WO2021077856A1 - Sirna and nano delivery system capable of silencing pcsk9 protein, and application of nano delivery system - Google Patents

Abstract

siRNA capable of silencing a Pcsk9 protein. A sense strand amino acid sequence of the siRNA is 5'-UUCCGAAUAAACUCCAGGC-3', and an anti-sense strand amino acid sequence is 5'-GCCUGGAGUUUAUUCGGAA-3'. Further provided are a nano delivery system capable of silencing the Pcsk9 protein, a preparation method therefor, and an application thereof. The method has a higher transfection effect, can maintain long-term action, has a better treatment effect of reducing blood lipid, and is applicable to gene therapy for reducing blood lipid.

Description

A siRNA capable of silencing Pcsk9 protein, its nano-delivery system and application Technical field

The invention belongs to the field of medicine, and specifically relates to a siRNA capable of silencing Pcsk9 protein, a nano-delivery system and application thereof.

Background technique

With the continuous improvement of people's living standards and changes in dietary structure and lifestyle, cases of high blood sugar, high cholesterol and high triglycerides are on the rise year by year, which in turn usually leads to diabetes, arteriosclerosis, cardiovascular and cerebrovascular diseases, etc. The occurrence of the disease. In 2002, the World Health Organization (WHO) announced that among the top ten risk factors for human health, hypercholesterolemia ranked eighth.

Common familial hypercholesterolemia is mainly caused by apolipoprotein (APOB), low-density lipoprotein receptor (LDL-R), and proprotein convertase Bacillus subtilis convertase (PCSK9) gene mutations. PCSK9 is mainly caused by It is distributed in the liver, and PCSK9 secreted outside the cell can bind to LDL-R and target to the lysosome for degradation. When the number of LDL receptors on the cell surface decreases, the overall low-density lipoprotein cholesterol (LDL-C) level in the blood increases accordingly. Studies have shown that the loss of function mutation of PCSK9 leads to a decrease in LDL cholesterol levels, so it is expected to be a control for hypercholesterolemia Potentially meaningful therapeutic targets for its complications.

The current clinical treatment is mainly based on statins. Studies have shown that patients who are intolerant to statins can cause adverse reactions such as muscle pain and rhabdomyolysis. Although evolocumab (trade name Ruibaian) is currently on the market in China, due to its high cost and the metabolism of PCSK9 monoclonal antibody via the reticuloendothelial system, injections are required every 2-4 weeks. Studies have shown that small interfering RNA (siRNA) can specifically silence the Pcsk9 gene, thereby inhibiting its protein expression and reducing low-density lipoprotein. However, the siRNA used to silence Pcsk9 inevitably encounters the problems faced by gene delivery: 1) Unmodified siRNA is easily degraded under the action of nuclease; 2) Modification of siRNA is complicated in structure, difficult, and may be reduced. The specificity of siRNA; 3) siRNA is randomly distributed in the body, reducing its accumulation at the target site; 4) siRNA is strongly negative due to the presence of phosphate residues in the backbone, and it is difficult to be taken up by cells with the same surface charge. The delivery of siRNA requires the help of an efficient transduction system, and viral vectors are currently the most widely used. Viral vectors can efficiently deliver hairpin RNA and effectively silence Pcsk9, but it has potential immunogenicity, tumorigenicity and teratogenicity, which raises concerns about its biological safety. Non-viral vectors are mainly liposomes and polymer materials. However, current non-viral vectors also encounter problems including high toxicity, poor stability, and low transfection efficiency. It is often difficult for people to make a choice between delivery efficiency and safety. Due to potential immunogenicity, tumorigenicity and teratogenicity, current viral vectors are forbidden for clinical treatment, which greatly limits their applications. As a system with great potential, non-viral vectors make up for the deficiencies of viral vectors and have great development prospects. However, current non-viral vectors also encounter problems including high toxicity, poor stability, and low transfection efficiency. Specifically for the treatment of hypercholesterolemia, people need to efficiently deliver siRNA to the liver, be taken up by hepatocytes, and successfully escape the lysosome, thereby producing a gene silencing effect. How to effectively solve the problem of non-viral vectors in siRNA delivery has become a research hotspot. Therefore, the development of an efficient delivery system for silencing Pcsk9 will provide an effective means for long-term treatment of hypercholesterolemia.

Summary of the invention

Therefore, the purpose of the present invention is to overcome the shortcomings in the prior art and find a siPcsk9 nanocapsule based on biomembrane camouflage (such as platelet membrane) to efficiently transfect siPcsk9 nanocapsules to reduce the level of PCSK9 protein, so as to achieve an efficient and long-term treatment of lowering cholesterol levels. effect.

In order to achieve the above-mentioned purpose, the first aspect of the present invention provides a siRNA capable of silencing PCSK9 protein. The sense chain amino acid sequence of the siRNA is 5′-UUCCGAAUAAACUCCAGGC-3′, and the antisense chain amino acid sequence is 5′-GCCUGGAGUUUAUUCGGAA- 3'.

Preferably, the 3'end of the siRNA sense strand and/or antisense strand is further modified with dTdT.

The second aspect of the present invention provides a nano-delivery system capable of silencing PCSK9 protein. The nano-system is a nanocapsule camouflaged by a biological membrane and wrapped with siRNA capable of silencing PCSK9 protein.

Among them, the siRNA capable of silencing the PCSK9 protein may be, for example, the siRNA described in the first aspect.

The nano-delivery system according to the second aspect of the present invention, wherein the biofilm is selected from one or more of the following: platelet membrane, red blood cell membrane, bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, macrophages; preferably Platelet membrane.

The nano delivery system according to the second aspect of the present invention, wherein the material of the nanocapsule is selected from one or more of the following: PLGA, DOTAP, polyurethane, hyaluronic acid, chitosan, polylactic acid; preferably PLGA And DOTAP.

The nano delivery system according to the second aspect of the present invention, wherein the mass ratio of PLGA to DOTAP in the nanocapsule is 20:1-20:11, preferably 20:1-20:5, most preferably 20:3 . The nano-delivery system according to the second aspect of the present invention, wherein the mass parts of the biofilm, nanocapsules and siRNA are: 1-50 parts of biofilm, 1-50 parts of nanocapsules, and 0.1-10 parts of siRNA; preferably 10-30 parts of biofilm, 10-30 parts of nanocapsule, 0.5-2 parts of siRNA; most preferably 23 parts of biofilm, 23 parts of nanocapsule, and 1 part of siRNA;

Preferably, when the nanocapsule material is selected from PLGA and DOTAP, the mass ratio of the biofilm to the nanocapsule is 1:1.

The third aspect of the present invention provides a preparation method of the nano delivery system described in the second aspect, and the preparation method may include the following steps:

(1) Prepare siRNA solution;

(2) Drop the siRNA solution prepared in step (1) into the PLGA/DOTAP solution;

(3) Add the mixed solution obtained in step (2) dropwise to the solvent, ultrasonically stir and centrifuge to remove the supernatant, resuspend the obtained precipitate, and resuspend to obtain a resuspension;

(4) Mix the resuspension solution obtained in step (3) with the biofilm, and sonicate to obtain the nano-delivery system.

According to the preparation method of the third aspect of the present invention, in the step (3), the solvent is selected from one or more of the following: PVA aqueous solution, Tween 20 aqueous solution, Tween 80 aqueous solution; preferably PVA aqueous solution, It is more preferably a 1%-10% PVA aqueous solution, and most preferably a 2% PVA aqueous solution. Among them, the PLGA/DOTAP solution is preferably a dichloromethane solution in which PLGA and DOTAP are mixed according to a ratio, and more preferably PLGA and DOTAP are mixed according to a ratio of 20:1-15.

The fourth aspect of the present invention provides a medicine for lowering low-density lipoprotein cholesterol, the medicine comprising:

Nucleic acid or small molecule compound; and/or

The nano delivery system described in the second aspect.

The nucleic acid or small molecule compound may be siPCSK9

The fifth aspect of the present invention provides the application of the siRNA described in the first aspect and/or the nano-delivery system described in the second aspect in the preparation of drugs for the treatment of hypercholesterolemia.

The sixth aspect of the present invention provides a drug nano-delivery system, which can be used to deliver drugs into relevant cells, improve the uptake rate of the drugs by the cells, and the stability of the drugs in the body.

A drug nano-delivery system is composed of a nanocapsule loaded with a drug and a biomembrane enveloping the nanocapsule. The biomembrane is a platelet membrane or a red blood cell membrane.

The drug may be small interfering RNA, for example, a type of siRNA that can silence the PCSK9 protein, for example, the siRNA described in the first aspect, or CRISPR/Cas9, CRISPR/dCas9, and other shRNAs.

The method of the present invention uses a platelet membrane with good biocompatibility to modify the PLGA/DOTAP core (PDC). This structure gives the nanoparticles the ability to efficiently load siRNA and improves the stability of the particles in the body. The DOTAP modified nucleus can promote the successful escape of siRNA from the lysosome, thereby improving the efficiency of silencing. This structure can ultimately achieve safe and efficient down-regulation of LDL-C in the body.

The delivery system of the present invention can have but not limited to the following beneficial effects:

The method of the present invention has a high transfection effect and can maintain a long-term effect, and has a good therapeutic effect on lowering blood lipids. The invention is suitable for gene therapy for lowering blood fat. It is believed that the method of the present invention has broad application prospects in cardiovascular diseases, genetic diseases and the like.

Description of the drawings

Hereinafter, the embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

Figure 1 shows the preparation process of siPcsk9 nanocapsules camouflaged by platelet membrane. Among them, Figure 1A shows polylactic acid-glycolic acid copolymer (PLGA) and cationic liposome DOTAP encapsulating siPcsk9 to construct nanocapsules, and Figure 1B shows the use of platelet membrane to wrap nanocapsules to prepare siPcsk9 camouflaged by platelet membrane. Nanocapsule process.

Figure 2 shows the cytotoxicity of the nanocapsules in Example 1. In PDC, the ratios of PLGA and DOTAP are 20/0, 20/1, 20/3, 20/5, 20/7, 20/9 and 20/11, respectively. The concentrations of siRNA were 0, 9.38, 18.75, 37.5, 75, 150, and 300 nM.

Figure 3 shows the loading efficiency of Example 1 nanocapsules on siRNA. In PDC/siRNA, the mass ratios of PDC to siRNA are 23/0.1, 23/0.2, 23/0.5, 23/1, 23/2, respectively.

Figure 4 shows the case of Example 1 where the platelet membrane is wrapped and loaded with siRNA nanocapsules. Among them, the mass ratio of platelet membrane to nanocapsule is 0/1, 1/5, 1/1 and 5/1, respectively.

FIG. 5 shows the nanoparticles obtained in Example 1. Figure 5A shows the plasma obtained after blood collection and centrifugation in mice, Figure 5B shows the flow cytometric quantitative determination of the proportion of platelets; Figure 5C shows the analysis of protein components by sodium dodecyl sulfonate-polyacrylamide gel electrophoresis (TPP, total platelet protein; PM, platelet membrane; PDC, PLGA/DOTAP core); Figure 5D shows the platelet membrane before encapsulating the PLGA/DOTAP core, and Figure 5E shows the platelet membrane encapsulating the PDC.

Figure 6 shows the expression levels of PCSK9, LDL-C, HDL, TG and other indicators in the blood of mice in Test Example 1. Figure 6A shows the PCSK9 level, Figure 6B shows the LDL-C level, and Figure 6C shows Figure 6D shows the TG level, Figure 6E shows the TBIL level, Figure 6F shows the ALT level, and Figure 6G shows the AST level.

Figure 7 shows the in vitro uptake of PPDP in Test Example 2, where Figure 7A shows the cellular uptake levels of PPDP (PM/PDC/siPcsk9) at different concentrations, and Figure 7B shows the uptake levels of PPDP cells at different times Fig. 7C shows the PPDP cell uptake levels of different cell lines, and Fig. 7D shows the PPDP cell fluorescence uptake levels of different cell lines.

Fig. 8 shows the regulation level of Hepa 1-6PCSK9 in vitro in Test Example 3. Fig. 8A shows the lysosomal escape ability of PPDP, Fig. 8B shows the in vitro mRNA level of PCSK9, and Fig. 8C shows the in vitro protein level of PCSK9.

Figure 9 shows the hemolysis and cytotoxicity of PPDP in vitro in Test Example 4. Figure 9A shows the hemolysis caused by different concentrations of PPDP, Figure 9B shows the hemolysis rate caused by different concentrations of PPDP, Figure 9C shows the living and dead cells caused by different concentrations of PPDP under CLSM observation, and Figure 9D shows the different Grouping the hemolysis caused by PPDP, Fig. 9E shows the hemolysis rate caused by different groups of PPDP, and Fig. 9F shows the status of live and dead cells caused by different groups of PPDP under CLSM observation.

Figure 10 shows the biodistribution and circulation of PPDP in the body in Test Example 4, Figure 9A shows the distribution of PPDP in the body over time, and Figure 10B shows the distribution of PPDP in various organs after 72 hours. Figure 10C shows the circulation of PPDP in the body

Figure 11 shows the protein expression levels of PCSK9 and LDLR in Test Example 4 in vivo. Figure 11A shows the protein level of PCSK9 in vivo, and Figure 11B shows the protein level of LDLR in vivo.

Figure 12 shows the protein expression levels of LDLR in hepatocytes and Kupffer cells in Test Example 4.

Fig. 13 shows the histopathological changes of the heart, liver, spleen, lung and kidney of mice after administration in Test Example 4.

Detailed ways

The present invention will be further explained by specific examples below. However, it should be understood that these examples are only used for more detailed and specific description, and should not be understood as limiting the present invention in any form.

This section gives a general description of the materials and test methods used in the test of the present invention. Although many materials and operating methods used to achieve the purpose of the present invention are well known in the art, the present invention is still described here in as much detail as possible. It is clear to those skilled in the art that, in the context, unless otherwise specified, the materials and operating methods used in the present invention are well known in the art.

Before describing the technical solution of the present invention in detail, the terms used in this article are defined as follows:

The term "siRNA" refers to: small interfering RNA.

The term "PLGA" refers to: polylactic acid-glycolic acid copolymer.

The term "DOTAP" refers to: (2,3-dioleoyl-propyl)trimethylammonium chloride.

The term "PVA" means: polyvinyl alcohol.

The term "siRNA" refers to: small interfering RNA.

The term "PBS" means: phosphate buffered saline solution.

The term "PM/PDC/siPcsk9" refers to: the platelet membrane encapsulates the PLGA/DOTAP core containing siPcsk9 nanocapsules.

The term "LDL-C" refers to: low-density lipoprotein cholesterol.

The term "HDL-C" refers to: high-density lipoprotein cholesterol.

The term "TG" means: triglycerides.

The term "TBIL" refers to: total bilirubin.

The term "ALT" refers to: alanine aminotransferase.

The term "AST" means: aspartate aminotransferase.

The term "PBAE" refers to: poly-β-aminoesters.

The term "HA" means: hyaluronic acid.

The term "PLA" means: polylactic acid.

The reagents and instruments used in the following examples are as follows:

Reagents:

Nuclease-free water, siPcsk9 dry powder, purchased from Takara Japan;

PLGA, purchased from Sigma-Aldrich, USA;

DOTAP, purchased from Avanti, USA;

Dichloromethane, purchased from Guangzhou Chemical Reagent Factory, China;

PVA, purchased from Sigma-Aldrich, USA;

PBS, purchased from Lifetechnology, USA;

Phalloidin, purchased from Life, USA;

TritonX-100, BSA, purchased from Sigma-Aldrich, USA;

C57BL/6 mice, purchased from Guangzhou Cybino Biotechnology Co., Ltd.;

ELISA kit, Hepa1-6 cells, purchased from Beijing Dingguochangsheng Biotechnology Co., Ltd.

instrument:

Confocal laser microscope, purchased from Zeiss Germany.

On the one hand, the present invention aims to find a high-efficiency transfection of siPcsk9 nanocapsules based on platelet membrane camouflage to knock down the PCSK9 protein level, so as to achieve a high-efficiency and long-term therapeutic effect of reducing cholesterol levels.

To achieve the goal, the present invention adopts the following technical solutions:

The present invention adopts biocompatibility and degradability polylactic acid-polyglycolic acid copolymer (PLGA) to encapsulate small interfering RNA, and at the same time, cationic liposome DOTAP is used to solve the problem that the adsorption force of PLGA and nucleic acid is small, and the lysosome cannot be completed. After the nanocapsules are constructed from defects such as escape, the platelet membrane from the donor is used to wrap the nanocapsules. Without any other transfection reagents, the small interfering RNA nanocapsule system can be efficiently delivered into the cells, which improves the cellular uptake. Intake rate and transfection efficiency are low in PCSK9 protein level, so as to achieve the therapeutic effect of continuously lowering blood cholesterol level, which has important application value. The specific process is shown in Figure 1.

The present invention exemplifies a gene that can silence the PCSK9 protein:

siRNAs against PCSK9,

Sense chain: 5′-UUCCGAAUAAACUCCAGGCT-3′ (SEQ ID NO.1),

Antisense strand: 5'-GCCUGGAGUUUAUUCGGAA-3' (SEQ ID NO. 2).

And the 3'of the above-mentioned sense strand and antisense strand are modified with a hanging base dTdT (siPCSK9).

Example 1

This example is used to illustrate the synthesis of nanoparticles of the present invention.

A method for preparing biofilm-encapsulated nanoparticles using nanomaterials and platelet membranes extracted is constructed.

1) Dissolve 56nmol of siPcsk9 dry powder (0.75mg) with 100μL of ribozyme-free water, and add it dropwise to 69mg/mL containing PLGA/DOTAP (PLGA and DOTAP follow w/w 20/0, 20/1, 20/3, 20/5, 20/7, 20/9 and 20/11) in dichloromethane solution (250μL), ice bath ultrasonic for 90s.

2) All the colostrum prepared above was added dropwise to 1 mL of 2% PVA aqueous solution, and ultrasonicated in an ice bath for 1 min.

3) Add all the above-prepared mixture to 10mL of 2% PVA aqueous solution and stir for 3h at room temperature, evaporate the organic solvent, centrifuge at 4℃, 18000g for 15min, remove the supernatant, and wash three times repeatedly. The obtained precipitate is resuspended in sterile PBS. Get resuspension.

4) Mix the above-mentioned resuspension mixture with the platelet membrane (according to the mass ratio of the protein on the platelet membrane to the nanocapsules 0/1, 1/1, 1/5, 1/1 and 5/1) (platelet membrane with membrane Quantitative protein quality), ultrasonically wrap the nanocapsules containing siPcsk9 to obtain nanoparticles PM/PDC/siPcsk9.

Among them, the synthesis of platelet membrane is:

1) Collect animal whole blood, then centrifuge at 1500 rpm for 20 min at room temperature to obtain platelet rich plasma, centrifuge at 1500 rpm at room temperature for 1 min to remove residual red blood cells and white blood cells, and centrifuge again at 3500 rpm for 12 min to obtain platelet pellets and prepare suspensions Store in the refrigerator at -80℃.

2) Platelet membrane extraction: the above suspension was thawed at room temperature, repeatedly frozen and thawed 3 times, washed with PBS, centrifuged at 5000 rpm for 5 minutes, and ultrasonicated in a water bath for 5 minutes until platelet membrane vesicles were formed.

Figure 1 shows the preparation process of siPcsk9 nanocapsules camouflaged by platelet membrane. Among them, Figure 1A shows polylactic acid-glycolic acid copolymer (PLGA) and cationic liposome DOTAP encapsulating siPcsk9 to construct nanocapsules, and Figure 1B shows the use of platelet membrane to wrap nanocapsules to prepare siPcsk9 camouflaged by platelet membrane. Nanocapsule process.

Figure 2 shows the cytotoxicity of the nanocapsules in Example 1. In PDC, the ratios of PLGA and DOTAP are 20/0, 20/1, 20/3, 20/5, 20/7, 20/9 and 20/11, respectively. The concentrations of siRNA were 0, 9.38, 18.75, 37.5, 75, 150, and 300 nM. We optimized the ratio of PLGA to DOTAP and found that when the ratio was 20/3, it showed high cell viability (>80%).

Figure 3 shows the loading efficiency of Example 1 nanocapsules on siRNA. In PDC/siRNA, the mass ratios of PDC to siRNA are 23/0.1, 23/0.2, 23/0.5, 23/1, 23/2, respectively. Among them, the efficiency of loading siRNA on PLGA/DOTAP nanoparticles can be close to 100%.

Figure 4 shows the case of Example 1 where the platelet membrane is wrapped and loaded with siRNA nanocapsules. Among them, the mass ratios of platelet membrane protein to nanocapsules are 0/1, 1/5, 1/1, and 5/1, respectively. Transmission electron microscopy (TEM) analysis shows that PPDP (PM/PDC/siPcsk9, referred to as PPDP, which is PLGA/DOTAP/siPCSK9 nanoparticles wrapped in the final synthesized platelet membrane) coating with a PM/PDP mass ratio of 1/1 The effect is the best. A smaller or larger PPDP coating quality ratio will cause the coating to be incomplete or greatly increase the size of the coating.

FIG. 5 shows the nanoparticles obtained in Example 1. Figure 5A shows the plasma obtained after blood collection and centrifugation in mice, Figure 5B shows the flow cytometric quantitative determination of the proportion of platelets; Figure 5C shows the analysis of protein components by sodium dodecyl sulfonate-polyacrylamide gel electrophoresis (TPP, total platelet protein; PM, platelet membrane; PDC, PLGA/DOTAP nucleus); Figure 5D shows the platelet membrane before encapsulating the PLGA/DOTAP nucleus, and Figure 5E shows the platelet membrane encapsulating the PLGA/DOTAP nucleus. Whole blood was collected from mice, and platelets were extracted from serum (Figure 5A). After labeling the cells with anti-CD42d antibody and analyzing by flow cytometry (FACS), up to 99% of the cells were CD42d positive (Figure 5B). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis showed that PPDP retained most of the protein on the platelet membrane (Figure 5C), making the nanoparticles have platelet-like functions. In addition, TEM also showed that the core of the PDP is about 130nm (Figure 5D). After wrapping the platelet membrane, the size increased to about 180 nanometers (Figure 5E).

Test example 1

This test example is used to illustrate the treatment of hypercholesterolemia by the nanoparticles of the present invention.

As in Example 1, the nanoparticles PM/PDC/siPcsk9 were synthesized to treat hypercholesterolemia. PM/PDC/siPcsk9 is the experimental group, Lipo2000/siPcsk9 is the positive control group, siLuciferase is used as the internal control, according to the preparation method of PM/PDC/siPcsk9, after loading siLuciferase, PM/PDC/siLuc is formed, siPcsk9 is the unmodified drug control In the group, PM/PDC is the no-load control group without drugs, and PBS is the blank control group.

Preparation of Lipo2000/siPcsk9:

1) Dissolve 5nmol of siPcsk9 dry powder with 250μL ribozyme-free water, take 15μL of it and add it to 150μL Opti-MEM and mix gently

2) At the same time, take 22.5μL Lipofectamine 2000 (Life, USA) and add it to 150μL Opti-MEM and mix gently

3) Add all the solution prepared in the above step 1) to the solution prepared in the above step 2), gently invert to mix evenly, and incubate at room temperature for 5 minutes.

PM/PDC/siLuc preparation:

1) Dissolve 56 nmol of siLuciferase (Luciferase siRNA) dry powder with 100 μL ribozyme-free water, and add it dropwise to 69 mg/mL dichloromethane solution (250 μL) containing PLGA/DOTAP (w/w 20:3), ice Bath ultrasound for 90s.

2) Add all the colostrum prepared above dropwise to 1 mL 2% PVA aqueous solution, and ultrasonicate for 1 min in an ice bath.

3) Add all the above-prepared mixed solution to 10mL 2% PVA aqueous solution and stir at room temperature for 1h, volatilize the organic solvent in vacuum for 3h, 4℃, 18000g centrifugation for 15min, remove the supernatant, and wash three times repeatedly. The precipitate obtained is sterile PBS Resuspended.

4) Mix the above mixture with the platelet membrane (according to the ratio of PLGA to the protein on the platelet membrane at 1:1), and ultrasonically wrap the nanocapsules containing siLuciferase.

siPcsk9 preparation:

Dissolve 5nmol of siPcsk9 dry powder with 25μL of ribozyme-free water and dilute to 200μM with sterile PBS solution.

PM/PDC preparation:

1) Take 100 μL of ribozyme-free water and add it dropwise to a dichloromethane solution (250 μL) containing 69 mg/mL PLGA/DOTAP (w/w 20:3), and ultrasonication in an ice bath for 90 seconds.

2) Add all the colostrum prepared above dropwise to 1 mL 2% PVA aqueous solution, and ultrasonicate for 1 min in an ice bath.

3) Add all the above-prepared mixture to 10mL 2% PVA aqueous solution and stir for 3h at room temperature, evaporate the organic solvent, 4℃, centrifuge at 18000g for 15min, remove the supernatant, and wash three times repeatedly. The obtained precipitate is resuspended in sterile PBS .

4) Mix the above mixture with the platelet membrane (according to the ratio of PLGA and the protein on the platelet membrane at 1:1), and ultrasonically wrap the nanocapsules containing siPcsk9.

Figure 6 compares with other treatment methods. Figure 6 shows the changes of biochemical factors in mice.

1) Take 30 female C57BL/6 mice (6-8 weeks old, weighing about 20g) and randomly divide them into the above five groups. After two weeks of administration, separate mouse liver and extract mouse serum for simultaneous use The ELISA kit detects the expression levels of PCSK9, LDL-C, HDL, TG and other indicators in the blood, as shown in Figure 6.

As shown in Figure 6, compared with the control group, the experimental group has a stronger silencing effect and significantly reduces the level of low-density lipoprotein-cholesterol (LDL-C).

Please refer to Figure 6. ELISA results show that the PCSK9 level is 499.38±129.61 pg/ml, which is about 40% lower than that of normal saline-treated mice (840.00±48.07 pg/mL) (Figure 6A). However, the control group Lipo2000/siPCSK9 (615.77±209.20pg/ml) showed about 20% reduction in PCSK9 than the PPDP group. The other groups of PPDL, siPcsk9 and PPD had no significant effect on the inhibition of PCSK9 (Figure 6A). While inhibiting PCSK9, PPDP also had a 28% down-regulation effect on LDL-C levels in mice. There was no significant change in the control group. The levels of PCSK9 and LDL-C induced by PPDP and Lipo2000/siPcsk9 were not statistically significant in this study, but there are discrete data points in the levels of PCSK9 and LDL-C induced by Lipo2000/siPcsk9, indicating that the application of Lipo2000 in vivo is unstable. Compared with the control group, the non-specific biochemical indicators HDL and TG did not change significantly. Liver function evaluation showed that TBIL, ALT, and AST in the Lipo2000/siPcsk9 group were significantly higher than those in the normal saline group after treatment, suggesting that it has potential toxicity (Figure 6). Although siRNA delivery using this optimized material will result in an effective down-regulation of LDL-C (approximately 56%), previous studies have also shown that the use of lipid nanoparticles can lead to impaired liver function. Our work contributes to the safe delivery of therapeutic siRNA based on PM camouflage nanoparticles without significant impact on liver function.

Test example 2

This test example is used to illustrate the in vitro transfection experiment of the nanoparticle hepatocytes of the present invention.

The nanoparticles PM/PDC/siPcsk9 synthesized by the method in Example 1 were transfected in vitro to mouse-derived liver cancer cells (Hepa1-6).

Confocal laser microscope (CLSM) observes cell uptake.

In order to study cellular uptake, the fluorescent dye 2-((1E, 3E, 5E)-5-(1-(5-carboxypentyl)-3,3-dimethylindole-2-ylide)pentan- 1,3-dienyl)-1-ethyl-3,3-dimethyl-3H-indole chloride (Cy5)-labeled siPcsk9 (Cy5-siPcsk9) loaded onto PLGA/DOTAP core (Cy5-PDP) In, the platelet membrane is coated on the PDP to form Cy5-PPDP, as described previously. Hepa1-6 cells were seeded in a confocal culture dish with a density of 10^5 cells/well. Once the cells had grown to about 70% confluence, they were washed and cultured in freshly prepared Opti-mem medium containing Cy5PPDP, the concentration of Cy5-siPcsk9 was equivalent to 18.75, 37.5, 75, 150 and 300 nM (Figure 7A). After the specified incubation time, the medium was removed, the cells were gently washed with PBS 3 times, and fixed with 4% paraformaldehyde for 15 min at room temperature, washed twice with PBS; ruptured with 0.1% Triton for 1 min, PBS Wash twice; then block with 3% BSA for 30 min, wash twice with PBS; then stain the cytoskeleton with Alexa Fluor 488 phalloidin (Invitrogen, Carlsbad, USA), and then use DAPI (4,6-diamino-2) -Phenylindole) dye counterstain the nucleus, and wash repeatedly with PBS. Cell imaging was performed on CLSM (LSM 880, Zeiss). In addition, the cellular uptake of PPDP over time was evaluated by CLSM. Nanoparticles were added at the last 150 nM Cy5-siPcsk9 and incubated for 1, 3, 6, 9 and 12h (Figure 7B). Then, the cells were stained with FITC-Phalloidin and Hoechst in the same way. Cell lines of alveolar macrophages, mononuclear macrophages, and umbilical cord mesenchymal stem cells were cultivated to prepare Cy5-PPDP, and different nano-preparations with a Cy5-siPcsk9 concentration of 150 nM were incubated with the cells for 9 hours at 37°C. The medium was removed, and the cells were washed three times with PBS. For CLSM, FITC-labeled phalloidin and DAPI were also fixed and stained (7C). In order to observe the low uptake of Cy5-PPDP by the cell line in Figure (7C), and at the same time, as in Figure 10C, different cell lines were incubated with synthetic Cy5-PPDP for 9 hours, and 1 mL of the culture medium of each group was taken. Fluorescence image (7D)

See Figure 7. We optimize the conditions for effective transfection by adjusting the dose and time. CLSM and FACS analysis showed that the transfection efficiency of PPDP with a siPcsk9 concentration of 18.75nM was low, and the transfection efficiency of 150nM after 6h incubation was almost 100%. Higher concentrations of PPDP did not further significantly improve the transfection efficiency. (Figure 7A). At the same time, CLSM and FACS analysis showed that the transfection time was 9h, and the transfection efficiency was 99% at the highest. The longer the transfection time, the higher the transfection efficiency (Figure 7B). Therefore, we conducted further experiments under the conditions of an optimized siRNA concentration of 150 nM and 9 hours of transfection. We also analyzed the cellular uptake of other cell lines, namely alveolar macrophages (AMs), mouse leukemia monocyte macrophages (Raw 264.7) and mouse bone marrow mesenchymal stem cells (MBMSCs). The cell uptake rates of these cells were 9.04%, 23.0%, and 16%, respectively (Figure 7C). At the same time, in order to explore whether the weaker uptake of fluorescent PPDP by immune cells is due to its degradation function, we tested the PDPP in the supernatant of immune cells (AMs or Raw264.7 cells) and found that compared with Hepa1-6 cells, Cy5 The positive nanoparticles were about 4 times higher (Figure 7D). It is worth noting that both AMs and Raw 264.7 cells are immune cell lines with low cell uptake, indicating that biologically induced artificial platelets can avoid immune cell clearance, which is beneficial for in vivo applications.

Experimental example 3

4.1 Cy5-siPcsk9 is used to evaluate the endoplasmic/lysosome escape of CLSM.

After inoculating Hepa1-6 (1×10^5 cells/well) in a confocal small dish and incubating for 24h, cells containing 150nM Cy5-PPDP or PM/PLGA/Cy5-siPcsk9 were transfected and cultured at different time points ( 1, 3, 6, 9 and 12h), then washed twice with PBS and dyed with LysoTracker ^TM blue DND-22 (ThermoFisher Scientific, USA) at room temperature for 30 minutes according to the instructions, and the nanoparticles were displayed by confocal laser scanning The cell distribution of nanomaterials at different time points of the cells (see Figure 8A for the results).

4.2 Real-time fluorescent quantitative PCR (Quantitative Real-time PCR, qPCR) experiment, the specific steps are as follows: In the qPCR experiment, first inoculate Hepa1-6 cells into a 6-well plate with a density of 10^6 cells per well, at 2.0 mL was supplemented with 10% FBS and 1% penicillin/streptomycin in DMEM, and cultured at 37°C in a 5% CO ² humidified atmosphere for 24 hours. The medium was replaced with Opti-men serum-reduced medium containing PBS, siPcsk9, PPDL, PDP and Lipo2000/siPcsk9, where the siRNA concentration was equivalent to 150nM, and the cells were cultured for another 48h.

(1) Use Trizol (Invitrogen, USA) to isolate total RNA from cells

1) First, wash the cells twice with pre-cooled PBS, and then aspirate the remaining liquid as much as possible, add 400μL of Trizol-reagent, wash down the cells as much as possible, then transfer to a 1.5mL EP tube, and then add pre-cooled chloroform to each tube 80μL, cap the EP tube tightly and vortex for 30s (Note: chloroform: Trizol=1:5, v/v);

2) Leave it at room temperature for 2-3 minutes, after obvious stratification occurs, centrifuge at 12000rpm, 4℃ for 15min;

3) Use a 200μL volume pipette to transfer the supernatant to a new ribozyme-free EP tube (do not suck the protein and other impurities in the middle or lower layer, or re-centrifuge), and then add an equal volume of isopropanol (about 250μL), inverted more than ten times, let stand at room temperature for 10min;

4) Centrifuge at 12000 rpm and 4°C for 10 min. A white precipitate can be seen at the bottom of the EP tube. Remove the supernatant and place it on the filter paper carefully.

5) Then add 400μL of pre-cooled 75% alcohol to each tube (DEPC water: absolute ethanol = 1:3, v/v preparation), and carefully resuspend the pellet with a pipette;

6) Centrifuge at 12000rpm for 5min at 4℃, aspirate the supernatant, and be careful not to aspirate the white precipitate;

7) Then open the lid of the EP tube and place it in a fume hood for a few minutes. After drying, add 25μL of ribozyme-free water to each tube;

9) Nanodrop measures RNA concentration.

(2) Take total RNA for reverse transcription, use the stem-loop primers synthesized by Ruibo Company, use TaKaRa Reverse Transcription Kit (RR037A, Japan) for reverse transcription, and use SYBR reagent (Cat.172-5124, BioRad) for reverse transcription. Perform quantitative PCR analysis. The operation steps are the same as the instructions, and the Light cycler 480 system is used for operation.

(3) Data processing

Using the ΔΔCt method, ΔCt=(Ct target gene-Ct internal reference gene), ΔΔCt=ΔCt processed sample-ΔCt control sample, and the final result is 2-ΔΔCt. Determine the effect of the drug on the expression of specific PCSK9miRNAs in the cell. See Figure 8B for the results.

(4) The siRNA sequence is as follows:

siPcsk9 (siRNA targeting Pcsk9mRNA):

sense:5′-UUCCGAAUAAACUCCAGGCdTdT-3′, (SEQ ID NO.1)

anti-sense: 5′-GCCUGGAGUUUAUUCGGAAdTdT-3′, (SEQ ID NO.2)

siLuc (siRNA targeting luciferase mRNA):

sense:5′-CUUACGCUGAGUACUUCGAdTdT-3′,(SEQ ID NO.3)

anti-sense: 5′-UCGAAGUACUCAGCGUAAGdTdT-3′, (SEQ ID NO.4)

The primer sequences of the target gene PCSK9 and the internal reference gene GAPDH are as follows:

Pcsk9 Forward: GAGACCCAGAGGCTACAGATT, (SEQ ID NO.5)

Pcsk9 Reverse: AATGTACTCCACATGGGGCAA; (SEQ ID NO.6)

GAPDH Forward: TGCACCACCAACTGCTTAGC, (SEQ ID NO.7)

GAPDH Reverse: GGCATGGACTGTGGTCATGAG (SEQ ID NO. 8).

4.3 is a Western blot analysis experiment, the specific steps are as follows:

Western Blot Analysis (Western Blot)

First, inoculate Hepa1-6 cells into a 6-well plate with a density of 10^6 cells per well, in 2.0 mL of DMEM supplemented with 10% FBS and 1% penicillin/streptomycin, and at 37°C, 5% Cultivate for 24h in a CO _{2 humidified atmosphere.} The medium was replaced with Opti-men serum-reduced medium containing PBS, siPcsk9, PPDL, PDP and Lipo2000/siPcsk9, where the siRNA concentration was equivalent to 150nM, and the cells were cultured for another 48h.

(1) Protein extraction and concentration test

First, wash the cells gently with pre-chilled PBS, and add 90μL of RIPA Lysis Buffer (add complete protease inhibitor just before use). Use a cell scraper to gently scrape off the cells and transfer to a 1.5mL EP tube. Incubate on ice for 30 min (during this period, you can quickly reset on ice after vortexing for 5 seconds each time, repeat 3-5 times), then centrifuge at 12000 rpm, 4°C for 15 min, and transfer 80 μL of the supernatant to a new EP tube. Measure the concentration of each group of proteins according to the above-mentioned BCA reagent method, and add 5×loading buffer to mix well (final concentration is 1×), boil for 5min, cool on ice and store at -20°C.

(2) SDS-PAGE running glue, transfer film and exposure

1) Glue preparation: Glue is prepared according to the size of the protein, 10% rapid glue (BIO-RAD) is prepared and inserted into the comb, and it is allowed to stand at room temperature until solidified.

2) Sample loading: Put the solidified gel into the electrophoresis tank, and add the freshly prepared electrophoresis solution. Pull the comb gently, add Marker and sample to the sample hole, keep constant voltage 200V for electrophoresis, stop electrophoresis when bromophenol blue reaches the bottom of the separation gel.

3) Transfer membrane: After the electrophoresis is completed, take out the glue, discard the excess glue, cut the PVDF membrane to the same size as the glue, and soak the membrane in methanol for 5 minutes to activate the membrane. Put the sponge, filter paper, gel, PVDF membrane, filter paper, sponge in the transfer box in sequence to make a "sandwich", then drive away the bubbles, place it in the electrophoresis tank after clamping, and add an appropriate amount of freshly prepared Transfer membrane solution, place the electrophoresis tank on ice, and transfer membrane at a constant pressure of 100V for 2 hours.

4) Sealing: Rinse the protein-transferred PVDF membrane with TBST, transfer to an appropriate amount of 5% skimmed milk powder (with TBST, at least covering the membrane), and seal at room temperature under a shaker for 1 hour.

5) Apply antibody: Discard the blocking solution, wash the membrane 3 times with TBST on a shaker, 10 minutes each time, transfer the PVDF membrane to the pre-diluted primary antibody solution, PCSK9 (Abcam, 1:1000), GAPDH (Abcam) , 1:1000) incubate overnight at 4°C on a shaker. After the incubation, recover the primary antibody solution, wash the membrane with TBST 3 times, 10 min each time; then transfer the PVDF membrane to the diluted secondary antibody solution (1:5000), incubate on a shaker at room temperature for 2 hours, and then wash with TBST .

6) Exposure: Mix the solutions A and B in the developing reagent at a ratio of 1:1, and add them evenly to the surface of the membrane. After incubating for about 1 min, place in the exposure machine Amersham Imager 600 system (GE, USA) for automatic exposure, and save the data. The results are shown in Figure 8C.

Since the lysosomal escape of siRNA is a key process for effective gene silencing, we evaluated the lysosomal escape of Pcsk9 and the resulting gene silencing. The PPDP taken up by the cells was captured by lysosomes (Cy5-siPcsk9) (red fluorescence overlapped with lysosomal blue-labeled red fluorescence) after 1 h (Figure 8A). The profile analysis also confirmed that Cy5-siPcsk9 overlapped with lysosomes. After 9h, a large amount of Cy5-siPcsk9 (separation of red fluorescence and blue fluorescence) was separated from the lysosome, and the corresponding profile analysis also showed this. However, the nuclear structure without DOTAP (PLGA/siPcsk9) has a lower lysosomal escape efficiency within 9 hours, and DOTAP modification makes siRNA have better lysosomal escape ability. Real-time PCR detection showed that PCSK9 mRNA was down-regulated by about 66% through PPDP (Figure 8B). However, the control group, PPDL, siPcsk9, PPD and PBS, did not change significantly in the down-regulation of Pcsk9 mRNA (Figure 8B). Compared with Lipo2000/siPcsk9, PPDP also showed an impressive gene silencing effect (66% vs. 74%) (Figure 8B). WB analysis confirmed that PPDP significantly inhibited the expression of PCSK9 (Figure 8C). We designed a nanostructure to improve lysosomal escape and specifically silence the targeted gene Pcsk9.

4.4 Hemolysis experiment and live and dead cell staining, the specific steps are as follows:

The specific steps of the hemolysis experiment are as follows:

Take fresh whole blood from C57 mice and add EDTA-2Na anticoagulant. The blood was separated at 5000 rpm for 5 minutes. Discard the upper layer of plasma and white blood cells, collect the red blood cells, wash the red blood cells with PBS buffer for several times until no color is found in the supernatant. Collect the bottom RBC pellet and dilute it with PBS to a 2% solution, such as adding 20 μL to 980 μL of PBS. The red blood cell solution and the PPDP solution prepared above are mixed to form a 1% RBC solution. The final siPcsk9 concentrations were 18.75, 37.5, 75, 150 and 300nM, respectively. 0.50 mL of red blood cell suspension was mixed with 0.50 mL of analogs, and 0.50 mL of PPDP, PPDL, PDP and Lipo2000/siPcsk9 were added to 0.50 mL of red blood cell suspension. The added PBS and 1.0% Triton X-100 solution were used as negative control and positive control, respectively. The sample was incubated at 37°C for 1 h, centrifuged at 10^4 rpm for 10 min, and then 0.10 ml of supernatant was added to a 96-well plate. The absorbance of hemoglobin at 540nm was recorded. The hemolysis rate is calculated as follows: hemolysis rate%=[(At-Anc)/(Apc-Anc)]×100%. At, the absorbance of the test substance; Anc, the absorbance of the negative control; Apc, the absorbance of the positive control

The specific steps for staining live and dead cells are as follows:

In order to evaluate the cytotoxicity of PPDP, the medium was replaced with freshly prepared complete DMEM containing PPDP, and the final siRNA concentration ranged from 18.75 to 300 nM. Cells treated with PBS or 1% Triton X-100 were used as negative control or positive control. After 24 hours of incubation, the cells were stained with a live/dead viability/cytotoxicity kit and imaged with CLSM. The cytotoxicity of other nanoparticles was also evaluated, such as Lipo2000/siPCSK9, PPDL, and PDP, where the siRNA concentration is equivalent to 150nM. See Figure 9 for the result.

To evaluate the biocompatibility, we analyzed the hemolysis and cytotoxicity of PPDP. Neither PPDP nor uncoated nanoparticles caused any significant hemolytic toxicity at working concentrations (Figures 9A and 9B), which can be confirmed by the live/dead assay of CLSM (Figure 9C). However, the use of commercially available Lipofectamine 2000 will have significant hemolysis (Figure 9D and 9E), which indicates that PPDP causes lower hemolysis and cytotoxicity, which is essential for in vivo applications. In vitro CLSM also shows that the commercially available Lipofectamine 2000 phase It caused higher cytotoxicity than PPDP (Figure 9F).

4.5 is the in vivo tracking study and the in vivo pharmacokinetic study, the specific steps are as follows:

The specific steps of the in vivo tracking study are as follows:

In order to investigate the in vivo enrichment of materials, we prepared Cy5-PDP and Cy5-PPDP preparations for in vivo tracing studies. The material preparation was injected intravenously through the tail vein of C57BL/6 mice. During all operations, the mice were anesthetized with 2% isoflurane. The imaging system (CRi Maestro, USA) is also used for tracking. The time points were set to 1, 6, 12, 24, 48, 72h. After in vivo tracking, the mice were sacrificed, and the main organs were extracted and imaged. Fluorescence analysis uses Maestro V3.0.A software.

In vivo pharmacokinetics study, the specific steps are as follows:

The purchased 10 female C57BL/6 (weight 18-20g) were randomly divided into 2 groups (PDP and PPDP). PDP and PPDP are synthesized in the above manner, and both are labeled with 1,1'-dioctadecyl-3,3,3',3'-tetramethylindole dicarbocyanine perchlorate (DiD), which stimulates The wavelength and emission wavelength are 644/665nm. Observe whether the C57BL/6 mice have hunched back, sneezing, convulsions and other abnormal conditions for a week. After the observation is not abnormal, set the time point 0.5,1,2,4,8,24 through tail vein injection (each containing DiD 20μg) ,and 48h, at each time node, take 50μL of mouse whole blood into an anticoagulation tube containing EDTA-2Na, complete the blood collection at 48h, and then immediately euthanize the animal, and then remove the organs of each mouse (Including heart, liver, spleen, lung and kidney).

Processing the blood sample: Mix the sample with 0.1 mM EDTA and perform three repeated freezing and thawing processes to ensure that the cells are completely destroyed and the nanoparticles are released. Then, add 500μL of dichloromethane and immediately vortex for 30s, centrifuge at 20000g at 4°C for 30min, and transfer the supernatant to a new test tube. The blank blood sample treatment is consistent with this method. Subsequently, the fluorescence intensity was measured with an RF-6000 fluorescence spectrophotometer (Shimadzu, Japan).

The establishment of the DiD standard curve: DiD blood solution was diluted to 20, 15, 10, 7.5, 5, 0.75 μg/mL, and then the fluorescence intensity was measured with an RF-6000 fluorescence spectrophotometer (Shimadzu, Japan).

Organ treatment: Put the organs of each mouse in each group into 2mL EP tubes, add 1mL water and homogenize, centrifuge at 20000g at 4℃ for 30min, transfer the supernatant to a new EP tube, and use RF-6000 fluorescence spectrophotometry A meter (Shimadzu, Japan) detects the fluorescence intensity. See Figure 10 for the results.

After injecting the PPDPs containing Cy5-siPcsk9 into the mice, the imaging system was used to track the distribution of nanoparticles in the body. We found that after 24h, the cumulative amount of PPDP in the liver was greater than that of naked nanoparticles (Figure 10A). In vitro imaging of major organs showed that the PPDP retained in the liver was about 20 times higher than that of other organs (Figure 10B). In addition, the liver of PPDP-administered mice increased twice as much as that of PDP mice (Figure 10B). Interestingly, PPDP showed that the circulation time of mice was much longer than that of PDP (Figure 10C).

4.6 is the expression levels of PCSK9 and LDLR in the liver of mice, and the specific steps are the same as the Western blot analysis in Figure 11. Purchased 30 female C57BL/6 mice (weight 18-20g), randomly divided into 6 groups: Saline group, siPcsk9 group, PP group, PPDL group, Lipo2000/siPcsk9 group, PPDP group, PPDP is the experimental group, Lipo2000/ siPcsk9 is the positive control group, while PPDL is the control group used to detect the specific silencing effect of siCPSK9, siPcsk9 is the unmodified drug control group, the PP group is the drug-free control group, and PBS is the blank control group. Tail vein administration is administered every 5 days. After 32 days of tail vein administration, 200 μL of whole blood from each mouse is collected into a 1.5 mL EP tube, and after it has clotted, it is centrifuged at 3500 rpm for 20 minutes, and the upper layer of serum is transferred to a new centrifuge tube. , Preserved at -80°C for later use, and then euthanized. The heart, liver, spleen, lung and kidney of each mouse were stripped off. See Figure 11 for the result.

Figure 11: We evaluated the effects of PPDPs in vivo. WB analysis showed that after PPDP treatment, the level of PCSK9 in liver tissue was effectively suppressed (Figure 11A). Consistent with this, the level of low-density lipoprotein receptors in liver tissue was high. In the control group (Figure 11B).

4.7 is the LDLR western blot analysis of isolated hepatocytes and Kupffer cells in mice. The specific steps are as follows:

1) C57BL/6 mice and C57BL/6 mice treated with normal saline were taken as controls 32 days after PPDP administration.

2) The mice were anesthetized, and the liver was perfused through the portal vein with 20 mL 0.5 mM EDTA-free Hank balanced salt solution. Next, 20 mL of Hanks' balanced salt solution containing 0.05% collagenase and 5 mM calcium, which has been pre-warmed, was infused into the liver.

3) Collect liver tissue and cut it, then soak it in collagenase solution at 37°C for 20 minutes, and filter the suspension with a cell filter (BD Biosciences, USA). The filtrate was centrifuged at a speed of 50 g for 5 min to obtain hepatocytes in the pellet.

4) In order to obtain Kupffer cells, the supernatant was centrifuged at 330g for 10 min. The cell pellet was resuspended in PBS, and then transferred to Percoll mixed solution (30% and 70% Percoll in PBS). The mixture was centrifuged at 1600 g for 30 min, and Kupffer cells were recovered at the interface of 30% and 70% components, and washed three times with ice-cold PBS. Analyze hepatocytes and Kupffer cells by white blood cell counting method. The results are shown in Figure 12 and Figure 13.

The corresponding profile analysis also shows this. However, the nuclear structure without DOTAP (PLGA/siPcsk9) has a lower lysosomal escape efficiency within 9 hours, and DOTAP modification makes siRNA have better lysosomal escape ability. Real-time PCR detection showed that PCSK9 mRNA was down-regulated by about 66% through PPDP (Figure 8B). However, the control group, PPDL, siPcsk9, PPD and PBS, did not change significantly in the down-regulation of Pcsk9 mRNA (Figure 8B). Compared with Lipo2000/siPcsk9, PPDP also showed an impressive gene silencing effect (66% vs. 74%) (Figure 8B). WB analysis confirmed that PPDP significantly inhibited the expression of PCSK9 (Figure 8C). We designed a nanostructure to improve lysosomal escape and specifically silence the targeted gene Pcsk9.

Figure 9: To evaluate the biocompatibility, we analyzed the hemolysis and cytotoxicity of PPDP. Neither PPDP nor uncoated nanoparticles caused any significant hemolytic toxicity at working concentrations (Figures 9A and 9B), which can be confirmed by the live/dead assay of CLSM (Figure 9C). However, the use of commercially available Lipofectamine 2000 will have significant hemolysis (Figure 9D and 9E), which indicates that PPDP causes lower hemolysis and cytotoxicity, which is essential for in vivo applications. In vitro CLSM also shows that the commercially available Lipofectamine 2000 phase It caused higher cytotoxicity than PPDP (Figure 9F).

Figure 10: After injection of PPDPs containing Cy5-siPcsk9 into mice, the imaging system was used to track the distribution of nanoparticles in the body. We found that after 24h, the cumulative amount of PPDP in the liver was greater than that of naked nanoparticles (Figure 10A). In vitro imaging of major organs showed that the PPDP retained in the liver was about 20 times higher than that of other organs (Figure 10B). In addition, the liver of PPDP-administered mice increased twice as much as that of PDP mice (Figure 10B). Interestingly, PPDP showed that the circulation time of mice was much longer than that of PDP (Figure 10C).

Figure 11: We evaluated the effects of PPDPs in vivo. WB analysis showed that after PPDP treatment, the level of PCSK9 in liver tissue was effectively suppressed (Figure 11A). Consistent with this, the level of low-density lipoprotein receptors in liver tissue was high. In the control group (Figure 11B).

Figure 12: In order to clarify whether PPDP is taken up by immune cells such as liver macrophages, Kupffer cells, we analyzed LDLR in two cell lines with WB and found that LDLR in liver cells increased significantly after PPDP administration (Figure 12). But the LDLR of Kupffer cells did not change much.

Hematoxylin-eosin (HE) staining of the extracted tissues showed that PPDP has no obvious toxicity to mice (Figure 13). In vivo experiments have shown that PPDP can safely and effectively reduce the expression of PCSK9, and its mechanism of action is related to the up-regulation of LDLR and the decrease of LDL-C.

Although the present invention has been described to a certain extent, it is obvious that various conditions can be appropriately changed without departing from the spirit and scope of the present invention. It can be understood that the present invention is not limited to the embodiments, but belongs to the scope of the claims, which includes equivalent substitutions of each of the factors.

Claims (18)

1. An siRNA capable of silencing the PCSK9 protein is characterized in that the amino acid sequence of the sense strand of the siRNA is 5'-UUCCGAAUAAACUCCAGGC-3', and the amino acid sequence of the antisense strand is 5'-GCCUGGAGUUUAUUCGGAA-3'.
2. The siRNA capable of silencing PCSK9 protein according to claim 1, wherein the 3'end of the sense strand and/or antisense strand of the siRNA is further modified with dTdT.
3. A nano-delivery system capable of silencing PCSK9 protein is characterized in that the nano-system is a nanocapsule camouflaged by a biological membrane that wraps siRNA capable of silencing PCSK9 protein.
4. The nano-delivery system capable of silencing PCSK9 protein according to claim 3, wherein the siRNA is according to claim 1 or 2.
5. The nano-delivery system according to claim 3, wherein the biofilm is selected from one or more of the following: platelet membrane, red blood cell membrane, bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, and macrophages; Preferably, it is a platelet membrane.
6. The nano delivery system according to claim 3, wherein the material of the nanocapsule is selected from one or more of the following: PLGA, DOTAP, polyurethane, hyaluronic acid, chitosan, polylactic acid; preferably For PLGA and DOTAP.
7. The nano-delivery system according to claim 6, wherein the mass ratio of PLGA to DOTAP in the nanocapsule is 20:1-20:11, preferably 20:1-20:5, most preferably 20 :3.
8. The nano-delivery system according to any one of claims 3 to 7, wherein the mass parts of the biomembrane protein, nanocapsules and siRNA are 1-50 parts of biomembrane protein, and 1-50 parts of nanocapsules. , 0.1-10 parts of siRNA; preferably 10-30 parts of biofilm, 10-30 parts of nanocapsule, 0.5-2 parts of siRNA; most preferably 23 parts of biofilm, 23 parts of nanocapsule, and 1 part of siRNA;

   Preferably, when the nanocapsule material is selected from PLGA and DOTAP, the mass ratio of the biofilm to the nanocapsule is 1:1.
9. The method for preparing a nano delivery system according to any one of claims 3 to 7, wherein the method comprises the following steps:

   (1) Prepare siRNA solution;

   (2) Drop the siRNA solution prepared in step (1) into the solution of nanocapsule material;

   (3) Add the mixed solution obtained in step (2) dropwise to the solvent, ultrasonically stir and centrifuge to remove the supernatant, resuspend the obtained precipitate, and resuspend to obtain a resuspension;

   (4) Mix the resuspension solution obtained in step (3) with the biofilm, and sonicate to obtain the nano-delivery system.
10. The preparation method according to claim 9, wherein in the step (3), the solvent is selected from one or more of the following: PVA aqueous solution, Tween 20 aqueous solution, Tween 80 aqueous solution; preferably PVA The aqueous solution is more preferably a 1%-10% PVA aqueous solution, and most preferably a 2% PVA aqueous solution.
11. A medicine for lowering low-density lipoprotein cholesterol, characterized in that the medicine comprises:

    SiRNA capable of silencing PCSK9 protein; and/or

    The nano delivery system of any one of claims 3 to 7.
12. The medicine for down-regulating low-density lipoprotein cholesterol according to claim 11, wherein the siRNA is according to claim 1 or 2.
13. Application of the siRNA according to claim 1 or 2 and/or the nano delivery system according to any one of claims 3 to 7 in the preparation of a medicine for treating hypercholesterolemia.
14. A drug nano-delivery system is characterized in that it is composed of a drug-loaded nanocapsule and a biofilm that wraps the nanocapsule, and the biofilm is a platelet membrane or a red blood cell membrane.
15. The drug nano-delivery system according to claim 14, wherein the drug is siRNA, further preferably siRNA capable of silencing PCSK9 protein, more preferably as shown in SEQ ID NO. 1 and SEQ ID NO. 2. siRNA.
16. The drug nano-delivery system according to claim 14 or 15, wherein the material for preparing the nanocapsules is selected from one or more of the following: PLGA, DOTAP, polyurethane, hyaluronic acid, chitosan, Polylactic acid; preferably PLGA and DOTAP.
17. The nano delivery system according to claim 16, wherein the mass ratio of PLGA to DOTAP in the nanocapsule is 20:1 to 20:11, preferably 20:1 to 20:5, most preferably 20 :3.
18. The nano-delivery system according to claim 14, wherein the mass parts of the biofilm protein, nanocapsules and drugs are 1-50 parts of biofilm, 1-50 parts of nanocapsules, and 0.1-10 parts of siRNA ; Preferably it is 10-30 parts of biomembrane, 10-30 parts of nanocapsule, 0.5-2 parts of siRNA; most preferably 23 parts of biomembrane, 23 parts of nanocapsule, and 1 part of siRNA;

    Preferably, when the nanocapsule material is selected from PLGA and DOTAP, the mass ratio of the biofilm to the nanocapsule is 1:1.

Images