WO2021078834A1 - Chimeric acid-alpha glucosidase polypeptides and uses thereof - Google Patents

Chimeric acid-alpha glucosidase polypeptides and uses thereof Download PDF

Info

Publication number
WO2021078834A1
WO2021078834A1 PCT/EP2020/079695 EP2020079695W WO2021078834A1 WO 2021078834 A1 WO2021078834 A1 WO 2021078834A1 EP 2020079695 W EP2020079695 W EP 2020079695W WO 2021078834 A1 WO2021078834 A1 WO 2021078834A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
gaa
capsid
nucleic acid
polypeptide
Prior art date
Application number
PCT/EP2020/079695
Other languages
French (fr)
Inventor
Pasqualina COLELLA
Francesco PUZZO
Federico Mingozzi
Original Assignee
Genethon
Universite D'evry Val D'essonne
INSERM (Institut National de la Santé et de la Recherche Médicale)
Sorbonne Universite
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genethon, Universite D'evry Val D'essonne, INSERM (Institut National de la Santé et de la Recherche Médicale), Sorbonne Universite filed Critical Genethon
Publication of WO2021078834A1 publication Critical patent/WO2021078834A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/0102—Alpha-glucosidase (3.2.1.20)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/59—Follicle-stimulating hormone [FSH]; Chorionic gonadotropins, e.g. HCG; Luteinising hormone [LH]; Thyroid-stimulating hormone [TSH]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)

Definitions

  • the present invention relates to chimeric acid-alpha glucosidase polypeptides and uses thereof.
  • Said chimeric polypeptides comprise a functional acid-alpha glucosidase polypeptide fused to one or more heterologous moieties.
  • Pompe disease also known as glycogen storage disease (GSD) type II and acid maltase deficiency, is an autosomal recessive metabolic myopathy caused by a deficiency of the lysosomal enzyme acid alpha- glucosidase (GAA).
  • GAA is an exo-1,4 and 1,6-a-glucosidase that hydrolyzes glycogen to glucose in the lysosome.
  • Deficiency of GAA leads to glycogen accumulation in lysosomes and causes progressive damage to respiratory, cardiac, and skeletal muscle. The disease ranges from a rapidly progressive infantile course that is usually fatal by 1-2 years of age to a more slowly progressive and heterogeneous course that causes significant morbidity and early mortality in children and adults.
  • Hirschhom RR The Metabolic and Molecular Bases oflnherited Disease, 3: 3389-3420 (2001, McGraw-Hill); Van der Ploeg and Reuser, Lancet 372: 1342-1351 (2008).
  • ERT enzyme-replacement therapy
  • Modified GAA proteins have also been proposed in the past to improve lysosomal storage disease treatment.
  • application W02004064750 and Sun et al. 2006 disclose a chimeric GAA polypeptide comprising a signal peptide operably linked to GAA as a way to enhance targeting of the protein to the secretory pathway.
  • GAA variants were provided to improve current gene replacement therapies for Pompe disease.
  • Said patent applications disclose GAA variants that were shown to be highly secretable and less immunogenic than their wild type counterpart.
  • the present invention relates to a nucleic acid molecule encoding a chimeric GAA polypeptide comprising a functional GAA polypeptide fused to one or more heterologous moieties, wherein at least one of the heterologous moieties is a carboxy-terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCGp).
  • CTP carboxy-terminal peptide
  • hCGp human Chorionic Gonadotropin beta-subunit
  • the chimeric GAA polypeptide comprises a functional GAA polypeptide fused to one heterologous moiety being a CTP of the hCGp.
  • the CTP of the hCGP may be encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, more preferably 100% identity to the nucleotide sequence of SEQ ID NO: 13.
  • the functional GAA polypeptide is encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, to a nucleotide sequence selected from SEQ ID NO: 1-3.
  • the functional GAA polypeptide corresponds to a truncated form of GAA.
  • the functional GAA polypeptide may have 42 consecutive amino acids truncated at its N-terminal end as compared to GAA.
  • the truncated GAA is encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, more preferably 100% identity to the nucleotide sequence of SEQ ID NO: 10.
  • heterologous moiety is fused at the N-terminal end of the functional GAA polypeptide.
  • the chimeric GAA polypeptide further comprises a signal peptide moiety that may have an amino acid sequence selected in the group consisting of SEQ ID NO: 18-22, preferably SEQ ID NO: 21.
  • nucleic acid construct comprising the nucleic acid molecule as described above, linked to a promoter, wherein said nucleic acid construct optionally further comprises an intron.
  • the nucleic acid construct comprises in this order: a promoter; an intron; the nucleic acid molecule as described above ; and a polyadenylation signal.
  • a further aspect of the invention relates to a vector comprising the nucleic acid molecule or the nucleic acid construct of the invention, such as a viral vector, preferably a retroviral vector, such as a lentiviral vector, or an AAV vector.
  • a viral vector preferably a retroviral vector, such as a lentiviral vector, or an AAV vector.
  • the vector is a single-stranded or double-stranded self-complementary AAV vector, preferably an AAV vector with an AAV-derived capsid, such as an AAV1 capsid, AAV2 capsid, variant AAV2 capsid, AAV3 capsid, variant AAV3 capsid, AAV3B capsid, variant AAV3B capsid, AAV4 capsid, AAV5 capsid, AAV6 capsid, variant AAV6 capsid, AAV7 capsid, AAV8 capsid, AAV9 capsid, AAV10 capsid such as AAVcylO capsid and AAVrhlO capsid, AAVrh74 capsid, AAVdj capsid, AAVAnc80 capsid, AAV-LK03 capsid, AAV2i8 capsid, and porcine AAV capsid, such as AAVpo4 capsid and AAVpo6 capsid
  • the invention also relates to an isolated cell transformed with the nucleic acid molecule, the nucleic acid construct or the vector as described above.
  • the invention also relates to a chimeric GAA polypeptide encoded by the nucleic acid molecule of the invention.
  • composition comprising, in a pharmaceutically acceptable carrier, the nucleic acid molecule, the nucleic acid construct, the vector, the isolated cell, or the chimeric GAA polypeptide as described above.
  • nucleic acid molecule for use as a medicament.
  • nucleic acid molecule, the nucleic acid construct, the vector, the isolated cell, or the chimeric GAA polypeptide is for use in a method for treating GSDII (Pompe disease).
  • FIG. 1 Schematic representation of expression cassettes encoding chimeric GAA variants of the invention.
  • the heterologous domains (HD) were cloned at the GAA N-terminus.
  • ITR inverted terminal repeats from AAV2; Promoter: ApoE Enhancer (ApoE) and hepatocyte-specific human alpha 1- antitrypsin promoter (hAAT); intron: optimized human haemoglobin b-subunit synthetic intron (HBB2.1); signal peptide from the human Chymotrypsinogen (sp7); HD: heterologous domain; GAAco: codon optimized GAA; polyA: human bovine growth hormone poly-adenylation sequence; Alb: albumin binding domain; CTP: Carboxyl -Terminal Peptide (CTP) of the Human Chorionic Gonadotropin b Subunit; linker: 3 amino acids linker.
  • ITR inverted terminal repeats from AAV2
  • Promoter ApoE Enhancer (ApoE
  • FIG. 1 Expression of chimeric GAA variants of the invention in human hepatocyte cell cultures.
  • FIG. 3 Activity of GAA variants of the invention in the plasma of C57BL/6 mice following AAV liver gene transfer.
  • Statistical analysis two-way ANOVA with Tukey’s post hoc (treatment and time), multiple comparison “All groups vs. all, time point independent”. Asterisks (*) indicate significant differences as specified in the legend. * p ⁇ 0.05.
  • FIG. 4 Secretion of GAA variants of the invention in the plasma of C57BL/6 mice following AAV liver gene transfer.
  • FIG. 1 Analyses of GAA activity in the tissues of Gaa -/- mice following AAV liver gene transfer of the chimeric HD-CTP variant.
  • Data are shown as mean ⁇ SD.
  • Asterisks (*) and hashtags (#) indicate significant differences versus the groups indicated in the legend; GAA activity in Liver (A), Triceps (B) and Brain (C) is depicted.
  • Statistical analysis one-way ANOVA with Tukey’s post hoc, multiple comparison “All groups vs. all”. * p ⁇ 0.05, #p ⁇ 0.05.
  • FIG. 6 Analyses of GAA immunogenicity in the plasma of Gaa -/- mice following AAV liver gene transfer of the chimeric HD-CTP variant.
  • Statistical analysis one-way ANOVA with Tukey’s post hoc, multiple comparison “All groups vs. all”.
  • Lysosomal acid a-glucosidase or "GAA" (1,4-a-D-glucan glucohydrolase), is an exo- 1,4-a-D-glucosidase that hydrolyses both a- 1,4 and a- 1,6 linkages of oligosaccharides to liberate glucose.
  • GAA glycogen storage disease type II
  • Pompe disease also referred to as Pompe disease (although this term formally refers to the infantile onset form of the disease). It catalyzes the complete degradation of glycogen with slowing at branching points.
  • the 28 kb human acid a- glucosidase gene on chromosome 17 encodes a 3.6 kb mRNA which produces a 951 amino acid polypeptide (Hoefsloot et ah, (1988) EMBO J. 7: 1697; Martiniuk et ah, (1990) DNA and Cell Biology 9: 85).
  • the enzyme receives co-translational N-linked glycosylation in the endoplasmic reticulum.
  • An aspect of the invention relates to a nucleic acid molecule encoding a chimeric GAA polypeptide comprising a functional GAA polypeptide fused to one or more heterologous moieties, wherein at least one of the heterologous moieties is a carboxy-terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCG ).
  • CTP carboxy-terminal peptide
  • hCG human Chorionic Gonadotropin beta-subunit
  • chimeric protein or “fusion protein” is meant proteins created through the joining of two or more genes that originally encode separate proteins.
  • a “chimeric GAA polypeptide” refers to the fusion of:
  • heterologous moieties derived from a polypeptide different from GAA.
  • GAA GAA polypeptide
  • precursor e.g., -110 kDa
  • GAA proteins or fragments thereof that are functional derivatives of GAA, i.e. that retain biological function of GAA (i.e., have at least one biological activity of the native GAA protein, e.
  • GAA variants can hydrolyze glycogen, as defined above) and GAA variants (e.g., GAA II as described by Kunita et ah, (1997) Biochemica et Biophysica Acta 1362: 269; GAA polymorphisms and SNPs are described by Hirschhom, R. and Reuser, A. J. (2001) In The Metabolic and Molecular Basis for Inherited Disease (Scriver, C. R. , Beaudet, A. L., Sly, W. S. & Valle, D. Eds. ), pp. 3389- 3419. McGraw-Hill, New York, see pages 3403-3405).
  • GAA coding sequence known in the art may be used, for example, see SEQ ID NO:l; GenBank Accession number NM_00152 and Hoefsloot et ah, (1988) EMBO J. 7: 1697 and Van Hove et ah, (1996) Proc. Natl. Acad. Sci. USA 93: 65 (human), GenBank Accession number NM_008064 (mouse), and Kunita et al., (1997) Biochemica et Biophysica Acta 1362: 269 (quail).
  • the nucleic acid molecule encodes a chimeric GAA polypeptide comprising any “functional GAA polypeptide”, i.e. it encodes for a GAA protein that, when expressed, has the functionality of wild-type GAA protein.
  • the functionality of wild-type GAA is to hydrolyse both a- 1,4 and a- 1,6 linkages of oligosaccharides and polysaccharides, more particularly of glycogen, to liberate glucose.
  • the functional GAA protein encoded by the nucleic acid of the invention may have a hydrolysing activity on glycogen of at least 50 %, 60 %, 70 %, 80 %, 90 %, 95 %, 99 %, or at least 100 % as compared to the wild-type GAA protein encoded by the nucleic acid sequence of SEQ ID NO: 1 to 3, for example as compared to the GAA polypeptide having the amino acid sequence of SEQ ID NO:4.
  • the activity of the functional GAA polypeptide encoded by the nucleic acid of the invention may even be of more than 100 %, such as of more than 110 %, 120 %, 130 %, 140 %, or even more than 150 % of the activity of the wild-type GAA protein encoded by the nucleic acid sequence of SEQ ID NO: 1 to 3, for example as compared to the GAA polypeptide having the amino acid sequence of SEQ ID NO:4.
  • a skilled person is readily able to determine whether a nucleic acid according to the invention expresses a functional GAA protein.
  • a suitable in vitro method involves inserting the nucleic acid into a vector, such as a plasmid or viral vector, transfecting or transducing host cells, such as 293T or HeLa cells, or other cells such as Huh7, with the vector, and assaying for GAA activity.
  • a suitable in vivo method involves transducing a vector containing the nucleic acid into a mouse model of Pompe disease or another glycogen storage disorder and assaying for functional GAA in the plasma of the mouse and presence of GAA in tissues. Suitable methods are described in more details in the experimental part below.
  • sequence of the nucleic acid molecule of the invention encoding the functional GAA polypeptide preferably has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, in particular at least 95 percent identity, for example at least 98, 99 or 100 percent identity to the nucleotide sequence of SEQ ID NO: 1, 2 or 3, which are sequences optimized for transgene expression in vivo.
  • nucleic acid molecules or two amino acid molecules refers to the sequence identity between two nucleic acid molecules or two amino acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position.
  • the percent of identity between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared X 100. For example, if 6 of 10 of the positions in two sequences are matched then the two sequences are 60% identical. Generally, a comparison is made when two sequences are aligned to give maximum identity.
  • bioinformatic tools known to the one skilled in the art might be used to align nucleic acid sequences such as BLAST or FASTA.
  • the functional GAA polypeptide encoded by the nucleic acid molecule as herein described is a functional, truncated form of GAA.
  • truncated form or “truncated GAA”, it is meant a GAA polypeptide that comprises one or several consecutive amino acids deleted from the N- terminal part of a parent GAA polypeptide.
  • a "parent GAA polypeptide” is a functional, precursor GAA sequence, but devoid of its signal peptide.
  • a complete wild-type GAA polypeptide i.e.
  • GAA a precursor form of GAA
  • SEQ ID NO: 5 or in SEQ ID NO: 6 has a signal peptide (corresponding to amino acids 1-27 of SEQ ID NO: 5 or SEQ ID NO: 6)
  • the parent GAA polypeptide serving as basis for the truncated GAA forms of these wild-type human GAA polypeptides are represented in SEQ ID NO: 7 and SEQ ID NO: 8, respectively and have no signal peptide.
  • the latter corresponding to amino acids 28-952 of SEQ ID NO: 5 and to amino acids 28-952 of SEQ ID NO: 6, is referred to as a parent GAA polypeptide.
  • the truncated GAA polypeptide is a functional GAA polypeptide, i.e. it has the functionality of wild-type GAA polypeptide as defined above.
  • the amino acid sequence of the parent GAA polypeptide or its coding sequence can be derived from any source, including avian and mammalian species.
  • avian as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys and pheasants.
  • mammalian species include, but is not limited to, chickens, ducks, geese, quail, turkeys and pheasants.
  • mammalian species includes, but is not limited to, chickens, ducks, geese, quail, turkeys and pheasants.
  • mammalian species as used herein includes, but is not limited to, humans, simians and other non-human primates, bovines, ovines, caprines, equines, felines, canines, lagomorphs, etc.
  • the parent GAA polypeptide is a human, mouse or quail, in particular a human, GAA polypeptide.
  • the parent GAA polypeptide may be a functional variant of a GAA polypeptide, comprising one or more amino acid modifications such as amino acid insertion, deletion and/or substitution as compared to a known GAA polypeptide.
  • the parent polypeptide may be a functional derivative of a human GAA polypeptide, such as the polypeptide of SEQ ID NO:7 or SEQ ID NO:8, in particular SEQ ID NO:7, having at least 80, 85, 90, 95, 96, 97, 98 or at least 99 percent sequence identity to this human GAA polypeptide.
  • the functional variant of a GAA polypeptide may have between 0 and 50, between 0 and 30, between 0 and 20, between 0 and 15, between 0 and 10, or between 0 and 5 amino acid changes to the parent GAA polypeptide, such as the parent GAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO:8, in particular SEQ ID NO:7.
  • the parent GAA polypeptide may consist of the human GAA polypeptide having the amino acid sequence shown in SEQ ID NO:7 or SEQ ID NO:8, in particular in SEQ ID NO:7.
  • the truncated form of GAA according to the invention is a N-terminally truncated form of a parent GAA polypeptide, wherein at least one amino acid is deleted from the N-terminal end of said parent GAA polypeptide.
  • the truncated GAA polypeptide may have 1 to 75 consecutive amino acids or more than 75 consecutive amino acids truncated from its N-terminal end as compared to the parent GAA polypeptide.
  • the truncated GAA polypeptide may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
  • the truncated GAA polypeptide resulting from the truncation of 1 amino acid in the parent GAA polypeptide is referred to as A 1 GAA truncated form
  • the GAA polypeptide resulting from the truncation of 2 consecutive amino acids from the N-terminal end is referred to as D2 GAA truncated form
  • the GAA polypeptide resulting from the truncation of 3 consecutive amino acids in the parent GAA polypeptide is referred to as D3 GAA truncated form
  • the truncated GAA polypeptide of the invention is a Al, D2, D3, D4, D5, D6, D7, D8, D9, D10, Al l, D12,
  • D70, D71, D72, D73, D74 or D75 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO:8, in particular in SEQ ID NO:7).
  • the truncated GAA polypeptide of the invention is a Al, D2, D3, D4,
  • D45, D46 or D47 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a Al, D2, D3, D4,
  • the truncated GAA polypeptide of the invention is a Al, D2, D3, D4,
  • D45 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D1, D2, D3, D4,
  • GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D1, D2, D3, D4,
  • the truncated GAA polypeptide of the invention is a D1, D2, D3, D4,
  • the truncated GAA polypeptide of the invention is a D2, D3, D4, D5,
  • the truncated GAA polypeptide of the invention is a D3, D4, D5, D6,
  • the truncated GAA polypeptide of the invention is a D4, D5, D6, D7,
  • the truncated GAA polypeptide of the invention is a D5, D6, D7, D8,
  • the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D6, D7, D8, D9 or D10 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), in particular a D7, D8 or D9 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), more particularly a D8 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D27, D28, D29, D30 or D31 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7), in particular a D28, D29 or D30 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), more particularly a D29 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D40, D41, D42, D43, or D44 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7), in particular a D41, D42 or D43 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), more particularly a D42 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D41, D42, D43, D44 or D45 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7), in particular a D42, D43 or D44 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), more particularly a D43 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D27, D28, D29, D30, D31, D40, D41, D42, D43, D44, D45, D46 or D47 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D7, D8, D9, D28, D29, D30, D41, D42, D43 or D44 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D40, D41, D42, D43 or D44, truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D8, D29, D42, D43 or D47 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D8, D29, D42 or D43 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D8 or D42 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a truncated form of a functional human GAA polypeptide.
  • the parent hGAA polypeptide is the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a
  • the truncated GAA polypeptide of the invention is a D1, D2, D3, D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44, D45, D46 or D47 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having
  • the truncated GAA polypeptide of the invention is a D1, D2, D3, D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44, D45 or D46 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75
  • the truncated GAA polypeptide of the invention is a D1, D2, D3, D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44 or
  • D45 GAA truncated form of a hGAA polypeptide and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D1, D2, D3,
  • D44 GAA truncated form of a hGAA polypeptide and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D1, D2, D3,
  • GAA truncated form of a hGAA polypeptide and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D1, D2, D3,
  • the truncated GAA polypeptide of the invention is a D2, D3, D4,
  • the truncated GAA polypeptide of the invention is a D3, D4, D5,
  • the truncated GAA polypeptide of the invention is a D4, D5, D6,
  • the truncated GAA polypeptide of the invention is a D5, D6, D7,
  • the truncated GAA polypeptide of the invention is a D6, D7, D8,
  • the truncated GAA polypeptide of the invention is a D7, D8, D9,
  • the truncated GAA polypeptide of the invention is a D8, D9, D10,
  • the truncated GAA polypeptide of the invention is a D3, D4, D5,
  • the truncated GAA polypeptide of the invention is a D4, D5, D6,
  • the truncated GAA polypeptide of the invention is a D5, D6, D7,
  • the truncated GAA polypeptide of the invention is a D6, D7, D8,
  • the truncated GAA polypeptide of the invention is a D7, D8, D9, D10, Al l, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95
  • the truncated GAA polypeptide of the invention is a D8, D9, A 10, Al l, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO:
  • SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D6, D7, D8, D9 or D10, in particular a D7, D8 or D9, more particularly a D8 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D27, D28, D29, D30 or D31, in particular a D28, D29 or D30, more particularly a D29 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO:
  • SEQ ID NO: 7 or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D40, D41, D42, D43 or D44, in particular a D41, D42 or D43, more particularly a D42 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D41, D42, D43, D44 or D45, in particular a D42, D43 or D44, more particularly a D43 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D27, D28, D29, D30, D31, D40, D41, D42, D43, D44 or D45, in particular a D7, D8, D9, D28, D29, D30, D41, D42, D43 or D44, in particular a D8, D29, D42 or D43 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 8, in particular in S
  • the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D40, D41, D42, D43 or D44, in particular a D8 or D42 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D8, D29, D42, D43 or D47 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D8, D29, D42 or D43 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D8 or D42 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
  • the truncated GAA polypeptide of the invention is a D42 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
  • the truncated GAA polypeptide of the invention is a D42 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO:8, in particular in SEQ ID NO:7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO:7 or SEQ ID NO:8, in particular in SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, in particular in SEQ ID NO: 7.
  • the functional variant of a GAA polypeptide may have, in addition to the truncation defined above, between 0 and 50, between 0 and 30, between 0 and 20, between 0 and 15, between 0 and 10, or between 0 and 5 amino acid changes to the parent GAA polypeptide, such as the parent GAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO:7.
  • the truncated hGAA polypeptide of the invention has an amino acid sequence consisting of the sequence shown in SEQ ID NO: 54, SEQ ID NO: 9, SEQ ID NO: 55, SEQ ID NO: 56 or SEQ ID NO: 57, or a functional variant thereof comprising from 1 to 5 amino, in particular from 1 to 4, in particular from 1 to 3, more particularly from 1 to 2, in particular 1 amino acid substitution as compared to the sequence shown in SEQ ID NO: 54, SEQ ID NO: 9, SEQ ID NO: 55, SEQ ID NO: 56 or SEQ ID NO: 57.
  • the truncated hGAA polypeptide of the invention has an amino acid sequence consisting of the sequence shown in SEQ ID NO: 54, SEQ ID NO: 9, SEQ ID NO: 55 or SEQ ID NO: 56, or a functional variant thereof comprising from 1 to 5 amino acid substitutions as compared to the sequence shown in SEQ ID NO: 54, SEQ ID NO: 9, SEQ ID NO: 55 or SEQ ID NO: 56.
  • the truncated hGAA polypeptide of the invention has an amino acid sequence consisting of the sequence shown in SEQ ID NO: 54 or SEQ ID NO: 9, or a functional variant thereof comprising from 1 to 5 amino, in particular from 1 to 4, in particular from 1 to 3, more particularly from 1 to 2, in particular 1 amino acid substitution as compared to the sequence shown in SEQ ID NO: 54 or SEQ ID NO: 9.
  • the truncated hGAA polypeptide of the invention has an amino acid sequence consisting of the sequence shown in SEQ ID NO: 9 or a functional variant thereof comprising from 1 to 5, in particular from 1 to 4, in particular from 1 to 3, more particularly from 1 to 2, in particular 1 amino acid substitution as compared to the sequence shown in SEQ ID NO: 9.
  • the nucleic acid sequence encoding the functional GAA polypeptide, in particular the truncated GAA polypeptide, can be optimized for expression of the GAA polypeptide in vivo. Sequence optimization may include a number of changes in a nucleic acid sequence, including codon optimization, increase of GC content, decrease of the number of CpG islands, decrease of the number of alternative open reading frames (ARFs) and decrease of the number of splice donor and splice acceptor sites. Because of the degeneracy of the genetic code, different nucleic acid molecules may encode the same protein. It is also well known that the genetic codes of different organisms are often biased towards using one of the several codons that encode the same amino acid over the others.
  • sequence optimized nucleotide sequence encoding a truncated GAA is codon-optimized to improve its expression in human cells compared to non-codon optimized nucleotide sequences coding for the same truncated GAA protein, for example by taking advantage of the human specific codon usage bias.
  • the optimized GAA coding sequence is codon optimized, and/or has an increased GC content and/or has a decreased number of alternative open reading frames, and/or has a decreased number of splice donor and/or splice acceptor sites, as compared to nucleotides 82-2859 of the wild-type hGAA coding sequence of SEQ ID NO:l.
  • nucleic acid sequence of the invention results in an at least 2, 3, 4, 5 or 10 % increase of GC content in the GAA sequence as compared to the sequence of the wild-type GAA sequence.
  • the nucleic acid sequence of the invention results in a 2, 3, 4 or, more particularly, 5% or 10% (particularly 5%) increase of GC content in the GAA sequence as compared to the sequence of the wild-type GAA nucleotide sequence.
  • the nucleic acid sequence of the invention encoding a functional GAA polypeptide is “substantially identical”, that is, about 70% identical, more preferably about 80% identical, even more preferably about 90% identical, even more preferably about 95% identical, even more preferably about 97%, 98% or even 99% identical to nucleotides 82-2859 of the sequence shown in SEQ ID NO: 1.
  • sequence optimization may also comprise a decrease in the number of CpG islands in the sequence and/or a decrease in the number of splice donor and acceptor sites.
  • sequence optimization is a balance between all these parameters, meaning that a sequence may be considered optimized if at least one of the above parameters is improved while one or more of the other parameters is not, as long as the optimized sequence leads to an improvement of the transgene, such as an improved expression and/or a decreased immune response to the transgene in vivo.
  • CAI codon adaptation index
  • a codon adaptation index is herein defined as a measurement of the relative adaptiveness of the codon usage of a gene towards the codon usage of highly expressed human genes.
  • the relative adaptiveness (w) of each codon is the ratio of the usage of each codon, to that of the most abundant codon for the same amino acid.
  • the CAI is defined as the geometric mean of these relative adaptiveness values. Non-synonymous codons and termination codons (dependent on genetic code) are excluded.
  • a nucleic acid molecule encoding a GAA has a CAI of at least 0.75 (in particular 0.77), 0.8, 0.85, 0.90, 0.92 or 0.94.
  • nucleic acid sequence refers to a DNA or RNA molecule in single or double stranded form, particularly a DNA encoding a functional GAA polypetide according to the invention.
  • the part of the nucleic acid molecule of the invention encoding the truncated GAA polypeptide has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, in particular at least 95 percent identity, for example at least 98, 99 or 100 percent identity to the corresponding part of the nucleotide sequence SEQ ID NO: 2 or 3, which are sequence-optimized sequences.
  • the part of the nucleic acid molecule of the invention encoding the truncated GAA polypeptide has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, in particular at least 95 percent identity, for example at least 98, 99 or 100 percent identity to the SEQ ID NO: 10 or SEQ ID NO: 11, preferably SEQ ID NO: 10, encoding the polypeptide having the amino acid sequence shown in SEQ ID NO: 9.
  • the nucleic acid sequence encoding the truncated GAA polypeptide consists of the sequence shown in SEQ ID NO: 10 or SEQ ID NO: 11, preferably SEQ ID NO: 10, encoding the polypeptide having the amino acid sequence shown in SEQ ID NO: 9.
  • the functional GAA polypeptide may be any of the functional GAA polypeptide described in WO2018/046772, WO2018/046775 and WO2018/046774 patent applications.
  • heterologous moiety is meant a peptide moiety issued from a peptide or polypeptide different from GAA.
  • heterologous moiety means any peptide moiety able to improve the activity of GAA in vivo, for example any peptide moiety improving plasmatic stability, plasmatic activity, lysosomal targeting, uptake to the target tissues such as skeletal muscles and/or crossing of the blood brain barrier.
  • nucleic acid molecule of the invention encodes a chimeric GAA polypeptide comprising :
  • heterologous moieties wherein at least one of the heterologous moieties is a carboxy- terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCG ).
  • CTP carboxy- terminal peptide
  • hCG human Chorionic Gonadotropin beta-subunit
  • the carboxy terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCG ) of the present invention comprises the amino acid sequence from amino acid position 138 to position 165 of human chorionic gonadotropin, as set forth in SEQ ID NO: 15.
  • the CTP sequence peptide is 28, 29, 30, 31, 32, 33 or 34 amino acids long.
  • the CTP of the hCG is 28 amino acids long.
  • the CTP of the hCG is a functional variant which differs from the native CTP by 1-5 amino acid substitutions.
  • functional variant is meant any CTP of the hCG able to improve the activity of GAA in vivo.
  • the amino acid sequence of the CTP of the hCG may have a least 85 % identity, at least 90 % identity, at least 92 % identity, at least 95 % identity, at least 98 % identity, or at least 99 % identity to the amino acid sequence of SEQ ID NO: 12.
  • the amino acid sequence of the CTP of the hCG comprises or consists of SEQ ID NO: 12.
  • the CTP of the hCG is encoded by the nucleotide sequence of SEQ ID NO: 13 or by a nucleotide sequence having at least 85 % identity, at least 90 % identity, at least 92 % identity, at least 95 % identity, at least 98 % identity, at least 99 % identity or at least 100 % identity to the nucleotide sequence of SEQ ID NO: 13.
  • the functional GAA polypeptide is fused to at least 1, 2, 3, 4, or at least 5 heterologous moieties, wherein at least one of said heterologous moieties is a CTP of the hCG as defined above.
  • the functional GAA polypeptide may be fused to 1, 2, 3, 4 or 5 heterologous moieties.
  • Heterologous moieties other than CTP of the hCG may be any heterologous moieties able to improve the activity of GAA in vivo, for example any heterologous moiety improving plasmatic stability, plasmatic activity, lysosomal targeting, uptake to the target tissues and/or crossing of the blood brain barrier.
  • the functional GAA polypeptide is fused to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 repeats of the CTP of the hCG as defined above.
  • the functional GAA polypeptide is fused to one (i.e. one and only one) heterologous moiety, wherein the heterologous moiety is a CTP of the hCG as defined above.
  • the one or more heterologous moieties is/are fused to the N-terminal end and/or to the C-terminal end of the functional GAA polypeptide.
  • one heterologous moiety is fused at the N-terminal end, and the same or a different heterologous moiety is fused to the C-terminal end of the functional GAA polypeptide.
  • the one or more heterologous moieties is/are fused to the N-terminal end of the functional GAA polypeptide.
  • one heterologous moiety which is a CTP of the hCG is fused at the N- terminal end of the functional GAA polypeptide.
  • the one or more heterologous moieties are attached to the functional GAA polypeptide sequence via a linker.
  • the linker which connects the one or more heterologous moieties to the functional GAA polypeptide sequence can be a covalent bond or a peptide bond. Any conventional linker leading to a correct folding of the chimeric GAA polypeptide may be used.
  • any linker able to introduce flexibility between the linked domains of the polypeptide may be used.
  • the linker is a Glycine-rich linker.
  • the linker may be any linker described in Chichili et al, Protein Sci. 2013 Feb;22(2): 153-67.
  • the linker has an amino acid sequence selected in the group consisting of : “GAP” (SEQ ID NO: 53), “GGGGSLVPRGSGGGGS” (SEQ ID NO: 36), “GSGSGS” (SEQ ID NO: 37), “GGGGSLVPRGSGGGG” (SEQ ID NO: 38), “GGSGGHMGSGG” (SEQ ID NO: 39), “GGSGGSGGSGG” (SEQ ID NO: 40), “GGSGG” (SEQ ID NO: 41), “GGSGGGGG” (SEQ ID NO: 42), “GSGSGS” (SEQ ID NO: 43), “GGGSEGGGSEGGGSEGGG” (SEQ ID NO: 44), “AAGAATAA” (SEQ ID NO: 45), “GGGGG” (SEQ ID NO: 46), “GGSSG” (SEQ ID NO: 47), “GSGGGTGGGSG” (SEQ ID NO: 48), “GSGSGSGSGGSG” (SEQ ID NO: 49), “GSGGSGGSGGSG
  • heterologous moiety is fused to the functional GAA polypeptide via a peptide linker having the amino acid sequence “GAP” (SEQ ID NO: 53).
  • the peptide linker is encoded by the nucleotide sequence of SEQ ID NO: 17 or by a nucleotide sequence at least 85 % identity, at least 90 % identity, at least 92 % identity, at least 95 % identity, at least 98 % identity or at least 99 % identity to the nucleotide sequence of SEQ ID NO: 17.
  • the chimeric GAA polypeptide encoded by the nucleic acid molecule of the invention may further comprise a signal peptide, such as the natural signal peptide of GAA, or an alternative signal peptide derived from another secreted protein.
  • a signal peptide such as the natural signal peptide of GAA, or an alternative signal peptide derived from another secreted protein.
  • the signal peptide is not an “heterologous moiety” as defined above.
  • nucleic acid molecule of the invention encodes a chimeric GAA polypeptide comprising :
  • heterologous moieties as defined above, wherein at least one of the heterologous moieties is a carboxy-terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCG ),
  • Non-limiting examples of such signal peptides include those described in the WO2018/046775 patent application.
  • the signal peptides may be selected from the group consisting of SEQ ID NO: 18 to 22.
  • the invention thereby provides a chimeric GAA polypeptide comprising a signal peptide, one or more heterologous moieties and a functional GAA polypeptide as defined above.
  • the signal peptide is the natural signal peptide of a GAA, such as the signal peptide of hGAA shown in SEQ ID NO: 18.
  • the signal peptide is an exogenous (or alternative) signal peptide, derived from a protein different from GAA.
  • the alternative signal peptide is selected in the group consisting of SEQ ID NO: 19, 20, 21 and 22, or a functional derivative thereof as defined below.
  • the signal peptide is selected in the group consisting of SEQ ID NO: 20, 21 and 22, or a functional derivative thereof as defined below.
  • Particular exogenous signal peptides workable in the present invention include amino acids 1-20 from chymotrypsinogen B2 (SEQ ID NO:21), the signal peptide of human alpha- 1 -antitrypsin (SEQ ID NO: 19), amino acids 1-25 from iduronate-2-sulphatase (SEQ ID NO:20), and amino acids 1-23 from protease Cl inhibitor (SEQ ID NO:22).
  • the signal peptides of SEQ ID NO: 18 and SEQ ID NO: 19 to SEQ ID NO: 22, allow higher secretion of the chimeric GAA polypeptide both in vitro and in vivo when compared to the chimeric GAA comprising its natural signal peptide.
  • the signal peptide has the sequence shown in SEQ ID NO: 18 to 22, or is a functional derivative thereof, i.e.
  • a sequence comprising from 1 to 5, in particular from 1 to 4, in particular from 1 to 3, more particularly from 1 to 2, in particular 1 amino acid deletion(s), insertion(s) or substitution(s) as compared to the sequences shown in SEQ ID NO: 18 to 22, as long as the resulting sequence corresponds to a functional signal peptide, i.e. a signal peptide that allows secretion of a GAA protein.
  • the signal peptide sequence has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, in particular at least 95 percent identity, for example at least 98, or 99 percent identity to a sequence selected in the group consisting of SEQ ID NO: 18 to 22, preferably to a sequence selected in the group consisting of SEQ ID NO: 19 to 22, more preferably to a sequence selected in the group consisting of SEQ ID NO: 20 to 22, even more preferably to the sequence of SEQ ID NO:21.
  • the signal peptide sequence consists of a sequence selected in the group consisting of SEQ ID NO: 18 to 22.
  • the signal peptide sequence consists of a sequence selected in the group consisting of SEQ ID NO: 19 to 22, more preferably the signal peptide sequence consists of a sequence selected in the group consisting of SEQ ID NO: 20 to 22. According to a preferred embodiment, the signal peptide sequence consists of the sequence has shown in SEQ ID NO:21.
  • the signal peptide is attached to the one or more heterologous moieties as defined above via a linker, which can be a covalent bond or a peptide bond.
  • a linker which can be a covalent bond or a peptide bond.
  • Any conventional linker leading to a correct folding of the chimeric GAA polypeptide may be used.
  • any linker able to introduce flexibility between the linked domains of the polypeptide may be used.
  • the linker is a Glycine-rich linker.
  • the nucleic acid molecule of the invention encodes a chimeric GAA polypeptide comprising, preferably in this order : a signal peptide as defined above, a heterologous moiety as defined above, optionally a linker as defined above, and a functional GAA polypeptide as defined above.
  • the chimeric GAA polypeptide comprises, preferably in this order : the signal peptide consisting of SEQ ID NO: 21, a heterologous moiety consisting of the CTP sequence as shown in SEQ ID NO: 12, optionally a linker of the sequence “GAP”, and a functional GAA polypeptide consisting of SEQ ID NO:9.
  • the nucleic acid molecule encodes a chimeric GAA polypeptide comprising or consisting of SEQ ID NO: 14, or a functional derivative thereof having at least 90% identity, in particular at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence shown in SEQ ID NO: 14.
  • the nucleic acid molecule of the invention comprises or consists of the sequence SEQ ID NO: 35, or a sequence having at least 90% identity, in particular at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence shown in SEQ ID NO: 35.
  • the invention also relates to a nucleic acid construct comprising the nucleic acid molecule of the invention.
  • the nucleic acid construct may correspond to an expression cassette comprising the nucleic acid sequence of the invention, operably linked to one or more expression control sequences and/or other sequences improving the expression of a transgene and/or sequences enhancing the secretion of the encoded protein and/or sequences enhancing the uptake of the encoded protein.
  • the term “operably linked” refers to a linkage of polynucleotide elements in a functional relationship.
  • a nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence.
  • a promoter or another transcription regulatory sequence, is operably linked to a coding sequence if it affects the transcription of the coding sequence.
  • expression control sequences are known in the art, such as promoters, enhancers (such as cis-regulatory modules (CRM)), introns, polyA signals, etc.
  • the expression cassette may include a promoter.
  • the promoter may be an ubiquitous or tissue-specific promoter, in particular a promoter able to promote expression in cells or tissues in which expression of GAA is desirable such as in cells or tissues in which GAA expression is desirable in GAA- deficient patients.
  • the promoter is a liver-specific promoter such as the alpha-1 antitrypsin promoter (hAAT) (SEQ ID NO: 23), the transthyretin promoter, the albumin promoter, the thyroxine-binding globulin (TBG) promoter, the LSP promoter (comprising a thyroid hormone-binding globulin promoter sequence, two copies of an alpha 1-microglobulin/bikunin enhancer sequence, and a leader sequence - 34.111, C. R., et al. (1997). Optimization of the human factor VIII complementary DNA expression plasmid for gene therapy of hemophilia A. Blood Coag. Fibrinol.
  • hAAT alpha-1 antitrypsin promoter
  • TBG thyroxine-binding globulin
  • LSP promoter comprising a thyroid hormone-binding globulin promoter sequence, two copies of an alpha 1-microglobulin/bikunin enhancer sequence, and
  • liver-specific promoters are known in the art, for example those listed in the Liver Specific Gene Promoter Database compiled the Cold Spring Harbor Laboratory (http://rulai.cshl.edu/LSPD/).
  • a preferred promoter in the context of the invention is the hAAT promoter.
  • the promoter is a promoter directing expression in one tissue or cell of interest (such as in muscle cells), and in liver cells.
  • tissue or cell of interest such as in muscle cells
  • promoters specific of muscle cells such as the desmin, Spc5-12 and MCK promoters may present some leakage of expression into liver cells, which can be advantageous to induce immune tolerance of the subject to the chimeric GAA protein expressed from the nucleic acid of the invention.
  • the expression cassette may include a tissue-specific promoter which is a promoter different from a liver specific promoter.
  • the promoter may be muscle-specific, such as the desmin promoter (and a desmin promoter variant such as a desmin promoter including natural or artificial enhancers), the SPc5-12 or the MCK promoter.
  • the promoter is a promoter specific of other cell lineage, such as the erythropoietin promoter, for the expression of the chimeric GAA polypeptide from cells of the erythroid lineage.
  • the promoter is an ubiquitous promoter.
  • Representative ubiquitous promoters include the cytomegalovirus enhancer/chicken beta actin (CAG) promoter, the cytomegalovirus enhancer/promoter (CMV), the PGK promoter, the SV40 early promoter, etc.
  • the promoter may also be an endogenous promoter such as the albumin promoter or the GAA promoter.
  • the promoter is any hybrid regulatory element as described in patent application PCT/EP2019/053061, including the specific promoters referred as “LiMP” and "’LiNeuP”.
  • the promoter is any hybrid promoter as described in patent application EP19 305455.8 herein incorporated by reference, wherein said hybrid promoter comprises one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter.
  • the promoter may be the specific promoter referred as EP1, EP2, EP3 or EP4 in patent application EP19 305455.8, in particular the promoter referred to as EP4.
  • the promoter is associated to an enhancer sequence, such as a cis-regulatory module (CRMs) or an artificial enhancer sequence.
  • the promoter may be associated to an enhancer sequence such as the human ApoE control region (or Human apolipoprotein E/C -I gene locus, hepatic control region HCR-1 - Genbank accession No. U32510, shown in SEQ ID NO:24).
  • an enhancer sequence such as the ApoE sequence is associated to a liver-specific promoter such as those listed above, and in particular such as the hAAT promoter.
  • Other CRMs useful in the practice of the present invention include those described in Rincon et al., Mol Ther.
  • the nucleic acid construct comprises an intron, in particular an intron placed between the promoter and the nucleic acid molecule of the invention encoding the chimeric GAA polypeptide.
  • An intron may be introduced to increase mRNA stability and the production of the protein.
  • the nucleic acid construct comprises a human beta globin b2 (or HBB2) intron, a coagulation factor IX (FIX) intron, a SV40 intron or a chicken beta-globin intron.
  • the nucleic acid construct of the invention contains a modified intron (in particular a modified HBB2 or FIX intron) designed to decrease the number of, or even totally remove, alternative open reading frames (ARFs) found in said intron.
  • ARFs are removed whose length spans over 50 bp and have a stop codon in frame with a start codon. ARFs may be removed by modifying the sequence of the intron.
  • modification may be carried out by way of nucleotide substitution, insertion or deletion, preferably by nucleotide substitution.
  • nucleotide substitution preferably by nucleotide substitution.
  • one or more nucleotides, in particular one nucleotide, in an ATG or GTG start codon present in the sequence of the intron of interest may be replaced resulting in a non-start codon.
  • an ATG or a GTG may be replaced by a CTG, which is not a start codon, within the sequence of the intron of interest.
  • the classical HBB2 intron used in nucleic acid constructs is shown in SEQ ID NO: 25.
  • this HBB2 intron may be modified by eliminating start codons (ATG and GTG codons) within said intron.
  • the modified HBB2 intron comprised in the construct has the sequence shown in SEQ ID NO: 26.
  • the classical FIX intron used in nucleic acid constructs is derived from the first intron of human FIX and is shown in SEQ ID NO: 27.
  • FIX intron may be modified by eliminating start codons (ATG and GTG codons) within said intron.
  • the modified FIX intron comprised in the construct of the invention has the sequence shown in SEQ ID NO: 28.
  • Chicken-beta globin intron used in nucleic acid constructs is shown in SEQ ID NO: 29.
  • Chicken-beta globin intron may be modified by eliminating start codons (ATG and GTG codons) within said intron.
  • the modified chicken-beta globin intron comprised in the construct of the invention has the sequence shown in SEQ ID NO: 30.
  • modified intron in particular a modified HBB2 or FIX intron, has advantageous properties and can significantly improve the expression of a transgene.
  • the nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' orientation, a promoter optionally preceded by an enhancer, the nucleic acid molecule of the invention (i.e. the sequence encoding the chimeric GAA polypeptide of the invention), and a polyadenylation signal (such as the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal, or another naturally occurring or artificial polyadenylation signal).
  • a promoter optionally preceded by an enhancer
  • the nucleic acid molecule of the invention i.e. the sequence encoding the chimeric GAA polypeptide of the invention
  • a polyadenylation signal such as the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal, or another naturally occurring or artificial polyadenylation signal.
  • the nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' orientation, a promoter optionally preceded by an enhancer, (such as the ApoE control region), an intron (in particular an intron as defined above), the nucleic acid molecule of the invention, and a polyadenylation signal.
  • the nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' orientation, an enhancer such as the ApoE control region, a promoter, an intron (in particular an intron as defined above), the nucleic acid molecule of the invention, and a polyadenylation signal.
  • the expression cassette comprising, in the 5' to 3' orientation, an ApoE control region, the hAAT-liver specific promoter, a HBB2 intron (in particular a modified HBB2 intron as defined above), the nucleic acid molecule of the invention, and the bovine growth hormone polyadenylation signal, such as the nucleic acid construct shown in SEQ ID NO: 16, which includes the nucleic acid molecule of SEQ ID NO: 35 encoding the chimeric GAA polypeptide of the invention, respectively.
  • the expression cassette comprises the ApoE control region, the hAAT-liver specific promoter, a codon-optimized HBB2 intron, the sequence of the nucleic acid molecule of the invention and the bovine growth hormone polyadenylation signal.
  • AAV vector AAV vector used for delivering said construct to a cell or organ.
  • AAV vector a major limitation of AAV vector is its cargo capacity which may vary from one AAV serotype to another but is thought to be limited to around the size of parental viral genome .
  • 5 kb is the maximum size usually thought to be packaged into an AAV8 capsid.
  • nucleic acid construct of the invention so that the resulting nucleic acid sequence, including sequences coding AAV 5'- and 3'-ITRs to preferably not exceed 110 % of the cargo capacity of the AAV vector implemented, in particular to preferably not exceed 5.5 kb.
  • the invention also relates to a vector comprising a nucleic acid molecule or construct as disclosed herein.
  • the vector of the invention is a vector suitable for protein expression, preferably for use in gene therapy.
  • the vector is a plasmid vector.
  • the vector is a nanoparticle containing a nucleic acid molecule of the invention, in particular a messenger RNA encoding the chimeric GAA polypeptide of the invention.
  • the vector is a system based on transposons, allowing integration of the nucleic acid molecule or construct of the invention in the genome of the target cell, such as the hyperactive Sleeping Beauty (SB 100X) transposon system (Mates et al. 2009).
  • SB 100X hyperactive Sleeping Beauty
  • the vector is a viral vector suitable for gene therapy, targeting any cell of interest such as liver tissue or cells, muscle cell, CNS cells (such as brain cells), or hematopoietic stem cells such as cells of the erythroid lineage (such as erythrocytes).
  • the nucleic acid construct of the invention also contains sequences suitable for producing an efficient viral vector, as is well known in the art.
  • the viral vector is derived from an integrating virus.
  • the viral vector may be derived from a retrovirus or a lentivirus.
  • the viral vector is an AAV vector, such as an AAV vector suitable for transducing liver tissues or cells, more particularly an AAV-1, -2 and AAV-2 variants (such as the quadruple-mutant capsid optimized AAV-2 comprising an engineered capsid with Y44+500+730F+T491V changes, disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods. [Epub ahead of print]), -3 and AAV-3 variants (such as the AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes, S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p.
  • AAV vector such as an AAV vector suitable for transducing liver tissues or cells, more particularly an AAV-1, -2 and AAV-2 variants (such as the quadruple-mutant capsid optimized AAV-2 comprising an engineered capsid with Y44+500+730F
  • Suitable sequences include AAV ITRs for an AAV vector, or LTRs for lentiviral vectors.
  • the invention also relates to an expression cassette as described above, flanked by an ITR or an LTR on each side.
  • Viral vectors are preferred for delivering the nucleic acid molecule or construct of the invention, such as a retroviral vector, for example a lentiviral vector, or a non-pathogenic parvovirus, more preferably an AAV vector.
  • a retroviral vector for example a lentiviral vector, or a non-pathogenic parvovirus, more preferably an AAV vector.
  • the human parvovirus Adeno-Associated Virus (AAV) is a dependovirus that is naturally defective for replication which is able to integrate into the genome of the infected cell to establish a latent infection. The last property appears to be unique among mammalian viruses because the integration occurs at a specific site in the human genome, called AAVS1, located on chromosome 19 (19ql3.3-qter).
  • AAV vectors have arisen considerable interest as potential vectors for human gene therapy.
  • favorable properties of the virus are its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from different tissues that can be infected.
  • human serotype 2 is the first AAV that was developed as a gene transfer vector.
  • Other currently used AAV serotypes include AAV-1, AAV-2 variants (such as the quadruple-mutant capsid optimized AAV-2 comprising an engineered capsid with Y44+500+730F+T491V changes, disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods.
  • -3 and AAV-3 variants such as the AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes, S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042
  • -3B and AAV- 3B variants such as the AAV6 variant comprising the triply mutated AAV6 capsid Y731F/Y705F/T492V form disclosed in Rosario et al., 2016, Mol Ther Methods Clin Dev.
  • AAV viruses may be engineered using conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, fortuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus.
  • Desirable AAV fragments for assembly into vectors include the cap proteins, including the vpl, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells.
  • AAV-based recombinant vectors lacking the Rep protein integrate with low efficacy into the host’s genome and are mainly present as stable circular episomes that can persist for years in the target cells.
  • artificial AAV serotypes may be used in the context of the present invention, including, without limitation, AAV with a non-naturally occurring capsid protein.
  • Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source.
  • An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. Accordingly, the present invention relates to an AAV vector comprising the nucleic acid molecule or construct of the invention.
  • the AAV vector comprises an AAV capsid able to transduce the target cells of interest, in particular hepatocytes.
  • the AAV vector is of the AAV-1, -2, AAV-2 variants (such as the quadruple-mutant capsid optimized AAV-2 comprising an engineered capsid with Y44+500+730F+T491V changes, disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods.
  • -3 and AAV-3 variants such as the AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes, S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042
  • -3B and AAV- 3B variants such as the AAV6 variant comprising the triply mutated AAV6 capsid Y731F/Y705F/T492V form disclosed in Rosario et al., 2016, Mol Ther Methods Clin Dev.
  • the AAV vector is of the AAV8, AAV9, AAVrh74 or AAV2i8 serotype (i.e. the AAV vector has a capsid of the AAV8, AAV9, AAVrh74 or AAV2i8 serotype).
  • the AAV vector is a pseudotyped vector, i.e. its genome and capsid are derived from AAVs of different serotypes.
  • the pseudotyped AAV vector may be a vector whose genome is derived from one of the above mentioned AAV serotypes, and whose capsid is derived from another serotype.
  • the genome of the pseudotyped vector may have a capsid derived from the AAV 8, AAV 9, AAVrh74 or AAV2i8 serotype, and its genome may be derived from and different serotype.
  • the AAV vector has a capsid of the AAV8, AAV9 or AAVrh74 serotype, in particular of the AAV8 or AAV9 serotype, more particularly of the AAV8 serotype.
  • the AAV vector may be selected, among others, in the group consisting of AAV8, AAV9 and AAVrh74.
  • the AAV vector may be selected, among others, in the group consisting of AAV5, AAV8, AAV9, AAV- LK03, AAV-Anc80 and AAV3B.
  • the capsid is a modified capsid.
  • a "modified capsid” may be a chimeric capsid or capsid comprising one or more variant VP capsid proteins derived from one or more wild-type AAV VP capsid proteins.
  • the AAV vector is a chimeric vector, i.e. its capsid comprises VP capsid proteins derived from at least two different AAV serotypes, or comprises at least one chimeric VP protein combining VP protein regions or domains derived from at least two AAV serotypes.
  • capsid comprises VP capsid proteins derived from at least two different AAV serotypes, or comprises at least one chimeric VP protein combining VP protein regions or domains derived from at least two AAV serotypes.
  • Examples of such chimeric AAV vectors useful to transduce liver cells are described in Shen et al., Molecular Therapy, 2007 and in Tenney et al., Virology, 2014.
  • a chimeric AAV vector can derive from the combination of an AAV8 capsid sequence with a sequence of an AAV serotype different from the AAV8 serotype, such as any of those specifically mentioned above.
  • the capsid of the AAV vector comprises one or more variant VP capsid proteins such as those described in W02015013313, in particular the RHM4-1, RHM15-1, RHM15-2, RHM15-3/RHM15-5, RHM15-4 and RHM15-6 capsid variants, which present a high liver tropism.
  • the modified capsid can be derived also from capsid modifications inserted by error prone PCR and/or peptide insertion (e.g. as described in Bartel et al., 2011).
  • capsid variants may include single amino acid changes such as tyrosine mutants (e.g. as described in Zhong et al., 2008)
  • the genome of the AAV vector may either be a single stranded or self-complementary double-stranded genome (McCarty et al., Gene Therapy, 2003).
  • Self-complementary double-stranded AAV vectors are generated by deleting the terminal resolution site (trs) from one of the AAV terminal repeats. These modified vectors, whose replicating genome is half the length of the wild type AAV genome have the tendency to package DNA dimers.
  • the AAV vector implemented in the practice of the present invention has a single stranded genome, and further preferably comprises an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid.
  • the invention relates to an AAV vector comprising, in a single- stranded or double-stranded, self-complementary genome (e.g. a single-stranded genome), the nucleic acid acid construct of the invention.
  • the AAV vector comprises an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid .
  • said nucleic acid is operably linked to a promoter, especially an ubiquitous or liver-specific promoter.
  • the promoter is an ubiquitous promoter such as the cytomegalovirus enhancer/chicken beta actin (CAG) promoter, the cytomegalovirus enhancer/promoter (CMV), the PGK promoter and the SV40 early promoter.
  • the ubiquitous promoter is the CAG promoter.
  • the promoter is a liver-specific promoter such as the alpha- 1 antitrypsin promoter (hAAT), the transthyretin promoter, the albumin promoter and the thyroxine binding globulin (TBG) promoter.
  • the liver-specific promoter is the hAAT liver- specific promoter of SEQ ID NO: 23.
  • the nucleic acid construct comprised into the genome of the AAV vector of the invention further comprises an intron as described above, such as an intron placed between the promoter and the nucleic acid sequence encoding the chimeric GAA polypeptide of the invention.
  • Representative introns that may be included within the nucleic acid construct introduced within the AAV vector genome include, without limitation, the human beta globin b2 (or HBB2) intron, the FIX intron and the chicken beta-globin intron.
  • Said intron within the genome of the AAV vector may be a classical (or unmodified) intron or a modified intron designed to decrease the number of, or even totally remove, alternative open reading frames (ARFs) within said intron.
  • the AAV vector in particular an AAV vector comprising an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid, of the invention includes within its genome a modified (or optimized) intron such as the modified HBB2 intron of SEQ ID NO: 26, the modified FIX intron of SEQ ID NO: 28 and the modified chicken beta-globin intron of SEQ ID NO: 30.
  • a modified (or optimized) intron such as the modified HBB2 intron of SEQ ID NO: 26, the modified FIX intron of SEQ ID NO: 28 and the modified chicken beta-globin intron of SEQ ID NO: 30.
  • the vector of the invention is an AAV vector comprising comprises an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid, comprising a genome containing, in the 5’ to 3’ orientation: an AAV 5'-ITR (such as an AAV2 5’-ITR); an ApoE control region; the hAAT-liver specific promoter; a HBB2 intron (in particular a modified HBB2 intron as defined above); the nucleic acid molecule of the invention encoding the chimeric GAA polypeptide; the bovine growth hormone polyadenylation signal; and an AAV 3'-ITR (such as an AAV2 3'-ITR), such as a genome comprising a the nucleic acid construct shown in SEQ ID NO: 16 flanked by an AAV 5'-ITR
  • the nucleic acid construct of the invention comprises a liver-specific promoter as described above, and the vector is a viral vector capable of transducing liver tissue or cells as described above.
  • the protolerogenic and metabolic properties of the liver are advantageously implemented thanks to this embodiment to develop highly efficient and optimized vectors to express secretable forms of GAA in hepatocytes and to induce immune tolerance to the protein.
  • the invention provides the combination of two vectors, such as two viral vectors, in particular two AAV vectors, for improving gene delivery and treatment efficacy in the cells of interest.
  • the two vectors may carry the nucleic acid molecule of the invention coding for the chimeric GAA polypeptide of the invention, under the control of one different promoter in each of these two vectors.
  • one vector comprises a promoter which is a liver-specific promoter (as one of those described above), and the other vector comprises a promoter which is specific of another tissue of interest for the treatment of a glycogen storage disorder, such as a muscle-specific promoter, for example the desmin promoter.
  • this combination of vectors corresponds to multiple co-packaged AAV vectors produced as described in WO2015196179.
  • the invention provides a chimeric GAA polypeptide, encoded by the nucleic acid molecule of the invention as described above.
  • the chimeric GAA polypeptide of the invention comprises a functional GAA polypeptide fused to one or more heterologous domains, wherein at least one of the heterologous domain is the CTP of the hHCG.
  • the chimeric GAA polypeptide has the sequence shown in SEQ ID NO: 14, or is a functional derivative thereof having at least 90% identity, in particular at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence shown in SEQ ID NO: 14.
  • the invention also relates to an isolated cell, for example a liver cell, that is transformed with a nucleic acid molecule or construct of the invention as is the case for ex vivo gene therapy.
  • Cells of the invention may be delivered to the subject in need thereof, such as GAA-deficient patient, by any appropriate administration route such as via injection in the liver or in the bloodstream of said subject.
  • the invention involves introducing the nucleic acid of the invention into liver cells, in particular into liver cells of the subject to be treated, and administering said transformed liver cells into which the nucleic acid has been introduced to the subject.
  • this embodiment is useful for secreting GAA from said cells.
  • the liver cells are liver cells from the patient to be treated, or are liver stem cells that are further transformed, and differentiated in vitro into liver cells, for subsequent administration to the patient.
  • the present invention further relates to a transgenic, nonhuman animal comprising in its genome the nucleic acid molecule or construct of the invention encoding the chimeric GAA polypeptide according to the invention.
  • the animal is a mouse.
  • nucleic acid molecule or construct of the invention e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the nucleic acid sequence of the invention, receptor-mediated endocytosis, construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc.
  • naked DNA such as minicircles and transposons can be used for delivery or lentiviral vectors.
  • gene editing technologies such as zinc finger nucleases, meganucleases, TALENs, and CRISPR can also be used to deliver the coding sequence of the invention.
  • compositions comprising the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide, or the isolated cell of the invention.
  • Such compositions comprise a therapeutically effective amount of the therapeutic (the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention), and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. or European Pharmacopeia or other generally recognized pharmacopeia for use in animals, and humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.
  • compositions can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin.
  • Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject.
  • the nucleic acid, vector or cell of the invention is formulated in a composition comprising phosphate-buffered saline and supplemented with 0.25% human serum albumin.
  • the nucleic acid, vector or cell of the invention is formulated in a composition comprising ringer lactate and a non-ionic surfactant, such as pluronic F68 at a final concentration of 0.01-0.0001%, such as at a concentration of 0.001%, by weight of the total composition.
  • the formulation may further comprise serum albumin, in particular human serum albumin, such as human serum albumin at 0.25%.
  • Other appropriate formulations for either storage or administration are known in the art, in particular from WO 2005/118792 or Allay et ak, 2011.
  • the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to, ease pain at the, site of the injection.
  • the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention can be delivered in a vesicle, in particular a liposome.
  • the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention can be delivered in a controlled release system.
  • Methods of administration of the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. In a particular embodiment, the administration is via the intravenous or intramuscular route.
  • nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention, whether vectorized or not, may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • This may be achieved, for example, by means of an implant, said implant being of a porous, nonporous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • the amount of the therapeutic of the invention i.e. the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the isolated cell of the invention
  • amount of the therapeutic of the invention which will be effective in the treatment of a glycogen storage disease can be determined by standard clinical techniques.
  • in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges.
  • dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances.
  • the dosage of the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention administered to the subject in need thereof will vary based on several factors including, without limitation, the route of administration, the specific disease treated, the subject's age or the level of expression necessary to obtain the therapeutic effect.
  • One skilled in the art can readily determine, based on its knowledge in this field, the dosage range required based on these factors and others.
  • typical doses of the vector are of at least lxlO 8 vector genomes per kilogram body weight (vg/kg), such as at least lxlO 9 vg/kg, at least lxlO 10 vg/kg, at least lxlO 11 vg/kg, at least lxlO 12 vg/kg at least lxlO 13 vg/kg, or at least lxlO 14 vg/kg.
  • the invention also relates to a method for treating a glycogen storage disease, which comprises a step of delivering a therapeutic effective amount of the nucleic acid, the vector, the chimeric GAA polypeptide, the pharmaceutical composition or the cell of the invention to a subject in need thereof.
  • the invention also relates to a method for treating a glycogen storage disease, said method inducing no immune response to the transgene (i.e. to the chimeric GAA polypeptide of the invention), or inducing a reduced immune response to the transgene, comprising a step of delivering a therapeutic effective amount of the nucleic acid molecule, nucleic acid construct, vector, pharmaceutical composition or cell of the invention to a subject in need thereof.
  • the invention also relates to a method for treating a glycogen storage disease, said method comprising repeated administration of a therapeutic effective amount of the nucleic acid molecule, nucleic acid construct, vector, pharmaceutical composition or cell of the invention to a subject in need thereof.
  • the nucleic acid molecule or the nucleic acid construct of the invention comprises a promoter which is functional in liver cells, thereby allowing immune tolerance to the expressed chimeric GAA polypeptide produced therefrom.
  • the pharmaceutical composition used in this aspect comprises a nucleic acid molecule or nucleic acid construct comprising a promoter which is functional in liver cells.
  • said cells may be cells previously collected from the subject in need of the treatment and that were engineered by introducing therein the nucleic acid molecule or the nucleic acid construct of the invention to thereby make them able to produce the chimeric GAA polypeptide of the invention.
  • said administration may be repeated at least once or more, and may even be considered to be done according to a periodic schedule, such as once per week, per month or per year.
  • the periodic schedule may also comprise an administration once every 2, 3, 4, 5, 6, 7, 8, 9 or 10 year, or more than 10 years.
  • administration of each administration of a viral vector of the invention is done using a different virus for each successive administration, thereby avoiding a reduction of efficacy because of a possible immune response against a previously administered viral vector.
  • a first administration of a viral vector comprising an AAV8 capsid may be done, followed by the administration of a vector comprising an AAV9 capsid, or even by the administration of a virus unrelated to AAVs, such as a retroviral or lentiviral vector.
  • the invention also relates to a method for treating a glycogen storage disease, comprising a step of delivering a therapeutic effective amount of the nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, pharmaceutical composition or cell of the invention to a subject in need thereof.
  • the transgene may be used to produce high levels of GAA protein, and provides therapeutic benefits such as improving GAA activity in plasma and/or in tissues such as skeletal muscles.
  • the invention also relates to a method for treating a glycogen storage disease, said method comprising repeated administration of a therapeutic effective amount of the nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, pharmaceutical composition or cell of the invention to a subject in need thereof.
  • the nucleic acid molecule or the nucleic acid construct of the invention comprises a promoter which is functional in liver cells, thereby allowing immune tolerance to the expressed chimeric GAA polypeptide produced therefrom.
  • the pharmaceutical composition used in this aspect comprises a nucleic acid molecule or nucleic acid construct comprising a promoter which is functional in liver cells.
  • said cells may be cells previously collected from the subject in need of the treatment and that were engineered by introducing therein the nucleic acid molecule or the nucleic acid construct of the invention to thereby make them able to produce the chimeric GAA polypeptide of the invention.
  • said administration may be repeated at least once or more, and may even be considered to be done according to a periodic schedule, such as once per week, per month or per year.
  • the periodic schedule may also comprise an administration once every 2, 3, 4, 5, 6, 7, 8, 9 or 10 year, or more than 10 years.
  • administration of each administration of a viral vector of the invention is done using a different virus for each successive administration, thereby avoiding a reduction of efficacy because of a possible immune response against a previously administered viral vector.
  • a first administration of a viral vector comprising an AAV8 capsid may be done, followed by the administration of a vector comprising an AAV9 capsid, or even by the administration of a virus unrelated to AAVs, such as a retroviral or lentiviral vector.
  • a treatment may include curative, alleviation or prophylactic effects. Accordingly, therapeutic and prophylactic treatment includes amelioration of the symptoms of a particular glycogen storage disease or preventing or otherwise reducing the risk of developing a particular glycogen storage disease.
  • the term “prophylactic” may be considered as reducing the severity or the onset of a particular condition. “Prophylactic” also includes preventing reoccurrence of a particular condition in a patient previously diagnosed with the condition. "Therapeutic” may also reduce the severity of an existing condition.
  • the term 'treatment' is used herein to refer to any regimen that can benefit a animal, in particular a mammal, more particularly a human subject.
  • the invention also relates to an ex vivo gene therapy method for the treatment of a glycogen storage disease, comprising introducing the nucleic acid molecule or the nucleic acid construct of the invention into an isolated cell of a patient in need thereof, for example an isolated hematopoietic stem cell, and introducing said cell into said patient in need thereof.
  • the nucleic acid molecule or construct is introduced into the cell with a vector as defined above.
  • the vector is an integrative viral vector.
  • the viral vector is a retroviral vector, such as a lenviral vector.
  • a lentiviral vector as disclosed in van Til et al., 2010, Blood, 115(26), p. 5329 may be used in the practice in the method of the present invention.
  • the invention also relates to the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention for use as a medicament.
  • the invention also relates to the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention, for use in a method for treating a disease caused by a mutation in the GAA gene, in particular in a method for treating Pompe disease.
  • the invention further relates to the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention, for use in a method for treating a glycogen storage disease, such as GSDI (von Gierke's disease), GSDII (Pompe disease), GSDIII (Cori disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII and lethal congenital glycogen storage disease of the heart, more particularly GSDI, GSDII or GSDIII, even more particularly GSDII and GSDIII, and most particularly GSDII.
  • a glycogen storage disease such as GSDI (von Gierke's disease), GSDII (Pompe disease), GSDIII (Cori disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII and lethal congenital glycogen storage disease of the heart, more particularly GSDI, GSDII or GSDIII, even more particularly GSD
  • the chimeric GAA polypeptide of the invention may be administered to a patient in need thereof, for use in enzyme replacement therapy (ERT), such as for use in enzyme replacement therapy of one of a glycogen storage disease, such as GSDIII (Cori's disease) but also for GSD-IV, -VI, -IX, - XI and cardiac glycogenosis due to AMP -activated protein kinase gamma subunit 2 deficiency.
  • ERT enzyme replacement therapy
  • the invention further relates to the use of the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention, in the manufacture of a medicament useful for treating a glycogen storage disease, such as GSDI (von Gierke's disease), GSDII (Pompe disease), GSDIII (Cori disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII and lethal congenital glycogen storage disease of the heart, more particularly GSDI, GSDII or GSDIII, even more particularly GSDII and GSDIII, and most particularly GSDII.
  • GSDI glycogen storage disease
  • the GAA transgene expression cassettes used in this study contained the codon-optimized human GAA (hGAA) coding sequence [Puzzo F., et al., Sci Transl Med. 2017 Nov 29;9(418)]. Codon-optimization was performed using a commercial algorithm (Thermo Fisher Scientific) [Puzzo F., et al., Sci Transl Med. 2017 Nov 29;9(418)].
  • the heterologous domains CTP and Albumin
  • Transgene sequences were cloned into an AAV vector backbone under the transcriptional control of the apolipoprotein E (hepatocyte control region enhancer) and the human alpha 1 -antitrypsin (hAAT) promoter. All DNA sequences used in the study were synthetized either by GeneCust or Thermo Fisher Scientific.
  • apolipoprotein E hepatocyte control region enhancer
  • hAAT human alpha 1 -antitrypsin
  • AAV vectors used in this study were produced using an adenovirus-free transient transfection method of HEK293 cells as described [Puzzo F, et al. Sci Transl Med. 2017 Nov 29;9(418)]. Titers of AAV vector stocks were determined using quantitative real-time PCR (qPCR) and SDS-PAGE followed by SYPRO Ruby protein gel stain and band densitometry. All vector preparations used in the study were quantified side-by-side before use.
  • the primers used for qPCR on AAV genome annealed to BGH polyA (Fw: tctagttgccagccatctgttgt (SEQ ID NO: 31 ): Rev: tgggagtggcaccttcca (SEQ ID NO: 32) and codon- optimized hGAA (Fw: agatacgccggacattggactg (SEQ ID NO: 33); Rev: gcacgcccagcagattgaac (SEQ ID NO: 34).
  • the AAV serotypes used is AAV8 (Zincarelli et al. Mol Ther. 2008 Jun; 16(6): 1073-80).
  • Human hepatoma cells (HuH7) were seeded in 6-well plates (5xl0 5 cells/well) and transfected using Lipofectamine 3000 (Thermo Fisher Scientific) accordingly to manufacturer’s instructions. 72 hours after transfection, cells and conditioned media were harvested and analyzed for GAA activity and Western blot analyses.
  • HuH7 cells were seeded in T75-well plates (lxlO 7 cells/well) and transfected using Lipofectamine 3000 (Thermo Fisher Scientific) accordingly to manufacturer’s instructions. 72 hours after transfection, HuH7 conditioned media were harvested and used to culture fibroblasts derived from Pompe disease patients (GMO 20124 GSDII 3p). After 72 hours in culture the fibroblasts were washed 3 times with PBS, harvested and analyzed for Western blot analyses.
  • Wild type C57BL/6 mice were purchased from Charles River (Charles River, France). The Gaa -/- mouse was generated by targeted disruption of exon 6 (Raben N. et al. J Biol Chem. 1998 Jul 24;273(30): 19086-92). Gaa-/- mice in the C57BL/6J/129Xl/SvJ background were used. Male littermate affected Gaa-/- and unaffected Gaa+/+ mice were used. AAV vectors were delivered to: 1. adult mice via the tail vein in a volume of 0.2 ml. Experimental groups were sized to allow for statistical analysis; all the animals were included in the analysis and none of the outliers was excluded. Mice were assigned randomly to the experimental groups, and the operators who performed vector delivery and functional analyses were blinded to group identity.
  • GAA activity was measured in mouse plasma (1/1000-1/2000 dilution) and tissues. Snap-frozen tissues were homogenized in di UltraPureTM DNase/RNase-Free Distilled Water (Thermo Fisher Scientific). 50-100 mg of tissue were weighed and homogenized, then centrifuged for 20 minutes at 10000 x g to collect supernatant. The enzymatic reaction was set up using 10 pi of sample (plasma or tissue homogenate) and 20 m ⁇ of substrate - 4MU-alpha-D-glucoside, in a 96 wells plate. The reaction mixture was incubated at 37°C for one hour, and then stopped by adding 150 m ⁇ of Sodium Carbonate buffer pH 10.5.
  • a standard curve (0-2500 pmol/m ⁇ of 4MU) was used to measure released fluorescent 4MU from individual reaction mixture, using the EnSpire alpha plate reader (Perkin-Elmer) at 449 nm (Emission) and 360 nm (Excitation).
  • the protein concentration of the clarified supernatant was quantified by BCA (Thermo Fisher Scientific). To calculate the GAA activity, released 4MU concentration was divided by the sample protein concentration and activity was reported as nmol/hour/mg protein.
  • HuH7 and Fibroblasts cell lysates were prepared using lOmM PBS (pH7.4) containing 1% of Triton- XI 00 and protease inhibitors (Roche Diagnosis).
  • Western blot on mouse plasma was performed on samples diluted 1:4 in distilled water. Mouse tissues were prepared as indicated for GAA activity. Protein concentration was determined using the BCA Protein Assay (Thermo Fisher Scientific). SDS- page electrophoresis was performed in a 4-12% polyacrylamide gel. After transfer the membrane was blocked with Odyssey buffer (Li-Cor Biosciences) and incubated with an anti-GAA antibody (rabbit monoclonal, Abeam), or anti-vinculin (mouse monoclonal, Sigma Aldrich). The membrane was washed and incubated with the appropriate secondary antibody (Li-Cor Biosciences), and visualized by Odyssey imaging system (Li-Cor Biosciences).
  • Anti-GAA antibody measurement was performed according to a published protocol. Briefly, maxisorp 96 wells plates (Thermo Fisher Scientific) were coated with 1 pg/ml of rhGAA. IgG standard curves were made by serial 1 to 2 dilutions of commercial mouse (Sigma Aldrich) recombinant IgG which were coated directly onto the wells in duplicate. Anti -mouse (Southern biotech) IgG secondary antibodies were used as secondary antibodies.
  • Two heterologous domains reported to increase protein half-life/stability were selected : 1. an albumin binding domain (Alb) and 2. the Carboxyl -Terminal Peptides (CTP) of the Human Chorionic Gonadotropin b Subunit (abbreviated as CTP)
  • the Alb or the CTP domains were inserted at the N- terminus of the sp7-A42-GAAco variant [Puzzo F., et ah, Sci Transl Med.
  • sp7-Alb-A42-GAAco variant (abbreviated as HD-Alb) or the sp7-CTP-A42-GAAco variant (abbreviated as HD-CTP), respectively (Fig. 1).
  • An aminoacidic linker (3 aminoacids, Maga JA, et al., J Biol Chem. 2013;288(3): 1428-1438.) was placed between the stability domains and the GAA to ensure proper enzyme folding (Fig. 1).
  • sp7-A42-GAAco variants were cloned in an expression cassette under the control of the hepatocyte-restricted Apolipoprotein (ApoE) enhancer with human alpha- 1 anti -trypsin (hAAT) promoter.
  • All the transgenes expression cassette encoding for the sp7-A42-GAAco variants contained the same previously described regulatory elements [Puzzo F., et al., Sci Transl Med. 2017 Nov 29;9(418); Fig. 1):
  • hAAT human alpha 1 -antitrypsin
  • HBB2.1 human haemoglobin b-subunit synthetic intron
  • bovine growth hormone (bGH) polyadenylation signal the bovine growth hormone (bGH) polyadenylation signal.
  • the production and enzymatic activity of the GAA variants with the heterologous domains [sp7-Alb- A42-GAAco (HD-Alb) and sp7-CTP-A42-GAAco (HD-CTP)] were first tested in a human hepatocyte cell line (HuH7) in culture by transient transfection of the respective pAAV plasmids.
  • the variant devoid of heterologous domains (sp7-A42-GAAco, abbreviated as HD0) was used as positive control.
  • Three independent transient transfections of HuH7 cells were performed (Fig. 2). Cell culture media and cells were harvested 72h after transfection. GAA enzyme activity was measured in cell lysates (Fig. 2A) and culture media (Fig.
  • the HD-CTP variant showed a preserved enzymatic activity in cell and culture media, indicating proper enzyme maturation and secretion (Fig. 2).
  • the HD- Alb variant instead resulted in reduced enzymatic activity in culture media compared to both HD0 and HD-CTP variants (Fig. 2).
  • AAV8 vectors encoding for each variant sp7-Alb-A42-GAAco (HD-Alb) and sp7-CTP- A42-GAAco (HD-CTP).
  • AAV8 vectors encoding for the GAA variant devoid of heterologous domains sp7-A42-GAAco (HDO) was used as positive control.
  • the AAV8 vectors were produced as they efficiently transduce mouse hepatocytes.
  • GAA activity in plasma was increased in all AAV-treated mice compared to PBS controls (Fig. 3).
  • Secretion of GAA in the circulation was readily confirmed in the plasma of all mice treated with AAV vectors at the first time point analyzed (14 days after treatment) by Western blot analyses with anti-GAA antibody (Fig. 4).
  • GAA band quantification Fig.
  • HD-CTP variant is more stable in the plasma than HDO, resulting in enzyme amount and activity superior to those achieved with the HDO variant.
  • mice were sacrificed and tissues were collected to evaluate GAA activity.
  • GAA enzyme activity was increased in the liver of Gaa-/- mice treated with AAV vectors (Fig. 5A) compared to both Gaa+/+ and PBS-treated Gaa-/- mice (Fig. 5A).
  • No significant differences in liver GAA activity were found between HD-CTD and HDO reflecting similar GAA protein expression in hepatocytes (Fig. 5A).
  • GAA activity in skeletal muscle triceps, Fig. 5B was significantly increased in the HD-CTP treatment group but not in the HDO treatment group (Fig. 5B).
  • the GAA activity in the HD-CTP cohort was significantly higher compared to the HDO, PBS and Gaa+/+ cohorts (Fig. 5B). These data show that the use of the chimeric HD-CTP variant results in improved uptake of the enzyme in skeletal muscle (Fig. 5B). In the CNS (brain, Fig. 5C) GAA activity was also significantly increased only in the HD-CTP treatment group (Fig. 5B) compared to the PBS treatment group (Fig. 5C). These data show that the use of the chimeric HD-CTP variant is advantageous with respect to enzyme uptake in the CNS, compared to HDO (Fig. 5C).

Abstract

The present invention relates to chimeric acid-alpha glucosidase polypeptides and uses thereof. Said chimeric polypeptides comprise a functional acid-alpha glucosidase polypeptide fused to one or more heterologous moieties.

Description

CHIMERIC ACID-ALPHA GLUCOSIDASE POLYPEPTIDES AND USES THEREOF
The present invention relates to chimeric acid-alpha glucosidase polypeptides and uses thereof. Said chimeric polypeptides comprise a functional acid-alpha glucosidase polypeptide fused to one or more heterologous moieties.
Pompe disease, also known as glycogen storage disease (GSD) type II and acid maltase deficiency, is an autosomal recessive metabolic myopathy caused by a deficiency of the lysosomal enzyme acid alpha- glucosidase (GAA). GAA is an exo-1,4 and 1,6-a-glucosidase that hydrolyzes glycogen to glucose in the lysosome. Deficiency of GAA leads to glycogen accumulation in lysosomes and causes progressive damage to respiratory, cardiac, and skeletal muscle. The disease ranges from a rapidly progressive infantile course that is usually fatal by 1-2 years of age to a more slowly progressive and heterogeneous course that causes significant morbidity and early mortality in children and adults. Hirschhom RR, The Metabolic and Molecular Bases oflnherited Disease, 3: 3389-3420 (2001, McGraw-Hill); Van der Ploeg and Reuser, Lancet 372: 1342-1351 (2008).
Current human therapy for treating Pompe disease involves administration of recombinant human GAA, otherwise termed enzyme-replacement therapy (ERT). ERT has demonstrated efficacy for severe, infantile GSD II. However the benefit of enzyme therapy is limited by a poor biodistribution of the protein following peripheral vein delivery, lack of uptake from several tissues, and the need for frequent infusions.
As an alternative or adjunct to ERT, the feasibility of gene therapy approaches to treat GSD-II have been investigated (Amalfitano, A., et al. (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866, Ding, E., et al. (2002) Mol. Ther. 5:436-446, Fraites, T. J., et al. (2002) Mol. Ther. 5:571-578, Tsujino, S., et al. (1998) Hum. Gene Ther. 9: 1609-1616).
Modified GAA proteins have also been proposed in the past to improve lysosomal storage disease treatment. In particular, application W02004064750 and Sun et al. 2006, disclose a chimeric GAA polypeptide comprising a signal peptide operably linked to GAA as a way to enhance targeting of the protein to the secretory pathway. In WO2018/046772, WO2018/046775 and WO2018/046774 patent applications, GAA variants were provided to improve current gene replacement therapies for Pompe disease. Said patent applications disclose GAA variants that were shown to be highly secretable and less immunogenic than their wild type counterpart.
Further improvements of GAA are herein described. SUMMARY OF THE INVENTION
The present invention relates to a nucleic acid molecule encoding a chimeric GAA polypeptide comprising a functional GAA polypeptide fused to one or more heterologous moieties, wherein at least one of the heterologous moieties is a carboxy-terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCGp).
In a particular embodiment, the chimeric GAA polypeptide comprises a functional GAA polypeptide fused to one heterologous moiety being a CTP of the hCGp. In particular, the CTP of the hCGP may be encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, more preferably 100% identity to the nucleotide sequence of SEQ ID NO: 13.
In a particular embodiment the functional GAA polypeptide is encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, to a nucleotide sequence selected from SEQ ID NO: 1-3. In another particular embodiment, the functional GAA polypeptide corresponds to a truncated form of GAA. In particular, the functional GAA polypeptide may have 42 consecutive amino acids truncated at its N-terminal end as compared to GAA. In a particular embodiment, the truncated GAA is encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, more preferably 100% identity to the nucleotide sequence of SEQ ID NO: 10.
In a particular embodiment, the heterologous moiety is fused at the N-terminal end of the functional GAA polypeptide.
In a particular embodiment, the chimeric GAA polypeptide further comprises a signal peptide moiety that may have an amino acid sequence selected in the group consisting of SEQ ID NO: 18-22, preferably SEQ ID NO: 21.
Another aspect of the invention relates to a nucleic acid construct comprising the nucleic acid molecule as described above, linked to a promoter, wherein said nucleic acid construct optionally further comprises an intron. In a particular embodiment, the nucleic acid construct comprises in this order: a promoter; an intron; the nucleic acid molecule as described above ; and a polyadenylation signal.
A further aspect of the invention relates to a vector comprising the nucleic acid molecule or the nucleic acid construct of the invention, such as a viral vector, preferably a retroviral vector, such as a lentiviral vector, or an AAV vector. In a particular embodiment, the vector is a single-stranded or double-stranded self-complementary AAV vector, preferably an AAV vector with an AAV-derived capsid, such as an AAV1 capsid, AAV2 capsid, variant AAV2 capsid, AAV3 capsid, variant AAV3 capsid, AAV3B capsid, variant AAV3B capsid, AAV4 capsid, AAV5 capsid, AAV6 capsid, variant AAV6 capsid, AAV7 capsid, AAV8 capsid, AAV9 capsid, AAV10 capsid such as AAVcylO capsid and AAVrhlO capsid, AAVrh74 capsid, AAVdj capsid, AAVAnc80 capsid, AAV-LK03 capsid, AAV2i8 capsid, and porcine AAV capsid, such as AAVpo4 capsid and AAVpo6 capsid or with a chimeric capsid. In a particular embodiment, the vector has an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, more particularly an AAV8 capsid.
The invention also relates to an isolated cell transformed with the nucleic acid molecule, the nucleic acid construct or the vector as described above.
The invention also relates to a chimeric GAA polypeptide encoded by the nucleic acid molecule of the invention.
It is also herein described a pharmaceutical composition, comprising, in a pharmaceutically acceptable carrier, the nucleic acid molecule, the nucleic acid construct, the vector, the isolated cell, or the chimeric GAA polypeptide as described above.
It is also described the nucleic acid molecule, the nucleic acid construct, the vector, the isolated cell, or the chimeric GAA polypeptide, for use as a medicament. In a particular embodiment, the nucleic acid molecule, the nucleic acid construct, the vector, the isolated cell, or the chimeric GAA polypeptide is for use in a method for treating GSDII (Pompe disease).
LEGENDS TO THE FIGURES
Figure 1. Schematic representation of expression cassettes encoding chimeric GAA variants of the invention. The heterologous domains (HD) were cloned at the GAA N-terminus. ITR: inverted terminal repeats from AAV2; Promoter: ApoE Enhancer (ApoE) and hepatocyte-specific human alpha 1- antitrypsin promoter (hAAT); intron: optimized human haemoglobin b-subunit synthetic intron (HBB2.1); signal peptide from the human Chymotrypsinogen (sp7); HD: heterologous domain; GAAco: codon optimized GAA; polyA: human bovine growth hormone poly-adenylation sequence; Alb: albumin binding domain; CTP: Carboxyl -Terminal Peptide (CTP) of the Human Chorionic Gonadotropin b Subunit; linker: 3 amino acids linker.
Figure 2. Expression of chimeric GAA variants of the invention in human hepatocyte cell cultures.
Analysis of HuH7 lysates and media 72h after transfection with plasmids encoding for the chimeric GAA variants sp7-Alb-A42-GAAco (HD-Alb) and sp7-CTP-A42-GAAco (HD-CTP). The GAA variant devoid of heterologous domains sp7-A42-GAAco (HD0) was used as comparison. CTRL: control cells transfected with a plasmid encoding for the enhanced green fluorescent protein and used as negative control. Transfection was repeated in 3 independent experiments. (A) Analysis of GAA activity in HuH7 lysates. (B) Analysis of GAA activity in HuH7 media. For each replicate, GAA data were expressed as relative amount compared to HD0 (HD0=100%). (A-B) Data are shown as mean ± standard deviation of the mean (SD) of 3 independent experiments. Statistical analysis: one-way ANOVA with Tukey’s post hoc. *p<0.05.
Figure 3. Activity of GAA variants of the invention in the plasma of C57BL/6 mice following AAV liver gene transfer. Analyses of GAA activity in the plasma of C57BL/6 mice measured at 0.5, 1 and 1.5 months after intravenous administration of AAV8 vectors encoding for the chimeric GAA variants (vector dose: 5xl0nvg/kg); mice treated with PBS were used as negative control (n=4 mice); HD-Alb: sp7-Alb-A42-GAAco (n=4 mice); HD-CTP : sp7-CTP-A42-GAAco (n=5 mice); HD0: sp7-A42- GAAco (n=4 mice). Data are shown as mean ± SD. Statistical analysis: two-way ANOVA with Tukey’s post hoc (treatment and time), multiple comparison “All groups vs. all, time point independent”. Asterisks (*) indicate significant differences as specified in the legend. * p<0.05.
Figure 4. Secretion of GAA variants of the invention in the plasma of C57BL/6 mice following AAV liver gene transfer. Analyses of GAA secretion in the plasma of C57BL/6 mice measured at 0.5 months after intravenous administration of AAV8 vectors encoding for the chimeric GAA variants (vector dose: 5xl0nvg/kg); mice treated with PBS were used as negative control (n=4 mice); HD-Alb: sp7-Alb-A42-GAAco (n=4 mice); HD-CTP : sp7-CTP-A42-GAAco (n=5 mice); HDO: sp7-A42- GAAco (n=4 mice). (A) Western blot in plasma with anti-hGAA antibody, recombinant human GAA (rhGAA) was used as positive control; marker: molecular weight marker. (B) Quantification of GAA protein bands from Western blot depicted in panels A, the non-specific lower band was used for loading normalization. Data are shown as mean ± SD. Statistical analysis: One-way ANOVA with Tukey’s post hoc, multiple comparison “All groups vs. all, time point independent”. Asterisks (*) indicate significant differences as specified in the legend. * p<0.05.
Figure 5. Analyses of GAA activity in the tissues of Gaa -/- mice following AAV liver gene transfer of the chimeric HD-CTP variant. Analyses of GAA activity in tissues of Gaa-/- mice 4 months after treatment with AAV8 vectors encoding for the chimeric HD-CTP variant (n=6) or the HDO variant (n=6), vector dose: 5xl0nvg/kg; mice treated with PBS were used as negative control (n=6); Gaa+/+ (n=5) were used as unaffected control. Data are shown as mean ± SD. Asterisks (*) and hashtags (#) indicate significant differences versus the groups indicated in the legend; GAA activity in Liver (A), Triceps (B) and Brain (C) is depicted. Statistical analysis: one-way ANOVA with Tukey’s post hoc, multiple comparison “All groups vs. all”. * p<0.05, #p<0.05.
Figure 6. Analyses of GAA immunogenicity in the plasma of Gaa -/- mice following AAV liver gene transfer of the chimeric HD-CTP variant. Analyses of anti -GAA IgG in the plasma of Gaa-/- mice at 1 and 4 months after administration with AAV8 vectors encoding for the HD0 and HD-CTP variants (n=6/cohort; vector dose: 5xl0nvg/kg); mice treated with PBS were used as negative control; Gaa+/+ (n=5) were used as unaffected control. Data are shown as mean ± SD. Statistical analysis: one-way ANOVA with Tukey’s post hoc, multiple comparison “All groups vs. all”.
DETAILED DESCRIPTION OF THE INVENTION
Lysosomal acid a-glucosidase or "GAA" (E.C. 3.2. 1.20) (1,4-a-D-glucan glucohydrolase), is an exo- 1,4-a-D-glucosidase that hydrolyses both a- 1,4 and a- 1,6 linkages of oligosaccharides to liberate glucose. A deficiency in GAA results in glycogen storage disease type II (GSDII), also referred to as Pompe disease (although this term formally refers to the infantile onset form of the disease). It catalyzes the complete degradation of glycogen with slowing at branching points. The 28 kb human acid a- glucosidase gene on chromosome 17 encodes a 3.6 kb mRNA which produces a 951 amino acid polypeptide (Hoefsloot et ah, (1988) EMBO J. 7: 1697; Martiniuk et ah, (1990) DNA and Cell Biology 9: 85). The enzyme receives co-translational N-linked glycosylation in the endoplasmic reticulum. It is synthesized as a 110-kDa precursor form, which matures by extensive glycosylation modification, phosphorylation and by proteolytic processing through an approximately 90-kDa endosomal intermediate into the final lysosomal 76 and 67 kDa forms (Hoefsloot, (1988) EMBO J. 7: 1697; Hoefsloot et ah, (1990) Biochem. J. 272: 485; Wisselaar et ah, (1993) J. Biol. Chem. 268: 2223; Hermans et ak, (1993) Biochem. J. 289: 681).
In patients with GSD II, a deficiency of acid a-glucosidase causes massive accumulation of glycogen in lysosomes, disrupting cellular function (Hirschhom, R. and Reuser, A. J. (2001), in The Metabolic and Molecular Basis for Inherited Disease, (eds, Scriver, C. R. et al.) pages 3389-3419 (McGraw-Hill, New York). In the most common infantile form, patients exhibit progressive muscle degeneration and cardiomyopathy and die before two years of age. Severe debilitation is present in the juvenile and adult onset forms.
Current approaches for treating Pompe disease involve administration of recombinant human GAA, otherwise termed enzyme-replacement therapy (ERT), or administration of a gene therapy vector expressing human GAA. The present inventors have studied new methods for enhancing the in vivo activity of GAA by fusing heterologous moieties with a GAA polypeptide. As a result, the present inventors have shown = that a fusion protein of GAA with the carboxy-terminal peptide of the human Chorionic Gonadotropin beta- subunit has improved properties including higher plasmatic activity and better activity in tissues such as skeletal muscles, more particularly in triceps. Noteworthy, the addition of the carboxy-terminal peptide of the human Chorionic Gonadotropin beta-subunit does not elicit an increased immunogenic response against the chimeric GAA polypeptide
1- Nucleic acid molecule
An aspect of the invention relates to a nucleic acid molecule encoding a chimeric GAA polypeptide comprising a functional GAA polypeptide fused to one or more heterologous moieties, wherein at least one of the heterologous moieties is a carboxy-terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCG ).
By “chimeric protein” or “fusion protein” is meant proteins created through the joining of two or more genes that originally encode separate proteins.
In the context of the present invention, a “chimeric GAA polypeptide” refers to the fusion of:
- a functional GAA polypeptide, with
- one or more “heterologous moieties” derived from a polypeptide different from GAA.
Functional GAA polypeptide
The term "GAA" or "GAA polypeptide", as used herein, encompasses mature (~76 or ~67 kDa) and precursor (e.g., -110 kDa) GAA, in particular the precursor form, as well as modified or mutated by insertion(s), deletion (s) and/or substitution(s) GAA proteins or fragments thereof that are functional derivatives of GAA, i.e. that retain biological function of GAA (i.e., have at least one biological activity of the native GAA protein, e. g., can hydrolyze glycogen, as defined above) and GAA variants (e.g., GAA II as described by Kunita et ah, (1997) Biochemica et Biophysica Acta 1362: 269; GAA polymorphisms and SNPs are described by Hirschhom, R. and Reuser, A. J. (2001) In The Metabolic and Molecular Basis for Inherited Disease (Scriver, C. R. , Beaudet, A. L., Sly, W. S. & Valle, D. Eds. ), pp. 3389- 3419. McGraw-Hill, New York, see pages 3403-3405). Any GAA coding sequence known in the art may be used, for example, see SEQ ID NO:l; GenBank Accession number NM_00152 and Hoefsloot et ah, (1988) EMBO J. 7: 1697 and Van Hove et ah, (1996) Proc. Natl. Acad. Sci. USA 93: 65 (human), GenBank Accession number NM_008064 (mouse), and Kunita et al., (1997) Biochemica et Biophysica Acta 1362: 269 (quail).
In the context of the present invention, the nucleic acid molecule encodes a chimeric GAA polypeptide comprising any “functional GAA polypeptide”, i.e. it encodes for a GAA protein that, when expressed, has the functionality of wild-type GAA protein. As defined above, the functionality of wild-type GAA is to hydrolyse both a- 1,4 and a- 1,6 linkages of oligosaccharides and polysaccharides, more particularly of glycogen, to liberate glucose. The functional GAA protein encoded by the nucleic acid of the invention may have a hydrolysing activity on glycogen of at least 50 %, 60 %, 70 %, 80 %, 90 %, 95 %, 99 %, or at least 100 % as compared to the wild-type GAA protein encoded by the nucleic acid sequence of SEQ ID NO: 1 to 3, for example as compared to the GAA polypeptide having the amino acid sequence of SEQ ID NO:4. The activity of the functional GAA polypeptide encoded by the nucleic acid of the invention may even be of more than 100 %, such as of more than 110 %, 120 %, 130 %, 140 %, or even more than 150 % of the activity of the wild-type GAA protein encoded by the nucleic acid sequence of SEQ ID NO: 1 to 3, for example as compared to the GAA polypeptide having the amino acid sequence of SEQ ID NO:4.
A skilled person is readily able to determine whether a nucleic acid according to the invention expresses a functional GAA protein. For example, one suitable in vitro method involves inserting the nucleic acid into a vector, such as a plasmid or viral vector, transfecting or transducing host cells, such as 293T or HeLa cells, or other cells such as Huh7, with the vector, and assaying for GAA activity. Alternatively, a suitable in vivo method involves transducing a vector containing the nucleic acid into a mouse model of Pompe disease or another glycogen storage disorder and assaying for functional GAA in the plasma of the mouse and presence of GAA in tissues. Suitable methods are described in more details in the experimental part below.
The sequence of the nucleic acid molecule of the invention encoding the functional GAA polypeptide preferably has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, in particular at least 95 percent identity, for example at least 98, 99 or 100 percent identity to the nucleotide sequence of SEQ ID NO: 1, 2 or 3, which are sequences optimized for transgene expression in vivo.
The term “identical” and declinations thereof refers to the sequence identity between two nucleic acid molecules or two amino acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. The percent of identity between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared X 100. For example, if 6 of 10 of the positions in two sequences are matched then the two sequences are 60% identical. Generally, a comparison is made when two sequences are aligned to give maximum identity. Various bioinformatic tools known to the one skilled in the art might be used to align nucleic acid sequences such as BLAST or FASTA.
In a particular embodiment, the functional GAA polypeptide encoded by the nucleic acid molecule as herein described is a functional, truncated form of GAA. By "truncated form" or “truncated GAA”, it is meant a GAA polypeptide that comprises one or several consecutive amino acids deleted from the N- terminal part of a parent GAA polypeptide. According to the present invention a "parent GAA polypeptide" is a functional, precursor GAA sequence, but devoid of its signal peptide. For example, with reference to the typical wild-type human GAA polypeptide, a complete wild-type GAA polypeptide (i.e. a precursor form of GAA) is represented in SEQ ID NO: 5 or in SEQ ID NO: 6 and has a signal peptide (corresponding to amino acids 1-27 of SEQ ID NO: 5 or SEQ ID NO: 6), whereas the parent GAA polypeptide serving as basis for the truncated GAA forms of these wild-type human GAA polypeptides are represented in SEQ ID NO: 7 and SEQ ID NO: 8, respectively and have no signal peptide. In this example, the latter, corresponding to amino acids 28-952 of SEQ ID NO: 5 and to amino acids 28-952 of SEQ ID NO: 6, is referred to as a parent GAA polypeptide.
According to the invention, the truncated GAA polypeptide is a functional GAA polypeptide, i.e. it has the functionality of wild-type GAA polypeptide as defined above.
The amino acid sequence of the parent GAA polypeptide or its coding sequence can be derived from any source, including avian and mammalian species. The term “avian” as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys and pheasants. The term “mammal” as used herein includes, but is not limited to, humans, simians and other non-human primates, bovines, ovines, caprines, equines, felines, canines, lagomorphs, etc. In embodiments of the invention, the parent GAA polypeptide is a human, mouse or quail, in particular a human, GAA polypeptide.
In addition, the parent GAA polypeptide may be a functional variant of a GAA polypeptide, comprising one or more amino acid modifications such as amino acid insertion, deletion and/or substitution as compared to a known GAA polypeptide. For example, the parent polypeptide may be a functional derivative of a human GAA polypeptide, such as the polypeptide of SEQ ID NO:7 or SEQ ID NO:8, in particular SEQ ID NO:7, having at least 80, 85, 90, 95, 96, 97, 98 or at least 99 percent sequence identity to this human GAA polypeptide. For example, the functional variant of a GAA polypeptide may have between 0 and 50, between 0 and 30, between 0 and 20, between 0 and 15, between 0 and 10, or between 0 and 5 amino acid changes to the parent GAA polypeptide, such as the parent GAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO:8, in particular SEQ ID NO:7. In particular, the parent GAA polypeptide may consist of the human GAA polypeptide having the amino acid sequence shown in SEQ ID NO:7 or SEQ ID NO:8, in particular in SEQ ID NO:7.
The truncated form of GAA according to the invention is a N-terminally truncated form of a parent GAA polypeptide, wherein at least one amino acid is deleted from the N-terminal end of said parent GAA polypeptide. For example, the truncated GAA polypeptide may have 1 to 75 consecutive amino acids or more than 75 consecutive amino acids truncated from its N-terminal end as compared to the parent GAA polypeptide. Specifically, the truncated GAA polypeptide may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74 or 75 consecutive amino acids truncated from its N-terminal end as compared to the parent GAA protein (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7). Using an alternative nomenclature, the truncated GAA polypeptide resulting from the truncation of 1 amino acid in the parent GAA polypeptide is referred to as A 1 GAA truncated form, the GAA polypeptide resulting from the truncation of 2 consecutive amino acids from the N-terminal end is referred to as D2 GAA truncated form, the GAA polypeptide resulting from the truncation of 3 consecutive amino acids in the parent GAA polypeptide is referred to as D3 GAA truncated form), etc. In a particular embodiment, the truncated GAA polypeptide of the invention is a Al, D2, D3, D4, D5, D6, D7, D8, D9, D10, Al l, D12,
D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31,
D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44, D45, D46, D47, D48, D49, D50,
D51, D52, D53, D54, D55, D56, D57, D58, D59, D60, D61, D62, D63, D64, D65, D66, D67, D68, D69,
D70, D71, D72, D73, D74 or D75 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO:8, in particular in SEQ ID NO:7).
In another particular embodiment, the truncated GAA polypeptide of the invention is a Al, D2, D3, D4,
D5, D6, D7, D8, D9, D10, A11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44,
D45, D46 or D47 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In another particular embodiment, the truncated GAA polypeptide of the invention is a Al, D2, D3, D4,
D5, D6, D7, D8, D9, D10, A11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44, D45 or D46 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In another particular embodiment, the truncated GAA polypeptide of the invention is a Al, D2, D3, D4,
D5, D6, D7, D8, D9, D10, A11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44 or
D45 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3, D4,
D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43 or D44
GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3, D4,
D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3, D4,
D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D2, D3, D4, D5,
D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D3, D4, D5, D6,
D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D4, D5, D6, D7,
D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D5, D6, D7, D8,
D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42 or D43 GAA truncated form (in particular a truncated form of the parent hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8, D9 or D10 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), in particular a D7, D8 or D9 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), more particularly a D8 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D27, D28, D29, D30 or D31 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7), in particular a D28, D29 or D30 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), more particularly a D29 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In another particular embodiment, the truncated GAA polypeptide of the invention is a D40, D41, D42, D43, or D44 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7), in particular a D41, D42 or D43 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), more particularly a D42 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In a further particular embodiment, the truncated GAA polypeptide of the invention is a D41, D42, D43, D44 or D45 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7), in particular a D42, D43 or D44 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7), more particularly a D43 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7).
In another embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D27, D28, D29, D30, D31, D40, D41, D42, D43, D44, D45, D46 or D47 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In another embodiment, the truncated GAA polypeptide of the invention is a D7, D8, D9, D28, D29, D30, D41, D42, D43 or D44 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In another embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D40, D41, D42, D43 or D44, truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In another embodiment, the truncated GAA polypeptide of the invention is a D8, D29, D42, D43 or D47 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In another embodiment, the truncated GAA polypeptide of the invention is a D8, D29, D42 or D43 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In another embodiment, the truncated GAA polypeptide of the invention is a D8 or D42 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In a particular embodiment, of the invention, the truncated GAA polypeptide of the invention is a truncated form of a functional human GAA polypeptide. In a further particular embodiment, the parent hGAA polypeptide is the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7. In a variant of this embodiment, the truncated GAA polypeptide of the invention is a
Al, D2, D3, D4, D5, D6, D7, D8, D9, D10, A11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44, D45, D46, D47, D48, D49, D50, D51, D52, D53, D54, D55, D56, D57, D58, D59, D60, D61, D62, D63, D64, D65, D66, D67, D68, D69, D70, D71, D72, D73, D74 or D75 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In a variant of this embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3, D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44, D45, D46 or D47 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In a variant of this embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3, D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44, D45 or D46 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In a variant of this embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3, D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43, D44 or
D45 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3,
D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, D43 or
D44 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7. In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3,
D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43
GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D1, D2, D3,
D4, D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D2, D3, D4,
D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D3, D4, D5,
D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D4, D5, D6,
D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D5, D6, D7,
D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8,
D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D7, D8, D9,
D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D8, D9, D10,
D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41 or D42 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7. In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D2, D3, D4,
D5, D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D3, D4, D5,
D6, D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D4, D5, D6,
D7, D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D5, D6, D7,
D8, D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8,
D9, D10, D11, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28,
D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D7, D8, D9, D10, Al l, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO: 7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D8, D9, A 10, Al l, D12, D13, D14, D15, D16, D17, D18, D19, D20, D21, D22, D23, D24, D25, D26, D27, D28, D29, D30, D31, D32, D33, D34, D35, D36, D37, D38, D39, D40, D41, D42, or D43 GAA truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, even more particularly in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO:
7, and having at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 SEQ ID NO: 8, in particular SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8, D9 or D10, in particular a D7, D8 or D9, more particularly a D8 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D27, D28, D29, D30 or D31, in particular a D28, D29 or D30, more particularly a D29 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO:
8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D40, D41, D42, D43 or D44, in particular a D41, D42 or D43, more particularly a D42 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D41, D42, D43, D44 or D45, in particular a D42, D43 or D44, more particularly a D43 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D27, D28, D29, D30, D31, D40, D41, D42, D43, D44 or D45, in particular a D7, D8, D9, D28, D29, D30, D41, D42, D43 or D44, in particular a D8, D29, D42 or D43 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D6, D7, D8, D9, D10, D40, D41, D42, D43 or D44, in particular a D8 or D42 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D8, D29, D42, D43 or D47 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D8, D29, D42 or D43 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In another variant of this embodiment, the truncated GAA polypeptide of the invention is a D8 or D42 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO: 7 or SEQ ID NO: 8, in particular in SEQ ID NO: 7.
In a particular embodiment, the truncated GAA polypeptide of the invention is a D42 truncated form of GAA (in particular of the hGAA protein shown in SEQ ID NO: 7 or SEQ ID NO: 8, particular in SEQ ID NO: 7).
In a particular embodiment, the truncated GAA polypeptide of the invention is a D42 truncated form of a hGAA polypeptide, and more particularly of the hGAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO:8, in particular in SEQ ID NO:7, or of a functional variant thereof comprising amino acid substitutions in the sequence shown in SEQ ID NO:7 or SEQ ID NO:8, in particular in SEQ ID NO:7, and having at least 80, 85, 90, 95, 96, 97, 98 or 99 percent identity to SEQ ID NO:7 or SEQ ID NO:8, in particular in SEQ ID NO: 7. In a particular embodiment, the functional variant of a GAA polypeptide may have, in addition to the truncation defined above, between 0 and 50, between 0 and 30, between 0 and 20, between 0 and 15, between 0 and 10, or between 0 and 5 amino acid changes to the parent GAA polypeptide, such as the parent GAA polypeptide shown in SEQ ID NO: 7 or SEQ ID NO: 8, in particular SEQ ID NO:7.
In a specific embodiment, the truncated hGAA polypeptide of the invention has an amino acid sequence consisting of the sequence shown in SEQ ID NO: 54, SEQ ID NO: 9, SEQ ID NO: 55, SEQ ID NO: 56 or SEQ ID NO: 57, or a functional variant thereof comprising from 1 to 5 amino, in particular from 1 to 4, in particular from 1 to 3, more particularly from 1 to 2, in particular 1 amino acid substitution as compared to the sequence shown in SEQ ID NO: 54, SEQ ID NO: 9, SEQ ID NO: 55, SEQ ID NO: 56 or SEQ ID NO: 57. In another specific embodiment, the truncated hGAA polypeptide of the invention has an amino acid sequence consisting of the sequence shown in SEQ ID NO: 54, SEQ ID NO: 9, SEQ ID NO: 55 or SEQ ID NO: 56, or a functional variant thereof comprising from 1 to 5 amino acid substitutions as compared to the sequence shown in SEQ ID NO: 54, SEQ ID NO: 9, SEQ ID NO: 55 or SEQ ID NO: 56. In a specific embodiment, the truncated hGAA polypeptide of the invention has an amino acid sequence consisting of the sequence shown in SEQ ID NO: 54 or SEQ ID NO: 9, or a functional variant thereof comprising from 1 to 5 amino, in particular from 1 to 4, in particular from 1 to 3, more particularly from 1 to 2, in particular 1 amino acid substitution as compared to the sequence shown in SEQ ID NO: 54 or SEQ ID NO: 9.
In a specific embodiment, the truncated hGAA polypeptide of the invention has an amino acid sequence consisting of the sequence shown in SEQ ID NO: 9 or a functional variant thereof comprising from 1 to 5, in particular from 1 to 4, in particular from 1 to 3, more particularly from 1 to 2, in particular 1 amino acid substitution as compared to the sequence shown in SEQ ID NO: 9.
The nucleic acid sequence encoding the functional GAA polypeptide, in particular the truncated GAA polypeptide, can be optimized for expression of the GAA polypeptide in vivo. Sequence optimization may include a number of changes in a nucleic acid sequence, including codon optimization, increase of GC content, decrease of the number of CpG islands, decrease of the number of alternative open reading frames (ARFs) and decrease of the number of splice donor and splice acceptor sites. Because of the degeneracy of the genetic code, different nucleic acid molecules may encode the same protein. It is also well known that the genetic codes of different organisms are often biased towards using one of the several codons that encode the same amino acid over the others. Through codon optimization, changes are introduced in a nucleotide sequence that take advantage of the codon bias existing in a given cellular context so that the resulting codon optimized nucleotide sequence is more likely to be expressed in such given cellular context at a relatively high level compared to the non-codon optimised sequence. In a preferred embodiment of the invention, such sequence optimized nucleotide sequence encoding a truncated GAA is codon-optimized to improve its expression in human cells compared to non-codon optimized nucleotide sequences coding for the same truncated GAA protein, for example by taking advantage of the human specific codon usage bias.
In a particular embodiment, the optimized GAA coding sequence is codon optimized, and/or has an increased GC content and/or has a decreased number of alternative open reading frames, and/or has a decreased number of splice donor and/or splice acceptor sites, as compared to nucleotides 82-2859 of the wild-type hGAA coding sequence of SEQ ID NO:l. For example, nucleic acid sequence of the invention results in an at least 2, 3, 4, 5 or 10 % increase of GC content in the GAA sequence as compared to the sequence of the wild-type GAA sequence. In a particular embodiment, the nucleic acid sequence of the invention results in a 2, 3, 4 or, more particularly, 5% or 10% (particularly 5%) increase of GC content in the GAA sequence as compared to the sequence of the wild-type GAA nucleotide sequence. In a particular embodiment, the nucleic acid sequence of the invention encoding a functional GAA polypeptide is “substantially identical”, that is, about 70% identical, more preferably about 80% identical, even more preferably about 90% identical, even more preferably about 95% identical, even more preferably about 97%, 98% or even 99% identical to nucleotides 82-2859 of the sequence shown in SEQ ID NO: 1. As mentioned above, in addition to the GC content and/or number of ARFs, sequence optimization may also comprise a decrease in the number of CpG islands in the sequence and/or a decrease in the number of splice donor and acceptor sites. Of course, as is well known to those skilled in the art, sequence optimization is a balance between all these parameters, meaning that a sequence may be considered optimized if at least one of the above parameters is improved while one or more of the other parameters is not, as long as the optimized sequence leads to an improvement of the transgene, such as an improved expression and/or a decreased immune response to the transgene in vivo.
In addition, the adaptiveness of a nucleotide sequence encoding a functional GAA to the codon usage of human cells may be expressed as codon adaptation index (CAI). A codon adaptation index is herein defined as a measurement of the relative adaptiveness of the codon usage of a gene towards the codon usage of highly expressed human genes. The relative adaptiveness (w) of each codon is the ratio of the usage of each codon, to that of the most abundant codon for the same amino acid. The CAI is defined as the geometric mean of these relative adaptiveness values. Non-synonymous codons and termination codons (dependent on genetic code) are excluded. CAI values range from 0 to 1, with higher values indicating a higher proportion of the most abundant codons (see Sharp and Li, 1987, Nucleic Acids Research 15: 1281-1295; also see: Kim et al, Gene. 1997, 199:293-301; zur Megede et al, Journal of Virology, 2000, 74: 2628-2635). Preferably, a nucleic acid molecule encoding a GAA has a CAI of at least 0.75 (in particular 0.77), 0.8, 0.85, 0.90, 0.92 or 0.94.
The term “nucleic acid sequence” (or nucleic acid molecule) refers to a DNA or RNA molecule in single or double stranded form, particularly a DNA encoding a functional GAA polypetide according to the invention.
In another embodiment of the invention, the part of the nucleic acid molecule of the invention encoding the truncated GAA polypeptide has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, in particular at least 95 percent identity, for example at least 98, 99 or 100 percent identity to the corresponding part of the nucleotide sequence SEQ ID NO: 2 or 3, which are sequence-optimized sequences.
In a preferred embodiment, the part of the nucleic acid molecule of the invention encoding the truncated GAA polypeptide has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, in particular at least 95 percent identity, for example at least 98, 99 or 100 percent identity to the SEQ ID NO: 10 or SEQ ID NO: 11, preferably SEQ ID NO: 10, encoding the polypeptide having the amino acid sequence shown in SEQ ID NO: 9. In a particular embodiment, the nucleic acid sequence encoding the truncated GAA polypeptide consists of the sequence shown in SEQ ID NO: 10 or SEQ ID NO: 11, preferably SEQ ID NO: 10, encoding the polypeptide having the amino acid sequence shown in SEQ ID NO: 9. In addition, the functional GAA polypeptide may be any of the functional GAA polypeptide described in WO2018/046772, WO2018/046775 and WO2018/046774 patent applications.
Heterologous moiety
The aim of the present inventors was to improve the activity of GAA in vivo. The present inventors investigated the possibility to improve GAA activity by fusing the GAA polypeptide as defined above with one or more heterologous moieties. By “heterologous moiety” is meant a peptide moiety issued from a peptide or polypeptide different from GAA. In the context of the invention “heterologous moiety” means any peptide moiety able to improve the activity of GAA in vivo, for example any peptide moiety improving plasmatic stability, plasmatic activity, lysosomal targeting, uptake to the target tissues such as skeletal muscles and/or crossing of the blood brain barrier.
In particular, the nucleic acid molecule of the invention encodes a chimeric GAA polypeptide comprising :
- a functional GAA polypeptide as defined above, fused to :
- one or more heterologous moieties, wherein at least one of the heterologous moieties is a carboxy- terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCG ).
The carboxy terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCG ) of the present invention comprises the amino acid sequence from amino acid position 138 to position 165 of human chorionic gonadotropin, as set forth in SEQ ID NO: 15. In some embodiments, the CTP sequence peptide is 28, 29, 30, 31, 32, 33 or 34 amino acids long. Preferably, the CTP of the hCG is 28 amino acids long.
In a particular embodiment, the CTP of the hCG is a functional variant which differs from the native CTP by 1-5 amino acid substitutions. By “functional variant” is meant any CTP of the hCG able to improve the activity of GAA in vivo. In particular, the amino acid sequence of the CTP of the hCG may have a least 85 % identity, at least 90 % identity, at least 92 % identity, at least 95 % identity, at least 98 % identity, or at least 99 % identity to the amino acid sequence of SEQ ID NO: 12. In particular, the amino acid sequence of the CTP of the hCG comprises or consists of SEQ ID NO: 12.
In a particular embodiment, the CTP of the hCG is encoded by the nucleotide sequence of SEQ ID NO: 13 or by a nucleotide sequence having at least 85 % identity, at least 90 % identity, at least 92 % identity, at least 95 % identity, at least 98 % identity, at least 99 % identity or at least 100 % identity to the nucleotide sequence of SEQ ID NO: 13. In a particular embodiment, the functional GAA polypeptide is fused to at least 1, 2, 3, 4, or at least 5 heterologous moieties, wherein at least one of said heterologous moieties is a CTP of the hCG as defined above. In particular, the functional GAA polypeptide may be fused to 1, 2, 3, 4 or 5 heterologous moieties. Heterologous moieties other than CTP of the hCG may be any heterologous moieties able to improve the activity of GAA in vivo, for example any heterologous moiety improving plasmatic stability, plasmatic activity, lysosomal targeting, uptake to the target tissues and/or crossing of the blood brain barrier.
In a particular embodiment, the functional GAA polypeptide is fused to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 repeats of the CTP of the hCG as defined above.
In a preferred embodiment, the functional GAA polypeptide is fused to one (i.e. one and only one) heterologous moiety, wherein the heterologous moiety is a CTP of the hCG as defined above.
In a particular embodiment, the one or more heterologous moieties is/are fused to the N-terminal end and/or to the C-terminal end of the functional GAA polypeptide. In a particular embodiment, one heterologous moiety is fused at the N-terminal end, and the same or a different heterologous moiety is fused to the C-terminal end of the functional GAA polypeptide. In a preferred embodiment, the one or more heterologous moieties is/are fused to the N-terminal end of the functional GAA polypeptide.
In a preferred embodiment, one heterologous moiety, which is a CTP of the hCG is fused at the N- terminal end of the functional GAA polypeptide.
In a particular embodiment, the one or more heterologous moieties are attached to the functional GAA polypeptide sequence via a linker. The linker which connects the one or more heterologous moieties to the functional GAA polypeptide sequence can be a covalent bond or a peptide bond. Any conventional linker leading to a correct folding of the chimeric GAA polypeptide may be used.
In particular, any linker able to introduce flexibility between the linked domains of the polypeptide may be used. In a particular embodiment, the linker is a Glycine-rich linker.
According to a particular embodiment, the linker may be any linker described in Chichili et al, Protein Sci. 2013 Feb;22(2): 153-67.
In a particular embodiment, the linker has an amino acid sequence selected in the group consisting of : “GAP” (SEQ ID NO: 53), “GGGGSLVPRGSGGGGS” (SEQ ID NO: 36), “GSGSGS” (SEQ ID NO: 37), “GGGGSLVPRGSGGGG” (SEQ ID NO: 38), “GGSGGHMGSGG” (SEQ ID NO: 39), “GGSGGSGGSGG” (SEQ ID NO: 40), “GGSGG” (SEQ ID NO: 41), “GGSGGGGG” (SEQ ID NO: 42), “GSGSGSGS” (SEQ ID NO: 43), “GGGSEGGGSEGGGSEGGG” (SEQ ID NO: 44), “AAGAATAA” (SEQ ID NO: 45), “GGGGG” (SEQ ID NO: 46), “GGSSG” (SEQ ID NO: 47), “GSGGGTGGGSG” (SEQ ID NO: 48), “GSGSGSGSGGSG” (SEQ ID NO: 49), “GSGGSGGSGGSGGS” (SEQ ID NO: 50), “GSGGSGSGGSGGSG” (SEQ ID NO: 51) or “GT” (SEQ ID NO: 52).
In a preferred embodiment, the heterologous moiety is fused to the functional GAA polypeptide via a peptide linker having the amino acid sequence “GAP” (SEQ ID NO: 53).
In particular, the peptide linker is encoded by the nucleotide sequence of SEQ ID NO: 17 or by a nucleotide sequence at least 85 % identity, at least 90 % identity, at least 92 % identity, at least 95 % identity, at least 98 % identity or at least 99 % identity to the nucleotide sequence of SEQ ID NO: 17.
Signal peptide
The chimeric GAA polypeptide encoded by the nucleic acid molecule of the invention may further comprise a signal peptide, such as the natural signal peptide of GAA, or an alternative signal peptide derived from another secreted protein. In the context of the present invention, the signal peptide is not an “heterologous moiety” as defined above.
Thus, the nucleic acid molecule of the invention encodes a chimeric GAA polypeptide comprising :
- a functional GAA polypeptide as defined above, fused to :
- one or more heterologous moieties as defined above, wherein at least one of the heterologous moieties is a carboxy-terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCG ),
- and optionally a signal peptide.
Non-limiting examples of such signal peptides include those described in the WO2018/046775 patent application. In particular, the signal peptides may be selected from the group consisting of SEQ ID NO: 18 to 22. The invention thereby provides a chimeric GAA polypeptide comprising a signal peptide, one or more heterologous moieties and a functional GAA polypeptide as defined above. In a particular embodiment, the signal peptide is the natural signal peptide of a GAA, such as the signal peptide of hGAA shown in SEQ ID NO: 18. In another embodiment, the signal peptide is an exogenous (or alternative) signal peptide, derived from a protein different from GAA. In a particular embodiment, the alternative signal peptide is selected in the group consisting of SEQ ID NO: 19, 20, 21 and 22, or a functional derivative thereof as defined below. In particular, the signal peptide is selected in the group consisting of SEQ ID NO: 20, 21 and 22, or a functional derivative thereof as defined below. Particular exogenous signal peptides workable in the present invention include amino acids 1-20 from chymotrypsinogen B2 (SEQ ID NO:21), the signal peptide of human alpha- 1 -antitrypsin (SEQ ID NO: 19), amino acids 1-25 from iduronate-2-sulphatase (SEQ ID NO:20), and amino acids 1-23 from protease Cl inhibitor (SEQ ID NO:22). The signal peptides of SEQ ID NO: 18 and SEQ ID NO: 19 to SEQ ID NO: 22, allow higher secretion of the chimeric GAA polypeptide both in vitro and in vivo when compared to the chimeric GAA comprising its natural signal peptide. In a particular embodiment, the signal peptide has the sequence shown in SEQ ID NO: 18 to 22, or is a functional derivative thereof, i.e. a sequence comprising from 1 to 5, in particular from 1 to 4, in particular from 1 to 3, more particularly from 1 to 2, in particular 1 amino acid deletion(s), insertion(s) or substitution(s) as compared to the sequences shown in SEQ ID NO: 18 to 22, as long as the resulting sequence corresponds to a functional signal peptide, i.e. a signal peptide that allows secretion of a GAA protein.
In a particular embodiment, the signal peptide sequence has at least 85 percent, more preferably at least 90 percent, and even more preferably at least 92 percent identity, in particular at least 95 percent identity, for example at least 98, or 99 percent identity to a sequence selected in the group consisting of SEQ ID NO: 18 to 22, preferably to a sequence selected in the group consisting of SEQ ID NO: 19 to 22, more preferably to a sequence selected in the group consisting of SEQ ID NO: 20 to 22, even more preferably to the sequence of SEQ ID NO:21. In a particular embodiment, the signal peptide sequence consists of a sequence selected in the group consisting of SEQ ID NO: 18 to 22. Preferably, the signal peptide sequence consists of a sequence selected in the group consisting of SEQ ID NO: 19 to 22, more preferably the signal peptide sequence consists of a sequence selected in the group consisting of SEQ ID NO: 20 to 22. According to a preferred embodiment, the signal peptide sequence consists of the sequence has shown in SEQ ID NO:21.
In a particular embodiment, the signal peptide is attached to the one or more heterologous moieties as defined above via a linker, which can be a covalent bond or a peptide bond. Any conventional linker leading to a correct folding of the chimeric GAA polypeptide may be used. In particular, any linker able to introduce flexibility between the linked domains of the polypeptide may be used. In a particular embodiment, the linker is a Glycine-rich linker.
In a particular embodiment, the nucleic acid molecule of the invention encodes a chimeric GAA polypeptide comprising, preferably in this order : a signal peptide as defined above, a heterologous moiety as defined above, optionally a linker as defined above, and a functional GAA polypeptide as defined above. In particular, the chimeric GAA polypeptide comprises, preferably in this order : the signal peptide consisting of SEQ ID NO: 21, a heterologous moiety consisting of the CTP sequence as shown in SEQ ID NO: 12, optionally a linker of the sequence “GAP”, and a functional GAA polypeptide consisting of SEQ ID NO:9.
In a particular embodiment, the nucleic acid molecule encodes a chimeric GAA polypeptide comprising or consisting of SEQ ID NO: 14, or a functional derivative thereof having at least 90% identity, in particular at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence shown in SEQ ID NO: 14.
In a particular embodiment, the nucleic acid molecule of the invention comprises or consists of the sequence SEQ ID NO: 35, or a sequence having at least 90% identity, in particular at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence shown in SEQ ID NO: 35.
2- Nucleic acid construct
The invention also relates to a nucleic acid construct comprising the nucleic acid molecule of the invention. The nucleic acid construct may correspond to an expression cassette comprising the nucleic acid sequence of the invention, operably linked to one or more expression control sequences and/or other sequences improving the expression of a transgene and/or sequences enhancing the secretion of the encoded protein and/or sequences enhancing the uptake of the encoded protein. As used herein, the term “operably linked” refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter, or another transcription regulatory sequence, is operably linked to a coding sequence if it affects the transcription of the coding sequence. Such expression control sequences are known in the art, such as promoters, enhancers (such as cis-regulatory modules (CRM)), introns, polyA signals, etc.
In particular, the expression cassette may include a promoter. The promoter may be an ubiquitous or tissue-specific promoter, in particular a promoter able to promote expression in cells or tissues in which expression of GAA is desirable such as in cells or tissues in which GAA expression is desirable in GAA- deficient patients. In a particular embodiment, the promoter is a liver-specific promoter such as the alpha-1 antitrypsin promoter (hAAT) (SEQ ID NO: 23), the transthyretin promoter, the albumin promoter, the thyroxine-binding globulin (TBG) promoter, the LSP promoter (comprising a thyroid hormone-binding globulin promoter sequence, two copies of an alpha 1-microglobulin/bikunin enhancer sequence, and a leader sequence - 34.111, C. R., et al. (1997). Optimization of the human factor VIII complementary DNA expression plasmid for gene therapy of hemophilia A. Blood Coag. Fibrinol. 8: S23-S30.), etc. Other useful liver-specific promoters are known in the art, for example those listed in the Liver Specific Gene Promoter Database compiled the Cold Spring Harbor Laboratory (http://rulai.cshl.edu/LSPD/). A preferred promoter in the context of the invention is the hAAT promoter. In another embodiment, the promoter is a promoter directing expression in one tissue or cell of interest (such as in muscle cells), and in liver cells. For example, to some extent, promoters specific of muscle cells such as the desmin, Spc5-12 and MCK promoters may present some leakage of expression into liver cells, which can be advantageous to induce immune tolerance of the subject to the chimeric GAA protein expressed from the nucleic acid of the invention.
Other tissue-specific or non-tissue-specific promoters may be useful in the practice of the invention. For example, the expression cassette may include a tissue-specific promoter which is a promoter different from a liver specific promoter. For example the promoter may be muscle-specific, such as the desmin promoter (and a desmin promoter variant such as a desmin promoter including natural or artificial enhancers), the SPc5-12 or the MCK promoter. In another embodiment, the promoter is a promoter specific of other cell lineage, such as the erythropoietin promoter, for the expression of the chimeric GAA polypeptide from cells of the erythroid lineage.
In another embodiment, the promoter is an ubiquitous promoter. Representative ubiquitous promoters include the cytomegalovirus enhancer/chicken beta actin (CAG) promoter, the cytomegalovirus enhancer/promoter (CMV), the PGK promoter, the SV40 early promoter, etc. In addition, the promoter may also be an endogenous promoter such as the albumin promoter or the GAA promoter. In a particular embodiment, the promoter is any hybrid regulatory element as described in patent application PCT/EP2019/053061, including the specific promoters referred as “LiMP” and "’LiNeuP”.
In a particular embodiment, the promoter is any hybrid promoter as described in patent application EP19 305455.8 herein incorporated by reference, wherein said hybrid promoter comprises one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter. In particular, the promoter may be the specific promoter referred as EP1, EP2, EP3 or EP4 in patent application EP19 305455.8, in particular the promoter referred to as EP4.
In a particular embodiment, the promoter is associated to an enhancer sequence, such as a cis-regulatory module (CRMs) or an artificial enhancer sequence. For example, the promoter may be associated to an enhancer sequence such as the human ApoE control region (or Human apolipoprotein E/C -I gene locus, hepatic control region HCR-1 - Genbank accession No. U32510, shown in SEQ ID NO:24). In a particular embodiment, an enhancer sequence such as the ApoE sequence is associated to a liver-specific promoter such as those listed above, and in particular such as the hAAT promoter. Other CRMs useful in the practice of the present invention include those described in Rincon et al., Mol Ther. 2015 Jan;23(l):43-52, Chuah et al., Mol Ther. 2014 Sep;22(9): 1605-13 or Nair et al., Blood. 2014 May 15 ; 123(20): 3195-9. In another particular embodiment, the nucleic acid construct comprises an intron, in particular an intron placed between the promoter and the nucleic acid molecule of the invention encoding the chimeric GAA polypeptide. An intron may be introduced to increase mRNA stability and the production of the protein. In a further embodiment, the nucleic acid construct comprises a human beta globin b2 (or HBB2) intron, a coagulation factor IX (FIX) intron, a SV40 intron or a chicken beta-globin intron. In another further embodiment, the nucleic acid construct of the invention contains a modified intron (in particular a modified HBB2 or FIX intron) designed to decrease the number of, or even totally remove, alternative open reading frames (ARFs) found in said intron. Preferably, ARFs are removed whose length spans over 50 bp and have a stop codon in frame with a start codon. ARFs may be removed by modifying the sequence of the intron. For example, modification may be carried out by way of nucleotide substitution, insertion or deletion, preferably by nucleotide substitution. As an illustration, one or more nucleotides, in particular one nucleotide, in an ATG or GTG start codon present in the sequence of the intron of interest may be replaced resulting in a non-start codon. For example, an ATG or a GTG may be replaced by a CTG, which is not a start codon, within the sequence of the intron of interest.
The classical HBB2 intron used in nucleic acid constructs is shown in SEQ ID NO: 25. For example, this HBB2 intron may be modified by eliminating start codons (ATG and GTG codons) within said intron. In a particular embodiment, the modified HBB2 intron comprised in the construct has the sequence shown in SEQ ID NO: 26. The classical FIX intron used in nucleic acid constructs is derived from the first intron of human FIX and is shown in SEQ ID NO: 27. FIX intron may be modified by eliminating start codons (ATG and GTG codons) within said intron. In a particular embodiment, the modified FIX intron comprised in the construct of the invention has the sequence shown in SEQ ID NO: 28. The classical chicken-beta globin intron used in nucleic acid constructs is shown in SEQ ID NO: 29. Chicken-beta globin intron may be modified by eliminating start codons (ATG and GTG codons) within said intron. In a particular embodiment, the modified chicken-beta globin intron comprised in the construct of the invention has the sequence shown in SEQ ID NO: 30.
The inventors have previously shown in WO2015/162302 that such a modified intron, in particular a modified HBB2 or FIX intron, has advantageous properties and can significantly improve the expression of a transgene.
In a particular embodiment, the nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' orientation, a promoter optionally preceded by an enhancer, the nucleic acid molecule of the invention (i.e. the sequence encoding the chimeric GAA polypeptide of the invention), and a polyadenylation signal (such as the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal, or another naturally occurring or artificial polyadenylation signal). In a particular embodiment, the nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' orientation, a promoter optionally preceded by an enhancer, (such as the ApoE control region), an intron (in particular an intron as defined above), the nucleic acid molecule of the invention, and a polyadenylation signal. In a further particular embodiment, the nucleic acid construct of the invention is an expression cassette comprising, in the 5' to 3' orientation, an enhancer such as the ApoE control region, a promoter, an intron (in particular an intron as defined above), the nucleic acid molecule of the invention, and a polyadenylation signal. In a further particular embodiment of the invention the expression cassette comprising, in the 5' to 3' orientation, an ApoE control region, the hAAT-liver specific promoter, a HBB2 intron (in particular a modified HBB2 intron as defined above), the nucleic acid molecule of the invention, and the bovine growth hormone polyadenylation signal, such as the nucleic acid construct shown in SEQ ID NO: 16, which includes the nucleic acid molecule of SEQ ID NO: 35 encoding the chimeric GAA polypeptide of the invention, respectively.
In a particular embodiment, the expression cassette comprises the ApoE control region, the hAAT-liver specific promoter, a codon-optimized HBB2 intron, the sequence of the nucleic acid molecule of the invention and the bovine growth hormone polyadenylation signal.
In designing the nucleic acid construct of the invention, one skilled in the art will take care of respecting the size limit of the vector used for delivering said construct to a cell or organ. In particular, one skilled in the art knows that a major limitation of AAV vector is its cargo capacity which may vary from one AAV serotype to another but is thought to be limited to around the size of parental viral genome . For example, 5 kb is the maximum size usually thought to be packaged into an AAV8 capsid. (Wu Z. et al, Mol Ther., 2010, 18(1): 80-86; Lai Y. etal, Mol Ther., 2010, 18(1): 75-79; Wang Y. etal, Hum Gene Ther Methods, 2012, 23(4): 225-33). Accordingly, those skilled in the art will take care in practicing the present invention to select the components of the nucleic acid construct of the invention so that the resulting nucleic acid sequence, including sequences coding AAV 5'- and 3'-ITRs to preferably not exceed 110 % of the cargo capacity of the AAV vector implemented, in particular to preferably not exceed 5.5 kb.
3- Vector
The invention also relates to a vector comprising a nucleic acid molecule or construct as disclosed herein. In particular, the vector of the invention is a vector suitable for protein expression, preferably for use in gene therapy. In one embodiment, the vector is a plasmid vector. In another embodiment, the vector is a nanoparticle containing a nucleic acid molecule of the invention, in particular a messenger RNA encoding the chimeric GAA polypeptide of the invention. In another embodiment, the vector is a system based on transposons, allowing integration of the nucleic acid molecule or construct of the invention in the genome of the target cell, such as the hyperactive Sleeping Beauty (SB 100X) transposon system (Mates et al. 2009). In another embodiment, the vector is a viral vector suitable for gene therapy, targeting any cell of interest such as liver tissue or cells, muscle cell, CNS cells (such as brain cells), or hematopoietic stem cells such as cells of the erythroid lineage (such as erythrocytes). In this case, the nucleic acid construct of the invention also contains sequences suitable for producing an efficient viral vector, as is well known in the art. In a particular embodiment, the viral vector is derived from an integrating virus. In particular, the viral vector may be derived from a retrovirus or a lentivirus. In a further particular embodiment, the viral vector is an AAV vector, such as an AAV vector suitable for transducing liver tissues or cells, more particularly an AAV-1, -2 and AAV-2 variants (such as the quadruple-mutant capsid optimized AAV-2 comprising an engineered capsid with Y44+500+730F+T491V changes, disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods. [Epub ahead of print]), -3 and AAV-3 variants (such as the AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes, S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), -3B and AAV-3B variants, -4, -5, -6 and AAV-6 variants (such as the AAV6 variant comprising the triply mutated AAV6 capsid Y731F/Y705F/T492V form disclosed in Rosario et al., 2016, Mol Ther Methods Clin Dev. 3, p.16026), -7, -8, -9, -10 such as -cylO and -rhlO, -rh74, -dj, Anc80, LK03, AAV2i8, porcine AAV serotypes such as AAVpo4 and AAVpo6, etc., vector or a retroviral vector such as a lentiviral vector and an alpha-retrovirus. As is known in the art, depending on the specific viral vector considered for use, additional suitable sequences will be introduced in the nucleic acid construct of the invention for obtaining a functional viral vector. Suitable sequences include AAV ITRs for an AAV vector, or LTRs for lentiviral vectors. As such, the invention also relates to an expression cassette as described above, flanked by an ITR or an LTR on each side.
Advantages of viral vectors are discussed in the following part of this disclosure. Viral vectors are preferred for delivering the nucleic acid molecule or construct of the invention, such as a retroviral vector, for example a lentiviral vector, or a non-pathogenic parvovirus, more preferably an AAV vector. The human parvovirus Adeno-Associated Virus (AAV) is a dependovirus that is naturally defective for replication which is able to integrate into the genome of the infected cell to establish a latent infection. The last property appears to be unique among mammalian viruses because the integration occurs at a specific site in the human genome, called AAVS1, located on chromosome 19 (19ql3.3-qter). Therefore, AAV vectors have arisen considerable interest as potential vectors for human gene therapy. Among the favorable properties of the virus are its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from different tissues that can be infected.
Among the serotypes of AAVs isolated from human or non-human primates (NHP) and well characterized, human serotype 2 is the first AAV that was developed as a gene transfer vector. Other currently used AAV serotypes include AAV-1, AAV-2 variants (such as the quadruple-mutant capsid optimized AAV-2 comprising an engineered capsid with Y44+500+730F+T491V changes, disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods. [Epub ahead of print]), -3 and AAV-3 variants (such as the AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes, S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), -3B and AAV- 3B variants, -4, -5, -6 and AAV-6 variants (such as the AAV6 variant comprising the triply mutated AAV6 capsid Y731F/Y705F/T492V form disclosed in Rosario et al., 2016, Mol Ther Methods Clin Dev. 3, p.16026), -7, -8, -9, -10 such as cylO and -rhlO, -rh74, -dj, Anc80, LK03, AAV2i8, porcine AAV serotypes such as AAVpo4 and AAVpo6, and tyrosine, lysine and serine capsid mutants of the AAV serotypes, etc.. In addition, other non-natural engineered variants and chimeric AAV can also be useful.
AAV viruses may be engineered using conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, fortuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus.
Desirable AAV fragments for assembly into vectors include the cap proteins, including the vpl, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells.
AAV-based recombinant vectors lacking the Rep protein integrate with low efficacy into the host’s genome and are mainly present as stable circular episomes that can persist for years in the target cells. Alternatively to using AAV natural serotypes, artificial AAV serotypes may be used in the context of the present invention, including, without limitation, AAV with a non-naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source. An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. Accordingly, the present invention relates to an AAV vector comprising the nucleic acid molecule or construct of the invention. In the context of the present invention, the AAV vector comprises an AAV capsid able to transduce the target cells of interest, in particular hepatocytes. According to a particular embodiment, the AAV vector is of the AAV-1, -2, AAV-2 variants (such as the quadruple-mutant capsid optimized AAV-2 comprising an engineered capsid with Y44+500+730F+T491V changes, disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods. [Epub ahead of print]), -3 and AAV-3 variants (such as the AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes, S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), -3B and AAV- 3B variants, -4, -5, -6 and AAV-6 variants (such as the AAV6 variant comprising the triply mutated AAV6 capsid Y731F/Y705F/T492V form disclosed in Rosario et al., 2016, Mol Ther Methods Clin Dev. 3, p.16026), -7, -8, -9, -10 such as -cylO and -rhlO, -rh74, -dj, Anc80, LK03, AAV2i8, porcine AAV such as AAVpo4 and AAVpo6, and tyrosine, lysine and serine capsid mutants of a AAV serotypes, etc., serotype. In a particular embodiment, the AAV vector is of the AAV8, AAV9, AAVrh74 or AAV2i8 serotype (i.e. the AAV vector has a capsid of the AAV8, AAV9, AAVrh74 or AAV2i8 serotype). In a further particular embodiment, the AAV vector is a pseudotyped vector, i.e. its genome and capsid are derived from AAVs of different serotypes. For example, the pseudotyped AAV vector may be a vector whose genome is derived from one of the above mentioned AAV serotypes, and whose capsid is derived from another serotype. For example, the genome of the pseudotyped vector may have a capsid derived from the AAV 8, AAV 9, AAVrh74 or AAV2i8 serotype, and its genome may be derived from and different serotype. In a particular embodiment, the AAV vector has a capsid of the AAV8, AAV9 or AAVrh74 serotype, in particular of the AAV8 or AAV9 serotype, more particularly of the AAV8 serotype.
In a specific embodiment, wherein the vector is for use in delivering the transgene to muscle cells, the AAV vector may be selected, among others, in the group consisting of AAV8, AAV9 and AAVrh74.
In another specific embodiment, wherein the vector is for use in delivering the transgene to liver cells, the AAV vector may be selected, among others, in the group consisting of AAV5, AAV8, AAV9, AAV- LK03, AAV-Anc80 and AAV3B.
In another embodiment, the capsid is a modified capsid. In the context of the present invention, a "modified capsid" may be a chimeric capsid or capsid comprising one or more variant VP capsid proteins derived from one or more wild-type AAV VP capsid proteins.
In a particular embodiment, the AAV vector is a chimeric vector, i.e. its capsid comprises VP capsid proteins derived from at least two different AAV serotypes, or comprises at least one chimeric VP protein combining VP protein regions or domains derived from at least two AAV serotypes. Examples of such chimeric AAV vectors useful to transduce liver cells are described in Shen et al., Molecular Therapy, 2007 and in Tenney et al., Virology, 2014. For example a chimeric AAV vector can derive from the combination of an AAV8 capsid sequence with a sequence of an AAV serotype different from the AAV8 serotype, such as any of those specifically mentioned above. In another embodiment, the capsid of the AAV vector comprises one or more variant VP capsid proteins such as those described in W02015013313, in particular the RHM4-1, RHM15-1, RHM15-2, RHM15-3/RHM15-5, RHM15-4 and RHM15-6 capsid variants, which present a high liver tropism. In another embodiment, the modified capsid can be derived also from capsid modifications inserted by error prone PCR and/or peptide insertion (e.g. as described in Bartel et al., 2011). In addition, capsid variants may include single amino acid changes such as tyrosine mutants (e.g. as described in Zhong et al., 2008)
In addition, the genome of the AAV vector may either be a single stranded or self-complementary double-stranded genome (McCarty et al., Gene Therapy, 2003). Self-complementary double-stranded AAV vectors are generated by deleting the terminal resolution site (trs) from one of the AAV terminal repeats. These modified vectors, whose replicating genome is half the length of the wild type AAV genome have the tendency to package DNA dimers. In a preferred embodiment, the AAV vector implemented in the practice of the present invention has a single stranded genome, and further preferably comprises an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid.
In a particularly preferred embodiment, the invention relates to an AAV vector comprising, in a single- stranded or double-stranded, self-complementary genome (e.g. a single-stranded genome), the nucleic acid acid construct of the invention. In one embodiment, the AAV vector comprises an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid . In a further particular embodiment, said nucleic acid is operably linked to a promoter, especially an ubiquitous or liver-specific promoter. According to a specific variant embodiment, the promoter is an ubiquitous promoter such as the cytomegalovirus enhancer/chicken beta actin (CAG) promoter, the cytomegalovirus enhancer/promoter (CMV), the PGK promoter and the SV40 early promoter. In a specific variant, the ubiquitous promoter is the CAG promoter. According to another variant, the promoter is a liver-specific promoter such as the alpha- 1 antitrypsin promoter (hAAT), the transthyretin promoter, the albumin promoter and the thyroxine binding globulin (TBG) promoter. In a specific variant, the liver-specific promoter is the hAAT liver- specific promoter of SEQ ID NO: 23. In a further particular embodiment, the nucleic acid construct comprised into the genome of the AAV vector of the invention further comprises an intron as described above, such as an intron placed between the promoter and the nucleic acid sequence encoding the chimeric GAA polypeptide of the invention. Representative introns that may be included within the nucleic acid construct introduced within the AAV vector genome include, without limitation, the human beta globin b2 (or HBB2) intron, the FIX intron and the chicken beta-globin intron. Said intron within the genome of the AAV vector may be a classical (or unmodified) intron or a modified intron designed to decrease the number of, or even totally remove, alternative open reading frames (ARFs) within said intron. Modified and unmodified introns that may be used in the practice of this embodiment where the nucleic acid of the invention is introduced within an AAV vector are thoroughly described above. In a particular embodiment, the AAV vector, in particular an AAV vector comprising an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid, of the invention includes within its genome a modified (or optimized) intron such as the modified HBB2 intron of SEQ ID NO: 26, the modified FIX intron of SEQ ID NO: 28 and the modified chicken beta-globin intron of SEQ ID NO: 30. In a further particular embodiment, the vector of the invention is an AAV vector comprising comprises an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, such as an AAV8 or AAV9 capsid, more particularly an AAV8 capsid, comprising a genome containing, in the 5’ to 3’ orientation: an AAV 5'-ITR (such as an AAV2 5’-ITR); an ApoE control region; the hAAT-liver specific promoter; a HBB2 intron (in particular a modified HBB2 intron as defined above); the nucleic acid molecule of the invention encoding the chimeric GAA polypeptide; the bovine growth hormone polyadenylation signal; and an AAV 3'-ITR (such as an AAV2 3'-ITR), such as a genome comprising a the nucleic acid construct shown in SEQ ID NO: 16 flanked by an AAV 5'-ITR (such as an AAV2 5’- ITR) and an AAV 3'-ITR (such as an AAV2 3'-ITR).
In a particular embodiment of the invention, the nucleic acid construct of the invention comprises a liver-specific promoter as described above, and the vector is a viral vector capable of transducing liver tissue or cells as described above. The protolerogenic and metabolic properties of the liver are advantageously implemented thanks to this embodiment to develop highly efficient and optimized vectors to express secretable forms of GAA in hepatocytes and to induce immune tolerance to the protein.
In addition, in a further particular embodiment, the invention provides the combination of two vectors, such as two viral vectors, in particular two AAV vectors, for improving gene delivery and treatment efficacy in the cells of interest. For example, the two vectors may carry the nucleic acid molecule of the invention coding for the chimeric GAA polypeptide of the invention, under the control of one different promoter in each of these two vectors. In a particular embodiment, one vector comprises a promoter which is a liver-specific promoter (as one of those described above), and the other vector comprises a promoter which is specific of another tissue of interest for the treatment of a glycogen storage disorder, such as a muscle-specific promoter, for example the desmin promoter. In a particular variant of this embodiment, this combination of vectors corresponds to multiple co-packaged AAV vectors produced as described in WO2015196179.
4- Chimeric GAA polypeptide
In another aspect, the invention provides a chimeric GAA polypeptide, encoded by the nucleic acid molecule of the invention as described above. In particular, the chimeric GAA polypeptide of the invention comprises a functional GAA polypeptide fused to one or more heterologous domains, wherein at least one of the heterologous domain is the CTP of the hHCG. In a particular embodiment, the chimeric GAA polypeptide has the sequence shown in SEQ ID NO: 14, or is a functional derivative thereof having at least 90% identity, in particular at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the sequence shown in SEQ ID NO: 14.
5- Cell
The invention also relates to an isolated cell, for example a liver cell, that is transformed with a nucleic acid molecule or construct of the invention as is the case for ex vivo gene therapy. Cells of the invention may be delivered to the subject in need thereof, such as GAA-deficient patient, by any appropriate administration route such as via injection in the liver or in the bloodstream of said subject. In a particular embodiment, the invention involves introducing the nucleic acid of the invention into liver cells, in particular into liver cells of the subject to be treated, and administering said transformed liver cells into which the nucleic acid has been introduced to the subject. Advantageously, this embodiment is useful for secreting GAA from said cells. In a particular embodiment, the liver cells are liver cells from the patient to be treated, or are liver stem cells that are further transformed, and differentiated in vitro into liver cells, for subsequent administration to the patient.
The present invention further relates to a transgenic, nonhuman animal comprising in its genome the nucleic acid molecule or construct of the invention encoding the chimeric GAA polypeptide according to the invention. In a particular embodiment, the animal is a mouse.
Apart from the specific delivery systems embodied below in the examples, various delivery systems are known and can be used to administer the nucleic acid molecule or construct of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the nucleic acid sequence of the invention, receptor-mediated endocytosis, construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc.
According to an embodiment, it may be desirable to introduce the chimeric GAA polypeptide, nucleic acid molecule, nucleic acid construct or the isolated cell of the invention into the liver of the subject by any suitable route. In addition naked DNA such as minicircles and transposons can be used for delivery or lentiviral vectors. Additionally, gene editing technologies such as zinc finger nucleases, meganucleases, TALENs, and CRISPR can also be used to deliver the coding sequence of the invention.
6- Pharmaceutical composition The present invention also provides pharmaceutical compositions comprising the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide, or the isolated cell of the invention. Such compositions comprise a therapeutically effective amount of the therapeutic (the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention), and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. or European Pharmacopeia or other generally recognized pharmacopeia for use in animals, and humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.
The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations and the like. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject. In a particular embodiment, the nucleic acid, vector or cell of the invention is formulated in a composition comprising phosphate-buffered saline and supplemented with 0.25% human serum albumin. In another particular embodiment, the nucleic acid, vector or cell of the invention is formulated in a composition comprising ringer lactate and a non-ionic surfactant, such as pluronic F68 at a final concentration of 0.01-0.0001%, such as at a concentration of 0.001%, by weight of the total composition. The formulation may further comprise serum albumin, in particular human serum albumin, such as human serum albumin at 0.25%. Other appropriate formulations for either storage or administration are known in the art, in particular from WO 2005/118792 or Allay et ak, 2011.
In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to, ease pain at the, site of the injection.
7- Administration and use
In an embodiment, the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention can be delivered in a vesicle, in particular a liposome. In yet another embodiment, the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention can be delivered in a controlled release system.
Methods of administration of the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. In a particular embodiment, the administration is via the intravenous or intramuscular route. The nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention, whether vectorized or not, may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment, e.g. the liver. This may be achieved, for example, by means of an implant, said implant being of a porous, nonporous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
The amount of the therapeutic of the invention (i.e. the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the isolated cell of the invention) which will be effective in the treatment of a glycogen storage disease can be determined by standard clinical techniques. In addition, in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances. The dosage of the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention administered to the subject in need thereof will vary based on several factors including, without limitation, the route of administration, the specific disease treated, the subject's age or the level of expression necessary to obtain the therapeutic effect. One skilled in the art can readily determine, based on its knowledge in this field, the dosage range required based on these factors and others. In case of a treatment comprising administering a viral vector, such as an AAV vector, to the subject, typical doses of the vector are of at least lxlO8 vector genomes per kilogram body weight (vg/kg), such as at least lxlO9 vg/kg, at least lxlO10 vg/kg, at least lxlO11 vg/kg, at least lxlO12 vg/kg at least lxlO13 vg/kg, or at least lxlO14 vg/kg.
The invention also relates to a method for treating a glycogen storage disease, which comprises a step of delivering a therapeutic effective amount of the nucleic acid, the vector, the chimeric GAA polypeptide, the pharmaceutical composition or the cell of the invention to a subject in need thereof.
The invention also relates to a method for treating a glycogen storage disease, said method inducing no immune response to the transgene (i.e. to the chimeric GAA polypeptide of the invention), or inducing a reduced immune response to the transgene, comprising a step of delivering a therapeutic effective amount of the nucleic acid molecule, nucleic acid construct, vector, pharmaceutical composition or cell of the invention to a subject in need thereof. The invention also relates to a method for treating a glycogen storage disease, said method comprising repeated administration of a therapeutic effective amount of the nucleic acid molecule, nucleic acid construct, vector, pharmaceutical composition or cell of the invention to a subject in need thereof. In this aspect, the nucleic acid molecule or the nucleic acid construct of the invention comprises a promoter which is functional in liver cells, thereby allowing immune tolerance to the expressed chimeric GAA polypeptide produced therefrom. As well, in this aspect, the pharmaceutical composition used in this aspect comprises a nucleic acid molecule or nucleic acid construct comprising a promoter which is functional in liver cells. In case of delivery of liver cells, said cells may be cells previously collected from the subject in need of the treatment and that were engineered by introducing therein the nucleic acid molecule or the nucleic acid construct of the invention to thereby make them able to produce the chimeric GAA polypeptide of the invention. According to an embodiment, in the aspect comprising a repeated administration, said administration may be repeated at least once or more, and may even be considered to be done according to a periodic schedule, such as once per week, per month or per year. The periodic schedule may also comprise an administration once every 2, 3, 4, 5, 6, 7, 8, 9 or 10 year, or more than 10 years. In another particular embodiment, administration of each administration of a viral vector of the invention is done using a different virus for each successive administration, thereby avoiding a reduction of efficacy because of a possible immune response against a previously administered viral vector. For example, a first administration of a viral vector comprising an AAV8 capsid may be done, followed by the administration of a vector comprising an AAV9 capsid, or even by the administration of a virus unrelated to AAVs, such as a retroviral or lentiviral vector.
The invention also relates to a method for treating a glycogen storage disease, comprising a step of delivering a therapeutic effective amount of the nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, pharmaceutical composition or cell of the invention to a subject in need thereof. The transgene may be used to produce high levels of GAA protein, and provides therapeutic benefits such as improving GAA activity in plasma and/or in tissues such as skeletal muscles. The invention also relates to a method for treating a glycogen storage disease, said method comprising repeated administration of a therapeutic effective amount of the nucleic acid molecule, nucleic acid construct, vector, chimeric GAA polypeptide, pharmaceutical composition or cell of the invention to a subject in need thereof. In this aspect, the nucleic acid molecule or the nucleic acid construct of the invention comprises a promoter which is functional in liver cells, thereby allowing immune tolerance to the expressed chimeric GAA polypeptide produced therefrom. As well, in this aspect, the pharmaceutical composition used in this aspect comprises a nucleic acid molecule or nucleic acid construct comprising a promoter which is functional in liver cells. In case of delivery of liver cells, said cells may be cells previously collected from the subject in need of the treatment and that were engineered by introducing therein the nucleic acid molecule or the nucleic acid construct of the invention to thereby make them able to produce the chimeric GAA polypeptide of the invention. According to an embodiment, in the aspect comprising a repeated administration, said administration may be repeated at least once or more, and may even be considered to be done according to a periodic schedule, such as once per week, per month or per year. The periodic schedule may also comprise an administration once every 2, 3, 4, 5, 6, 7, 8, 9 or 10 year, or more than 10 years. In another particular embodiment, administration of each administration of a viral vector of the invention is done using a different virus for each successive administration, thereby avoiding a reduction of efficacy because of a possible immune response against a previously administered viral vector. For example, a first administration of a viral vector comprising an AAV8 capsid may be done, followed by the administration of a vector comprising an AAV9 capsid, or even by the administration of a virus unrelated to AAVs, such as a retroviral or lentiviral vector.
According to the present invention, a treatment may include curative, alleviation or prophylactic effects. Accordingly, therapeutic and prophylactic treatment includes amelioration of the symptoms of a particular glycogen storage disease or preventing or otherwise reducing the risk of developing a particular glycogen storage disease. The term "prophylactic" may be considered as reducing the severity or the onset of a particular condition. "Prophylactic" also includes preventing reoccurrence of a particular condition in a patient previously diagnosed with the condition. "Therapeutic" may also reduce the severity of an existing condition. The term 'treatment' is used herein to refer to any regimen that can benefit a animal, in particular a mammal, more particularly a human subject.
The invention also relates to an ex vivo gene therapy method for the treatment of a glycogen storage disease, comprising introducing the nucleic acid molecule or the nucleic acid construct of the invention into an isolated cell of a patient in need thereof, for example an isolated hematopoietic stem cell, and introducing said cell into said patient in need thereof. In a particular embodiment of this aspect, the nucleic acid molecule or construct is introduced into the cell with a vector as defined above. In a particular embodiment, the vector is an integrative viral vector. In a further particular embodiment, the viral vector is a retroviral vector, such as a lenviral vector. For example, a lentiviral vector as disclosed in van Til et al., 2010, Blood, 115(26), p. 5329, may be used in the practice in the method of the present invention.
The invention also relates to the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention for use as a medicament.
The invention also relates to the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention, for use in a method for treating a disease caused by a mutation in the GAA gene, in particular in a method for treating Pompe disease. The invention further relates to the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention, for use in a method for treating a glycogen storage disease, such as GSDI (von Gierke's disease), GSDII (Pompe disease), GSDIII (Cori disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII and lethal congenital glycogen storage disease of the heart, more particularly GSDI, GSDII or GSDIII, even more particularly GSDII and GSDIII, and most particularly GSDII. The chimeric GAA polypeptide of the invention may be administered to a patient in need thereof, for use in enzyme replacement therapy (ERT), such as for use in enzyme replacement therapy of one of a glycogen storage disease, such as GSDIII (Cori's disease) but also for GSD-IV, -VI, -IX, - XI and cardiac glycogenosis due to AMP -activated protein kinase gamma subunit 2 deficiency.
The invention further relates to the use of the nucleic acid molecule, the nucleic acid construct, the vector, the chimeric GAA polypeptide or the cell of the invention, in the manufacture of a medicament useful for treating a glycogen storage disease, such as GSDI (von Gierke's disease), GSDII (Pompe disease), GSDIII (Cori disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII and lethal congenital glycogen storage disease of the heart, more particularly GSDI, GSDII or GSDIII, even more particularly GSDII and GSDIII, and most particularly GSDII.
EXAMPLES
MATERIALS AND METHODS
GAA expression cassettes and AAV vectors
The GAA transgene expression cassettes used in this study contained the codon-optimized human GAA (hGAA) coding sequence [Puzzo F., et al., Sci Transl Med. 2017 Nov 29;9(418)]. Codon-optimization was performed using a commercial algorithm (Thermo Fisher Scientific) [Puzzo F., et al., Sci Transl Med. 2017 Nov 29;9(418)]. The heterologous domains (CTP and Albumin) were cloned at the N- terminus of the GAA transgene as depicted in Figure 1. Transgene sequences were cloned into an AAV vector backbone under the transcriptional control of the apolipoprotein E (hepatocyte control region enhancer) and the human alpha 1 -antitrypsin (hAAT) promoter. All DNA sequences used in the study were synthetized either by GeneCust or Thermo Fisher Scientific.
AAV vectors used in this study were produced using an adenovirus-free transient transfection method of HEK293 cells as described [Puzzo F, et al. Sci Transl Med. 2017 Nov 29;9(418)]. Titers of AAV vector stocks were determined using quantitative real-time PCR (qPCR) and SDS-PAGE followed by SYPRO Ruby protein gel stain and band densitometry. All vector preparations used in the study were quantified side-by-side before use. The primers used for qPCR on AAV genome annealed to BGH polyA (Fw: tctagttgccagccatctgttgt (SEQ ID NO: 31 ): Rev: tgggagtggcaccttcca (SEQ ID NO: 32) and codon- optimized hGAA (Fw: agatacgccggacattggactg (SEQ ID NO: 33); Rev: gcacgcccagcagattgaac (SEQ ID NO: 34). The AAV serotypes used is AAV8 (Zincarelli et al. Mol Ther. 2008 Jun; 16(6): 1073-80).
In vitro experiments
Human hepatoma cells (HuH7) were seeded in 6-well plates (5xl05 cells/well) and transfected using Lipofectamine 3000 (Thermo Fisher Scientific) accordingly to manufacturer’s instructions. 72 hours after transfection, cells and conditioned media were harvested and analyzed for GAA activity and Western blot analyses.
For the enzyme uptake experiments HuH7 cells were seeded in T75-well plates (lxlO7 cells/well) and transfected using Lipofectamine 3000 (Thermo Fisher Scientific) accordingly to manufacturer’s instructions. 72 hours after transfection, HuH7 conditioned media were harvested and used to culture fibroblasts derived from Pompe disease patients (GMO 20124 GSDII 3p). After 72 hours in culture the fibroblasts were washed 3 times with PBS, harvested and analyzed for Western blot analyses.
Mouse studies
Wild type C57BL/6 mice were purchased from Charles River (Charles River, France). The Gaa -/- mouse was generated by targeted disruption of exon 6 (Raben N. et al. J Biol Chem. 1998 Jul 24;273(30): 19086-92). Gaa-/- mice in the C57BL/6J/129Xl/SvJ background were used. Male littermate affected Gaa-/- and unaffected Gaa+/+ mice were used. AAV vectors were delivered to: 1. adult mice via the tail vein in a volume of 0.2 ml. Experimental groups were sized to allow for statistical analysis; all the animals were included in the analysis and none of the outliers was excluded. Mice were assigned randomly to the experimental groups, and the operators who performed vector delivery and functional analyses were blinded to group identity.
GAA activity GAA activity was measured in mouse plasma (1/1000-1/2000 dilution) and tissues. Snap-frozen tissues were homogenized in di UltraPure™ DNase/RNase-Free Distilled Water (Thermo Fisher Scientific). 50-100 mg of tissue were weighed and homogenized, then centrifuged for 20 minutes at 10000 x g to collect supernatant. The enzymatic reaction was set up using 10 pi of sample (plasma or tissue homogenate) and 20 mΐ of substrate - 4MU-alpha-D-glucoside, in a 96 wells plate. The reaction mixture was incubated at 37°C for one hour, and then stopped by adding 150 mΐ of Sodium Carbonate buffer pH 10.5. A standard curve (0-2500 pmol/mΐ of 4MU) was used to measure released fluorescent 4MU from individual reaction mixture, using the EnSpire alpha plate reader (Perkin-Elmer) at 449 nm (Emission) and 360 nm (Excitation). The protein concentration of the clarified supernatant was quantified by BCA (Thermo Fisher Scientific). To calculate the GAA activity, released 4MU concentration was divided by the sample protein concentration and activity was reported as nmol/hour/mg protein.
Western blot analyses
HuH7 and Fibroblasts cell lysates were prepared using lOmM PBS (pH7.4) containing 1% of Triton- XI 00 and protease inhibitors (Roche Diagnosis). Western blot on mouse plasma was performed on samples diluted 1:4 in distilled water. Mouse tissues were prepared as indicated for GAA activity. Protein concentration was determined using the BCA Protein Assay (Thermo Fisher Scientific). SDS- page electrophoresis was performed in a 4-12% polyacrylamide gel. After transfer the membrane was blocked with Odyssey buffer (Li-Cor Biosciences) and incubated with an anti-GAA antibody (rabbit monoclonal, Abeam), or anti-vinculin (mouse monoclonal, Sigma Aldrich). The membrane was washed and incubated with the appropriate secondary antibody (Li-Cor Biosciences), and visualized by Odyssey imaging system (Li-Cor Biosciences).
Anti-GAA antibody detection
Anti-GAA antibody measurement was performed according to a published protocol. Briefly, maxisorp 96 wells plates (Thermo Fisher Scientific) were coated with 1 pg/ml of rhGAA. IgG standard curves were made by serial 1 to 2 dilutions of commercial mouse (Sigma Aldrich) recombinant IgG which were coated directly onto the wells in duplicate. Anti -mouse (Southern biotech) IgG secondary antibodies were used as secondary antibodies.
RESULTS
1. Cloning of the GAA variant in AAV plasmids
Two heterologous domains reported to increase protein half-life/stability were selected : 1. an albumin binding domain (Alb) and 2. the Carboxyl -Terminal Peptides (CTP) of the Human Chorionic Gonadotropin b Subunit (abbreviated as CTP) The Alb or the CTP domains were inserted at the N- terminus of the sp7-A42-GAAco variant [Puzzo F., et ah, Sci Transl Med. 2017 Nov 29;9(418), patent application WO2018/046774 )] to generate the: sp7-Alb-A42-GAAco variant (abbreviated as HD-Alb) or the sp7-CTP-A42-GAAco variant (abbreviated as HD-CTP), respectively (Fig. 1). An aminoacidic linker (3 aminoacids, Maga JA, et al., J Biol Chem. 2013;288(3): 1428-1438.) was placed between the stability domains and the GAA to ensure proper enzyme folding (Fig. 1).
To achieve efficient expression in the liver, all the sp7-A42-GAAco variants were cloned in an expression cassette under the control of the hepatocyte-restricted Apolipoprotein (ApoE) enhancer with human alpha- 1 anti -trypsin (hAAT) promoter. All the transgenes expression cassette encoding for the sp7-A42-GAAco variants contained the same previously described regulatory elements [Puzzo F., et al., Sci Transl Med. 2017 Nov 29;9(418); Fig. 1):
- an AAV cis-packaging backbone containing two ITR sequences from AAV2, required for the packaging of the viral genome,
- the apolipoprotein E (ApoE) hepatocyte control region enhancer
- the hepatocyte-specific human alpha 1 -antitrypsin (hAAT) promoter
- human haemoglobin b-subunit synthetic intron (HBB2.1) to stabilize the mRNA and enhance protein expression,
- a codon optimized version of the GAA coding sequence devoid of the endogenous signal peptide
- an heterologous signal peptide to allow the GAA secretion (sp7)
- the bovine growth hormone (bGH) polyadenylation signal.
2. Analysis of the GAA variants in human hepatocyte cell cultures
The production and enzymatic activity of the GAA variants with the heterologous domains [sp7-Alb- A42-GAAco (HD-Alb) and sp7-CTP-A42-GAAco (HD-CTP)] were first tested in a human hepatocyte cell line (HuH7) in culture by transient transfection of the respective pAAV plasmids. The variant devoid of heterologous domains (sp7-A42-GAAco, abbreviated as HD0) was used as positive control. Three independent transient transfections of HuH7 cells were performed (Fig. 2). Cell culture media and cells were harvested 72h after transfection. GAA enzyme activity was measured in cell lysates (Fig. 2A) and culture media (Fig. 2B). Compared to HD0, the HD-CTP variant showed a preserved enzymatic activity in cell and culture media, indicating proper enzyme maturation and secretion (Fig. 2). The HD- Alb variant instead resulted in reduced enzymatic activity in culture media compared to both HD0 and HD-CTP variants (Fig. 2).
3. Analysis of the GAA variants in wild type C57BL/6 mice following AAV-mediated liver gene transfer
To evaluate the production and secretion of the chimeric GAA variants upon AAV liver gene transfer, we generated AAV8 vectors encoding for each variant: sp7-Alb-A42-GAAco (HD-Alb) and sp7-CTP- A42-GAAco (HD-CTP). AAV8 vectors encoding for the GAA variant devoid of heterologous domains sp7-A42-GAAco (HDO) was used as positive control. The AAV8 vectors were produced as they efficiently transduce mouse hepatocytes. The AAV8 vectors were injected intravenously (i.v.) in 4-week old wild-type C57BL/6 mice (n=4-5/cohort) (vector dose: 5xl0nvg/kg). The study follow-up was 1.5 months. Mice were treated with the different AAV8 encoding for: HDO, HD-Alb and HD-CTP; mice injected with PBS (phosphate-buffered saline) were used as negative control.
Plasma samples were collected and analyzed at 0.5, 1 and 1.5 months after treatment to measure circulating GAA activity. GAA activity in plasma was increased in all AAV-treated mice compared to PBS controls (Fig. 3). Notably, higher circulating GAA activity was found in mice treated with the HD- CTP variant compared to both HDO and HD-Alb at all the time points tested (Fig. 3). Secretion of GAA in the circulation was readily confirmed in the plasma of all mice treated with AAV vectors at the first time point analyzed (14 days after treatment) by Western blot analyses with anti-GAA antibody (Fig. 4). GAA band quantification (Fig. 4B) also showed a significant higher amount of circulating GAA in the HD-CTP cohort compared to the HDO and HD-Alb cohorts confirming the activity data (Fig. 3). Notably, in the mouse plasma the circulating HD-CTP variant showed an higher molecular weight compared to the HDO variant which supports its high glycosylation (Fig. 4A, bottom panel).
Overall these data suggest that the HD-CTP variant is more stable in the plasma than HDO, resulting in enzyme amount and activity superior to those achieved with the HDO variant.
4. ANALYSIS OF THE GAA VARIANTS IN THE Gaa KNOCK-OUT (Gaa-/-) MOUSE MODEL OF POMPE DISEASE FOLLOWING AAV-MEDIATED LIVER GENE TRANSFER
Two-month-old Gaa-/- mice (n=6/group) were injected intravenously with AAV8 vectors encoding for HD-CTP or HDO, as comparison (vector dose: 5xl0nvg/kg). Littermate Gaa-/- mice (n=6) treated with PBS were used as affected controls (Ctrl). Littermate Gaa+/+ mice (n=5) were used as unaffected controls. The study follow-up was 4 months.
At the end of the study (4 months after treatment) mice were sacrificed and tissues were collected to evaluate GAA activity. GAA enzyme activity was increased in the liver of Gaa-/- mice treated with AAV vectors (Fig. 5A) compared to both Gaa+/+ and PBS-treated Gaa-/- mice (Fig. 5A). No significant differences in liver GAA activity were found between HD-CTD and HDO reflecting similar GAA protein expression in hepatocytes (Fig. 5A). However, GAA activity in skeletal muscle (triceps, Fig. 5B) was significantly increased in the HD-CTP treatment group but not in the HDO treatment group (Fig. 5B). The GAA activity in the HD-CTP cohort was significantly higher compared to the HDO, PBS and Gaa+/+ cohorts (Fig. 5B). These data show that the use of the chimeric HD-CTP variant results in improved uptake of the enzyme in skeletal muscle (Fig. 5B). In the CNS (brain, Fig. 5C) GAA activity was also significantly increased only in the HD-CTP treatment group (Fig. 5B) compared to the PBS treatment group (Fig. 5C). These data show that the use of the chimeric HD-CTP variant is advantageous with respect to enzyme uptake in the CNS, compared to HDO (Fig. 5C). Finally, we evaluated the immunogenicity of the HD-CTP variant by measuring anti-GAA immunoglobulin G (IgG) in mouse plasma at 1 and 4 months after vector administration (Fig. 6). No significant anti-GAA humoral immune response was observed in mice treated with HD-CTP variant compared to HDO (Fig. 6). Low (<1 pg/mL) and sporadic anti-GAA IgG were detected at 1 month but they came back to 0 at the end of the study (Fig. 6), as observed in a previous study of AAV liver gene transfer with secretable GAA [Puzzo F., et al., Sci Transl Med. 2017 Nov 29;9(418)].
In addition, uptake of the chimeric GAA variant in pompe disease fibroblasts in culture was evaluated. It was shown that the HD-CTP variant was readily internalized and maturated within the cells (data not shown).

Claims

1. A nucleic acid molecule encoding a chimeric GAA polypeptide comprising a functional GAA polypeptide fused to one or more heterologous moieties, wherein at least one of the heterologous moieties is a carboxy-terminal peptide (CTP) of the human Chorionic Gonadotropin beta-subunit (hCGp).
2. The nucleic acid molecule according to claim 1, wherein the CTP of the hCGp is encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, more preferably 100% identity to the nucleotide sequence of SEQ ID NO: 13.
3. The nucleic acid molecule according to claim 1 or 2, wherein the functional GAA polypeptide is encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, to a nucleotide sequence selected from SEQ ID NO: 1-3.
4. The nucleic acid molecule according to anyone of claims 1-3, wherein the functional GAA polypeptide corresponds to a truncated form of GAA, the truncated form of GAA having preferably 42 consecutive amino acids truncated at its N-terminal end as compared to GAA, the truncated form of GAA being more preferably encoded by a nucleotide sequence having at least 85 % identity, preferably at least 90 % identity, more preferably 100% identity to the nucleotide sequence of SEQ ID NO: 10.
5. The nucleic acid molecule according to any one of the preceding claims, wherein the heterologous moiety is fused at the N-terminal end of the functional GAA polypeptide.
6. The nucleic acid molecule according to anyone of the preceding claims, wherein the chimeric GAA polypeptide further comprises a signal peptide moiety having an amino acid sequence selected in the group consisting of SEQ ID NO: 18-22, preferably SEQ ID NO: 21.
7. A nucleic acid construct comprising the nucleic acid molecule according to claims 1-6 operably linked to a promoter, wherein said nucleic acid construct optionally further comprises an intron.
8. The nucleic acid construct of claim 7, comprising, preferably in this order: a promoter; an intron; the nucleic acid molecule as defined in claims 1-6; and a polyadenylation signal.
9. A vector comprising the nucleic acid molecule or the nucleic acid construct according to any one of the preceding claims, such as a viral vector, preferably a retroviral vector, such as a lentiviral vector, or an AAV vector.
10. The vector according to claim 9, which is a single-stranded or double-stranded self-complementary AAV vector, preferably an AAV vector with an AAV-derived capsid, such as an AAV1 capsid, AAV2 capsid, variant AAV2 capsid, AAV3 capsid, variant AAV3 capsid, AAV3B capsid, variant AAV3B capsid, AAV4 capsid, AAV5 capsid, AAV6 capsid, variant AAV6 capsid, AAV7 capsid, AAV8 capsid, AAV9 capsid, AAV10 capsid such as AAVcylO capsid and AAVrhlO capsid, AAVrh74 capsid, AAVdj capsid, AAVAnc80 capsid, AAV-LK03 capsid, AAV2i8 capsid, and porcine AAV capsid, such as AAVpo4 capsid and AAVpo6 capsid or with a chimeric capsid, the AAV vector having more preferably an AAV8, AAV9, AAVrh74 or AAV2i8 capsid, in particular an AAV8, AAV9 or AAVrh74 capsid, more particularly an AAV8 capsid.
11. An isolated cell transformed with the nucleic acid molecule of claims 1-6, the nucleic acid construct of claims 7-8 or the vector of any one of claims 9-10.
12. A chimeric GAA polypeptide encoded by the nucleic acid molecule according to claims 1-6.
13. A pharmaceutical composition, comprising, in a pharmaceutically acceptable carrier, the nucleic acid molecule of any one of claims 1-6, the nucleic acid construct of any one of claims 7-8, the vector of any one of claims 9-10, the isolated cell according to claim 11, or the chimeric GAA polypeptide according to claim 12.
14. The nucleic acid molecule of any one of claims 1-6, the nucleic acid construct of any one of claims 7-8, the vector of any one of claims 9-10, the isolated cell according to claim 11, or the chimeric GAA polypeptide according to claim 12, for use as a medicament.
15. The nucleic acid molecule of any one of claims 1-6, the nucleic acid construct of any one of claims 7-8, the vector of any one of claims 9-10, the isolated cell according to claim 11, or the chimeric GAA polypeptide according to claim 12, for use in a method for treating GSDII (Pompe disease).
PCT/EP2020/079695 2019-10-22 2020-10-22 Chimeric acid-alpha glucosidase polypeptides and uses thereof WO2021078834A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP19306371.6 2019-10-22
EP19306371 2019-10-22

Publications (1)

Publication Number Publication Date
WO2021078834A1 true WO2021078834A1 (en) 2021-04-29

Family

ID=68581684

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2020/079695 WO2021078834A1 (en) 2019-10-22 2020-10-22 Chimeric acid-alpha glucosidase polypeptides and uses thereof

Country Status (1)

Country Link
WO (1) WO2021078834A1 (en)

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030144189A1 (en) * 2002-01-31 2003-07-31 Joyce Lustbader Long-acting hormone and growth factor compositions and uses thereof
WO2004064750A2 (en) 2003-01-22 2004-08-05 Duke University Improved constructs for expressing lysosomal polypeptides
WO2005118792A1 (en) 2004-06-01 2005-12-15 Avigen, Inc. Compositions and methods to prevent aav vector aggregation
WO2014080401A2 (en) * 2012-11-20 2014-05-30 Prolor Biotech Inc Method of increasing the hydrodynamic volume of polypeptides by attaching to gonadotrophin carboxy terminal peptides
WO2015013313A2 (en) 2013-07-22 2015-01-29 The Children's Hospital Of Philadelphia Variant aav and compositions, methods and uses for gene transfer to cells, organs and tissues
WO2015162302A2 (en) 2014-04-25 2015-10-29 Genethon Treatment of hyperbilirubinemia
WO2015196179A1 (en) 2014-06-20 2015-12-23 University Of Florida Research Foundation, Inc. Methods of packaging multiple adeno-associated virus vectors
CN105461810A (en) * 2014-08-31 2016-04-06 复旦大学 Long-acting recombinant human granulocyte colony-stimulating factor and preparation method therefor and use thereof
EP3293259A1 (en) * 2016-09-12 2018-03-14 Genethon Acid-alpha glucosidase variants and uses thereof
WO2018046774A1 (en) 2016-09-12 2018-03-15 Genethon Acid-alpha glucosidase variants and uses thereof
WO2018046775A1 (en) 2016-09-12 2018-03-15 Genethon Acid-alpha glucosidase variants and uses thereof
WO2019032898A1 (en) * 2017-08-09 2019-02-14 Bioverativ Therapeutics Inc. Nucleic acid molecules and uses thereof

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030144189A1 (en) * 2002-01-31 2003-07-31 Joyce Lustbader Long-acting hormone and growth factor compositions and uses thereof
WO2004064750A2 (en) 2003-01-22 2004-08-05 Duke University Improved constructs for expressing lysosomal polypeptides
WO2005118792A1 (en) 2004-06-01 2005-12-15 Avigen, Inc. Compositions and methods to prevent aav vector aggregation
WO2014080401A2 (en) * 2012-11-20 2014-05-30 Prolor Biotech Inc Method of increasing the hydrodynamic volume of polypeptides by attaching to gonadotrophin carboxy terminal peptides
WO2015013313A2 (en) 2013-07-22 2015-01-29 The Children's Hospital Of Philadelphia Variant aav and compositions, methods and uses for gene transfer to cells, organs and tissues
WO2015162302A2 (en) 2014-04-25 2015-10-29 Genethon Treatment of hyperbilirubinemia
WO2015196179A1 (en) 2014-06-20 2015-12-23 University Of Florida Research Foundation, Inc. Methods of packaging multiple adeno-associated virus vectors
CN105461810A (en) * 2014-08-31 2016-04-06 复旦大学 Long-acting recombinant human granulocyte colony-stimulating factor and preparation method therefor and use thereof
EP3293259A1 (en) * 2016-09-12 2018-03-14 Genethon Acid-alpha glucosidase variants and uses thereof
WO2018046772A1 (en) 2016-09-12 2018-03-15 Genethon Acid-alpha glucosidase variants and uses thereof
WO2018046774A1 (en) 2016-09-12 2018-03-15 Genethon Acid-alpha glucosidase variants and uses thereof
WO2018046775A1 (en) 2016-09-12 2018-03-15 Genethon Acid-alpha glucosidase variants and uses thereof
WO2019032898A1 (en) * 2017-08-09 2019-02-14 Bioverativ Therapeutics Inc. Nucleic acid molecules and uses thereof

Non-Patent Citations (40)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. NM_008064
AMALFITANO, A. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 8861 - 8866
CHICHILI ET AL., PROTEIN SCI, vol. 22, no. 2, February 2013 (2013-02-01), pages 153 - 67
CHUAH ET AL., MOL THER., vol. 22, no. 9, September 2014 (2014-09-01), pages 1605 - 13
Cold Spring Harbor Laboratory; "Genbank", Database accession no. U32510
FARES F A ET AL: "Design of a long-acting follitropin agonist by fusing the C-terminal sequence of the chorionic gonadotropin beta subunit to the follitropin beta subunit", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 89, no. 10, 15 May 1992 (1992-05-15), pages 4304 - 4308, XP002005696, ISSN: 0027-8424, DOI: 10.1073/PNAS.89.10.4304 *
FRAITES, T. J. ET AL., MOL. THER., vol. 5, 2002, pages 571 - 578
FUAD FARES ET AL: "Designing a Long Acting Erythropoietin by Fusing Three Carboxyl-Terminal Peptides of Human Chorionic Gonadotropin β Subunit to the N-Terminal and C-Terminal Coding Sequence", INTERNATIONAL JOURNAL OF CELL BIOLOGY, vol. 9, no. 11, 1 January 2011 (2011-01-01), pages 2021 - 7, XP055053357, ISSN: 1687-8876, DOI: 10.1155/2011/275063 *
HERMANS ET AL., BIOCHEM. J., vol. 289, 1993, pages 681
HIRSCHHORN, R.REUSER, A. J. ET AL.: "The Metabolic and Molecular Basis for Inherited Disease", vol. 3, 2001, MCGRAW-HILL, pages: 3389 - 3419,3403-3405
HOEFSLOOT ET AL., BIOCHEM. J., vol. 272, 1990, pages 485
HOEFSLOOT ET AL., EMBO J, vol. 7, 1988, pages 1697
ILL, C. R. ET AL.: "Optimization of the human factor VIII complementary DNA expression plasmid for gene therapy of hemophilia", A. BLOOD COAG. FIBRINOL., vol. 8, 1997, pages S23 - S30, XP002098302
J. A. MAGA ET AL: "Glycosylation-independent Lysosomal Targeting of Acid ?alpha-Glucosidase Enhances Muscle Glycogen Clearance in Pompe Mice", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 288, no. 3, 27 November 2012 (2012-11-27), US, pages 1428 - 1438, XP055305638, ISSN: 0021-9258, DOI: 10.1074/jbc.M112.438663 *
KIM ET AL., GENE, vol. 199, 1997, pages 293 - 301
KUNITA ET AL., BIOCHEMICA ET BIOPHYSICA ACTA, vol. 1362, 1997, pages 269
LAI Y. ET AL., MOL THER., vol. 18, no. 1, 2010, pages 75 - 79
LEE D E ET AL: "The prolonged half-lives of new erythropoietin derivatives via peptide addition", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ELSEVIER, AMSTERDAM, NL, vol. 339, no. 1, 6 January 2006 (2006-01-06), pages 380 - 385, XP024923468, ISSN: 0006-291X, [retrieved on 20060106], DOI: 10.1016/J.BBRC.2005.11.034 *
LING ET AL., HUM GENE THER METHODS, 18 July 2016 (2016-07-18)
MAGA JA ET AL., J BIOL CHEM, vol. 288, no. 3, 2013, pages 1428 - 1438
MARTINIUK ET AL., DNA AND CELL BIOLOGY, vol. 9, 1990, pages 85
MCCARTY ET AL., GENE THERAPY, 2003
NAIR ET AL., BLOOD, vol. 123, no. 20, 15 May 2014 (2014-05-15), pages 3195 - 9
PUZZO F. ET AL., SCI TRANSL MED, vol. 9, no. 418, 29 November 2017 (2017-11-29), pages 418
RABEN N. ET AL., J BIOL CHEM., vol. 273, no. 30, 24 July 1998 (1998-07-24), pages 19086 - 92
RINCON ET AL., MOL THER., vol. 23, no. 1, January 2015 (2015-01-01), pages 43 - 52
ROSARIO ET AL., MOL THER METHODS CLIN DEV, vol. 3, 2016, pages 16026
SHARPLI, NUCLEIC ACIDS RESEARCH, vol. 15, 1987, pages 1281 - 1295
SHEN ET AL., MOLECULAR THERAPY, 2007
SUN ET AL: "Enhanced Efficacy of an AAV Vector Encoding Chimeric, Highly Secreted Acid @a-Glucosidase in Glycogen Storage Disease Type II", MOLECULAR THERAPY : THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, CELL PRESS, US, vol. 14, no. 6, 18 November 2006 (2006-11-18), pages 822 - 830, XP005726585, ISSN: 1525-0016, DOI: 10.1016/J.YMTHE.2006.08.001 *
TENNEY ET AL., VIROLOGY, 2014
TSUJINO, S. ET AL., HUM. GENE THER., vol. 9, 1998, pages 1609 - 1616
VAN DER PLOEGREUSER, LANCET, vol. 372, 2008, pages 1342 - 1351
VAN HOVE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 65
VAN TIL ET AL., BLOOD, vol. 115, no. 26, 2010, pages 5329
VERCAUTEREN ET AL., MOL. THER., vol. 24, no. 6, 2016, pages 1042
WANG Y. ET AL., HUM GENE THER METHODS, vol. 23, no. 4, 2012, pages 225 - 33
WISSELAAR ET AL., J. BIOL. CHEM., vol. 268, 1993, pages 2223
ZINCARELLI ET AL., MOL THER, vol. 16, no. 6, June 2008 (2008-06-01), pages 1073 - 80
ZUR MEGEDE ET AL., JOURNAL OF VIROLOGY, vol. 74, 2000, pages 2628 - 2635

Similar Documents

Publication Publication Date Title
US20220389399A1 (en) Acid-alpha glucosidase variants and uses thereof
US20220275396A1 (en) Acid-alpha glucosidase variants and uses thereof
US20240043867A1 (en) Acid-alpha glucosidase variants and uses thereof
EP3293260A1 (en) Acid-alpha glucosidase variants and uses thereof
WO2021078833A1 (en) Chimeric polypeptides and uses thereof
WO2021078834A1 (en) Chimeric acid-alpha glucosidase polypeptides and uses thereof
NZ791162A (en) Acid-alpha glucosidase variants and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20792447

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20792447

Country of ref document: EP

Kind code of ref document: A1