WO2021075645A1 - Pharmaceutical composition for preventing or treating familial adenomatous polyposis, comprising niclosamide and metformin - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for treating familial adenomatous polyposis by concomitantly administering niclosamide or a pharmaceutically acceptable salt thereof, and metformin or a pharmaceutically acceptable salt thereof. The pharmaceutical composition of the present invention shows a significant synergy effect for preventing or treating familial adenomatous polyposis, due to the concomitant administration of niclosamide or a pharmaceutically acceptable salt thereof, and metformin or a pharmaceutically acceptable salt thereof.

Description

Pharmaceutical composition for the prevention or treatment of familial adenomatous polyposis containing niclosamide and metformin

This application claims priority based on Korean Application No. 10-2019-0128674 filed on October 16, 2019, and all contents disclosed in the specification and drawings of the application are incorporated herein by reference.

The present invention relates to a pharmaceutical composition for treating or preventing familial adenomatous polyposis (FAP). The invention also relates to a method of treating or preventing familial adenomatous polyposis.

Familial adenomatous polyposis is an autosomal dominant disease caused by mutations in the gene of Adenomatous Polyposis Coli (APC) located on chromosome 5. Due to the mutation of the APC gene, the progression of the adenoma-cancer continuum proceeds early, and a myriad of polyps (adenomas, adenomas) can occur even in young patients in their 10s and 20s. In addition, adenomatous polyposis can also occur in the upper gastrointestinal tract, especially in the duodenum, so periodic monitoring through an upper endoscope is required.

Epithelial-mesenchymal transition (EMT) is a biological mechanism by which cancer cells of epithelial origin lose intrinsic epithelial properties such as cell-cell adhesion changes, cell polarity and metastaticity, invasiveness, and increased mobility. Most solid tumors are carcinomas derived from epithelial cells. Carcinoma cells are involved in invasion, vascular invasion and circulation near the primary tumor by acquiring mobility and reducing cell-cell adhesion to adjacent cells, which migrate and colonize distant organs to form macroscopic metastases. Since 90% of cancer patients die from metastasis and recurrence, not primary tumors, prevention of cancer metastasis is very important for cancer treatment. EMT is associated with penetration and metastasis administered by Wnt dependent Snail expression. Snail, a zinc-finger transcription factor, acts as a transcription factor inhibitor of E-cadherin in tumor formation and development and induces EMT. Thus, decreased expression of E-cadherin is a predictor of malignant tumors. When MCF7 cells are overexpressed with Snail, cell invasion increases and the expression of E-cadherin decreases. Even when Wnt is overexpressed, Snail increases the expression of E-cadherin. These results indicate that Snail plays the role of an inducer in EMT.

Axin2 plays an important role in the Snail-mediated EMT process via the Wnt pathway. GSK3β, which induces the degradation of Snail, emerges from the nucleus, stabilizes the nucleus and induces EMT. GSK3β is found in the cytoplasm by Axin2 and increases the intranuclear expression of Snail. Snail stabilized in the nucleus acts as an inhibitor of transcription of E-cadherin and induces EMT. Therefore, Axin2 plays a very important role in regulating Snail-mediated EMT through Wnt signaling. On the other hand, the Hippo pathway is a highly conserved pathway that regulates organ size, homeostasis, and cancer development, and is highly conserved in mammals. In mammals, the Hippo pathway is Mammalian sterile 20-like 1/2 (MST1/2), Salvador (SAV1), large tumor suppressor homolog 1/2 (LATS1/2), and yes-related. It consists of a protein (YAP), a transcriptional co-activator with PDZ binding motif (TAZ), and a TEA domain family member (TEAD).

When the Hippo pathway is activated, the MST1/2 kinase binds to SAV1 and phosphorylates LATS1/2 to activate LATS1/2. Activated LATS1/2 phosphorylates YAP and then activates YAP to induce cytoplasmic sequestration and degradation. When the Hippo pathway is activated, phosphorylation of YAP is reduced and remains in the nucleus, and YAP migrates into the nucleus and binds to the transcriptional enhancer factor (TEF) family of TEAD to express the target gene. In normal cells, the proliferation of intercellular contact cells is limited by the Hippo pathway. However, in the case of more than contact inhibition such as cancer cells, the Hippo pathway is inhibited and the size of individual and cell growth cannot be controlled, resulting in inhibition of excessive cell proliferation and cell death, thereby contributing to tumor formation.

In previous studies involving the Wnt pathway along with the Hippo-YAP pathway during cancer progression, it has been reported that Hippo-YAP signaling inhibits Wnt signaling. However, in a recent study, Wnt signaling was reported to be an important factor in regulating YAP through Dishevelled (DVL). DVL is an activator of Wnt signaling, binds to phosphorylated YAP, and then transports YAP to the cytoplasm to inhibit YAP activation. When the tumor suppressor p53 or LKB1 axis is normal, DVL, an activator of Wnt signaling, can inhibit the extracellular transport of YAP, but when the p53 or LKB1 axis is defective, the Wnt and Hippo-YAP pathways simultaneously grow and grow in size. Adjust. When analyzing the 20-year survival rate of breast cancer patients, when the YAP target gene, connective tissue growth factor (CTGF), and the Wnt signaling target gene Axin2 were simultaneously expressed, the mutation of the p53 gene had a poorer prognosis compared to the case without the mutation. . Abnormal activation of Wnt and Hippo-YAP signaling during cancer progression may be an important biomarker in cancer predicting cancer prognosis.

Chemoprevention refers to preventing or prolonging the occurrence of cancer or precancerous lesions by using drugs or natural substances. Because FAP patients develop a large number of polyps, they can be good targets for chemoprophylaxis. When chemoprophylaxis is performed on FAP patients, the effect of inhibiting the occurrence and proliferation of adenomas in the colon or rectum and preventing the occurrence of adenomas in other organs (eg, duodenum, etc.) can be expected. have.

To date, the chemoprophylactic drugs mainly studied in FAP patients are non-steroidal anti-inflammatory drugs (NSAIDs). NSAIDs inhibit cyclooxygenase, which converts arachidonic acid to prostaglandin. Prostaglandins play a major role in the adenoma-cancer process, which changes cell adhesion, inhibits apoptosis, or promotes angiogenesis. Cyclooxygenases include COX-1 and COX-2, and COX-2 is mainly involved in the development and progression of adenomas. In a randomized, double-blind, placebo-controlled study of 22 FAP patients, there was a significant decrease in the number and width of polyps when 150 mg of sulindac was administered twice a day (bid) for 9 months. When 18 patients who did not undergo surgery were analyzed, the effect persisted for up to 9 months even after stopping the drug. Sullindac significantly inhibited the recurrence of rectal adenoma even in patients with rectal left after surgery, but the effect of preventing the progression of cancer in the end has not been proven. Selective Cox-2 inhibitors were used as chemoprophylaxis to prevent side effects of the digestive system caused by sulindak. In a double-blind, placebo-controlled study of 77 FAP patients, when celecoxib 100mg or 400mg bid or placebo was administered for 6 months, the number of polyps in patients receiving celecoxib 400mg was compared to placebo group. It decreased by 28% (p=0.003), and the size of the polyp decreased by 30.7% (p=0.001). The selective Cox-2 inhibitor showed a clear effect without side effects of the digestive system, but its use was limited due to the occurrence of cardiac and cerebrovascular toxicity in proportion to the dose. In addition, a 6-month combination of 150mg bid and 75mg of erlotinib (EGFR tyrosine kinase inhibitor), which has been used as an anticancer drug, reduced colon polyps by 69.4% compared to the placebo group. However, the administration of erlotinib causes side effects such as skin lesions, oral mucositis, or diarrhea, and further studies on the effect of dose adjustment and long-term administration are required.

Meanwhile, metformin is a biguanide derivative and is widely used as a therapeutic agent for type 2 diabetes. Metformin inhibits the production of glucose in the liver and improves insulin resistance in peripheral tissues. Because metformin does not directly stimulate insulin secretion, the side effects of hypoglycemia are low, and there is no effect of lowering blood sugar in normal people. In the Diabetes Prevention Program (DPP), which was developed to prevent the occurrence of diabetes in patients with elevated blood sugar or glucose tolerance, no serious side effects occurred when metformin was administered for 7-8 years. The most common side effects are gastrointestinal symptoms such as nausea, epigastric discomfort, diarrhea, or constipation. About 4% of patients stopped taking the drug due to side effects. However, most of the symptoms of gastrointestinal side effects recover through an adaptation period of about 1 month. In addition, metformin may show slight weight loss in the dose group. Also, because metformin does not directly stimulate insulin secretion, it does not cause hypoglycemia in non-diabetic adults.

In addition, niclosamide was developed in 1958 and is one of the most effective and safe medicines on the list of essential medicines of the World Health Organization (WHO). have. As recommended in the treatment of parasite infections, according to various parasites, a single dose of 2g for adults is recommended for up to 2 weeks. Niclosamide has been widely used all over the world, and it is known that the side effects of oral administration are very small (1-4%). Predictable side effects include nausea, abdominal pain, constipation, headache, loss of appetite, diarrhea, dizziness, or itching, and no serious side effects have been reported. And most of these symptoms are side effects related to the digestive system, and reversible recovery is possible by stopping drug administration. It is also introduced as a very safe drug (quite free of undesirable effects) in the world's most widely used pharmacology school textbook (Goodman and Gilman's, 8 ^{th ed).} In 2002, the World Health Organization's'WHO Specifications and Evaluation for Public Health Pesticides' report revealed the results of a toxicity test after long-term ingestion of niclosamide. The dose of No-Observed-Adverse-Effect-Level) corresponded to 2000 ppm (2000 mg/kg), and the NOAEL when ingested into mice for 104 weeks was 200 ppm (200 mg/kg). When comparing the lifespan of rats or mice and humans, 24 months of rats correspond to 60 years of human lifespan, and 104 weeks of mice correspond to about 70 years of human lifespan. Niclosamide used in the above clinical study is 650 mg, which corresponds to approximately 10.8 mg/kg (assuming 60 kg based on the average body weight), so the problem of toxicity after 6 months intake at 10.8 mg/kg/day in the human body is expected to be very slight. I can judge. In addition, according to the WHO data and various other toxicity data, it is known that there is no genotoxicity or carinogenecity caused by niclosamide. For example, no evidence of cancer incidence was found at 5000 ppm (5000 mg/kg), 104 weeks treatment in mice and rats. There was no possibility of embrotoxic or teratogenic effects with large doses of niclosamide (1000 mg/kg) for various gestational cycles in rabbits.

That is, metformin and niclosamide are known to be relatively safe drugs to date, and are expected to be more suitable than conventional drugs in terms of the safety of chemoprevention therapy. However, there are no studies on the effects of metformin or niclosamide as chemoprophylaxis in patients with FAP.

In conclusion, although the effectiveness of some drugs in the treatment of FAP has been proven to date, there is no globally approved drug due to the aforementioned side effects, and some very limited sulindac or celecoxib are used. Therefore, in order to treat FAP, new chemoprophylactic drugs that are safe and effective are needed.

The problem to be solved by the present invention is to provide a pharmaceutical composition having an excellent preventive or therapeutic effect for familial adenomatous polyposis.

Another problem to be solved by the present invention is to provide an effective prevention or treatment method for familial adenomatous polyposis.

In the incidence and progression of familial adenomatous polyposis, since various signaling systems related to cell or tumor proliferation are affected through complex interactions such as feedback, targeting any one signaling molecule has no tumor suppression effect or It may appear insignificant. As a result of the present inventors' diligent efforts to find a treatment for familial adenomatous polyposis, (a) niclosamide or a pharmaceutically acceptable salt thereof and (b) metformin or a pharmaceutically acceptable salt thereof are used in combination to treat FAP. Or, it was surprisingly discovered that the preventive effect was significantly increased.

This synergistic effect is based on the experimental results confirmed by the present inventors to be described later, as the Axin2-Wnt signaling inhibitory effect of niclosamide and the AMPK-mTOR signaling inhibitory effect of metformin act simultaneously, and are related to the proliferation of adenomatic polyps. It is presumed to be due to the fact that the two representative signal transduction systems are simultaneously suppressed and the two signal transduction systems and the Hipp-YAP pathway can interact, but the present invention related to the synergistic effect of these combinations confirmed through various experimental results It is not limited to these theoretical mechanisms.

Specifically, the present inventors confirmed that Wnt and Hippo-YAP signals are activated when there is a mutation of APC, and as a result of confirming the expression of Axin2, a key substance for Wnt signaling, the expression of Axin2 is high in cell lines with APC mutations. I did. Among them, when the DLD-1 and SW480 cell lines were selected to suppress Axin2 expression, the activation of YAP was observed to increase, and the same result was also observed when niclosamide, which inhibits Axin2-GSK3 binding, was treated. Inhibition of Axin2 expression increased the expression of YAP in the nucleus and decreased the expression of phosphorylated YAP (S127).

On the other hand, when metformin was treated, the activation of YAP was inhibited and the expressions of Snail-mediated EMT-related factors, Axin2 and Snail, were also reduced. That is, when niclosamide and metformin were used in combination, metformin supplemented the YAP activation function of niclosamide, regulated AMPK-mTOR signal related to cancer cell growth, and effectively suppressed Snail-mediated EMT. Furthermore, through animal clinical trials using APC-min mice, the combination of niclosamide and metformin significantly reduced the number of small intestine polyps compared to each single administration, resulting in a synergistic effect in the prevention or treatment of familial adenomatic polyps. It was confirmed that it exerts.

The present invention provides a pharmaceutical composition for the prevention or treatment of familial adenomatous polyposis comprising (a) niclosamide or a pharmaceutically acceptable salt thereof and (b) metformin or a pharmaceutically acceptable salt thereof as an active ingredient do.

In one embodiment, the pharmaceutical composition of the present invention may include niclosamide or a pharmaceutically acceptable salt thereof, and metformin or a pharmaceutically acceptable salt thereof. Salts suitable as the pharmaceutically acceptable salts are not particularly limited as those commonly used in the art to which the present invention pertains, such as acid or base addition salts.

In one embodiment, the pharmaceutically acceptable salt of niclosamide may include a metal salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or acidic amino acid, and the like. Suitable metal salts include alkali metal salts such as sodium salts, potassium salts and the like; Alkaline earth metal salts such as calcium salt, magnesium salt, and barium salt; Aluminum salts and the like may be included. Salts with organic bases include trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N,N-dibenzyl Salts such as ethylenediamine may be included. Salts with inorganic acids may include salts of hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, and the like. Salts with organic acids may include salts of formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, and the like. Salts with basic amino acids may include salts with arginine, lysine, ornithine. Salts with acidic amino acids may include salts with aspartic acid, glutamic acid, and the like.

In one embodiment, the pharmaceutically acceptable salt of metformin may include salts with organic acids, inorganic acids, or acidic amino acids. Salts with organic acids include acetic acid, propionic acid, isobutyl acid, oxalic acid, maleic acid, malonic acid, succinic acid, suberic acid, fumaric acid, manderic acid, phthalic acid, benzenesulphonic, p-tolylsulphonic, citric acid, tartaric acid. , A salt with methanesulphonic acid or an analog thereof, etc. may be included. Salts with inorganic acids may include salts with hydrochloric acid, bromic acid, nitric acid, carbonic acid, monohydrocarbon acid, phosphoric acid, monohydrogen phosphoric acid, dihydrogenphosphoric acid, sulfuric acid, monohydrogen sulfuric acid, hydrogen iodide or phosphorous acid, and analogs thereof. Salts with acidic amino acids may include salts with aspartic acid, glutamic acid, and the like.

In one embodiment, niclosamide or a pharmaceutically acceptable salt thereof of the pharmaceutical composition of the present invention; And the molar ratio of metformin or a pharmaceutically acceptable salt thereof is 1: 10 to 10000, preferably 1: 100 to 7000, more preferably 1: 2000 to 4000 (Niclosamide or a pharmaceutically acceptable salt thereof: metformin or its Pharmaceutically acceptable salt). When the pharmaceutical composition of the present invention contains niclosamide and metformin in the specific molar ratio, the effect of preventing or treating familial adenomatic polyposis may be remarkably increased.

In another aspect, the present invention provides a therapeutically effective amount of (a) niclosamide or a pharmaceutically acceptable salt thereof, (b) a therapeutically effective amount of metformin or a pharmaceutically acceptable salt thereof, and (c) a pharmaceutical. It provides a pharmaceutical composition comprising an acceptable carrier.

"Effective amount" as used herein destroys, transforms, controls, or eliminates familial adenomatic polyps; Slowing down or minimizing the expansion of familial adenomatic polyps; Or it refers to the amount of niclosamide and metformin sufficient to provide a therapeutic benefit in the treatment or management of familial adenomatous polyposis. "Effective amount" also refers to the amount of niclosamide and metformin sufficient to cause the death of familial adenomatic polyp cells. "Effective amount" also refers to an amount sufficient to inhibit or reduce the activity of familial adenomatic polyps, either in vitro or in vivo.

In another embodiment, the present invention provides a therapeutically effective amount of niclosamide or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of metformin or a pharmaceutically acceptable salt thereof, to an individual in need thereof. It provides a method of treating or preventing familial adenomatous polyposis comprising a. In another aspect, the subject is a human. In another embodiment, the method exhibits the effect of preventing or treating familial adenomatic polyposis through inhibition of Wnt/YAP/mTOR signaling and Snail-mediated epithelial mesenchymal transition (EMT). In another embodiment, the familial adenomatous polyposis treated or prevented by the method is a familial adenomatous polyposis caused by mutations in the APC (adenomatous polyposis coli) gene.

In another aspect, the present invention provides niclosamide or a pharmaceutically acceptable salt thereof; And it provides a kit for the prevention or treatment of familial adenomatous polyposis comprising metformin or a pharmaceutically acceptable salt thereof as an active ingredient. In another embodiment, the kit refers to a set comprising a composition and accessories necessary for the prevention or treatment of familial adenomatous polyposis. In another embodiment, the accessory included in the kit is a tool or device commonly used in the art for the prevention or treatment of familial adenomatous polyposis. In another aspect, niclosamide or a pharmaceutically acceptable salt thereof included in the kit; And metformin or a pharmaceutically acceptable salt thereof are administered simultaneously or sequentially. In another embodiment, the kit additionally includes an instruction for taking any one or more selected from the group consisting of the amount of the active ingredients, the route of administration, the number of administrations, and indications (familial adenomatic polyposis).

In another embodiment, the kit exhibits an effect of preventing or treating familial adenomatic polyposis through inhibition of Wnt/YAP/mTOR signaling and Snail-mediated epithelial mesenchymal transition (EMT). In another embodiment, the familial adenomatous polyposis treated or prevented by the kit is a familial adenomatous polyposis caused by mutations in the APC (adenomatous polyposis coli) gene.

That is, the present invention provides a pharmaceutical use, characterized in that niclosamide or a pharmaceutically acceptable salt thereof, and metformin or a pharmaceutically acceptable salt thereof are used as active ingredients. In one aspect, the pharmaceutical use of the present invention is for the treatment or prophylaxis of familial adenomatous polyposis as described herein. In another embodiment, the pharmaceutical use shows the effect of preventing or treating familial adenomatous polyposis through inhibition of Wnt/YAP/mTOR signaling and Snail-mediated epithelial mesenchymal transition (EMT). In another embodiment, the familial adenomatous polyposis in the pharmaceutical use is a familial adenomatous polyposis caused by mutation of the APC (adenomatous polyposis coli) gene.

In the present invention, "prevention" refers to any action that delays the development, growth, and proliferation of familial adenomatic polyps by administration of the composition of the present invention.

In the present invention, "treatment" refers to any action that improves or beneficially alters familial adenomatic polyp by inhibiting the growth and proliferation of familial adenomatal polyp by administration of the composition of the present invention.

In one embodiment, niclosamide of the present invention or a pharmaceutically acceptable salt thereof, and metformin or a pharmaceutically acceptable salt thereof are generally administered in a therapeutically effective amount. Niclosamide or a pharmaceutically acceptable salt thereof of the present invention, and metformin or a pharmaceutically acceptable salt thereof are in the form of a pharmaceutical composition suitable for this route by any suitable route, and effective administration for the intended treatment. It can be administered in amounts.

In one embodiment, the effective dosage of niclosamide or a pharmaceutically acceptable salt thereof is generally about 0.0001 to about 200 mg/kg body weight/day, preferably about 0.001 to about 100 mg/day, in single or divided doses. kg/day. In addition, the effective dosage of metformin or a pharmaceutically acceptable salt thereof is generally about 0.0001 to about 200 mg/kg body weight/day, preferably about 0.001 to about 100 mg/kg/day, in single or divided doses. Depending on the age, species, and disease or condition being treated, dosage levels below the lower limit of this range may be suitable. In other cases, still larger dosages can be used without harmful side effects. Larger dosages can be divided into several smaller dosages, for administration throughout the day. Methods for determining the appropriate dosage are well known in the art.

For the treatment of familial adenomatous polyposis, the niclosamide and metformin described herein, or pharmaceutically acceptable salts thereof, may be administered in various ways as follows.

Oral administration

The pharmaceutical composition of the present invention can be administered orally, and the oral cavity is a concept including swallowing. By oral administration, the pharmaceutical composition of the present invention enters the gastrointestinal tract, or can be absorbed directly from the mouth into the bloodstream, for example, buccal or sublingual administration.

Suitable compositions for oral administration may be in the form of solid, liquid, gel, or powder, and may have formulations such as tablets, lozenges, capsules, granules, powders, etc. .

Compositions for oral administration may optionally be enteric coated and exhibit delayed or sustained release through enteric coating. That is, the composition for oral administration according to the present invention may be a formulation having an immediate or modified release pattern.

Liquid formulations may include solutions, syrups and suspensions, and such liquid compositions may be contained within soft or hard capsules. Such formulations may contain a pharmaceutically acceptable carrier, such as water, ethanol, polyethylene glycol, cellulose, or oil. The formulation may also contain one or more emulsifying and/or suspending agents.

In tablet formulations, the amount of the active ingredient drug may be present in about 0.05% to about 95% by weight, more generally from about 2% to about 50% by weight of the formulation, based on the total weight of the tablet. Further, the tablet may contain a disintegrant comprising from about 0.5% to about 35% by weight, more generally from about 2% to about 25% by weight of the formulation. Examples of the disintegrant may include lactose, starch, sodium starch glycolate, crospovidone, croscarmellose sodium, maltodextrin, or a mixture thereof, but is not limited thereto.

Suitable lubricants included to make tablets may be present in an amount of about 0.1% to about 5% by weight, such as talc, silicon dioxide, stearic acid, calcium, zinc or magnesium stearate, sodium stearyl fumarate, and the like. Although it can be used as a lubricant, the present invention is not limited to the types of these additives.

Gelatin, polyethylene glycol, sugar, gum, starch, polyvinylpyrrolidone, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, etc. can be used as a binder for manufacturing into tablets. And, as a suitable diluent for preparing tablets, mannitol, xylitol, lactose, dextrose, sucrose, sorbitol, starch, microcrystalline cellulose, etc. may be used, but the present invention is not limited to the types of these additives. .

Optionally, the solubilizing agent that may be included in the tablet may be used in an amount of about 0.1% to about 3% by weight based on the total weight of the tablet, for example, polysorbate, sodium lauryl sulfate, sodium dodecyl sulfate, propylene carbonate, Diethylene glycol monoethyl ether, dimethyl isosorbide, polyoxyethylene glycolated natural or hydrogenated castor oil, HCOR ^TM (Nikkol), oleyl ester, Gelucire ^TM , caprylic/caprylic acid mono/ Although diglyceride, sorbitan fatty acid ester, sorbitol HS ^TM and the like can be used in the pharmaceutical composition according to the present invention, the present invention is not limited to the specific types of such solubilizing agents.

Parenteral Administration

The pharmaceutical composition of the present invention can be administered directly into the bloodstream, muscle, or intestines. Suitable methods for parenteral administration include intravenous, intra-muscular, subcutaneous intraarterial, intraperitoneal, intrathecal, intracranial injection, etc. Includes. Suitable devices for parenteral administration include injectors (including needles and needleless syringes) and infusion methods.

Compositions for parenteral administration may be formulations with immediate or modified release patterns, and modified release patterns may be delayed or sustained release patterns.

Most parenteral formulations are liquid compositions, and such liquid compositions are aqueous solutions containing active ingredients, salts, buffers, isotonic agents, and the like according to the present invention.

Parenteral formulations can also be prepared in dried form (eg, lyophilized) or as sterile non-aqueous solutions. These formulations can be used with a suitable vehicle such as sterile water. Solubility-enhancing agents can also be used in the preparation of parenteral solutions.

Topical Administration

The pharmaceutical composition of the present invention can be administered topically to the skin or transdermally. Formulations for this topical administration include lotions, solutions, creams, gels, hydrogels, ointments, foams, implants, patches and the like. Pharmaceutically acceptable carriers for topical administration formulations may include water, alcohol, mineral oil, glycerin, polyethylene glycol, and the like. Topical administration can also be performed by electroporation, iontophoresis, phonophoresis, or the like.

Compositions for topical administration may be formulations with immediate or modified release patterns, and modified release patterns may be delayed or sustained release patterns.

The pharmaceutical composition of the present invention exhibits a remarkable synergistic effect in the treatment or prevention of familial adenomatic polyposis through the combination of niclosamide and metformin. The treatment or prevention method of the present invention exerts a remarkable synergistic effect in the treatment or prevention of familial adenomatic polyposis through the combination of niclosamide and metformin.

1a and b show the results of measuring TCF/LEF and TEAD reporter activity after transfecting 293 cells with mutant APC. Figure 1c is a protein-rich pSer127-YAP, the mobility shift of YAP, Figure 1d is the evaluation of CTGF transcript and TEAD reporter activity through Axin2 knockdown.

Figures 2a and b show the evaluation of Axin2, Snail protein abundance, Axin2 transcription level, and TCF/LEF activity when niclosamide is treated on CRC cells. FIG. 2C is an evaluation of pSer127-YAP abundance according to niclosamide, mobility shift of YAP in a force-tag gel, and nuclear YAP levels. 2D is an evaluation of CTGF transcription and TEAD reporter activity according to niclosamide. FIG. 2E is a measurement of YAP phosphorylation in all cell lines, and FIG. 2F is a measurement of relative fluorescence intensity in the entire nuclear region.

3A and 3B are immunoblot analysis, evaluation of the effect of metformin-mediated YAP regulation on YAP mobility shift, CTGF transcript and TEAD reporter activity in CRC cells on a force-tag gel. Figure 3c is to evaluate the phosphorylation of mTOR substrate liposome protein S6, Figure 3d is to evaluate the transcription level and TCF / LEF reporter activity of metformin in CRC cells.

4A is an evaluation of the expression of nuclear YAP and p-Ser127-YAP when niclosamide and metformin are administered in combination through immunoblot analysis. 4B is an evaluation of CTGF transcription level and TEAD reporter activity. 4C is an evaluation of nuclear YAP in a group administered with a combination of niclosamide and metformin through immunofluorescence analysis.

5A is an evaluation of AMPK activation upon administration of niclosamide and/or metformin, and FIG. 5B is an evaluation of ATP levels by phosphorylated AMPK. 5C is an evaluation of the activation of S6 acting as an mTOR effector.

Figure 6a, b shows the evaluation of Wnt signaling (Figure 6a), Axin2 transcription level (Figure 6b left), and TCF/LEF reporter activity (Figure 6b right) through immunoblot analysis. Figure 6c confirms the increase or decrease of epithelial markers and mesenchymal markers, Figure 6d is to evaluate the migration of CRC cells.

Figure 7a is a change in the weight of the mouse according to the drug administration, Figure 7b-d confirms that the tumorigenic potential according to the drug administration is suppressed.

8A is a change in body weight of a mouse according to drug administration, FIG. 8B is a measurement of the number of small intestine polyps 14 weeks after drug administration, and FIG. 8C is a result of observing small intestine polyps through a stereoscopic microscope.

9 is an evaluation of the combined treatment effect of niclosamide and metformin on FAP organoids through immunofluorescence analysis.

Hereinafter, examples, etc. will be described in detail to aid understanding of the present invention. However, the embodiments according to the present invention may be modified in various forms, and the scope of the present invention should not be construed as being limited to the following examples. The embodiments of the present invention are provided to more completely describe the present invention to those of ordinary skill in the art.

Experimental materials and methods

1. Cell culture, transfection and reagents

DLD-1 (ATCC, CCL-221) and human embryonic kidney 293 cells cultured in Dullbecco's Modified Eagle's Medium (DMEM, Lonza, 12-604F) and SW480 (Korea Cell Line Bank, KCLB No. 10228) Were grown in Roswell Park Memorial Laboratory 1640 (RPMI 1640, Lonza, 12-702F) using 10% fetal bovine serum (FBS, Life technologies) and 100 IU/ml penicillin/streptomycin. SW480 and DLD-1 cells are cells carrying the truncated APC gene. All cells were cultured in a humidified incubator at 37° C. and 5% CO _2. The Tet-pLKO-puro vector (#21915 obtained from Addgene) was used for inducible shRNA knockdown. The target sequence of shRNA for Axin2 was 5'-ACCACCACTACATCCACCA-3' (SEQ ID NO: 1). Mutant APC expression vectors pCMV-neo-Bam APC 1-1309 (# 16508) and pCMV-neo-Bam APC 1-1941 (# 16510) were obtained from Addgene. Mycoplasma infection test was performed with a PCR-based kit (Sigma, MP0040). Transfection was performed by Lipofectamine 2000 according to the manufacturer's protocol (Invitrogen, 11668-019). Niclosamide (2', 5-dichloro-4'-nitrosalicylanilide) was purchased from CAYMAN, and metformin was obtained from TCI America (TCI, M2009). Niclosamide and metformin were dissolved in DMSO and distilled water in an in vitro experiment.

2. Cell migration assay

For migration analysis for niclosamide and metformin, DLD-1, SW480 cells (5 x 10 ⁴ ) were seeded into transwell inserts (5.0 μm pores, BD Biosciences). The filter insert was pre-wetted before adding 1 x PBS and cotton cloth to the cells. 1 mL of medium was added to the lower chamber. ^{5 Х 10 4} /100 ul of cells were added to the medium on the top of the insert. After incubation for 48 hours, a medium containing 0.5 μM niclosamide and 5 mM metformin was added to the bottom, washed twice for 18 hours with 1×PBS, and fixed with 4% formaldehyde. The upper part was wiped with cotton, and the lower part was stained with 0.25% crystal violet. Cell counts were measured in 5 random fields.

3. Immunoblot Analysis

Niclosamide and metformin were treated for 16 hours, then washed twice with PBS, and 1% Triton X-100 lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% triton X-100) and Incubated together. The cells were collected through a scraper and centrifuged at 13,200 rpm for 15 minutes at 4°C. For the separation of the nuclear protein fraction, buffer A (10mM HEPES[pH7.9], 10mM KCl, 0.1mM EDTA, 1mM DTT) and buffer C (20mM HEPES[pH7.9], added with 10% Nonidet NP-40), 0.4M NaCl, 1mM EDTA, 1mM DTT) was dissolved on ice for 5 minutes (buffer A) and 15 minutes (buffer C). Total and nuclear extraction were used according to the manufacturer's instructions. The supernatant was collected and transferred to a new tube to extract the protein eluate. Protein was quantified using BCA protein analysis (Thermo), 5x sample buffer was added, boiled for 10 minutes, and then stored on ice. SDS-polyacrylamide was separated by electrophoresis and transferred to a nitrocellulose membrane (Whatman). After transfer, the membrane was blocked with 5% skim milk (BD bioscience) for 1 hour, and incubated at room temperature for 3 hours or at 4°C for 12 hours or more. Relative YAP abundance compared to loading control HDAC1 was determined through the ImageJ program downloaded from NIH (https://imagej.nih.gov/ij/). Snail (Cell Signaling, #3895S), Axin1 (Cell signaling, #2087S), Axin2 (Cell Signaling, #2151S), YAP (Sanatacruz, sc-101199), p-YAP(S127) (Cell Signaling, #4911S), Antibodies against S6 (Cell Signaling, #2217S), p-S6(S235/236) (Cell Signaling, #4858S), α-Tubulin (Ab frontier, LF-PA0146A), HDAC1 (Santacruz, sc-81598) are commercially available. I got it from the company. Phos-tag gel was purchased from WAKO Chemicals (AAL-107). Detection was performed using WEST SAVE (Ab frontier, LF-QC0101) CP-BU MEDICAL X-RAY FILM BLUE (AGFA).

4. Quantitative real-time-PCR and reporter analysis

Total RNA was extracted with TRIzol reagent (Invitrogen) according to the manufacturer's protocol. cDNA was prepared using the SuperScript III synthesis kit (Invitrogen). Real-time quantitative PCR (qPCR) analysis was performed with an ABI-7300 instrument according to the SYBR green mix protocol (n = 3). Each ΔCt value from each sample was calculated by normalizing to GAPDH. After qPCR reaction, the specificity of the primer was confirmed by a dissociation curve. Primer sequences used for real-time qPCR are shown in Table 1 below. For TEAD or TCF/LEF, cells were transfected with 100 ng of reporter vector and 1 ng of pSV-Renilla expression vector. Luciferase and Renilla activities were measured 48 hours after transfection using a dual luciferase reporter system kit (Promega) and normalized through Renilla activity. The experimental results were averaged by three experiments.

Primer sequence used in real-time quantitative PCR

gene	Forward direction	Reverse
E-cadherin	TGAGTGTCCCCCGGTATCCTC (SEQ ID NO: 2)	CAGTATCAGCCGCTTTCAGATTTT (SEQ ID NO: 3)
Claudin	GGCTGCTTTGCTGCAACTGTC (SEQ ID NO: 4)	GAGCCGTGGCACCTTACACG (SEQ ID NO: 5)
Occludin	CGGTCTAGGACGCAGCAGAT (SEQ ID NO: 6)	AAGAGGCCTGGATGACATGG (SEQ ID NO: 7)
Snail	TCTCTGAGGCCAAGGATCTC (SEQ ID NO: 8)	CTTCGGATGTGCATCTTGAG (SEQ ID NO: 9)
Zeb1	GCACCTGAAGAAGACCAGAG (SEQ ID NO: 10)	TGCATCTGGTGTTCCATTTT (SEQ ID NO: 11)
Fibronectin	CAGGATCACTTACGGAGAAACAG (SEQ ID NO: 12)	GCCAGTGACAGCATACACAGTG (SEQ ID NO: 13)
Axin2	AAGGGCCAGGTCACCAAAC (SEQ ID NO: 14)	CCCCCAACCCATCTTCGT (SEQ ID NO: 15)
CTGF	CAAAATCTCCAAGCCTATCAAGTT (SEQ ID NO: 16)	CTCCACAGAATTTAGCTCGGTAT (SEQ ID NO: 17)
GAPDH	TCCGCGGCTATATGAAAACAG (SEQ ID NO: 18)	TCGTAGTGGGCTTGCTGAA (SEQ ID NO: 19)

5. Immunofluorescence analysis

For immunofluorescence studies, cells were washed twice with ice-cold PBS and incubated with 4% formaldehyde for 15 minutes at room temperature. For staining, cells were permeabilized with 0.5% Triton X-100 for 45 minutes, blocked with PBS containing 3% bovine serum albumin for 1 hour, and incubated overnight at 4° C. with primary antibody. Thereafter, the cells were washed 3 times with PBS containing 0.1% Tween 20, and then incubated with anti-mouse-Alexa Fluor-594 (Invitrogen, A11005) secondary antibody. Cells were fixed with Vectorshield (Vector) with 4',6-diamidino-2-phenylindole (DAPI). Cell fluorescence was monitored using a confocal microscope (Zeiss LSM780). Images were analyzed using Image J software (Media Cybernetics, Inc., USA). Relative fluorescence intensity was measured in the entire nuclear area.

6. ATP detection analysis

To determine relative ATP levels, cells were plated in 6-well plates at 1 ^{×10 6 cells/well.} Cells seeded in the presence or absence of a medium containing glucose were prepared for 6 hours before measuring ATP levels. ATP levels were analyzed using an ATP assay kit (K354, BioVision) based on an ELISA detection system according to the manufacturer's method.

7. In vivo xenograft assay

All animal experiments were conducted in accordance with the regulations of Yonsei University's Animal Experimental Ethics Committee, and approved by the Animal Care Committee of Yonsei University's College of Dental Science and the National Cancer Center Research Institute. Female BALB/c nude mice (6 weeks old, purchased from Nara Biotech) were injected subcutaneously and used for orthotopic xenograft analysis. To study the antitumor effect of the combination of niclosamide and metformin, SW480 cells of the control or experimental group were trypsinized, harvested, and injected ^{into subcutaneous tissue (1×10 6 cells per 0.1 ml PBS).} For the combination treatment of in vivo niclosamide and metformin, after subcutaneous injection of SW480 cells into mice, only with vehicle, niclosamide (200mg/kg, PO), or metformin (2mg/mL, PO) , Or niclosamide (200mg/kg, PO) and metformin (2mg/mL, PO) were treated together. (2mg/mL, PO). The mice were applied 5 times for 4 weeks from the day after the tumor cells were injected. Tumor growth and body weight were monitored twice a week with a Vernier caliper, and the tumor volume was calculated according to the formula below.

V (mm3) = (a X b ² )/2: a, longest diameter; b, the shortest diameter.

8. APC min mouse experiment

APC min mice were prepared by crossing C57BL/6J wild-type female mice with C57BL/6J-APC min +/- (APC min, The Jackson Laboratory strain 002020) male mice. The genotyping work proceeded as follows. 200-300 μl of direct PCR lysis reagent (Viagen, 102-T) containing 0.4 mg/ml proteinase K was added to the tail of a 0.5 cm mouse. Incubate for 5-6 hours at 55°C in a water bath until no tissue clumps were observed. Thereafter, the crude lysate was incubated in a water bath at 85° C. for 45 minutes. Hair was precipitated by centrifugation for 10 seconds at 13200 rpm before genotyping. APC primer (APCmin WT; GCCATCCCTTCACGTTAG (SEQ ID NO: 20); APCmin Com; TTCCACTTTGGCATAAGGC (SEQ ID NO: 21); APCmin Mut; TTCTGAGAAAGACAGAAGTTA (SEQ ID NO: 22)) and 1 μl of lysate in 20 μl polymerase chain reaction (PCR) were used to perform genotyping. APC min mice were housed in Yonsei University School of Dentistry. When APC min mice reached 6 weeks of age, chemical treatment was started. For the combination treatment of niclosamide and metformin, mice were treated with vehicle or niclosamide (50 mg/kg, PO) alone or metformin (2 mg/mL, PO) alone, or niclosamide (50 mg/kg, PO) and It was treated with metformin (2mg/mL, PO) for 14 weeks. After 14 weeks of treatment, mice were sacrificed and the entire intestine was dissected. The tissue was fixed in 4% formaldehyde for 24 hours and then washed twice with 70% ethanol. The number of polyps in the small intestine was calculated using a stereomicroscope. The size of polyps less than 1 mm was small, between 1 mm and 3 mm was medium, and those larger than 3 mm were considered to be large.

9. Patient-derived FAP organoid culture

The tissue collected by endoscopic biopsy from the colon of the FAP patient was washed with PBS (100μg/ml primocin mixture) and cut into 0.5mm pieces, and in 37℃ digestion buffer (DMEM, 2.5% FBS, 6.25mg/ml collagenase type IX). Let it sit for 30 minutes. Then, the separated cells are mixed with 20 μL Matrigel and dispensed into 48 wells. Polyp organoid culture (advanced DMEM/F12 with 1% penicillin/streptomycin, Glutamax, 1×N2, 1×B27 without retinoic acid, 2 mM L-glutamine, 50 ng/ml EGF, 1 mM N-Acetyl-L-cysteine , 10mM Nicotinamide, 10nM Gastrin I, 10μM SB202190, 500 nM A-83-01, 2.5μM PGE2 and 100 ng/ml Noggin) are replaced every 2 days. Dispense into other wells and culture and proliferate in the same way. Proliferated FAP organoids are stored frozen in liquid nitrogen, dissolved when necessary, and cultured in the same manner to be used in experiments.

10. Statistical Analysis

All statistical analyzes for cell viability, cell migration and reporter analysis were performed with two-tailed Student's t-tests; Data are expressed as mean and s.d. Double asterisk indicates P<0.01, and one asterisk indicates P<0.05. Statistical significance of animal experiments was determined using the Mann-Whitney test. Data are presented as mean and s.e.m for tumor volume. No statistical method was used to predetermine the sample size.

Experiment result

Example 1: Axin2 is related to YAP activity induced by mutant APC

In most CRCs, Wnt signaling is overactivated by mutations in the APC gene, which can initiate tumorigenesis. YAP is essential for APC-deficient adenoma development, and Hippo-YAP signaling is an important effector pathway downstream from APC. To confirm this, mutant APC was transfected into 293 cells, and TCF/LEF and TEAD reporter activities were measured. The activities of TEAD and TCF/LEF were increased by the APC mutation (Fig. 1a, b).

In colon carcinomas with APC mutations, Axin2 and Snail are often found in invasive lesions, and the regulatory axis of the canonical Wnt dependent Axin2 plays an important role in the regulation of Snail-mediated EMT in cancer. In addition, Axin2 is a typical downstream target of the TCF/LEF transcription factor, and is highly abundant in CRC due to loss of APC function. This was consistent with the APC mutation in cell lines that confirmed high Axin2 levels. On the other hand, Axin1 expression was observed in all cell lines regardless of the APC mutation type.

Among these, two cell lines (DLD-1, SW480) were selected to generate an inducible Axin2 knockdown cell line. In inducible Axin2 knockdown cells, it was investigated whether the expression of YAP changes with niclosamide treatment. YAP has several phosphorylation sites that regulate protein stability or participate in cytoplasmic retention. Ser127 phosphorylation is required for cytoplasmic translocation of YAP. As a result, protein-rich pSer127-YAP, mobility shift of YAP (Fig. 1c), CTGF transcript and TEAD reporter activity (Fig. 1d) were examined through Axin2 knockdown.

The content disclosed in FIG. 1 is specifically as follows. (a) Relative TCF/LEF reporter (top flash) activity (left) and relative TEAD reporter activity (right) in HEK 293 cells transiently transfected with Hop and Top flash with Renilla. (b) 30 μg of each total cell lysate (WCL) was used for immunoblot analysis for Axin1 and Axin2. APC mutant cell lines are DLD-1, SW480, SW620, Caco-2 and HT-29, while HEK293, MCF7, MDA-MB-231, HCC1954, HCT116 and RKO cell lines are APC wild type. (c) Expression of the inducible Axin2 cell line showed endogenous YAP and Axin2 protein abundance by whole-cell lysate (WCL). The level of YAP phosphorylation was determined by mobility shift on a force-tag gel in an induced knockdown of an Axin2 CRC cell line treated with p-S127-YAP antibody and 3 μg/mL of doxycycline (Dox) for 48 hours. (d) The relative transcript abundance of Axin2 was determined by quantitative PCR analysis in cells expressing Axin2 shRNA (left). Relative CTGF reporter activity (Dox +) in cells expressing shRNA of Axin2 (right). Statistical significance compared to the control group through the two-sided Student's t-test **, P <0.01; ***, P <0.001. (e) The relative transcript abundance of CTGF was determined by quantitative PCR analysis in cells expressing Axin2 shRNA (left). Relative TEAD reporter activity (Dox +) in cells expressing shRNA of Axin2 (right). Statistical significance compared to the control group was **, P <0.01; ***, P <0.001.

Example 2: Niclosamide modulates YAP nuclear location and TEAD transcriptional activity

Niclosamide attenuates Wnt activity and Snail-mediated EMT program, and it was shown that Axin2, Snail protein abundance, Axin2 transcription level, and TCF/LEF activity were inhibited when niclosamide was treated on CRC cells (Fig. 2a, b). Nuclear YAP is overexpressed by regulating YAP phosphorylation in CRC cells, and YAP induces EMT, causing cancer invasion and metastasis. When investigating how YAP expression is regulated during niclosamide treatment, interestingly, a pattern of expression of YAP in the nucleus appeared. Niclosamide increased nuclear YAP levels by reducing the abundance of pSer127-YAP and the mobility shift of YAP in the force-tagged gel (FIG. 2C). Consistent with immunoblot analysis, CTGF transcription and TEAD reporter activity were increased by niclosamide (FIG. 2D ). To determine if the translocation of YAP by niclosamide is due to p53 upstream of the Lats/YAP axis, HCL116 (p53 wild type), HCT116 p53 -/-, DLD-1 and SW480 (p53 mutant) were combined with niclosamide. Were processed together.

As a result, YAP phosphorylation was decreased in all cell lines (Fig. 2e). This indicates that the action of niclosamide involved in YAP phosphorylation is an independent function of p53. And immunofluorescence analysis by endogenous YAP revealed that these proteins are mainly located in the nucleus of CRC cells. Figure 2f is a measurement of the relative fluorescence intensity in the entire nuclear region.

The content disclosed in FIG. 2 is specifically as follows. (a) Immunoblot shows endogenous Axin2, Snail protein abundance when cells are treated with 0.5 μM niclosamide for 16 hours. (b) Relative Axin2 transcript abundance (left) and TCF/LEF reporter (top flash) activity in cells transiently transfected with Renilla luciferase with top flash and treated with 0.5 μM niclosamide for 16 hours ( Right side). Statistical significance compared to the control group was *, P <0.05; **, P <0.01; ***, P<0.001. (c) YAP phosphorylation status in the cytoplasmic and nuclear fractions was determined by mobility shift on p-S127-YAP antibody and force-tag gel A. (d) Relative CTGF transcription levels (left) and relative TEAD reporter activity (right) were measured through reporter analysis and qPT-PCR. Statistical significance compared to the control group was *, P <0.05; **, P <0.01; ***, P <0.001. (e) HCT116 wild type, HCT116 p53 null (p53 -/-), DLD-1 and SW480 cells were treated with 0.25 μM of niclosamide, and phosphorylation of YAP was observed with a migratory shift force-tag. Cells were deficient in serum and glucose and were treated with niclosamide for 6 hours before the experiment. (f) CRC cells were cultured at 80-90% density and treated with niclosamide. Then, the intracellular location of endogenous YAP was measured using a confocal microscope. DAPI nuclear staining; Scale bar, 5 μm. Image J was used to quantify the intracellular location of YAP. Statistical significance compared to the control group was expressed as ***, P <0.001 through the two-sided Student t-test.

Example 3: Metformin affects the maintenance of YAP in the cytoplasm

Metformin regulates the Hippo pathway by increasing YAP phosphorylation and reduces the nuclear localization of YAP. The regulation of metformin-mediated YAP in CRC cells was shown to decrease the mobility shift of YAP on immunoblot analysis, force-tag gel, CTGF transcript and TEAD reporter activity (Fig. 3a, b). Metformin is less potent than niclosamide, but metformin has been shown to inhibit the protein abundance of Axin2 and Snail. In addition, phosphorylation of mTOR substrate liposome protein S6 was found (Fig. 3c). Similar to the results of the blot analysis, the transcription level of metformin and the TCF/LEF reporter activity were decreased in CRC cells (FIG. 3D ).

The content disclosed in FIG. 3 is specifically as follows. (a) The YAP phosphorylation status in the cytoplasmic and nuclear fractions is determined through the mobility shift on the p-S127-YAP antibody and the force-tag gel. (b) Relative CTGF transcription levels (left) and relative TEAD reporter activity (right) were determined through reporter analysis and qPT-PCR. CRC cells were treated with metformin 10mM. Statistical significance was expressed as **, P<0.01 through the two-sided Student's t-test. (c) Immunoblot shows the endogenous Axin2, Snail, p-S235/236-ribosomal protein S6 protein abundance when CRC cells were treated with metformin 10mM for 16 hours. (d) Relative Axin2 transcriptional abundance (left) and TCF/LEF reporter (top flash) activity (right) in cells transiently transfected with Renilla luciferase with top flash and treated with metformin 10 mM for 16 hours. Statistical significance compared to the control group was *, P <0.05; **, P <0.01.

Example 4: Combination effect of niclosamide and metformin through modulation of phosphorylation-dependent YAP

The above results confirmed that niclosamide increased YAP in the nucleus and metformin decreased the expression of YAP in the nucleus. In order to observe the change in the combination of niclosamide and metformin, CRC cells were treated with 0.25 μM of closamide, 10 mM of metformin, or 0.25 μM of niclosamide + 10 mM of metformin for 16 hours.

As a result, through immunoblot analysis, it was confirmed that the expression of nuclear YAP and p-Ser127-YAP decreased when niclosamide and metformin were administered together compared to niclosamide alone (FIG. 4A). And CTGF transcription level and TEAD reporter activity also showed the same results (Fig. 4b). In addition, in immunofluorescence analysis, it was found that nuclear YAP was decreased in the combination group of niclosamide and metformin compared to the group treated with niclosamide alone (Fig. 4c). Relative fluorescence intensity was measured over the entire nuclear area.

The content disclosed in FIG. 4 is specifically as follows. (a-c) Each cell was treated with 0.25 μM niclosamide, 10 mM metformin, or 0.25 μM niclosamide + metformin 10 mM. Immunoblot analysis of YAP phosphorylation status in the cytoplasmic and nuclear fractions was measured using the p-S127-YAP antibody. (a) Relative CTGF transcription levels (left) and relative TEAD reporter activity (right). Statistical significance compared to the control group was **, P <0.01; ***, P <0.001. (b) and immunofluorescence (c) were measured after treatment. Statistical significance compared to the control group was **, P <0.01; ***, P <0.001.

Example 5: Niclosamide and metformin inhibit mTOR-AMPK pathway

AMPK is activated by AMP, which is increased by various metabolic stresses such as energy depletion and hypoxia, and plays an important role in maintaining energy homeostasis by inhibiting ATP use. Metformin, which induces the activation of AMPK, inhibits tumors through the LKB1-AMPK-mTOR pathway. Activated LKB1 exhibits anticancer effects by promoting phosphorylation of AMPK and inhibiting mTORC1 through TSC2 (Tuberous Sclerosis Complex 2).

In order to observe the change in the effect of metformin treated with niclosamide over time, the activation of AMPK was observed under energy stress. As a result, AMPK activation was increased through protein expression (FIG. 5A), and cancer cell growth was suppressed by lowering ATP levels by phosphorylated AMPK (FIG. 5B).

In addition, inhibition of the mTOR pathway was confirmed by inhibiting the activation of S6 acting as an mTOR effector when compared to single treatment with two drugs (Fig. 5C). These results indicate that the combination of niclosamide and metformin regulates the AMPK-mTOR pathway.

The content disclosed in FIG. 5 is specifically as follows. (a) Each cell was treated with 0.5 μM niclosamide, 5 mM metformin, or 0.5 μM niclosamide + metformin 5 mM in 5.5 mM glucose medium for 16 hours. Endogenous AMPK, p-AMPK protein abundance was measured through immunoblot analysis. (b) Cells were cultured without glucose while being treated with niclosamide and metformin for 6 hours, and then ATP levels were measured. (c) Immunoblot shows endogenous Axin2, Snail protein abundance when cells are treated with niclosamide 0.25 μM, metformin 10 mM, or niclosamide 0.25 μM + metformin 10 mM for 16 hours.

Example 6: Niclosamide and metformin inhibit Snail-mediated EMT with inhibition of typical Wnt signaling

The combination of niclosamide and metformin has been shown to attenuate the expression of YAP in the nucleus by niclosamide. Then, the inhibitory effect of the combination of niclosamide and metclomine on Wnt signaling was tested. By confirming that niclosamide effectively reduces Axin2 and Snail, it can be seen that it is a major protein related to EMT in Wnt signaling, and it was also confirmed that metformin was also subtly reduced. The combination of the two drugs significantly reduced endogenous Axin2 and Snail, and effectively reduced Wnt signaling (Figure 6a), Axin2 transcription level (Figure 6b left), and TCF/LEF reporter activity (Figure 6b right) through immunoblot analysis. Suppress. Based on this, the transcription levels of the two drug combinations were confirmed through qPCR. Consequently, treatment with niclosamide and metformin significantly increased epithelial markers and decreased mesenchymal markers (FIG. 6C ). Transwell analysis was performed to confirm the mobility of both drugs. This was consistent with the result of significantly reduced migration when CRC cells were treated with a combination of niclosamide and metformin, compared to when treated with only niclosamide or metformin (FIG. 6D).

The content disclosed in FIG. 6 is specifically as follows. (a) Cells were treated with niclosamide 0.5 μM, metformin 5 mM, or niclosamide 0.5 μM and metformin 5 mM for 16 hours. Endogenous Axin2, Snail protein abundance was measured through immunoblot analysis. (b) Relative Axin2 transcriptional abundance (left) and TCF/LEF reporter (top flash) activity in cells transiently transfected with top flash with Renilla luciferase (right). Statistical significance compared to the control group was *, P <0.05; **, P <0.01; ***, P <0.001. (c) Relative epithelial markers (left) and mesenchymal markers (right) measured by qRT-PCR in CRC cells treated with niclosamide 0.25 μM, metformin 10 mM, or niclosamide 0.25 μM + metformin 10 mM for 16 hours. Warrior level. Statistical significance compared to the control group was *, P <0.05; **, P <0.01; ***, P <0.001. (d) Mobility of cells treated with 0.5 μM of niclosamide, 10 mM of metformin, or 0.5 μM of niclosamide + metformin 5 mM was measured by transwell migration assay. Statistical significance compared to the control group was *, P <0.05; ***, P <0.001.

Example 7: Niclosamide and metformin inhibit tumorigenicity in xenograft models

To investigate the in vivo therapeutic potential of the drug combination by a pharmacological approach, SW480 cells were injected subcutaneously into mice administered orally with a combination of niclosamide, metformin, niclosamide and metformin. In the course of drug administration, no obvious side effects were observed in mouse body weight (Fig. 7A). Administration of niclosamide or metformin alone inhibited tumor formation, and the combination of both drugs suppressed the tumorigenic potential (Fig. 7b-d).

The content disclosed in FIG. 7 is specifically as follows. (ad) For the combination treatment of niclosamide and metformin in vivo, mice were subjected to vehicle, niclosamide alone (200 mg/kg, PO), metformin alone (2 mg/mL) daily after subcutaneous injection ^{of SW480 (1×10 6) cells.} , PO) or niclosamide (200mg/kg, PO) and metformin (2mg/mL, PO) combination. Body weight (a) and tumor growth (b, c) were observed twice a week. After the end of the experiment, all tumors were isolated from mice (d). Statistical significance compared to the control group was expressed as *, P<0.05 through the two-sided Student's t-test.

Example 8: Niclosamide and metformin inhibit adenoma formation in APC-min mice

To determine polyp formation upon combination of niclosamide and metformin in APC min mice, 6 week old female and male mice were randomly grouped. APC min mice were orally administered a combination of vehicle (n=8), niclosamide 50mg/kg (n=9), metformin 2mg/ml, niclosamide 50mg/kg and metformin for 14 weeks. No weight loss was found due to the drug (FIG. 8A ). 14 weeks after drug administration, the number of small intestine polyps was significantly reduced in the niclosamide and metformin combination group compared to the control group, niclosamide or metformin alone group (FIG. 8B). And the APC min mice were sacrificed and polyps were observed in the small intestine through a stereoscopic microscope (FIG. 8c).

The content disclosed in FIG. 8 is specifically as follows. (ac) To test niclosamide and metformin combination therapy in APC min mice, APC mice were used with vehicle, niclosamide alone (50 mg/kg, PO), metformin alone (2 mg/mL, PO) or niclosamide ( It was treated daily with a combination of 50 mg/kg, PO) and metformin (2 mg/mL, PO). Body weight (a) and total number of polyps (b). Small intestine polyp observed after the end of the experiment (c). Statistical significance compared to the control group was *, P <0.05; **, P <0.01.

Example 9: Confirmation of the effect of combined treatment of niclosamide and metformin on patient-derived FAP organoids

FAP organoids were prepared from patient FAP tissue biopsies, seeded in 2 μl Matrigel, and polyp organoid culture solution (experimental materials and methods) was exchanged every 2 days. After treatment with niclosamide (0.5 or 1 μM), metformin (2 mM), or a combination of niclosamide and metformin for 8 days, organoids were stained with calcein AM and observed, which is shown in FIG. 9A (magnification, x40 ). Quantitative analysis of the fluorescence intensity of the FAP organoid cells was performed using ImageJ, which is shown in FIG. 9B (three-fold experiment, n=3). Means±SD. * P <0.05, ** P <0.01 (Student t-test).

Claims (15)

1. Niclosamide or a pharmaceutically acceptable salt thereof; And

   A pharmaceutical composition for the prevention or treatment of familial adenomatous polyposis comprising metformin or a pharmaceutically acceptable salt thereof as an active ingredient.
2. The pharmaceutical composition according to claim 1, wherein the pharmaceutical composition exhibits an effect of preventing or treating familial adenomatous polyposis through inhibition of Wnt/YAP/mTOR signaling and Snail-mediated epithelial mesenchymal transition (EMT).
3. The method of claim 1, wherein the niclosamide or a pharmaceutically acceptable salt thereof; And the molar ratio of metformin or a pharmaceutically acceptable salt thereof is 1: 10 to 10000 (Niclosamide or a pharmaceutically acceptable salt thereof: metformin or a pharmaceutically acceptable salt thereof), a pharmaceutical composition.
4. The pharmaceutical composition according to claim 1, wherein the familial adenomatous polyposis is a familial adenomatous polyposis caused by mutation of an APC (adenomatous polyposis coli) gene.
5. Familial adenomatous polyposis comprising administering to an individual in need thereof a therapeutically effective amount of niclosamide or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of metformin or a pharmaceutically acceptable salt thereof. How to treat or prevent.
6. The method of claim 5, wherein the method shows the effect of preventing or treating familial adenomatic polyposis through inhibition of Wnt/YAP/mTOR signaling and Snail-mediated epithelial mesenchymal transition (EMT).
7. The method of claim 5, wherein the familial adenomatous polyposis is a familial adenomatous polyposis caused by mutation of an APC (adenomatous polyposis coli) gene.
8. Niclosamide or a pharmaceutically acceptable salt thereof; And

   A kit for the prevention or treatment of familial adenomatous polyposis comprising metformin or a pharmaceutically acceptable salt thereof as an active ingredient.
9. The kit of claim 8, wherein the kit exhibits an effect of preventing or treating familial adenomatic polyposis through inhibition of Wnt/YAP/mTOR signaling and Snail-mediated epithelial mesenchymal transition (EMT).
10. The kit according to claim 8, wherein the familial adenomatous polyposis is a familial adenomatous polyposis caused by a mutation in an APC (adenomatous polyposis coli) gene.
11. According to claim 8, Niclosamide contained in the kit or a pharmaceutically acceptable salt thereof; And metformin or a pharmaceutically acceptable salt thereof are administered simultaneously or sequentially.
12. The kit according to claim 8, wherein the kit additionally comprises a medication instruction sheet which discloses any one or more selected from the group consisting of the dosage, route of administration, number of administrations, and indications
13. Use of niclosamide or a pharmaceutically acceptable salt thereof, and metformin or a pharmaceutically acceptable salt thereof for treating or preventing familial adenomatic polyposis.
14. The use according to claim 13, wherein the use shows the effect of preventing or treating familial adenomatic polyposis through inhibition of Wnt/YAP/mTOR signaling and Snail-mediated epithelial mesenchymal transition (EMT).
15. The use according to claim 13, wherein the familial adenomatous polyposis is a familial adenomatous polyposis caused by a mutation in an APC (adenomatous polyposis coli) gene.

Images