WO2021063464A2

WO2021063464A2 - Bacterial nanocellulose material and uses thereof

Info

Publication number: WO2021063464A2
Application number: PCT/DK2020/050264
Authority: WO
Inventors: Isabel ALVAREZ-MARTOS; Deby FAPYANE
Original assignee: Cellugy Aps
Priority date: 2019-10-01
Filing date: 2020-09-30
Publication date: 2021-04-08
Also published as: WO2021063464A3; EP4041905A2

Abstract

The present invention relates to a process for producing bacterial nanocellulose (BNC), the process comprising a) culturing in a liquid culturing medium Komagataeibacter rhaeticus, Gluconobacter oxydans, and at least one of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera lindneri; and b) removing a hydrogel comprising BNC from the liquid medium, thereby providing bacterial nanocellulose (BNC). The invention also relates to obtained hydrogels, dried films, layers design and uses thereof.

Description

BACTERIAL NANOCELLULOSE MATERIAL AND USES THEREOF

Technical field of the invention

The present invention relates to a packaging material based on bacterial nanocellulose (BNC). In particular, the present invention relates to a packaging material, which is compostable.

Background of the invention

Nowadays, the majority of food packaging solutions are made from fossil-based plastics, which are produced and consumed in an unsustainable manner: (1) They emit greenhouse gases during production and degradation. (2) They are intended for single-use, while it takes hundreds of years for the material to degrade. (3) A large amount of the waste ends up as litter, resulting in high waste management costs and the pollution of our ecosystem. The scale of the plastic pollution crisis is well documented - even the world's most remote oceans and seabeds are contaminated with unknown consequences for wildlife and human health.

Indeed, flexible packaging has a vital role to play in containing and protecting food as it moves through the supply chain to the consumer. However, the excellent mechanical and barrier properties enabled through the use of multiple thin layers of different materials, result in its main challenge: recyclability. There is currently a lack of recycling options for these laminated films due to the difficulty of separating into their single material components. This is a lot of waste (in EU 5 million tons per year) that is not managed in a proper way and may eventually end up polluting the land and oceans. As a result, food producers and supermarkets have been in the focus of politicians and campaigners to phase out their current single-use plastic packaging thus, creating a demand for renewable and sustainable solutions.

Demand for bioplastic packaging is influenced by a number of factors. Continuous improvement in technology are leading to more efficient and cost-competitive ways of producing bioplastics. This, coupled with their superior environmental benefits and the rising costs of fossil fuels, has led to significant investment in the development of bioplastics as a responsible alternative. The EU is playing a major role in promoting the use of biodegradable and recyclable bioplastics as a way to reduce the amount of waste sent to landfill. Furthermore, companies are more and more committed to help the environment through their Corporate Social Responsibility (CSR) schemes. However, what is really pushing the change is the rising consumer demand for environmentally responsible products (80% of European consumers want to buy products with a minimal impact on the environment).

There are three main groups of bioplastics:

1. Fossil-based/Biodegradable. Fossil fuel based but designed to be biodegradable. Primarily used as additives to improve performance of other bioplastics: a comparatively small group.

2. Bio-based/non-biodegradable. Entirely or partially produced from bio-based renewable resources yet technically equivalent to fossil-based counterparts so they are not biodegradable. Around 56.8% of global bioplastics production capacity in 2018.

3. Bio-based/Biodegradable. 100% bio-based and biodegradable. 34.4% of global bioplastics production capacity. Only available at industrial scale for five years. This is the largest innovative area of the plastics industry and is growing rapidly as new innovative polymers emerge. The most relevant polymers for food contact materials (FCMs) are polylactic acids (PLAs), polyhydroxyalkanoates (PHAs), cellulose blends and starch blends.

Starch is a polysaccharide produced by green plants for energy storage. Native starch cannot be applied to thermoplastic processing and thus, is usually a complex blend with compostable polymers and additives like plasticizers. This is necessary to improve water resistance, processing properties and mechanical properties. Commonly the starch content in this blends is lower than 50% and not all are allowed for food contact applications.

PLAs are amorphous or semi-crystalline polyesters that can be produced from the fermentation of lactic acid. Specific benefits of PLA in packaging applications are its transparency, gloss, stiffness, printability, processability and excellent aroma barrier. PLA is a rigid material with (mechanical) properties that are comparable with Polystyrene (PS), Polypropylene (PP), and Polyethylene Terephthalate (PET). The world of bioplastics is increasingly becoming one of biosciences. The fastest growing bio-based & biodegradable bioplastic is PH A, which is synthesized using "white biotechnology" (/.e. produced by microorganisms). PHAs are generally extracted with chlorinated solvents from heterotrophic bacteria grown on refined sugars or oils. They display excellent biodegradability in various environments including soil and seawater and generally have good barrier properties (similar to that of conventional packaging materials such as PET and PP). The market for PHA is growing at over 20% annually - but its growth is constrained by its high cost. They are more expensive than most other (bio)plastics (5-19 € per Kg).

Cellulose, long been used as a packaging material, has recently attracted renewed attention because of its biobased character. Besides being the chief component of paper, cellulose is also used to make cellophane and cellulose acetate. Cellophane is a transparent material widely used in confectionery and bakery items. It cannot be thermoformed (i.e. via melting) and a separate sealing layer is required to make the material sealable. Cellophane offers extremely good biodegradability in diverse environments. Cellulose acetate is extremely suitable for food serviceware such as cups for hot drinks and cutlery. Life-cycle-assessment (LCA) data is not available for cellophane or cellulose acetate, but the environmental impact of these materials is reported to be higher than that of many conventional plasticsNanocellulose is an emerging material derived from the processing of woodfibre down to the smallest fibre component (nanofibrils, CNF or nanocrystals, CNC). This is a 2 steps process: (1) liberation of cellulose from plant cell walls by removing lignin and hemicellulose, well-known process in the pulp and paper industry referred to as pulping and bleaching. (2) mechanical disintegration of cellulose, also known as fibrillation. This process was developed during the 1980s, but was not commercialized as it required a highly energy intensive production process to break the numerous hydrogen bonds present between the fibrils. Since the early 2020s, new processes to produce woodfibre based nanocellulose are being developed.

In contrast, nanocellulose can be obtained using "white biotechnology", where it is biosynthesized from glucose using specific bacterial strains. These nanofibers are devoid of other contaminating polysaccharides (lignin, hemicelluloses and pectin) and have greater optical transparency. The mechanism of bacterial nanocellulose (BNC) production is the construction of an interface air/culture medium film. Therefore, isolation and purification is relatively simple, requiring no energy or chemical intensive processes. First commercially available products of BNC was nata de coco, originated in the Philippines during the 1990s. Commercialization is still incipient and focused on high-value niche markets (eg. tissue engineering, wound dressing, artificial skin and blood vessels and carriers for drug delivery).

Further, today, biobased bioplastics are mostly made from food crops (so-called "first generation feedstocks") such as sugarcane, sugar beet, corn, potato, and wheat. While first generation feedstocks have reached an advanced stage and are widely used in many countries, the European Parliament recently supported the need to set limits to their use, raising concerns about food price, land use impact, and food shortage. Therefore, the bioplastics industry is currently searching for second and third generation feedstocks (e.g. waste, residues, or algae), which don't create additional demand for land for non-food production. Although, these new technologies are still on experimentation and demonstration stage, they leave significant potential for using biotechnology to create new materials for industrial purposes - among them bioplastics

Hence, an improved bio-based & biodegradable material would be advantageous, and in particular a more efficient and/or reliable process for producing such materials would be advantageous.

Summary of the invention

The present invention relates to a nanocellulose-based film produced by using fruits as raw material.

The nanocellulose-based flexible films protects both the food it packs and the environment. Mimicking nature, the material has been designed to either break down into healthy nutrients for soil, or be recycled in a closed-loop process with minimum loss in material performance. The films can be disposed and recycled in the existing system for paper and cardboard and is converted into compost at room temperature in the compost heap or together with organic waste, where it may decompose in 3-16 weeks (see e.g. example 18). Moreover, the raw materials may be renewable and non-edible or produced by using fruit waste streams, avoiding the competition with crops that might be used to feed the exponentially growing population.

The films are created to address different food packaging requirements: (1) Barrier properties, some food products require breathable films, while others require strong barrier against oxygen and water, (2) Sealability, by integrating a sealing layer to close the films using standard heat sealing equipment and (3) Dimensions to obtain films with the required size for different packaging applications (e.g. bags, lidding, or wrapping films). To fulfill the diverse packaging requirements, the film can be easily modified by coating with other polymers, generating layers with different properties. All the polymers used in this invention are cellulose-based, with each contributing to provide different properties to the final films. The concentration and thickness of each layer have been optimized to provide the films with the required oxygen and water barrier properties.

Sealing is an important aspect in packaging. Generally, bioplastics require the addition of a plastic sealing layer, which may affect their end-of-life and recyclability as they are no longer 100% biodegradable nor recyclable. The film of the present invention utilizes cellulose-based polymers such as CMC (carboxymethylcellulose) or MC (methylcellulose), usually used as thickeners in food or cosmetics. Both polymers are cheap, abundant and most importantly biodegradable, making the perfect match for a 100% biodegradable packaging.

The film of the present invention is entirely built from cellulose-based polymers, it behaves like a thin layer of plant cells where nature can degrade it as it degrades plants or wood. The material will disappear in nature and bring benefits as additional soil nutrition. In addition, the material is recyclable with cardboard and thus can be disposed in this existing waste collection system. The material is expected not to affect the cardboard quality, as it is pure cellulose (no lignin nor hemicellulose), or even can be used as an additive due to its long fiber nature.

Thus, an object of the present invention relates to provision of process for producing a bio-based & compostable film, preferably consisting entirely of cellulose-based materials.

In particular, it is an object of the present invention to provide a material that solves the above mentioned problems of the prior art with lack of transparency. Thus, one aspect of the invention relates a process of producing bacterial nanocellulose (BNC), the process comprising a) culturing in a liquid medium o Komagataeibacter rhaeticus; o Gluconobacter oxydans; and o at least one of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera lindneri ; and b) removing a hydrogel comprising BNC from the liquid medium, thereby providing BNC.

Another aspect of the present invention relates to a BNC material obtained/obtainable from a process according to the invention. Yet another aspect of the present invention is to provide a process for sealing/gluing one or more BNC materials according to the invention, the process comprising using methylcellulose (MC) and/or Carboxymethylcellulose (CMC) as a sealant/glue to adhere two parts of the BNC material together. Still another aspect of the present invention is to provide a film comprising

- a base layer comprising bacterial nanocellulose (BNC), wherein 10-20% of the hydroxyl groups are replaced by nitro groups;

- a nitrocellulose layer; and

- optionally a sealing layer comprising MC or CMC on at least one side of the film.

Yet another aspect of the invention relates to the use of a BNC material according to the invention as a packaging material, a lidding, a sheet, a bag, a lamination material, a wound dressing or a bandage.

A further use relates to the use of a composition comprising o Komagataeibacter rhaeticus; o Gluconobacter oxydans; and o at least one of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera lindneri,· for production of BNC.

A further aspect relates to the provided BNC material according to the invention for use as a medicament.

Yet an aspect relates to a product, packed in a material/film according to the invention.

Brief description of the figures Figure 1 shows a schematic overview of the production process, showing different steps from end to end production covering: raw material preparation, cultures treatment and reuse, fermentation conditions and process, BNC treatment and layer structure. (A) Whole fruit is used as a raw material and feedstock for culture medium during the fermentation. (B) Fermentation with a symbiotic culture. The arrow indicates "re-use" of the rest of the medium and the culture from for a new fermentation process.

Figure 2 shows (A) the bacterial composition of symbiotic cultures and (B) the fungal composition of symbiotic cultures.

Figure 3 shows that (A) a strict aerobic fermentation process begins when fermentation medium is mixed with culture. (B) The BNC is synthesized on the surface/interphase of water and air which (C) is easy to be harvested. (D) Silent aeration aerobic fermentation. The method to aerate using secondary aeration tank in order to increase O2 concentration without disturbing the surface static condition.

Figure 4 shows a schematic diagram for processing whole vegetable to fruit juice. Figure 5 shows the transparency of the produced films (A) before and (B) after overnight treatment with 1% HNO3.

Figure 6 shows heavy metals and fluorine content (ppm on total solids) for the tested material (final dried film). * Microwave digestion was executed on the sample according to DIN EN 13657, before the analysis of the heavy metals; ** Maximum levels for USA (according to ASTM D6868 (2012) heavy metals content must be less than 50% of those prescribed for sludges or composts in the country where the product is sold).

Figure 7 shows SEM imaging of (A) dry BNC film and (B) with a spray-coated layer of nitrocellulose. Scalebar 1 pm.

Figure 8 shows several applications using heatsealed BNC bags.

Figure 9 shows evolution of the disintregration of EcoFLEXY by showing visual presentation of the evolution of the disintegration of dry BNC film coated with 0.25% nitrocellulose at ambient temperature.

Figure 10 shows visual presentation of the content of a composting reactor with dry BNC film coated with 0.25% nitrocellulose after 4 weeks of composting at ambient temperature.

The present invention will now be described in more detail in the following.

Detailed description of the invention

A process for producing bacterial nanocellulose (BNC),

As also outlined above, in here is presented a process for producing bacterial nanocellulose (BNC), hydrogels comprising BNC, dried films/materials/sheets comprising BNC. In here is also presented processes for modifiying BNC material to provide improved materials. Thus, an aspect of the invention relates to a process for producing bacterial nanocellulose (BNC), the process comprising a) culturing in a liquid culturing medium o Komagataeibacter rhaeticus; o Gluconobacter oxydans; and o at least one of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera lindneri ; and b) removing a hydrogel comprising BNC from the liquid medium, thereby providing bacterial nanocellulose (BNC). As shown in examples 1-2 a process has been developed for producing BNC comprising materials. In example 3, the dominating strains producing the BNC have been identified.

In example 3, it is also described how the specific bacterial strains are considered to improve the production of BNC. Thus, in an embodiment, at least two of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera Hndne , such as at least three or such as at least all four strains.

In yet an embodiment, one or both of Hanseniaspora uvarum and Brettanomyces bruxellensis present in the culturing medium.

The nutritional source can have different origins. Thus, in an embodiment, the culturing medium in step a) comprises fruit juice and/or vegetable juice, such as filtered or unfiltered fruit or vegetable juice in an embodiment, the culturing medium in step a) comprises tea, such as a tea buffered medium.

In another embodiment, the fruit juice is selected from the group consisting of apple, strawberry, blackberry, aronia (chokeberry), rovada, grape, plum, cranberry, pea, orange, banana and combinations thereof.

In yet another embodiment, the vegetable juice is selected from the group consisting of potato, carrot, beet, sugar beet and combination thereof.

Preferably, the culturing medium comprises leftover materials from production of other food products. Thus, in a further embodiment, the culturing medium in step a) comprises fruit and/or vegetable parts such as peels, pulp and juices (or water residue).

Normally input material for culturing is sterilized before use, to avoid contamination. In an embodiment, the culturing medium is not sterilized before the bacteria and yeasts are applied to the medium. It has been found that the symbiotic culture of fungi and bacteria will predominate the culturing medium thereby making sterilization unnecessary. Sterilized material may of course also be used.

In an embodiment, the culturing medium in step a) comprises

- a sugar content in the range 5 - 15 degrees brix, preferably such as 7-13 degrees brix, preferably 8-12 degrees brix; and/or

- a sugar content in the range 5-15% sucrose (w/w), preferably such as 7- 13% (w/w), even more preferably 8-12% (w/w). As shown in example 5, the sugar content has been optimized.

In the present context "Brix" or "degrees Brix" (symbol °Bx) is the sugar content of an aqueous solution. One degree Brix is 1 gram of sucrose in 100 grams of solution and represents the strength of the solution as percentage by mass. If the solution contains dissolved solids other than pure sucrose, then the °Bx only approximates the dissolved solid content. The °Bx is traditionally used in the wine, sugar, carbonated beverage, fruit juice, maple syrup and honey industries.

In an embodiment, the culturing medium in step a) has a pH value in the range 2.5 - 4, preferably such as in the range 2.8 - 3.8, more preferably in the range 3- 3.5. As shown in example 6, it has surprisingly been found that a pH around 3 is optimal for the culturing medium comprising the symbiotic culture. This is much lower than other BNC producing cultures, which is usually fixed at more neutral pH, 6-7.

In an embodiment step a) is performed at a temperature in the range 15-30°C, such as 15-27°C, preferably such as 18-23°C, more preferably such as 20-23°C. As shown in example 7, it has surprisingly been found that a temperature around room temperature is optimal for the culturing medium comprising the symbiotic culture. This was lower than expected.

To create uniform hydrogels on the surface of the culturing medium the fermentation conditions should be controlled. Thus, in another embodiment, the culturing in step a) is aerobic fermentation, preferably static aerobic fermentation, such as without shaking, stirring or any process causing fluctuative medium height level. In yet a further embodiment, air is supplied to the medium, by aeration outside the culturing container, such as by aerating a flow tube outside the culturing container. Example 4 and figure 3D describe such an aeration system.

The ratio between the bacterial strains can also be optimized. Thus, in an embodiment, the numerical ratio between Komagataeibacter rhaeticus and Gluconobacter oxydans is in the range 10:1 to 1:10, such as 10:1 to 1:3, such as 10:1 to 1:1, preferably 7:1 to 2:1, more preferably 5:1 to 2:1, such as around 3:1. Example 3 + figure 2A shows that these two strains are dominating bacteria, preferably with a higher number of Komagataeibacter rhaeticus.

In a further embodiment, the ratio by weight between culturing medium and culture is in the range 5:1 to 1:2, such as 5:1 to 1:1, preferably 5:1 to 2:1, more preferably 4:1 to 2:1, such as around 3:1. Example 8 shows data on such ratios.

The culturing (fermentation) period in step a) before collecting the produced BNC hydrogel may vary. In an embodiment, the culturing in step a) takes place for a period of 2-10 days at room temperature, preferably 3-7 days, even more preferably 4-6 days. The longer the incubation the thicker the hydrogel will be. A thickness around 0.6-0.7 cm is preferred when collecting the hydrogel.

In a related embodiment, the BNC hydrogel in step b) is removed from the surface of the culturing medium or from the interphase between surface and culturing medium. In yet a related embodiment, the BNC hydrogel in step b) is removed, when it has a thickness in the range 0.2 cm to 2 cm, such as in the range 0.3 to 1 cm, preferably in the range 0.5 to 1 cm, more preferably 0.6-0.8 cm, such as around 0.7 cm. A thickness of 0.6-0.7 cm may be obtained after 5 days.

After collecting the hydrogel, the culturing medium may be reused. Thus, in an embodiment, the remaining culturing medium after removal of the BNC hydrogel in step b) is used as an inoculum in a new culturing step a).

It is considered important that the provided hydrogel is sterilized before further use, since it may comprise viable bacteria or fungi from the medium. Thus, in an embodiment, the process further comprises a step c) of sterilizing the provided BNC hydrogel. In a related embodiment, the sterilization in step c) is performed by incubation in a base such as NAOH and/or NaCICM. For food applications NAOH is preferred. Unfortunately, sterilization using NaOH may result in undesired colouring of the sterilized material at higher concentration. Thus, in yet an embodiment, the sterilization in step c) is performed in

- 0.3- 2% (w/w) NaOH, preferably 0.5-1%; or

- 0.5- 5% (w/w) NaCI04, preferably 0.5- 5%.

As shown in example 9, NaOH within this range does not result in undesired colouring of the material, instead a white material is provided.

It may be desired that the final material is transparent. Thus, in an embodiment, the process further comprises a step d) of treating the sterilized BNC hydrogel with acid, to provide a transparent BNC gel. In a related embodiment, the acid treatment is performed in HNO3, more preferably at a concentration of 0.3 to 2% (w/w), even more preferably at a concentration of 0.5 to 1% (w/w). Example 10 shows that a transparent material is provided when 0.5 to 1% (w/w) HNO3 is used.

For the material to function as a sheet, such as a packaging material, it should be dried. Thus, in an embodiment, the process further comprises a step e) of drying the provided BNC hydrogel, to provide a dried BNC material. In a related embodiment, the drying step e) is performed at a temperature in the range 30- 40°C such as for 10-20 hours, preferably at 33-39°C for 12-18 hours. In yet a related embodiment, the drying is performed on a non-stick surface such as on silicone, preferably an oil-coated non-stick surface such as silicone surface, such as coated with rapseed oil, sunflower or any vegetable-based oil. Example 11 shows optimization of the drying step.

The dried BNC material may have different thicknesses, depending on the start material and drying conditions. Thus, in a preferred embodiment, the provided dried BNC material has a thickness in the range 10-100 pm, preferably 10-60 pm, more preferably 20-60 pm. Additional features of the dried material may be introduced by modifying the material. Thus, in an embodiment, the process further comprises a step f) of coating the dried BNC material with nitrocellulose, such as coating with a 0.1 to 5% (w/w) solution of nitrocellulose, such as a 0.1 to 3%, such as 0.1 to 2%, preferably 0.5-1.5%, and more preferably 0.8-1.2%. For food applications, lower levels are preferred. As outlined in example 16 nitrocellulose treatment enhances puncture resistance, water resistance, O2 resistance and flexibility. In a related embodiment, a nitrocellulose layer is coated on each side of the dried BNC material.

In a preferred embodiment, the process comprises steps a) to d) as outlined above.

In another preferred embodiment, the process comprises steps a) to e) as outlined above.

In yet another preferred embodiment, the process comprises steps a) to f) as outlined above.

It has been identified that antioxidants and polyphenols can improve the output of the process (see example 19). Polyphenols, such as Theaflavins are also present in tea (black tea).

Thus, in an embodiment, the liquid culturing medium comprises tea, preferably black tea.

In another embodiment, the liquid culturing medium comprises one or more antioxidants and/or polyphenols. In example 19 ascorbic acid, Epicatechin and Theaflavin are tested. Thus, in an embodiment, the antioxidant is ascorbic acid.

In another embodiment, the polyphenol is selected from the group consisting of Theaflavin and Epicatechin.

In yet another embodiment, the polyphenol is an antioxidant polyphenol, such as Theaflavin or derivatives thereof, wherein the derivative thereof comprises a tropolone moiety. In a further embodiment, the one or more Theaflavins or derivatives thereof are selected from the group consisting of Theaflavin, Theaflavin-3-gallate, theaflavin-3'-gallate, and theaflavin-3-3'-digallate.

In yet a further embodiment, the liquid culturing medium comprises one or more antioxidant polyphenols, such as Theaflavin, at a concentration in the range 5-100 g/l, such as in the range 5-80 g/l, preferably in the range 20-50 g/l, and more preferably 30-40 g/l.

A BNC material obtained/obtainable by manufacturing process

The process described above, produces a unique product produced by fermentation using a unique combination of micro-organisms. Thus, another aspect of the invention relates to a BNC material obtained/obtainable from a process according to the invention.

In an embodiment, he BNC material is transparent (to the naked eye).

In another embodiment, the material has a HAZE level above 85 % measured according to ASTMD 1003:2013.

In yet another embodiment, the BNC material has

- a total solid content (TS,%) above 60%, such as above 70%, such as above 80% preferably above 85%, and more preferably above 90%; and/or

- a moisture content below 40%, such as below 30%, such as below 20%, preferably below 15%, and more preferably below 10%; and/or

- a total volatile solids content (VS,% on TS) above 60%, such as above 70% such as above 80% preferably above 85%, and more preferably above 87%; and/or

- an ash content (% on TS) below 40%, such as below 30%, such as below 20%, preferably below 15%, and more preferably below 13%.

In an embodiment, the BNC material is in compliance with EN 13432 (2000), NF T51-800 (2015), ASTM D6868 (2017) and/or CAN/BNQ 0017-088 (2010) in relation to heavy metal content and fluorine content. In an embodiment, the BNC material is in compliance with EN 13432, the French standard NF T51-800, the Canadian standard CAN/BNQ 0017-088 and/or the international standard ISO 18606 (2013) in relation to minimum volatile solids content of 50% on total solids (TS).

In another embodiment, the BNC material is in compliance with biodegradability according to the French standard NF T 51-800 (Plastics - Specifications for plastics suitable for home composting (2015)). In a related embodiment, the BNC material is biodegradable.

In the present context, the term "biodegradable" refers to the ability of materials to break down and return to nature. In order for packaging products or materials to qualify as biodegradable, they must completely break down and decompose into natural elements within a short time after disposal - typically a year or less. The ability to biodegrade within landfills helps to reduce the buildup of waste, contributing to a safer, cleaner and healthier environment. Materials that are biodegradable include corrugated cardboard and even some plastics. Most plastics, however, are not biodegradable - meaning they cannot break down easily after disposal and can remain on the planet as waste for decades.

In yet an embodiment, the BNC material is compostable. In the present context, the term "compostable material" is similar to "biodegradable material", as they are both intended to return to the earth safely. However, "compostable materials" go one step further by providing the earth with nutrients once the material has completely broken down. These materials may be added to compost piles, which are designated sites with specific conditions dependent on wind, sunlight, drainage and other factors. While "biodegradable materials" are designed to break down within landfills, "compostable materials" require special composting conditions. Compostable packaging materials include starch-based packing peanuts - an alternative to Styrofoam loose fill packaging that can be dissolved in water and added to composts for safe disposal. See also examples 12, 14 and 18. In an embodiment a BNC material according to the invention is (with thickness 40-50 um) (dried BNC films after basic/acid treatment) is disintegrable in soil after 4 weeks. See example 18.

In a further embodiment, the BNC material is in compliance with 1935/2004/EC, 2023/2006/EC, and/or the Danish food contact regulation Bekendtgorelse nr. 822 of 26.06.2013.

The BNC material may also have other properties.

In an embodiment, the BNC material has a water vapour permeability in the range of 20-150 [g/(m².day)] depending on the material layering procedures. The water vapour permeability was determined using Water Permeance determined in accordance with ASTM E96/E96M-16.

In an embodiment, the BNC material has a:

- a longitudianlly tensile strength of at least 1 MPA, such as at least 5 MPa, preferably of at least 8 MPa; and/or

- a cross direction tensile strenght of at least 5 MPa, such as at least 10 MPa, preferably of at least 12 MPa.

In another embodiment, the BNC material has a puncture resistance of at least 10N.

In a further embodiment, the BNC material has an oxygen permeability of 5-162 [cm³/(m²x day x bar)] depending on the material layering procedures.

In yet an embodiment, the BNC material is burn resistant up to 300C.

In an embodiment, the BNC material comprises Theaflavin or a derivative thereof, such as selected from the group consisting of Theaflavin, Theaflavin-3-gallate, Theaflavin-3'-gallate, and Theaflavin-3-3'-digallate. Preferably, the materials comprises theaflavin. In an embodiment, the theaflavins or derivatives thereof are present at a concentration in the range 5-100 g/l, such as in the range 5-80 g/l, preferably in the range 20-50 g/l, and more preferably 30-40 g/l. Preferably, the Theaflavins or derivatives thereof are present in the hydrogel. As shown in example 19, the addition of Theaflavin improves the process substantially. Wihtout being bound by theory, it is believed that the Theaflavin will also be present in the obtained material, such as in the hydrogel.

Process for sealing/gluing one or more BNC materials together

When the dried material according to the invention is going to be used as a packaging material or as a bag, it would be advantageous that it is possible to glue at least part of one or more materials together. It would also be advantageous if the glue consisted of a cellulosic material, so that the complete product consisted of cellulose materials, which can be recycled with other cellulosic-based material such as paper and cardboard. Thus, an aspect of the invention relates to a process for sealing/gluing one or more BNC materials according to the invention together, the process comprising using methylcellulose (MC) and/or Carboxymethylcellulose (CMC) as a sealant/glue to adhere two parts of the BNC material together. In an embodiment, the sealing can be comprises with heat.

In yet an embodiment, a product is sealed inside the one or more BNC materials. In a connected embodiment, the product is selected from the group consisting of solid products such as a food product, a cosmetic product, and tableware. It is of course to be understand that other solid product groups could also be packed inside the material. Figure 8 shows different materials packed inside a sealed material according to the invention.

Material

The material produced by the process of the invention, may comprise unique features. In here, the material may be named "material of the invention", "sheet", "film, "biofilm", "EcoFLEXY". Thus, an aspect of the invention relates to a film comprising - a base layer comprising bacterial nanocellulose (BNC), wherein 1-50%, such as 5-40%, preferably 5-30% or more preferably 10-20% of the hydroxyl groups are replaced with nitro groups;

- a nitrocellulose layer; and

- optionally a sealing layer comprising MC or CMC on at least part of the film.

In a related aspect, the invention relates to a film comprising

- a base layer comprising bacterial nanocellulose (BNC),

- a nitrocellulose layer; and

- optionally a sealing layer comprising MC or CMC on at least part of the film.

In an embodiment, 5-30% of the hydroxyl groups are replaced with nitro groups or more preferably 10-20% of the hydroxyl groups are replaced with nitro groups (in the bacterial nanocellulose (BNC).

As also outlined above and in the example section, treatment with HNCb introduces nitro groups in the BNC (see example 10), whereas the nitrocellulose layer introduces further functionalities. Finally, the methyl/carboxymethylcellulose may function as a sealant. In sum, a novel product is provided comprising only cellulose based materials allowing the material to be compostable according to standard regulations (see e.g. examples 12, 14 and 18).

In an embodiment, a nitrocellulose layer is present on both sides of the base layer.

In another embodiment,

- the base layer has a thickness in the range 10-100 pm, preferably 10-60 pm, more preferably 20-60 pm; and/or

- the nitrocellulose layer has a thickness in the range of 1-10 pm.

In yet an embodiment, the film is transparent. In a related embodiment, the material has a HAZE level above 85 % measured according to ASTMD 1003:2013.

In a further embodiment, the film has - a total solid content (TS,%) above 60%, such as above 70%, such as above 80% preferably above 85%, and more preferably above 90%; and/or

In an embodiment, the film is in compliance with EN 13432 (2000), NF T51-800 (2015), ASTM D6868 (2017) and/or CAN/BNQ 0017-088 (2010) in relation to heavy metal content and fluorine content.

In yet an embodiment, the film is in compliance with EN 13432, the French standard NF T51-800, the Canadian standard CAN/BNQ 0017-088 and/or the international standard ISO 18606 (2013) in relation to minimum volatile solids content of 50% on total solids (TS).

In yet another embodiment, the film is biodegradable. In a related embodiment, the film is in compliance with biodegradability according to the French standard NF T 51-800 (Plastics - Specifications for plastics suitable for home composting (2015)).

Im an embodiment, the film is compostable. In a related embodiment, the film is in compliance with 1935/2004/EC, 2023/2006/EC, and/or the Danish food contact regulation Bekendtgorelse nr. 822 of 26.06.2013.

In another embodiment, the film is water resistant.

In yet another embodiment, the film has a

- a longitudianlly tensile strength of at least 1 MPA, such as at least 5 MPa, preferably of at least 8 MPa; and/or - a cross direction tensile strength of at least 5 MPa, such as at least 10 MPa, preferably of at least 12 MPa.

In an embodiment, the film has a puncture resistance of at least 10N.

Inan embodiment, the film has an oxygen permeability of 5-262 ml/(m2 x day x atm (bar)).

In an embodiment, the film is burn resistant up to 300°C.

In an embodiment, the material according to the invention, e.g. in the form of a hydrogel or film comprises one or more Theaflavins or derivatives thereof, such as selected from the group consisting of Theaflavin, Theaflavin-3-gallate, theaflavin- 3'-gallate, and theaflavin-3-3'-digallate. Preferably, the materials comprises theaflavin.

Thus, an alternative aspect of the invention relates to a BNC hydrogel, wherein the hydrogel comprises Theaflavin or derivatives thereof.

In an embodiment, the hydrogel and/or film comprises traces of Komagataeibacter rhaeticus, Gluconobacter oxydans, Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and/or Kloeckera Hndneri. Since these strains may be part of the culture medium, it is expected that traces may be present in the gel or film. In the present context, traces may be DNA or RNA signatures, or specific protein signatures.

In an embodiment, the hydrogel or film according to the invention comprises traces of Komagataeibacter rhaeticus, Gluconobacter oxydans and at least one of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera Hndneri. Preferably the traces are of dead microorganisms, as the process preferably comprises a sterilization step.

As also described below, it is to be understood that embodiments of one aspect of the invention also applies to other aspects of the invention. For example, the aspect relating to BNC materials obtained by the process of the invention, also applies to this aspect relating to materials/films of the invention.

Uses

The BNC material according to the invention may have different uses in either dry or in the hydrogel form (with water content).

Thus, in an aspect the invention relates to the use of a BNC material according to the invention as a packaging material, a sheet, a bag, a lamination material, a wound dressing or a bandage.

In an embodiment, the use is for packaging fruit, such as dried or fresh fruit.

Another use relates to the use of the hydrogel material as a lamination material, a wound dressing, a facial mask, or as a thickener such as for food or cosmetics.

A further use relates to the use of a composition comprising o Komagataeibacter rhaeticus; o Gluconobacter oxydans; and o at least one of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera lindneri ; for production of BNC.

A further aspect relates to the provided BNC material according to the invention for use as a medicament. In an embodiment, the BNC material according to the invention for use as a wound dressing, with the proviso that the BNC material is a hydrogel. Dried material may function as artificial skin or a biodegradable bandage.

Packed product

Yet an aspect relates to a product packed in a material according to the invention. When functional as a packaging material as e.g. shown in figure 8, the material is a dried material according to the invention. In an embodiment, the product is selected from the group consisting of food, such as dried fruit, fresh fruit, prepacked food, cosmetics, such as soap, a packed shampoo, table wear, household vegetable garbage and household fruit garbage (solid goods).

It should be noted that embodiments and features described in the context of one of the aspects of the present invention also apply to the other aspects of the invention.

All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.

The invention will now be described in further details in the following non-limiting examples.

Examples

Example 1 - Overview

In figure 1, a schematic overview of the production process is outlined.

Example 2 - Isolation of symbiotic culture composition for production

Materia! and methods Material:

The kombucha fungus starter (Wellness-Drinks, Eleonore-Sterling-Str. 2060433 Frankfurt am Main). Black tea extract (Ahmad tea, UK). No-added sugar pasteurized juice (Rynkeby, Denmark). Sucrose (Sigma Aldrich, Denmark).

Instrumentation:

Refractometer to measure sugar brix at the range of 0-20% with sensitivity 0.1% (ESSKA GmBH, Germany).

Methods:

The symbiotic culture starter was treated with medium consisting of 10% sucrose and 10% black tea extract at 25°C with ratio culture: medium of 1:3. The starter is being cultured in batch mode for more than 20 times (1 week per batch). The resulting new culture emerged from batch no 20, and was used for further testing with diverse type of juice as it showed stability in producing stable wet weight of BNC. The symbiotic culture from tea medium treatment was further grown in large variety of fruit and vegetable juices (no further treatment, used as it is) with the same ratio as before. The brix was measured everyday using refracto meter. At the end of day 3 and 5, %-sugar used were calculated. Table 1 shows that the culture consumes sugar the most in the filtered apple and carrot juice with total sugar consumption up to 38-39%. However, the culture in the carrot juice shown crumbly BNC production due to high fibers content in the juice. Therefore, the culture grown in the filtered apple juice is selected for further test and production. Table 1. Starter culture adaptation and selection using vegetables/fruit juices as medium

*BRIX= 1 brix is equal to 100 g/L sugar Conclusion

Using the above process, the skilled person can obtain a culture as used in the present invention.

Example 3 - Culture composition based on the Next Generation Sequencing (NGS) of 16s RNA and DNA.

Aim of study

To determine the microorganism species present in the culture composition.

Materials and methods

Next generation sequencing (NGS) 16sRNA:

The protocol for the NGS analyses according ISI service 25130 has been optimised to analyse bacteria, fungi and higher organisms simultaneously. Total DNA is extracted and amplified using a 2-step polymerase chain reaction (PCR) targeting the V3-V4 16S regions of the 16S rRNA gene from prokaryotes, as well as three primer sets targeting the hypervariable regions V3-V4 of the 18S rRNA gene from eukaryotes. The NGS amplicon sequencing is performed on a desktop sequencer (MiSeq from Illumina, Inc.). The sequence data is compared to the RDP database for bacteria, and the Silva database for fungi, using the BION software. The output is the number of reads of sequences which can be assigned to defined species in the databases; the number of reads to some degree correlates with the amount of DNA originally present in the sample.

Identification through specific DNA sequence for Komagataeibacter rhaeticus and Gluconobacter oxydans:

PCR reactions were carried out in 50 pi total volume including 5 ul 10 x TAQ polymerase reaction buffer, 1 ul 10 mM dNTP, 0.6 ul lOOpmol/ul oligo 1, 0.6 ul lOOpmol/ul oligo 2, and 3 units TAQ polymerase.

The following oligos were used: for specific amplification of the isocitrate dehydrogenase gene from Komagataeibacter rhaeticus:

Oligo 1 (SEQ ID NO: 1): 5' C ATG G C A A AG AT C A AG GTC AG 3' and oligo 2 (SEQ ID NO: 2): 5' CTTACGCCTTGGCCAGTGC 3'

For the amplification of the oxidase gene from Gluconobacter oxydans:

Oligo 1 (SEQ ID NO: 3): 5' ATTACGCGCGAAACCCTC 3' and oligo 2 (SEQ ID NO:

4): 5' AGGCCGGAATAGCGGCCTTC 3'. The PCR program consisted of an initial denaturation step at 95°C for 5 min followed by 30 cycles of 92°C for 30 s., 55°C for 45 s. and 72°C for 2 min followed by a final elongation step at 72°C for 5 min. The PCR products were separated on a 0.8% agarose gel in TBE buffer. The Komagataeibacter rhaeticus specific DNA oligos is represented by 1,200 bp oligo lane, while Gluconobacter oxydans specific DNA oligos represented by 1,400 bp oligo lane.

Results

Figure 2A shows the outcome of the analysis in relation to bacterial population, whereas figure 2B shows the outcome of the analysis in relation to fungal population. Figure 2C shows the outcome of the specific DNA oligos specific for Komagataeibacter rhaeticus and Gluconobacter oxydans.

Conclusion

The culture of the invention comprises a combination of known bacterial and fungal strains, which are dominating in the culture.

Without being bound by theory, it is believed that each of the dominating strains contributes to a synergistic effect in the production of BNC.

Komagataeibacter rhaeticus;

Komagataeibacter rhaeticus is known to use C6-sugar, such as glucose and fructose, as carbon source to produce nanocellulose. Their byproduct consists of gluconic acid, C5-ketoglutarate or lower carbon derivative such as lactic (C3) and acetic acid (C2).

Gluconobacter oxydans;

Gluconobacter oxydans is mainly used for biorefinery for its ability turning C3-4 carbon to lower-carbon derivative such as lactic (C3) and acetic acid (C2). It was just found that it contributes to nanocellulose production as well.

Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces baiiii and Kloeckera lindneri ;

One or more of these strains of fungus in the symbiotic cultures is known to break down higher sugar such as disaccharide (sucrose) to C6 or lower that can be used by K.rhaeticus or G.oxydans to produce nanocellulose. In return, the two bacteria protect the fungus from other contaminant by making acidic pH environment.

The bacterial strains can be obtained individually in German Collection of Microorganisms and Cell Cultures GmbH (dsmz.de), while the fungus strain can be found in CBS-KNAW fungal collection (CBS.nl).

K. rhaeticus : DSM 16663

G. oxydans : DSM 2003

Hanseniaspora uvarum : CBS 10325

Example 4 - optimization of fermentation process

Aim of study

To optimize the fermentation process in relation to production of the hydrogel

Materials , methods and results

The bacterial BNC (BNC) is produced during an aerobic fermentation process (Figure 3A). Generally, the BNC will be synthesized inside the medium to form sphere-like gel, made from nanocellulose (using G. xylinus as culture reference).

In the present invention, the BNC is synthesized on the interphase of water (medium) and air in which the shape will follow the shape of the mold or fermenter, typically the fermentation is undergone for 7 days in the 10% sucrose tea medium.

As it is synthesized in the interphase or surface of the medium, it can easily be harvested (figure 3B and 3C). A crucial part of the fermentation is that the fermentation process shall be conducted in static mode as shaking or stirring modes (to increase aeration) will deteriorate the film produced, resulting uneven BNC film surface which will affect its transparency.

To keep a high rate of aeration without deteriorating the film produced, aeration with bubbles should be avoided. As shown in figure 3D, bubbles can be avoided by aerating the medium in a separate aeration outside the fermentation tank. The aerated medium can then be circulated to the fermentation tank. As shown in Table 2 below, static culturing results in a high wet weight of BNC and BNC films are formed as desired. Table 2. The effect of aeration or shaking in the fermentation process

Conclusion

Static culturing using aeration in a separate aeration tank provides the best results.

Example 5 - optimization of sugar content during fermentation

Aim of study

To optimize sugar content during fermentation

Materials and methods

To optimize sugar content during fermentation, different sugar concentrations were evaluated in Hestin-Schramm medium. The medium containing different sucrose concentration (1.5-30) with 1.03 g/L citric acid and 6.03 g/L sodium biphosphate.

Results

The results are shown in table 3 below. Table 3. Sugar concentration optimisation

*Wet weight including the initial culture weight

Conclusion

A sugar content (sucrose) around 10% (lOOg/L) appears to be an optimal concentration, albeit other concentration may also be used.

Example 6 - pH optimization

Aim of study

To optimize pH during fermentation.

Materials and methods

To optimize pH during fermentation, different pH's during fermentation were evaluated in Hestin-Schramm medium. The medium is conditioned with different pH with alternating amount of citric acid and sodium biphosphate with 10% sucrose.

Results

The results are shown in table 4 below. Table 4. Medium pH optimisation

*Wet weight inc uding the initial culture added Conclusion

A pH optimum around 3 was identified. Buffering the medium showed not to work as culture is still shifting to pH 3 after 3 days culturing, which is quite unusual than culture used in several literatures (pH 6 using Hestin-schramm medium) (Machado et al., Komagataeibacter rhaeticus as an alternative bacteria for cellulose production. Carbohydrates Polymers. 2016. 152. 841-849).

Example 7 - Temperature optimization

Aim of study To optimize temperature during fermentation.

Materials and methods

To optimize temperature during fermentation, different temperatures during fermentation were evaluated in Hestin-Schramm medium. The medium containing 10% glucose concentration with 1.03 g/L citric acid and 6.03 g/L sodium biphosphate.

Results

The results are shown in table 5 below. Table 5. Cultivation temperature optimisation

*Wet weight including the initial culture added

Conclusion

Room temperature is the best condition for the culture to grow which is quite different from literature (30 C) (Machado et al., Komagataeibacter rhaeticus as an alternative bacteria for cellulose production. Carbohydrates Polymers. 2016. 152. 841-849).

Example 8 - Test of different fruit sources in the fermentation medium Aim of study

To evaluate different fruit sources as medium ingredient compared to Hestin- Schramm (HS) medium with different sugar types

Materials and methods Juices: The pasteurized juice (without any additional sugar/sucrose) was supplied from (Saftsusme or Rynkeby, Denmark) and diluted with culture or water to achieve desired sugar concentration

Whole fruit: Aronia or chokeberry (kind gift from AU-Food). The whole fruit was frozen before use, and processed just before use as medium.

Figure 4 shows shows a schematic diagram of producing whole fruit to fruit juices.

Hestin-Schramm medium: the medium containing 10% sugar (sucrose/glucose/fructose) with 1.03 g/L citric acid and 6.03 g/L sodium biphosphate.

Results

The results are shown in table 6 below.

Table 6. The production of BNC from fruit or whole fruit

Conclusion

It is shown that BNC can be produced from different fruit sources or tea produced better nanocellulose yield than generally used HS medium with sucrose/glucose/fructose. It is also shown that the higher medium ratio to culture gives higher BNC production.

Results

Results are shown in table 7 below. Table 7. The OD of culture after 95 H grown in apple juice or HS medium-glucose

Example 9 - Sterilization of obtained hydrogel

Aim of study

Since the hydrogel may comprise attached and trapped bacteria/fungi. It is important to sterilize the hydrogel from any entrapped/attached microorganisms before further use.

Materials and methods

Freshly- harvested bacterial cellulose hydrogels were first washed with warm tap water, followed by incubation in different NaOH/NaCICM concentrations overnight.

Results

The results are shown in table 8 below. Table 8. NaOH or NaCICM treatment for attached or trapped live bacterial elimination in BNC

Conclusion

The optimum NaOH concentration to eliminate all the attached and trapped bacteria while also resulting in a decolored BNC film was 1%. All the concentrations of NaCICM used shown to kill bacteria and resulted in all decolored BNC. For food applications, NaOH is preferred, since it does not contain Cl ions.

Example 10 - improved transparency

Aim of study To asses transparency of the material after acid treatment with nitric acid (HNO3).

Materials and methods and results A NaOH treated hydrogel from example 9, was used. Acid treatment is intended to improve the water resistancy of the film (hydrogel), after NaOH treatment, while further decolour the BNC from white to transparent. The nitro group from the modification of cellulose abundant OH-group was shown using AT-IR fingerprint from dried film. The nitro-group is determined using ratio from nitro:OH group stretch from the ATIR data.

Results are shown in table 9 below.

Table 9. Effect of HNO3 concentration to BNC film physical properties.

Transparent materials after treatment are shown in figure 5 after 0.5% and 1% treatment with HNO3. Further, the AT-IR fingerprint indicated a % of nitro-groups of 10-20% (% of substituted OH-groups) measured by the ratio of nitro:OH IR stretch. Nitro groups emerged at band 1250-1750 nm in the AT-IR fingerprint (not shown). Conclusion

Acid treatment with 0.5-1% HNO3 makes the hydrogel transparent and introduced nitro-groups in the material.

Example 11 - Optimization of drying and transparency. Aim of study

Optimization of drying to maintain transparency.

Materials and methods

A HNO3 treated hydrogel as from example 10, was used.

To result in transparent film, the wet thickness of the BNC film (hydrogel) should be controlled during harvest time. The drying time and condition are also important in achieving transparency of the film. The film should preferably be dried on an oily nonstick surface, such as a silicone mat.

Type of oil tested: Rapeseed and sunflower.

Results

Results are shown in table 10 below. Table 10. Temperature and drying condition to achieve fully transparent dry BNC film (ecoFLEXY).

Conclusion

The film should preferably be dried on an oily nonstick surface, such as a silicone mat. Optimal temperature is around 37°C for 15 hours. Without being bound by theory, it is believed that the vegetable oil C-H group is masking the BNC surface thus make it more transparent comparing with air-dried BNC which makes it more opaque.

Example 12 - Volatile solid content

Aim of study

To determine if the materials of the invention meets the requirements for packaging recoverable through composting and biodegradation.

Materials and methods Materials:

Tested material was dried BNC films with thickness 40-50 urn.

The European norm EN 13432 Requirements for packaging recoverable through composting and biodegradation - Test scheme and evaluation criteria for the final acceptance of packaging (2000), the French standard NF T51-800 Plastics - Specifications for plastics suitable for home composting (2015), the Canadian standard CAN/BNQ 0017-088 Specifications for compostable plastics (2010) and the international standard ISO 18606 Packaging and the environment - Organic recycling (2013), prescribe a minimum volatile solids content of 50% on total solids (TS).

The total solids or dry matter content is determined by drying at 105°C for at least 14 hours and weighing. Determination of moisture content'. The total solids content is given in percent on wet weight. The volatile solids and ash content is determined by heating the dried sample at 550°C for at least 4 hours and weighing. Determination of organic matter and carbon content'. The results are given in percent on total solids.

Results

The total solids content (TS), the moisture content, the volatile solids content (VS) on total solids and the ash content on total solids of the test item are shown in Table 11 below. Table 11. Total solids content, moisture content, volatile solids content and ash content of the material of the invention.

Conclusion

As outlined above, EN 13432 (2000), NF T51-800 (2015), CAN/BNQ 0017-088 (2010) and ISO 18606 (2013) prescribe a minimum volatile solids content of 50% on TS. The tested material had a volatile solids content of 87.8% on TS, thus being in compliance with these regulations.

Example 13 - Heavy metals-fluorine content

Aim of study

To determine if the materials of the invention meets the requirements in relation to heavy metal content as prescribed by EN 13432 (2000), NF T51-800 (2015), ASTM D6868 (2017) and CAN/BNQ 0017-088 (2010).

Materials , methods and results Materials:

Tested materials were dried BNC films with thickness 40-50 um.

Figure 6 shows heavy metals and fluorine content (ppm on total solids) for the material of the invention (here denoted EcoFLEXY) together with the required values for the above listed regulations.

Conclusion

All values are well below the maximum levels as prescribed by the standards.

Example 14 - Biodegradability study of biosheets/films

Aim of study

To test the Biodegradability the biosheets/films over 75 days Materials and methods

Materials:

Tested material was dried BNC films with thickness 40-50 urn. The controlled composting biodegradation test is an optimized simulation of an intensive aerobic composting process where the biodegradability of a test item under dry, aerobic conditions is determined. The inoculum normally consists of stabilized and mature compost derived from the organic fraction of municipal solid waste (MS ). The test item is mixed with the inoculum and introduced into a static reactor vessel where it is intensively composted under optimal oxygen, temperature and moisture conditions. During the aerobic biodegradation of organic materials, a mixture of gases, principally carbon dioxide and water, are the final decomposition products while part of the organic material will be assimilated for cell growth. The carbon dioxide production is continuously monitored and integrated to determine the carbon dioxide production rate and the cumulative carbon dioxide production. After determining the carbon content of the test compound, the percentage of biodegradation can be calculated as the percentage of solid carbon of the test compound, which has been converted to gaseous, mineral C under the form of CO2. Also the kinetics of the biodegradation can be established.

According to the French standard "NF T 51-800 Plastics - Specifications for plastics suitable for home composting (2015)" the test is considered as valid if the percentage of biodegradation for the reference item is more than 70% after 90 days; The deviation of the percentage of biodegradation for the reference item in the different vessels is less than 20% at the end of the test; The compost inoculum in the blank control has produced more than 10 and less than 50 mg of CO2 per g of volatile solids (mean values) after 10 days of incubation.

Results Results are shown in table 12 below.

Table 12. TOC, net CO2 production and biodegradation after 45 and 165 days.

With AVG average, SD = standard deviation, REL = relative biodegradation, and CL = confidence limits

Conclusion The biodegradation of reference item cellulose started almost immediately and proceeded at a good rate. After 23 days, cellulose was already degraded by 71.0%, while after 46 days a biodegradation of 79.1% ± 1.0% was found. The reinoculation with 20% and 10% fresh VGF (Vegetable, Garden and Fruit waste) after respectively 47 and 117 days caused no significant increase in biodegradation rate and at the end of the test (165 days) a plateau in biodegradation was reached at a level of 83.5% ± 2.3%. The test is considered valid if after 90 days the biodegradation percentage of the reference item is more than 70% and if the standard deviation of the biodegradation percentage of the reference item is less than 20% at the end of the test. Both requirements were fulfilled.

Example 15 - Nitrocellulose optimization for food contact application

Aim of study

To evaluate whether these products comply with the requirements of 1935/2004/EC, 2023/2006/EC, and the Danish food contact regulation Bekendtgorelse nr. 822 of 26.06.2013.

Materials and methods Materials: Tested material was dried BNC films with thickness 40-50 um with additional 1 layer (5 pm) of 0.25% nitrocellulose on one side.

Nitrocellulose is a cellulose derivative, which can be degraded by cellulase enzyme (secreted by soil bacteria or fungus) at room temperature. It has property of being transparent and water resistance. Thus, nitrocellulose was used for layering the material (EcoFLEXY) to add water resistance. However, there is limit in its application due to several chemical impurities from its production. Based on the food safety assessment, the limit of nitrocellulose layering is 20 mg/dm3 (equal to 1% nitrocellulose layer to cover A4 paper with thickness 10 micron).

Conclusion

It was concluded that nitrocellulose coated materials comply with the requirements of 1935/2004/EC, 2023/2006/EC, and the Danish food contact regulation Bekendtgorelse nr. 822 of 26.06.2013.

Example 16 - Properties of material (EcoFLEXY) with different layer compositions

Aim of study:

To determine ecoFLEXY and its derivatives chemical composition and physical properties after nitrocellulose coating.

Samples:

Materials and methods Materials:

Nitrocellulose in ether/ethanol and ethanol (sigma Aldrich, Denmark).

Methods:

The dried BNC films were sprayed with 5 ml_ 0.25% nitrocellulose in ethanol using tatoo-spraying equipped with air compressor. The coating was done until the nitrocellulose layer was formed homogenously on the dried BNC surface.

Tested materials:

A. ecoFLEXY (dried BNC)

B. ecoFLEXY with 1 side 0.25% nitrocellulose (NC) C. ecoFLEXY with 2 side 0.25% nitrocellulose (NC)

Results

A. SEM imaging: SEM imaging (Figure 7) shows that ecoFLEXY has 10 nm wide BNC fibril with length between 25-100 mhi. Addition of nitrocellulose formed layer on the top of the fibril, covering the available hydrophilic OH group with hydrophobic nitro group.

B. AT-IR analysis: The overall fingerprint from AT-IR test showed that ecoFLEXY is indeed cellulose. There are several fingerprints that can be extracted such as nitro group on the nitrocellulose modified ecoFLEXY for sample B and C. It could also be seen that the nitrocellulose does not penetrate to other side of the film.

- OH group: 3000-3500 nm - Nitro group: 1250-1750 nm

C. Tensile strengths:

Table 13. Longitudinal and cross direction tensile strength or ecoFLEXY and its derivatives

D. Puncture test:

Penetration testing is very similar to compression testing with one key difference, the penetrometer probe is typically much smaller than the sample being tested and passes completely through a sample or an element of the product. Puncture is similar, meaning the probe passes into the sample, though not necessarily exiting. This test method can be performed on a wide variety of food products and is a very useful test in simulating a bite or in comparative analysis.

Table 14. Puncture resistance of ecoFLEXY and its derivatives

E. Oxygen permeability:

To compare the Oxygen Transmission data, the thickness of the samples are converted to 40 pm thick samples. To make this conversion we assume that the structure of the material is the same throughout the sample. Therefore, these numbers are only indications of the barrier properties for a 40 pm thick sample.

Table 15. Oxygen permeability of ecoFLEXY and its derivatives

F. Water permeability: To make this conversion we assume that the structure of the material is the same throughout the sample, which may not be the case. Therefore, these number are only indications of the barrier properties for a 40 pm thick sample.

Table 16. Water permeability of ecoFLEXY and its derivatives (in gradient of 100%RH)

G. Water vapour transmission rate (WVRT)

To evaluate the ability of EcoFLEXY in adsorb water from the product and desorb water to the atmosphere. Dessicant method

The water vapor transmission rate (WTR) measured three different places on one sheet is measured according to the ASTM standard F 1249. The method measures how much water is transferred from the air above the film. Water method

The water vapor transmission rates measured on both the three different places on the same sheet and on the 10 different sheets were performed with an Electrometer 5100 Payne Permeability Cup. The device was weighed initially and left in a temperature and humidity controlled room for at least 24 hours before it was finally weighed again. At each weight measurements, temperature and humidity were noted. WTR can be calculated by the differences in weight over time.

Table 17. WTR using dessicant method measured three placed on the same cellulose sheet.

Table 18. WTR using the water method measured three placed on the same cellulose sheet.

The water vapor transmission rate was measured three different places using both the desiccant method, where calcium chloride is used and the water method where demineralized water is used. The results show that the difference between the rates for evaporating water through the cellulose films are >500 times higher compared to letting water from the air into the films.

H. Haze level (opaque/transparency):

Haze is cloudiness of a product that is caused by scattering of light. Light may be scattered by particles suspended in the substance, such as pigment particles or contaminants, or by an imperfect surface caused by dirt, oil, or a fine texture. Haze is an important appearance attribute which can be quantified and then used to assess the quality of objects such as liquids, glass, plastics, painted panels, and even metals.

Transmission haze is defined as the forward scattering of light from the surface of a nearly clear specimen viewed in transmission. Normally, light scattered back through the sample is not included. Also, only light scattered more than 2.5° from the incident light is considered to contribute to haze. When measuring haze, the percentage of light diffusely scattered compared to the total light transmitted is reported

Table 19. The haze and total transmittance of ecoFLEXY and its derivatives

Thermogravimetric analysis (TGA)

Thermogravimetric analysis (TGA) is conducted to measure mass while the temperature of a sample is changed over time. This test was conducted to know the stability of the material in different temperature.

It is shown that ecoFLEXY and its derivatives is stable up to 300°C before it burns. Table 20. The TGA analysis of ecoFLEXY and its derivatives

Conclusion

Addition of nitrocellulose forms layer on the top of the fibril, covering the available hydrophilic OH group with hydrophobic nitro group.

In addition, the above data shows that the material of the invention may have a high water resistance (adjustable), high strength (adjustable), O2 transmission can be adjusted, transparency and burn resistance. Example 17 - Sealing layer/sealant

Aim of study

To develop a sealing for the material of the invention.

Materials and methods Methyl cellulose (MC), carboxymethyl cellulose (CMC) and ethanol were from Sigma Aldrich, Denmark. Methods:

The MC or CMC (1 g) was dispersed in 5% ethanol, then 2 ml_ boiled water was added. Final gel was formed by addition 8 ml_ of cold water. Stirring and vigorous mixing was necessary to avoid clumps.

Initially, preliminary experiment to see the possibility of using cellulose-based glue to adhere 2 cellulose layers together found that both sodium Carboxymethylcellulose (CMC) and methylcellulose (MC) solutions are usable as adhesive material for cellulose. However, MC has lower adhesion strength compared to CMC, so the experiment was carried further using CMC. Then application method was explored. It was either by applying the CMC glue directly as needed to seal the sheets, or by applying a layer of dry CMC on the cellulose sheets, followed by rehydration as necessary. The second method was more interesting, as it meant that only by applying water to the area where sealing is desired, then heating/drying the area of contact, adhesion can be achieved with a relatively good strength. It has been found to be concentration-dependent; the higher CMC concentration used, the stronger the adhesion, up to the point where the adhesion strength is stronger than the material's strength (i.e. the material broke before the adhesion was broken). Figure 8 shows different materials sealed inside a package consisting of the material of the invention.

Conclusion

It is possible to apply a sealing to the material, while keeping the material a "pure" cellulose material. The adhesive may be sodium Carboxymethylcellulose (CMC) and/or methylcellulose (MC), depending on the desire strength of the adhesion.

Example 18 - Disintegration test

Materials: The material was dried BNC films with thickness 40-50 um.

Methods: Test item EcoFLEXY was put into slide frames and mixed with compost inoculum. The obtained mixture is incubated in the dark at ambient temperatures (28°C ± 2°C). The test is performed in 2 replicates (qualitative evaluation).

Results

Figure 9 gives a visual presentation of the evolution of the disintegration of test material EcoFLEXY during 4 weeks of composting at ambient temperature. The disintegration of EcoFLEXY has started and has proceeded very swiftly. Already after 1 week of composting small holes started to appear in the test material. One week later by far the major part of the test material had disappeared. Only some small test item pieces remained present at the borders of the slide frames. The disintegration proceeded and after 4 weeks of composting all slide frames were completely empty and no test item pieces remained present in the test reactors (Figure 10).

As complete disintegration was obtained, the test was stopped after 4 weeks of composting.

Conclusion

The material according to the invention shows superior disintegration abilities in a composting test. In fact, a material with thickness 40-50 pm (dried BNC films after basic/acid treatment) will be disintegrated in soil after 4 weeks.

Example 19 - Utilization of antioxidants/polyphenols in the medium

Aim of study

To evaluate the effect of antioxidant/polyphenols addition in the medium to the BNC production.

Materials and methods

The nanocellulose production was evaluated using Hestin-Schramm medium: the medium containing 10% sucrose with 1.03 g/L citric acid and 6.03 g/L sodium biphosphate with varied antioxidant/phoplyphenols concentration.

Results Results are shown in table 21 below.

Table 21. The effect of polyphenol in medium to BNC production

Conclusion It is shown that BNC production can be enhanced using addition of antioxidant/polyphenols in certain concentrations. Theaflavins enhanced BNC production up to 100% at the concentration approximately 30 g/L. Lower or higher concentrations of theaflavins in the medium yielded less BNC production. Epicathecin or ascorbic acid at certain concentration only enhances 10-20% BNC production.

Claims

1. A process for producing bacterial nanocellulose (BNC), the process comprising a) culturing in a liquid culturing medium o Komagataeibacter rhaeticus; o Gluconobacter oxydans; o at least one of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera lindneri ; and b) removing a hydrogel comprising BNC from the liquid medium, thereby providing bacterial nanocellulose (BNC).

2. The process according to claim 1, comprising at least two of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera lindneri, such as at least three or such as at least all four strains.

3. The process according to claim 1 or 2, comprising one or both of Hanseniaspora uvarum and Brettanomyces bruxellensis.

4. The process according to claim 1, wherein the culturing medium in step a) comprises fruit juice and/or vegetable juice, such as filtered or unfiltered fruit or vegetable juice, or tea.

5. The process according to claim 1 or 2, wherein the fruit juice is selected from the group consisting of apple, strawberry, blackberry, aronia, chokeberry, grape, plum, cranberry, pea, orange, banana and combinations thereof.

6. The process according to claim 1 or 2, wherein the vegetable juice is selected from the group consisting of potato, carrot, beet, sugar beet and combination thereof.

7. The process according to claim any of the preceding claims, wherein the culturing medium in step a) comprises fruit and/or vegetable parts such as peels, pulp and/or juices.

8. The process according to any of the preceding claims, wherein the culturing medium is not sterilized before the bacteria and yeasts are applied to the medium.

9. The process according to any of the preceding claims, wherein the culturing medium in step a) comprises

- a sugar content in the range 5-15% sucrose (w/w), preferably such as 7- 13% (w/w), even more preferably 8-12% (w/w).

10. The process according to any of the preceding claims, wherein the culturing medium in step a) has a pH value in the range 2.5 - 4, preferably such as in the range 2.8 - 3.8, more preferably in the range 3-3.5.

11. The process according to any of the preceding claims, wherein step a) is performed at a temperature in the range 15-30°C, such as 15-27°C, preferably such as 18-23°C, more preferably such as 20-23°C.

12. The process according to any of the preceding claims, wherein the culturing in step a) is aerobic fermentation, preferably static aerobic fermentation, such as without shaking.

13. The process according to any of the preceding claims, wherein air is supplied to the medium, by aeration outside the culturing container, such as by aerating a flow tube outside the culturing container.

14. The process according to any of the preceding claims, wherein the numerical ratio between Komagataeibacter rhaeticus and Gluconobacter oxydans is in the range 10: 1 to 1: 10, such as 10: 1 to 1:3, such as 10: 1 to 1: 1, preferably 7: 1 to 2: 1, more preferably 5: 1 to 2: 1, such as around 3: 1.

15. The process according to any of the preceding claims, wherein the ratio by weight between culturing medium and culture is in the range 5: 1 to 1:2, such as 5: 1 to 1: 1, preferably 5: 1 to 2: 1, more preferably 4: 1 to 2: 1, such as around 3: 1.

16. The process according to any of the preceding claims, wherein the culturing in step a) takes place for a period of 2-10 days at room temperature, preferably 3-7 days, even more preferably 4-6 days.

17. The process according to any of the preceding claims, wherein the BNC hydrogel in step b) is removed from the surface of the culturing medium or from the interphase between surface and culturing medium.

18. The process according to any of the preceding claims, wherein the BNC hydrogel in step b) is removed, when it has a thickness in the range 0.2 cm to 2 cm, such as in the range 0.3 to 1 cm, preferably in the range 0.5 to 1 cm, more preferably 0.6-0.8 cm, such as around 0.7 cm.

19. The process according to any of the preceding claims, wherein the remaining culturing medium after removal of the BNC hydrogel in step b) is used as an inoculum in a new culturing step a).

20. The process according to any of the preceding claims, wherein the process further comprises a step c) of sterilizing the provided BNC hydrogel.

21. The process according to claim 20, wherein the sterilization in step c) is performed by incubation in a base such as NAOH and/or NaCICM.

22. The process according to claim 20 or 21, wherein the sterilization in step c) is performed in

- 0.3- 2% (w/w) NaOH, preferably 0.5-1%; or

- 0.5- 5% (w/w) NaCI04, preferably 0.5- 5%.

23. The process according to any of the preceding claim, further comprising a step d) of treating the sterilized BNC hydrogel with acid, to provide a transparent BNC gel.

24. The process according to claim 23, wherein the acid treatment is performed in HNO3, more preferably at a concentration of 0.3 to 2% (w/w), even more preferably at a concentration of 0.5 to 1% (w/w).

25. The process according to any of the preceding claims, further comprising a step e) of drying the provided BNC hydrogel, to provide a dried BNC material.

26. The process according to claim 25, wherein the drying step e) is performed at a temperature in the range 30-40°C such as for 10-20 hours, preferably at 33-

39°C for 12-18 hours.

27. The process according to claim 25 or 26, wherein the drying is performed on a non-stick surface such as on silicone, preferably an oil-coated non-stick surface such as silicone surface, such as coated with rapseed oil or sunflower.

28. The process according to any of claims 25-27, wherein the provided dried BNC material has a thickness in the range 10-100 pm, preferably 10-60 pm, more preferably 20-60 pm.

29. The process according to any of the preceding claims, wherein the process further comprises a step f) of coating the dried BNC material with nitrocellulose, such as coating with a 0.1 to 5% (w/w) solution of nitrocellulose, such as a 0.1 to 3%, such as 0.1 to 2%, preferably 0.5- 1.5%, and more preferably 0.8- 1.2%.

30. The process according to claim 29 wherein a nitrocellulose layer is coated on each side of the dried BNC material.

31. The process according to any of the preceding claims, wherein the liquid culturing medium comprises tea, preferably black tea.

32. The process according to any of the preceding claims, wherein the liquid culturing medium comprises one or more antioxidants and/or polyphenols.

33. The process according to claim 32, wherein the polyphenols are Theaflavins or derivatives thereof, wherein the derivative thereof comprises a tropolone moiety.

34. The process according to claim 33, wherein the one or more Theaflavins or derivatives thereof are selected from the group consisting of Theaflavin, Theaflavin-3-gallate, Theaflavin-3'-gallate, and Theaflavin-3-3'-digallate.

35. The process according to any of the preceding claims wherein the liquid culturing medium comprises one or more polyphenols, such as Theaflavin, at a concentration in the range 5-100 g/l, such as in the range 5-80 g/l, preferably in the range 20-50 g/l, and more preferably 30-40 g/l.

36. A BNC material obtained/obtainable from a process according to any of claims 1-30.

37. The BNC material according to claim 36, wherein the material is transparent.

38. The BNC material according to any of claims 36-37, wherein the material has a HAZE level above 85 % measured according to ASTMD 1003:2013.

39. The BNC material according to any of claims 36-38 having

40. The BNC material according to any of claims 36-39, being in compliance with EN 13432 (2000), NF T51-800 (2015), ASTM D6868 (2017) and/or CAN/BNQ 0017-088 (2010) in relation to heavy metal content and fluorine content.

41. The BNC material according to any of claims 36-40, being in compliance with EN 13432, the French standard NF T51-800, the Canadian standard CAN/BNQ 0017-088 and/or the international standard ISO 18606 (2013) in relation to minimum volatile solids content of 50% on total solids (TS).

42. The BNC material according to any of claims 36-41, being biodegradable.

43. The BNC material according to any of claims 36-42, being in compliance with biodegradability according to the French standard NF T 51-800 (Plastics - Specifications for plastics suitable for home composting (2015)).

44. The BNC material according to any of claims 36-43, being compostable.

45. The BNC material according to any of claims 36-44, being in compliance with

1935/2004/EC, 2023/2006/EC, and/or the Danish food contact regulation Bekendtgorelse nr. 822 of 26.06.2013.

46. The BNC material according to any of claim 36-45, being water resistant.

47. The BNC material according to any of claim 36-46, having a

- a cross direction tensile strength of at least 5 MPa, such as at least 10 MPa, preferably of at least 12 MPa.

48. The BNC material according to any of claim 36-47, having a puncture resistance of at least 10N.

49. The BNC material according to any of claim 36-48, having an oxygen permeability of 5-262 ml/(m2 x day x atm (bar)).

50. The BNC material according to any of claim 36-49, being burn resistant up to 300°C.

51. A process for sealing/gluing one or more BNC materials together, the process comprising using methylcellulose (MC) and/or Carboxymethylcellulose (CMC) as a sealant/glue to adhere two parts of the BNC material together.

52. The process according to claim 51, wherein the sealing is performed by heat sealing.

53. The process according to claim 51 or 52, wherein a product has been sealed inside the one or more BNC materials.

54. The process according to any of claims 51-53, wherein the product is selected from the group consisting of solid products such as a food product, a cosmetic product, and table wear.

55. A film comprising

- a base layer comprising bacterial nanocellulose (BNC), wherein 1-50%, such as 5-40%, preferably 5-30% or more preferably 10-20% of the hydroxyl groups are replaced with nitro groups;

- a nitrocellulose layer; and

- optionally a sealing layer comprising MC or CMC on at least part of the film.

56. The film layer according to claim 51, wherein a nitrocellulose layer is present on both sides of the base layer.

57. The film layer according to claim 55 or 56, wherein the base layer has a thickness in the range 10-100 pm, preferably 10-60 pm, more preferably 20-60 pm; and/or the nitrocellulose layer has a thickness in the range of 1-10 pm.

58. Use of a BNC material according any of claims 36-50 or the film layer according to any of claims 55-57 as a packaging material, a sheet, a bag, a wound dressing or a bandage.

59. The use according to claim 58, for packaging fresh fruit.

60. Use of a hydrogel material obtained by a process according to any of claims 1- 24 as a wound dressing, a facial mask, a thickener such as for food or cosmetics.

61. Use of a composition comprising o Komagataeibacter rhaeticus; o Gluconobacter oxydans; and o at least one of Hanseniaspora uvarum, Brettanomyces bruxellensis, Zygosaccharomyces bailii and Kloeckera lindneri ; for production of BNC.

62. The BNC material according any of claims 36-50 for use as a medicament.

63. The BNC material according any of claims 36-50 for use as a wound dressing, with the proviso that the BNC material is a hydrogel.

64. A product packed in a material according to any of claims 36-50 or the film according to any of claim 55-57.

65. The product according to claim 64, wherein the product is selected from the group consisting of food, such as dried fruit, fresh fruit, prepacked food, cosmetics, such as soap, a packed shampoo, table wear, house hold vegetable garbage and house hold fruit garbage.