVS2.hLDLR011-T treated male and female mice. Male and female DKO mice (n=5 per group) are transduced with 3 X 10¹¹ GC/kg AAV8 vector expressing wild type hLDLR and different codon optimized hLDLR variants. LDL cholesterol levels are measured at 28 days after the gene transfer.

G. Construction of the hLDLR expression cassettes.

From the clinical approach point of view, the success of gene therapy treatment for Homozygous familial hypercholesterolemia (HoFH) would depends on dose-dependent vector efficacy, vector toxicity, and host immune response to the vector. An ideal clinical candidate vector should be able to achieve efficacy at a low vector dose without eliciting toxicity and host immune responses to the vector and transgene product. In this study, we aimed to develop a more efficient second generation AAV vector for gene therapy of HoFH through codon optimization and vector optimization. Here, we report that the combination of codon optimization and vector construct optimization increase the efficacy of AAV.hLDLR vector by 10-fold. Combining with an efficient liver tropic AAV capsid and the triple mutant, this vector has great potential to achieve clinical benefits in HoFH patients at a safe dose.

Improve LDLR expression by codon engineering

To improve expression levels of human LDLR in the AAV vector, we first incorporated the Kozak sequence in front of the start codon since the wild-type (WT) hLDLR sequence does not contain the Kozak consensus sequence, which has been shown to enhance translation from the correct initiation codon. However, when comparing two vectors in in LDLR-/-, APOBEC-1-/- double knockout (DKO) mice, the two groups of mice showed similar levels of reduction of LDL-C 14 days after vector treatment. Since codon engineering has been shown to increase transgene expression levels in AAV vectors, we designed four engineered hLDLR cDNA sequences using different algorithms (LDLR-001, LDLR-011, LDLR-201, and LDLR-026). We replaced the WT hLDLR cDNA sequence in the AAV vector with each of the four engineered cDNA sequences and packaged each construct with AAV 8 capsid for in vivo evaluation in DKO mice (male double knock of LDLR-/- and apolipoprotein B mRNA editing enzyme catalytic (APOBEC-1)).

To determine which of the engineered hLDLR constructs reduce serum non-HDL cholesterol more efficiently, we performed a pilot study by injecting 4.0 x 10¹¹ GC/kg AAV8- hLDLR vectors intravenously in male DKO mice. Fourteen days after vector treatment, serum non-HDL cholesterol levels reduced: AAV8.hLDLR-WT by 68%, hLDLR-Kozak by 67%, hLDLROOl by 87%, hLDLROl 1 by 90%, hLDLR201 by 74%, and hLDLR026 by 17%). The hLDLR026 variant showed significantly less efficient reduction compared to hLDLR-WT indicating the influence of cDNA sequence on transgene expression levels and not all engineered sequences would lead to improved expression.

We further evaluated the dose effect of hLDLROl 1 at two lower doses, 1.2 xlO¹¹ GC/kg and 4.0 xlO¹⁰ GC/kg. hLDLROl 1 did not show efficient reduction at 4 x 10¹⁰ GC/kg. At 1.2 x 10¹⁰ GC/kg, hLDLROl 1 showed 61% reduction of LDL-C, similar to hLDLR-WT at 4 xlO¹⁰ GC/kg, suggesting hLDLROl 1 is about 3-fold more efficient than hLDLR-WT. Based on the pilot study data, we proceeded with LDLR011 as the cDNA sequence for further vector optimization.

Improve LDLR expression by vector engineering

To further improve hLDLR expression from AAV vectors containing the liver- specific thyroxine-binding globulin (TBG) promoter, we evaluated the effects of a different intron sequence -intervening sequence 2 (IVS) of human beta globin gene, or the effects of WPRE at the 3 ’end of the cDNA in the expression cassette. These two elements have been previously used in AAV vectors for gene therapy of hemophilia B and showed efficient expression of factor IX (L. Wang, K. Takabe, S. M. Bidlingmaier, C. R. Ill, I. M. Verma, Sustained correction of bleeding disorder in hemophilia B mice by gene therapy. Proc Natl Acad Sci U S A 96, 3906 (Mar 30, 1999); L. Wang, T. C. Nichols, M. S. Read, D. A. Bellinger, I. M. Verma, Sustained expression of therapeutic level of factor IX in hemophilia B dogs by AAV -mediated gene therapy in liver. Mol Ther 1, 154 (Feb, 2000)). In addition, we introduced the previously demonstrated gain-of- function triple mutations to confer partial resistance to LDLR degradation via PCSK9 or IDOL pathway to the hLDLROl 1 cDNA sequence (Somanathan S, Jacobs F, Wang Q, Hanlon AL, Wilson JM, Rader DJ. AAV vectors expressing LDLR gain-of-function variants demonstrate increased efficacy in mouse models of familial hypercholesterolemia. Circ Res. 2014; 115:591— 599).

In the DKO mouse model, the effects of introns and WPRE were evaluated. We administered the WT-hLDLR and hLDLR variants vector to DKO mice at three different dosages (1.0E11, 3.0E11, and 1.0E12 GC/kg) to evaluate the dosage effect of LDL-C reduction in male DKO mice at day 14 and 28 days after administration of the vectors. (IHC and In situ hybridization (ISH) detected hLDLR protein in liver on day 28 post injection of male animals treated with 3xl0^u GC/kg or lxlO¹² GC/kg of the rAAV) We noted that compared to PBS injected control DKO mice, hLDLR-WT and hLDLR variants vector at the low dose induced a modest reduction (70% reduction compared to the baseline values) and hLDLR variants performed slightly better in 2-fold reduction of LDL-C compared to wild type hLDLR vectors. At 3E11 and 1E12 GC/kg vector dose, hLDLR variants showed 5-fold increased reduction compared to wild type hLDLR vectors. IHC staining and ISH analysis of liver showed a high-level expression of hLDLR on day 28 liver sections. To confirm the roles of IVS2 and WPRE in enhancing hLDLR mRNA levels, we compared the hLDLR mRNA levels in the liver of male DKO mice treated with 1E12 GC/kg of hLDLR vectors. IVS2-containing vectors showed 5.7- and 3.6-fold higher levels than PI-hLDLR-WT or PI-hLDLROl 1, respectively. WPRE-containing vector showed 3.6-and 2.4-fold higher than hLDLR-WT or PI-hLDLROl 1, respectively. The IVS intron demonstrated a better efficacy compared to the PI intron while addition of a WPRE sequence did not provide any detectable change.

We then compared the efficacy of the hLDLR-WT and four of the engineered hLDLR vectors in both female and male mice at two vector doses (3E11 and IE 12 GC/kg) at 14 and 28 days after vector administration. In female DKO mice, hLDLR-WT vector was not effective at the 3E11 GC/kg dose to reduce serum LDL-C. LDL levels were the same as PBS- treated control mice (FIGs. 14A and 14B). Vectors containing hLDLROl 1 all showed significantly reduction of LDL-C levels, with the vectors containing IVS2 or WPRE showed higher reduction than PI.hLDLROl 1. At 1E12 GC/kg, all vectors were effective to reduce the serum LDL-C levels significantly, with IVS2.hLDLR011 showing the most significant reduction (95% reduction compared to the baseline values). Interestingly, male DKO mice showed more robust reduction compared to female mice. Male mice treated with hLDLROl 1 vectors showed 93-98% reduction of LDL-C on day 14 post vector treatment, while the hLDLR-WT vector- treated mice showed 52% of reduction (FIGs. 14A and 14B). At 1E12 GC/kg dose, LDL-C levels in hLDLROl 1 vector treated mice became almost undetectable. We therefore treated the male with a lower dose at IE 11 GC/kg. At this low dose, vectors containing IVS2 or WPRE showed more significantly reduction than PI.hLDLROl 1 and were similar to the PI.hLDLROl 1 at 3E11 GC/kg, indicating the effects of IVS2 and WPRE is about 3-fold. Immunohistochemical (IHC) staining on hLDLR on liver harvested at d28 post vector treatment showed strongest staining on the linings of most hepatocytes in male DKO mice treated with hLDLROl 1 vector compared to fewer positive hepatocytes in female DKO mice. Male mice had significantly higher (5- to 8-fold higher) vector genome copies in the liver than the female mice. Males treated with 3E11 GC/kg had similar vector genome copies as the female mice treated with IE 12 GC/kg, suggesting AAV8 gene transfer was about 3-fold higher in male DKO mice than in female mice.

IVS.hLDLRO 11. triple was efficient at 0.16 GC/cell and achieved 98% of LDL reduction.

Example 3 - Development of AAV3B variants with better liver transduction in nonhuman primates by directed evolution

Adeno-associated virus (AAV) mediated gene therapy becomes a promising way to treat diseases, especially rare diseases that have very few effective treatments. AAVs isolated from natural sources have limitations in terms of gene deliver efficiency and specificity. Directed evolution has been used to generate AAV mutants that may overcome those drawbacks.

We used a scorecard approach to generate the initial diversity on AAV3B hyper variable region (HVR) VIII. See, FIGs. 21A to 21D. We then conducted selections in human- hepatocytes-xenografted Fah^_/_/Rag2^_/_/I12rg^_/_ (FRG) mice, by injecting the libraries intravenously and retrieving AAV cDNA from human hepatocytes isolated from those mice to prepare new libraries for the next rounds. Sixteen AAV3B variants that showed dramatic increase of relative frequencies were evaluated in nonhuman primates (NHPs) with a validated barcodes system. Most of the 16 variants were clearly better than AAV3B in terms of liver transduction, with some showing high liver specificity. Two variants were further evaluated with a therapeutic transgene for liver gene therapy in NHPs and the preliminary results confirmed the NHP barcode evaluation result.

To set up an AAV directed evolution platform comprising of: 1) A scorecard approach to produce the initial diversity;

2) The selection with the FRG mouse model that is more clinically relevant;

3) A barcode evaluation system to improve evaluation efficiency and accuracy. A. Methods

The AAV3B variants were isolated by directed evolution (library construction and FRG mouse selection) and further selected/evaluated with barcode evaluation.

Library construction

1. We generated a DNA fragment by PCR with Q5 DNA polymerase (NEB) and Primer 01 + Primer 02.

2. We then loaded the fragment into AAV library backbone in a “scarless” way (by using the unique property of restriction enzyme BsmBI whose recognition site is different from its cleavage site) and performed electroporation to generate the initial library L3BSCAR0 (Its map and sequence are L3BSC). See, FIG. 20A. 3. The plasmid library was then transfected into HEK293 cells along with the plasmids pAdAF6 and pRep to produce the packaged AAV library.

FRG Mouse selection

To select the library for human liver tropism, we injected intravenously the packaged AAV library into human-hepatocytes-xenografted Fah^_/_/Rag2^_/_/I12rg^_/_ (FRG) mice (Yecuris, OR, USA) at a dose of > 1 xlO¹² GC/mouse. Four weeks later, we harvested the hepatocytes with collagenase perfusion. Human hepatocytes were then enriched by treating the hepatocytes with anti H-2kb antibody coated magnetic beads to remove the murine hepatocytes. The AAV signal was then retrieved from the human hepatocytes by RT-PCR with Q5 DNA polymerase, Primer03 and Primer04 and then loaded into the library backbone to generate a new library (Its map and sequence are still L3BSC) for the next round of selection.

The diversity change (variant frequency changes) was monitored by next generation sequencing (NGS).

After two rounds of FRG mouse selection, we picked 16 variants (the variants have the highest frequencies) and used the barcode evaluation system to evaluate their performance.

The barcode evaluation system

The DNA barcodes can evaluate multiple testing articles, each tagged with a DNA barcode, at the same time, by reading the frequency changes of each barcode before and after the treatments. Our barcode evaluation system was used to evaluate the performance of various AAV capsids at the same time. The key component of the system was a series of barcoded cis plasmids, each of the plasmids carrying a unique 6-bp DNA barcode. Those cis plasmids were identical except the DNA barcodes. The backbone of those cis plasmids was the cis plasmid for self-complementary AAV vectors - a transgene cassette flanked by a defective ITR (AITR) at the cassette’s 5’ end and a normal ITR at its 3’ end. The transgene cassette (see, FIG. 20C) was CB8 promoter — SV40 intron — eGFP — SV40 polyA signal, with

1) that all the ATGs within the eGFP are removed so no protein is expressed - the resulting ORF is named as dEGFP (dead eGFP); and

2) that the 6-bp barcode is inserted right after the dEGFP.

A barcoded cis plasmid was mixed with pAdAF6 and the trans plasmid carrying an AAV capsid gene to be tested, for triple-transfection into HEK293 cells to produce an AAV vector prep. Each vector in the prep had the tested capsid as its capsid and carries in its genome the DNA barcode from the cis plasmid. Therefore, the barcode was linked to the tested capsid.

For multiple capsids to be tested, the AAV vector preps were produced individually so each capsid linked to a unique DNA barcode. The preps were then pooled together for animal studies. After the pooled vectors were injected into animals, various tissues were then collected and preserved in RNA later solution. PCR and RT-PCR can then be carried out and the barcode frequencies are then read by NGS.

Collect tissues into RNAlater (Qiagen). Store the preserved samples at -20°C or -80°C. Use Trizol (Ambion) to extract RNA, by following the manufacturer’s instructions. DNase I treatment: 100 pL reaction system, 2 pL of DNase I recombinant, RNase-free (Roche, 10 U/pL), < 100 pg Trizol-extracted RNA, 37°C 1 hour. Use RNeasy Mini Kit (Qiagen) to do the cleanup, by following the manufacturer’s instructions. Follow RT’s manual (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems) to do the RT, with oligo dT (Invitrogen, Cat # 18418012, 0.1 pg oligo dT/1 pg total RNA). 1 pg total RNA/10 pL reaction. RT - controls included. PCR: Q5 DNA polymerase. For 50 pL reaction, < 5pL cDNA, 2.5 pL of 10 pM Primer05 and 2.5 pL of 10 pM Primer06. 98 °C 30s, x cycles of (98 °C 10s, 72 °C 17s), 72 120s, 4°C infinite. The PCR products are read by NGS to obtain the frequencies of the barcodes in the samples. B. Creation of vectors with high tropism to human hepatocytes and low recognition by NAbs based on engineered forms of AAV3B.

To develop novel AAV capsid with high liver tropism and neutralizing antibody escape, monoclonal antibodies were previously generated from screening human PBMC, and alanine scanning of HVR V and HVR VIII were performed to study the key amino acid in AAV3B-antibody binding. When no single point mutation was found to have deterministic effect, we examined the HVR VIII of AAV3B and focused on the non- conserved amino acids compared to the other AAV serotypes. AAV3B VPlwas aligned with that of 180 other AAVs, and 10 amino acids between 582-594 were chosen based on their variability among the aligned sequences. In order to maximize the viability of the mutant, degenerate codons were designed with the intention to introduce alternative amino acids appeared in other AAVs at the aligned position. The underlining assumption is that the alternatives appeared in other serotypes are more likely to result in packageable vectors. When it is not possible to address all the alternative amino acids using degenerate codon, amino acids of similar size but different charge group were introduced. The mutant capsid sequences were cloned into the AAV capsid expression plasmid, mixed with helper plasmid (pAdAF6) and pRep, and then transfected into 293 cells to produce the packaged AAV library by Penn Vector Core.

FRG mice xenografted with human hepatocytes were used to select AAV mutants with human liver tropism from the library. FRG stands for triple mutant of Fah(-/-), Rag-2(-/-) and IL2rg(-/-). The Fah is a gene in the catabolic pathway for tyrosine, and its deletion leads to liver damage unless the drug 2-(2-nitro-4-trifluoromethylbenzoyl) 1,3-cyclohexedione (NTBC) is supplemented to block the accumulation of the toxic metabolite. When NTBC is withdraw, hepatocyte from human donor can be introduced, and the double knockout of Rag-2(-/-) and IL2rg(-/-) cause severe immune-deficiency and allows the survival of the human hepatocyte. FRG mice with repopulated human hepatocyte were purchased from Yecuris (Tigard, OR, USA) and injected with the library intravenously at, minimally, 1 x 10¹² GC per animal. At day 28, the livers were perfused with collagenase to harvest the hepatocytes. Among the 4 animals injected, up to 40 million human hepatocytes were recovered with over 95% viability. Magnetic beads with anti- H2-kb, which is a mouse specific marker, were used to remove mouse hepatocytes from the harvested cells. Primers targeting the designed mutations were applied to produce DNA fragments containing HVR VIII via RT-PCR. The DNA fragments were cloned back into the capsid expression plasmid to proceed with the next round of selection/enrichment.

To select vectors with high tropism to human hepatocytes from the library, we injected an AAV3B library into FRG mice xenografted with human hepatocytes. RNA fragments recovered from the isolated human hepatocytes was subjected to RT-PCR using primers flanking the engineered HVRVIII region and re-cloned into a cis-plasmid designed to express AAV3B VP1 for repeat selection. We performed next generation sequencing (NGS) on the libraries from before selection (denoted as ARO), after first round (AR1) and the plasmid after second round of humanized FRG selection (AR2) and examined the frequency of each variant. The 18 highest frequencies AAV3B variants observed in AR2 was found to have consistently increasing normalized frequencies in the library sequenced, which suggests that these variants may have relative advantage in transducing human hepatocytes. The amino acid and DNA sequences shown in the sequence listing are enclosed herein.

To further narrow down the candidates for clinical candidates, we compared the top AAV3B variants selected from the FRG mice in NHP using barcoded transgene. Self complimentary AAV vectors were designed with silenced GFP transgene which has a 6- nucleotide barcode added right after the ORF on the 5’ end before the poly (A) signal. The barcodes are uniquely paired with mutant capsids and produced as individual vectors. The barcode system was first tested in mice, and a barcode found to enhance transgene RNA level relative to the vector DNA in the same tissue was disqualified. Two groups of 10 vectors, including AAV3B variants, AAV8 and AAV3B as the control, were injected intravenously in 2 NHPs at 2 x 10¹³ GC/kg. 7 days after the vector administration, the necropsies were performed and the liver tissues were collected. NGS was performed on the cDNA PCR from the vector retained from injection and the cDNA from RT-PCR the tissue isolated RNA to count the frequency of each barcode. The normalized frequencies per barcode in each tissue was then further compared against the frequencies at injection and the relative change of barcode representing AAV3B before and after injection. See, FIGs. 23A to 23F. The figures show the barcode study results from liver samples of animal B6134 and V208L. Barcode 1 and 11 (BC01 and BC 11) were packaged with AAV8 and AAV3B respectively. Based on the relative fold change (normalized frequencies in tissue/normalized frequencies in retained vector) of the corresponding barcodes, most AAV3B mutant capsids we tested in the barcode study showed improved liver tropism compared to AAV3B.

These results indicate that our platform work and we obtained promising AAV3B variants with good liver transduction in NHPs. The AAV3B variants substantially reduce the cost of liver targeting gene therapy by both improving the gene transfer efficiency and the production yield compared to the current gold standard, AAV8.

The relative potency of the AAV3B variants are evaluated in FRG mice. All publications cited in this specification are incorporated herein by reference, as is US Provisional Patent Application No. 63/025,731, filed Mary 15, 2020, and US Provisional Patent Application No 62/924,074 filed on October 21, 2019. Applicant hereby incorporates by reference the Sequence Listing material in the accompanying file labelled " 19- 905 lPCT_ST25.txt". Similarly, the SEQ ID NOs which are referenced herein and which appear in the appended Sequence Listing are incorporated by reference. While the invention has been described with reference to particular embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

CLAIMS:

1. A recombinant adeno-associated viral particle (rAAV) comprising an AAV capsid and a vector genome packaged therein, wherein the vector genome comprises an inverted terminal repeats (ITRs) and an engineered nucleic acid sequence encoding at least a signal peptide and a functional human low-density lipoprotein receptor (hLDLR) under control of regulatory sequences which direct the hLDLR expression, wherein the functional hLDLR protein comprises an amino acid sequence of amino acid (aa) 22 to aa 860 of SEQ ID NO: 1 or an amino acid sequence of aa 22 to aa 860 of SEQ ID NO: 2, and wherein the hLDLR coding sequence comprises a sequence of nucleotide (nt) 64 to nt 2580 of SEQ ID NO: 3 or a sequence sharing a 95% to 99.9% identity thereto.

2. The rAAV according to claim 1, wherein the hLDLR coding sequence comprises a sequence of nt 64 to nt 2580 of SEQ ID NO: 3.

3. The rAAV according to claim 1, wherein the hLDLR coding sequence comprises a sequence of nt 64 to nt 2580 of SEQ ID NO: 4.

4. The rAAV according to any one of claims 1 to 3, wherein the signal peptide comprises a sequence of aa 1 to aa 21 of SEQ ID NO: 1.

5. The rAAV according to any one of claims 1 to 4, wherein the signal peptide coding sequence comprises nt 1 to nt 63 of SEQ ID NO: 3 or a sequence sharing a 95% to 99.9% identity thereto.

6. The rAAV according to any one of claims 1 to 5, wherein the rAAV is suitable for delivery of the vector genome in a liver cell.

7. The rAAV according to any one of claims 1 to 6, wherein the regulatory sequences comprise a promoter.

8. The rAAV according to claim 7, wherein the promoter is a liver specific promoter.

9. The rAAV according to claim 7 or claim 8, wherein the promoter is a Human thyroxine binding globulin (TBG) promoter.

10. The rAAV according to any one of claims 1 to 9, wherein the regulatory sequences comprise one or more of a polyadenylation (poly A) sequence, an intron, and an enhancer.

11. The rAAV according to any one of claims 1 to 10, wherein the regulatory sequences comprise multiple enhancers in tandem.

12. The rAAV according to any one of claims 1 to 11, wherein the regulatory sequences comprise an alpha- 1 microglobuliri/bikunin (ABP) enhancer.

13. The rAAV according to any one of claims 1 to 12, wherein the regulatory sequences comprise a human b-globin intron 2.

14. The rAAV according to any one of claims 1 to 13, wherein the regulatory sequences comprise a bovine growth hormone (bGH) polyA sequence.

15. The rAAV according to any one of claims 1 to 14, wherein the vector genome comprises a sequence of SEQ ID NO: 5 or SEQ ID NO: 6.

16. The rAAV according to any one of claims 1 to 15, wherein the AAV capsid has liver tropism.

17. The rAAV according to any one of claims 1 to 16, wherein the AAV capsid is an AAV3B variant capsid selected from AAV3B.AR2.08 or AAV3B.AR2.16.

18. A recombinant vector for producing an rAAV according to any one of claims 1 to 17.

19. The recombinant vector according to claim 18, wherein the vector is a plasmid.

20. A pharmaceutical composition comprising an rAAV according to any one of claims 1 to 17 and a formulation buffer.

21. The pharmaceutical composition according to claim 20, wherein the formulation buffer is suitable for intravenous delivery or for peripheral vein infusion.

22. A method for treating familial hypercholesterolemia or a disease associated with hLDLR, comprising administrating an effective amount of the rAAV according to any one of claims 1 to 17 to a subject in need thereof.

23. The method according to claim 22, wherein the rAAV or the vector is administered intravenously or via peripheral vein infusion.

24. The method according to claim 22 or claim 12, wherein the rAAV or the vector is administered at a dose from 1 x 10⁷ genome copies (GC) per kilogram (kg) body weight to 1 x 10¹⁴ GC per kg body weight.

25. The method according to any one of claims 22 to 24, further comprising administrating an immunosuppressant to the subject.

26. The method according to any one of claims 22 to 25, wherein the low-density lipoprotein (LDL) level in a biological sample of the subject is decreased after the administration of the rAAV or vector.

27. The method according to any one of claims 22 to 26, wherein a disease symptom of the subject is ameliorated after administration of the rAAV or vector.

28. The method according to any one of claims 22 to 27, wherein the disease progression is delayed after administration of the rAAV or vector.

29. An rAAV according to any one of claims 1 to 17, or a pharmaceutical composition according to any one of claim 20 or 21, for use in a regimen for treating familial hypercholesterolemia or a disease associated with hLDLR.

30. An rAAV production system useful for producing an rAAV according to any one of claims 1 to 17, wherein the production system comprises a cell culture comprising:

(a) a nucleic acid sequence encoding an AAV capsid protein,

(b) the vector genome; and

(c) an AAV rep function and a helper functions sufficient to permit packaging of the vector genome into the AAV capsid.

31. The rAAV production system according to claim 30, wherein the cell culture is a human embryonic kidney 293 cell culture.

32. Use of an rAAV according to any one of claims 1 to 17, or a pharmaceutical composition according to any one of claim 20 or 21, for treating familial hypercholesterolemia or a disease associated with hLDLR.

33. Use of an rAAV according to any one of claims 1 to 17, or a pharmaceutical composition according to any one of claim 21 to 21, for preparing a medicament.