WO2021060914A1

WO2021060914A1 - Anti-claudin-3 chimeric antigen receptor

Info

Publication number: WO2021060914A1
Application number: PCT/KR2020/013072
Authority: WO
Inventors: 신영기; 김성수; 양호빈; 이지혜; 이. 그래햄티모시; 아라우호파트리씨아 로사 데
Original assignee: (재)록원바이오융합연구재단
Priority date: 2019-09-26
Filing date: 2020-09-25
Publication date: 2021-04-01
Also published as: KR20210037581A

Abstract

The present invention relates to a chimeric antigen receptor (CAR) comprising a claudin-3 binding domain. Immune cells modified to express the chimeric antigen receptor of the present invention recognize and bind claudin 3 (particularly ECL-2 domain) exposed specifically on cancer cells relative to normal cells, especially solid cancer cells. In particular, the chimeric antigen receptor of the present invention comprises an antibody binding specifically to ECL-2 and a functional fragment thereof and has higher selectivity and binding affinity than conventional antibodies targeting ECL-1. Therefore, the immune cells having the chimeric antigen receptor of the present invention expressed thereon effectuate strong anticancer effects particularly on solid cancers while exhibiting low toxicity.

Description

Anti-Claudin-3 Chimeric Antigen Receptor

The present invention relates to an anti-cladin-3 chimeric antigen receptor, and more particularly, to the use of immune cells comprising the chimeric antigen receptor for the prevention or treatment of cancer.

Claudin (CLDN) is a major essential membrane protein for tight junctions (TJ) between cells. In the case of mammals, there are 27 families, and in the case of humans, the claudin family excluding claudin 13 in mammals. The claudin family has a similar structure that penetrates the cell wall and is embedded in it, and most have a structure with two extracellular loops. Claudin is known to play a role in controlling the flow of molecules between cells, but recent studies have reported that it is closely related to the occurrence of cancers such as colon cancer, gastric cancer, breast cancer, esophageal cancer, and ovarian cancer. About 90% of malignant tumors originate from the epithelium. In normal epithelial cells, the cells are located parallel to the epithelial plane. Therefore, claudin, which constitutes TJ between normal epithelial tissues, is difficult to detect on the surface of tissues or organs, but in the early stages of epithelial tumor development, control of the mitotic spindle is released, and cells proliferate by out-of-plane division. And claudin is exposed to the tissue surface.

In particular, it has been reported that claudin-3 and claudin-4 are overexpressed among the claudin family in ovarian cancer, which is known to have a poor prognosis because there is no obvious symptom and there is no appropriate treatment method other than surgery and chemotherapy (Claudin Proteins in Human Cancer: Promising New Targets for Diagnosis and Therapy, PJ Morin, Cancer Res. 65: 9604-9006 (2005)). In addition, as a result of confirming the survival rate of 84 patients with ovarian serous adenocarcinoma and the expression rate of claudin 3 by the survival curve of the Kaplan-Meier technique, a study was reported that the expression rate of claudin 3 was closely related to the shortening of the patient's lifespan. (Expression profile of tight junction protein claudin 3 and claudin 4 in ovarian serous adenocarcinoma with prognostic, Choi et al ., Histol. Histopathol. 22:1185~1195 (2005)). As described above, the increase or decrease of the expression of claudin with high specificity in cancer tissues can be used as a predictive indicator for cancer production, and as claudin becomes a useful biomarker in the diagnosis and treatment of cancer, a therapeutic agent targeting claudin in various groups. Trying to develop.

Meanwhile, a chimeric antigen receptor (CAR) is a receptor engineered to contain one or more intracellular signaling domains and antigen binding domains for immune cell activation. Chimeric antigen receptor-immunocytes introduced into immune cells such as cytotoxic T cells and natural killer cells (hereinafter referred to as NK cells) engineered to express chimeric antigen receptors on the surface are antigens to which the antigen-binding domain binds. It is targeted and activated by binding to the antigen, causing an immune response against cells expressing the antigen.

The antigen-binding domain of a chimeric antigen receptor is generally a monoclonal antibody or a functional fragment thereof (eg, single-chain variable fragment, scFv). That is, the chimeric antigen receptor is designed to recognize an antigen in a non-MHC-restricted manner, and thus is a receptor capable of targeting the antigen regardless of the type of HLA to which the chimeric antigen receptor immune cell is administered.

Over the past decade, a number of chimeric antigen receptors have been reported that target a variety of cell surface tumor antigens. The effect on the second-generation chimeric antigen receptor to which the intracellular signaling domain derived from the immune co-stimulatory molecule is added compared to the first-generation chimeric antigen receptor consisting of an antigen-binding domain, an intracellular signaling domain, and a transmembrane domain connecting them. Was dramatically improved. The third-generation chimeric antigen receptor is designed to contain two or more intracellular signaling domains derived from co-stimulatory molecules compared to the first-generation chimeric antigen receptor in order to improve the proliferative ability and persistence of modified T cells.

However, treatment using immune cells into which chimeric antigen receptors have been commercialized so far is limited to hematologic cancer. In solid cancer, there are cases where the tumor cell-derived chemokine and the chemokine receptor on the immune cell do not match. In this case, it is difficult to induce and penetrate into the tumor location. This is because immune cells administered in an inhibitory tumor microenvironment such as an environment adverse to secretion and cell survival (eg, nutrient deficiency, oxidative stress, hypoxia) are difficult to produce the intended effect.

In this situation, the present inventors completed the present invention by devising a chimeric antigen receptor and an immune cell therapeutic incorporating the chimeric antigen receptor having a specific high binding ability to claudin 3, which is specifically expressed in solid cancer cells compared to normal cells.

The technical problem to be achieved by the present invention is i) Claudin-3 binding domain; ii) transmembrane domain; And iii) an intracellular signaling domain.

Another technical problem to be achieved by the present invention is to provide a polynucleotide encoding the chimeric antigen receptor.

Another technical problem to be achieved by the present invention is to provide a recombinant vector comprising the polynucleotide.

Another technical problem to be achieved by the present invention is to provide an isolated host cell comprising the chimeric antigen receptor.

Another technical problem to be achieved by the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising the host cell as an active ingredient.

The technical problem to be achieved by the present invention is not limited to the technical problems mentioned above, and other technical problems that are not mentioned can be clearly understood by those of ordinary skill in the technical field to which the present invention belongs from the following description. There will be.

As one aspect for achieving the above technical problem, the present invention is i) Claudin-3 binding domain (Claudin-3 binding domain); ii) transmembrane domain; And iii) an intracellular signaling domain.

Here, the binding domain may specifically bind to a second extracellular loop (ECL-2) region of claudin-3, and the second extracellular loop region of claudin-3 is represented by SEQ ID NO: 2 It may include an amino acid sequence.

The claudin-3 binding domain may be an antibody or a functional fragment thereof. The antibody is selected from the group consisting of IgG, IgA, IgM, IgE and IgD, and the functional fragment is a diabody, Fab, F(ab'), F(ab')2, Fv, dsFv, and scFv. It may be selected from the group consisting of.

The claudin-3 binding domain is a heavy chain complementarity determining region 1 (VH-CDR1) comprising an amino acid sequence represented by SEQ ID NO: 3, a heavy chain complementarity determining region 2 (VH-CDR2) comprising an amino acid sequence represented by SEQ ID NO: 4 , And a heavy chain variable region comprising a heavy chain complementarity determining region 3 (VH-CDR3) comprising the amino acid sequence represented by SEQ ID NO: 5; And light chain complementarity determining region 1 (VL-CDR1) comprising the amino acid sequence represented by SEQ ID NO: 6, light chain complementarity determining region 2 (VL-CDR2) comprising the amino acid sequence represented by SEQ ID NO: 7, and SEQ ID NO: 8. The epitope that includes the light chain variable region including the light chain complementarity determining region 3 (VL-CDR3) containing the indicated amino acid sequence or recognized by the claudin-3 binding domain including the heavy chain variable region and the light chain variable region It could be a competitive combination.

The claudin-3 binding domain is a heavy chain complementarity determining region 1 (VH-CDR1) comprising an amino acid sequence represented by SEQ ID NO: 9, a heavy chain complementarity determining region 2 (VH-CDR2) comprising an amino acid sequence represented by SEQ ID NO: 10. , And a heavy chain variable region comprising a heavy chain complementarity determining region 3 (VH-CDR3) comprising the amino acid sequence represented by SEQ ID NO: 11; And light chain complementarity determining region 1 (VL-CDR1) comprising the amino acid sequence represented by SEQ ID NO: 12, light chain complementarity determining region 2 (VL-CDR2) comprising the amino acid sequence represented by SEQ ID NO: 13, and SEQ ID NO: 14. The epitope that includes the light chain variable region including the light chain complementarity determining region 3 (VL-CDR3) containing the indicated amino acid sequence or recognized by the claudin-3 binding domain including the heavy chain variable region and the light chain variable region It could be a competitive combination.

The claudin-3 binding domain is a scFv comprising an amino acid of SEQ ID NO: 15 or 16 or an amino acid having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% complementarity with the amino acid sequence. I can.

The intracellular signaling domain is CD3 zeta (ξ, zeta), TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, CD278, CD66d, DAP10, DAP12, FcεRI And it may be characterized in that it is derived from a protein selected from the group consisting of a combination thereof.

The chimeric antigen receptor may be characterized in that it further comprises a costimulatory domain. The costimulatory domains are MHC class I molecules, TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, SLAM proteins (signaling lymphocytic activation molecules), NK cell activating receptors, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1 , LFA-1(CD11a/CD18, lymphocyte function-associated antigen-1), 4-1BB(CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR) , KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6 , CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE/RANKL , DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108 ), S LAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, CD19a, a ligand that specifically binds to CD83, PD-1 and It may be characterized in that it is derived from a costimulatory molecule selected from the group consisting of a combination thereof.

The transmembrane domain is TCR alpha chain, TCR beta chain, TCR zeta chain, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, It may be characterized by being derived from a protein selected from the group consisting of CD154 and CD8.

The chimeric antigen receptor may further include a hinge.

The chimeric antigen receptor may further include a leader sequence at the N-terminus.

The chimeric antigen receptor may be characterized in that it comprises a sequence selected from the group consisting of SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.

Another aspect of the present invention provides a polynucleotide encoding the chimeric antigen receptor.

Another aspect of the present invention provides a recombinant vector comprising the polynucleotide.

Another aspect of the present invention provides an isolated host cell comprising the chimeric antigen receptor.

Here, the host cell may be obtained from a subject to which the host cell is to be administered, or may be obtained from an allogeneic subject other than the subject to which the host cell is to be administered.

The host cells are mesenchymal stem cells (MSCs), dedifferentiation inducing stem cells (iPSCs), CD34 cells, hematopoietic endothelial cells, hematopoietic stem cells (HSCs), hematopoietic pluripotent progenitor cells, embryonic stem cells (ESCs), or immune cells. It can be. The immune cells may be selected from the group consisting of T cell precursors, NK cell precursors, T cells, NK (Natural Killer) cells, NKT (Natural Killer T) cells, B cells, monocytes, macrophages, and dendritic cells. .

Another aspect of the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the host cell as an active ingredient.

Here, the cancer is selected from the group consisting of ovarian cancer, colon cancer, bladder cancer, lung cancer, liver cancer, gastric cancer, esophageal cancer, breast cancer, prostate cancer, pancreatic cancer, uterine cancer, cervical cancer, melanoma, colon cancer, kidney cancer, and metastatic pleural tumor. I can.

The above-described problem solving means are merely exemplary and should not be construed as limiting the present invention. In addition to the above-described exemplary embodiments, additional embodiments may exist in the drawings and detailed description of the invention.

The immune cells modified to express the chimeric antigen receptor of the present invention recognize and bind to the claudin 3 (particularly, the ECL-2 region) specifically exposed in cancer cells, especially solid cancer cells, compared to normal cells. In particular, the chimeric antigen receptor of the present invention contains an antibody that specifically binds to ECL-2 and functional fragments thereof, and has higher selectivity and avidity than conventional antibodies targeting ECL-1. Therefore, the immune cells expressing the chimeric antigen receptor of the present invention may exhibit a particularly strong anticancer effect against solid cancer and at the same time exhibit low toxicity against normal cells not exposed to claudin-3.

The effects of the present invention are not limited to the above effects, and should be understood to include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

1 is a flow cytometry result of binding to CHO-K1 cells (negative cell line, control) for scFvs selected using CHO-CLDN3 cell line biopanning and L-Claudin-33 cell line ELISA to be.

2 is a flow cytometry result of binding to CHO-CLDN3 cells for scFvs selected using CHO-CLDN3 cell line biopanning and L-Claudin-3 cell line ELISA.

3 is an SDS-PAGE test result for IgG antibody proteins produced under reducing and non-reducing conditions, respectively.

Figure 4a is the phylogenetic relationship of claudin families.

Figure 4b is the extracellular first loop (EL1, Extracellular 1st loop) and extracellular second loop (EL2, Extracellular 2nd) of CLDN4, CLDN5, CLDN6, CLDN8, CLDN9, CLDN17 and CLDN1 and mouse CLDN3 located phylogenetic close to CLDN3. loop) region shows sequence homology.

5A and 5B show that HEK293 cells transformed to express each of the human claudin family proteins (CLDN1, CLDN3, CLDN4, CLDN5, CLDN6, CLDN8, CLDN9, CLDN17) were treated with the 4G3 antibody of the present invention and flow cytometric analysis. , It is a result of confirming the specific binding ability to CLDN3 expressing cells.

5C is a result of confirming the binding ability to CLDN3 expressing cells by treating HEK293 cells transformed to express mouse CLDN3 with the 4G3 antibody of the present invention and performing flow cytometry.

6 shows OVCAR-3 and Caov-3, which are cell lines overexpressing claudin 3 as ovarian cancer, and TOV-112D, a cell line with very low claudin 3 expression, and hCLDN3/TOV-112D cells transformed to overexpress CLDN3. This is a result of comparatively confirming the binding specificity of the 4G3 antibody by treating the 4G3 antibody of the present invention and performing flow cytometry.

7 shows the results of immunoprecipitation analysis using the 4G3 antibody of the present invention for OVCAR-3, Caov-3, TOV-112D and hCLDN3/TOV-112D cells (input: cell lysate).

Figure 8a shows the results of immunofluorescence staining for OVCAR-3, Caov-3, TOV-112D and hCLDN3/TOV-112D cells using a control antibody (control IgG).

8B is a result of immunofluorescence staining for OVCAR-3, Caov-3, TOV-112D and hCLDN3/TOV-112D cells using 4G3 antibody.

9A is a result of flow cytometry analysis of binding of an antibody of the present invention (4G3 IgG) to CHO-K1 cells (negative cell line, control).

9B is a result of flow cytometry analysis of binding of the antibody (4G3 IgG) of the present invention to CHO-CLDN3 cells (positive cell line, control).

9C is a result of measuring the binding affinity (dissociation constant (KD)) of the antibody (4G3 IgG) of the present invention in CLDN3 expressing cells (hCLDN3/HEK293 and hCLDN3/TOV-112D) by LigandTracer Green (ridgeview).

Figure 10a is a fusion protein comprising a region of amino acids 1 to 104 of CLDN1 as an extracellular 1st loop (EL1) and a region of amino acids 104 to 220 of CLDN3 as an extracellula 2nd loop (EL2). In cells expressing (hCLDN1-3/HEK293) and cells (hCLDN3-1/HEK293) expressing a fusion protein comprising a CLDN3 amino acid 1-103 region as EL1 and a CLDN1 amino acid 105-211 region as EL2, It is a schematic diagram of the expression (structure) pattern of each fusion protein.

Figure 10b is a result of flow cytometric analysis of hCLDN1-3/HEK293 or hCLDN3-1/HEK293 cells treated with 4G3 antibody (top), and Western blotting results confirming whether the desired fusion protein was properly expressed in the cells. (lower).

11A is a result of confirming the in vivo tumor targeting ability of the 4G3 antibody of the present invention in a tumor xenograft animal model, and FIG. 11B is a result of quantifying fluorescence intensity after organ extraction in the animal model.

12 is a schematic diagram of an embodiment of a vector containing a nucleic acid encoding a CAR having a 4G3 scFv as an extracellular domain.

FIG. 13 is an image confirming the expression of RFP635, a marker on the vector, in Jurkat cells into which vector construct 1 (FIG. 13A) or 2 (FIG. 13B) was introduced.

FIG. 14 is a result of confirming changes in expression of claudin-3 in Jurkat cells expressing CAR construct 1 and expression of CD69 (FIGS. 14a and b) and CD25 (FIGS. 14c and d) after co-culture with non-expressing cells by FACS. .

FIG. 15 is a result of confirming changes in expression of claudin-3 in Jurkat cells expressing CAR construct 2 and expression of CD69 (FIGS. 15a and b) and CD25 (FIGS. 15c and d) after co-culture with non-expressing cells by FACS. .

Hereinafter, the present invention will be described with reference to the accompanying drawings. However, the present invention may be implemented in various different forms, and therefore is not limited to the embodiments described herein. In the drawings, parts irrelevant to the description are omitted in order to clearly describe the present invention, and similar reference numerals are attached to similar parts throughout the specification.

The terms used in the present specification are only used to describe specific embodiments, and are not intended to limit the present invention. Singular expressions include plural expressions unless the context clearly indicates otherwise. In the present specification, terms such as "comprise" or "have" are intended to designate the presence of features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, but one or more other features. It is to be understood that the presence or addition of elements or numbers, steps, actions, components, parts, or combinations thereof does not preclude in advance.

According to an aspect of the present invention, a chimeric antigen receptor is i) claudin-3 binding domain; ii) transmembrane domain; And iii) an intracellular signaling domain.

As used herein, the term “chimeric antigen receptor (CAR)” refers to an antigen-binding domain (eg, single-chain variable fragment) of an antibody linked to a domain for activation of immune cells (such as NK cells or T-cells). (scFv)) is an artificially produced hybrid protein or polypeptide. Chimeric antigen receptors have the ability to redirect specificity and responsiveness to selected targets in a non-MHC-restricted manner using the antigen-binding properties of monoclonal antibodies. Non-MHC-restricted antigen recognition provides immune cells expressing chimeric antigen receptors with the ability to recognize antigens independent of antigen processing of antigen presenting cells, and is a major part of tumor cell immune evasion. It makes it possible to exhibit an immune response regardless of the inhibition of the antigen presentation pathway, which is one of the mechanisms.

The chimeric antigen receptor of the present invention specifically binds to claudin-3, which is specifically exposed to cancer cells, especially solid cancer cells, compared to normal cells.

The term “claudin-3 (also referred to as CLDN3)” as used herein is a protein belonging to the claudin family, and exists in a portion where tight junctions occur, and is unique to remove spaces between cells in tight junctions. Plays the role of. Tight junctions are rigid structures that connect adjacent cell membranes in tissues of organisms such as animals. Claudin-3 is a structural protein that regulates the intercellular permeability of small solutes such as ions. Claudin-3 is a protein having four transmembrane regions, and has a structure in which the N- and C-terminals are present inside the cell and two loops are exposed to the outside of the cell. Among the two loops outside the cell, the loop of the amino acid region closer to the N-terminus than in the entire protein sequence of claudin-3 is referred to as the first extracellular loop (represented as ECL-1 or EL1 in the present invention), and the other loop is seen. In the present invention, it is referred to as an extracellular second loop (denoted as ECL-2 or EL2 in the present invention). Preferably, the claudin-3 may be human-derived, according to SEQ ID NO: 1, wherein the extracellular first loop is a region containing the 27 to 80 amino acids of the claudin-3 protein amino acid sequence according to SEQ ID NO: 1. , The extracellular second loop refers to a region containing amino acids 144 to 159 of the claudin-3 protein amino acid sequence (see SEQ ID NO: 2). Herein, the claudin-3 binding domain may specifically bind to the extracellular second loop region of claudin-3, and the extracellular second loop region of claudin-3 includes the amino acid sequence represented by SEQ ID NO: 2. I can.

Claudin-3 (Claudin-3 or CLDN-3) is known to function as a toxin receptor for Clostridium perfringens enterotoxin (CPE). CPE binds to claudin-3 and claudin-4 and then forms a large complex that causes cell necrosis, creating voids in the cell membrane.

On the other hand, the extracellular domains of claudin proteins are involved in the formation of tight junctions (TJ). In a normal confluent epithelial cell monolayer, claudin-3 is the apical site of the lateral membrane. lateral membrane), and dysregulation of the mitotic spindle during epithelial tumor formation and out-of-plane differentiation in tumor cells induces an abnormal location of the TJ component on the cell surface. (Saeki R, et al ., Potency of claudin-targeting as antitumor therapy, Mol Cell Pharmacol. 2010; 2:47-51.). In this regard, claudin-3 protein has been reported to increase the degree of exposure in many cancerous tissues such as ovarian cancer, prostate cancer, breast cancer, uterine cancer, liver cancer, lung cancer, pancreatic cancer, gastric cancer, bladder cancer and colon cancer. The Swedish Human Protein Atlas (HPA) website (http://www.proteinatlas.org/) is available as a reference for the claudin-3 expression profile for disease. The expression of claudin-3 and claudin-4 is particularly elevated in chemotherapy-resistant and/or recurrent uterine cancer, which is known to have the highest mortality rate among gynecological cancers in the United States. However, the development of anticancer drugs specifically targeting claudin-3 exposed in a tumor state is still showing limitations.

In the present invention, if the claudin-3 is known as claudin-3 in the art, a specific biological origin and sequence may not be particularly limited. For example, claudin-3 of the present invention is derived from a mouse (Mus musculus), and NCBI (Genbank) Accession No. Known as Q9Z0G9, etc., as derived from rats (Rattus norvegicus), NCBI (Genbank) Accession No. Known as Q63400, etc., as derived from chicken (Gallus gallus), NCBI (Genbank) Accession No. Known as Q98SR2, etc., as derived from dog (Canis lupus familiaris), NCBI (Genbank) Accession No. Known as Q95KM5, etc., a monkey (Macaca mulatta) derived from UniProtKB Entry. Known as F6RQF6, etc., as derived from human (homo sapiens), NCBI (Genbank) Accession No. It may include those known as O15551 (see SEQ ID NO: 1).

The chimeric antigen receptor having a unique claudin-3 binding domain provided by the present invention has excellent ability to specifically target only claudin-3 without cross-reactivity with other claudin family against claudin-3 expressing cells, and has a very good avidity (affinity ), it is expected that the ability to kill cancer cells exposed to claudin-3 will be very good. In particular, the claudin-3 binding domain of the present invention specifically attaches to the ECL-2 region of claudin-3, and accordingly, the claudin-3 forms an incomplete junction unlike normal tissues that are not exposed to the surface. The antibody (or functional fragment thereof) of the present invention can be selectively accessible to the tumor tissue exposed to claudin-3, and this ability is particularly significant in that it can significantly reduce the toxicity problem of anticancer drugs against normal cells. Is big.

The claudin-3 binding domain of the chimeric antigen receptor of the present invention may be an antibody or a functional fragment thereof.

In the present invention, the term “antibody” is also called immunoglobulin (Ig), and is a generic term for proteins that selectively act on antigens and are involved in immunity in vivo. Whole antibodies found in nature are generally composed of two pairs of light chain (LC) and heavy chain (HC), which are polypeptides consisting of several domains, or two pairs of these HC/LCs. The basic unit is the structure of There are 5 types of heavy chains that make up mammalian antibodies, and there are 5 types, denoted by the Greek letters α, δ, ε, γ, and μ, and different types of antibodies, such as IgA, IgD, IgE, IgG, and IgM, respectively, depending on the type of heavy chain. Will constitute. There are two types of light chains constituting mammalian antibodies, represented by λ and κ.

The heavy and light chains of an antibody are structurally divided into a variable region and a constant region according to the variability of the amino acid sequence. The constant region of the heavy chain is composed of 3 or 4 heavy chain constant regions such as CH1, CH2 and CH3 (IgA, IgD and IgG antibodies) and CH4 (IgE and IgM antibodies) depending on the type of antibody, and the light chain is one constant region. It is composed of phosphorus CL. The variable regions of the heavy and light chains each consist of one domain of the heavy chain variable region (VH) or the light chain variable region (VL). The light chain and the heavy chain are connected by one covalent disulfide bond as each variable region and the constant region are aligned side by side, and the heavy chain of the two molecules bonded to the light chain is connected through two covalent disulfide bonds. To form. The whole antibody specifically binds to the antigen through the variable regions of the heavy and light chains, and the whole antibody consists of two pairs of heavy and light chains (HC/LC), so that the entire antibody of one molecule has two variable regions. It has a bivalent single specificity that binds to the same two antigens.

The variable region including the region where the antibody binds to the antigen is subdivided into a framework region (FR) with low sequence variability and a complementary determining region (CDR), a hypervariable region with high sequence variability. do. In the VH and VL, three CDRs and four FRs are arranged in the order of FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 in the direction from the N-terminus to the C-terminus, respectively. Even within the variable region of an antibody, the CDR with the highest sequence variability directly binds to the antigen, and is most important for antigen specificity of the antibody. The type of antibody according to the present invention is not limited as long as it has a combination of the aforementioned CDRs. Specifically, it may be selected from the group consisting of IgG, IgA, IgM, IgE and IgD, and particularly preferably an IgG antibody. The IgG as its subtype includes, but is not limited to, IgG1, IgG2, IgG3, IgG4, and the like. In addition, it may be a monoclonal antibody derived from one B cell, or a polyclonal antibody derived from multiple B cells, but a group of antibodies having substantially the same amino acid sequence of the heavy and light chains of the antibody. It is preferably a phosphorus monoclonal antibody.

In the present invention, the functional fragment of an antibody refers to a fragment that maintains the antigen-specific binding ability of the entire antibody, and specifically, Fab, F(ab'), F(ab')2, Fv, scFv, diabody ) Or dsFv. Fab (fragment antigen-binding) is an antigen-binding fragment of an antibody, and consists of one variable domain and a constant domain of each of the heavy and light chains. F(ab')2 is a fragment produced by hydrolyzing an antibody with pepsin. Two Fabs are linked by a disulfide bond at a heavy chain hinge. F(ab') is a monomeric antibody fragment in which a heavy chain hinge is added to a Fab separated by reducing the disulfide bond of the F(ab')2 fragment. Fv (variable fragment) is an antibody fragment consisting only of the variable regions of each of the heavy and light chains. A single chain variable fragment (scFv) is a recombinant antibody fragment in which a heavy chain variable region (VH) and a light chain variable region (VL) are connected by a flexible peptide linker. A diabody refers to a fragment in which the VH and VL of an scFv are connected by a very short linker, so that they cannot be bonded to each other, and form a dimer by bonding with the VL and VH of other scFvs of the same type, respectively. dsFv refers to a polypeptide obtained by substituting a cysteine residue for one of the amino acid residues of VH and VL through an S-S bond between the cysteine residues. Amino acid residues substituted with cysteine residues can be selected based on prediction of the conformational structure of an antibody according to the method described by Reiter et al. (Protein Engineering, 7, 697 (1994)).

The claudin-3 binding domain of the present invention comprises a heavy chain complementarity determining region 1 (VH-CDR1) comprising an amino acid sequence represented by SEQ ID NO: 3, and a heavy chain complementarity determining region 2 (VH-) comprising an amino acid sequence represented by SEQ ID NO: 4 CDR2), and a heavy chain variable region comprising a heavy chain complementarity determining region 3 (VH-CDR3) comprising an amino acid sequence represented by SEQ ID NO: 5; And light chain complementarity determining region 1 (VL-CDR1) comprising the amino acid sequence represented by SEQ ID NO: 6, light chain complementarity determining region 2 (VL-CDR2) comprising the amino acid sequence represented by SEQ ID NO: 7, and SEQ ID NO: 8. The epitope that includes the light chain variable region including the light chain complementarity determining region 3 (VL-CDR3) containing the indicated amino acid sequence or recognized by the claudin-3 binding domain including the heavy chain variable region and the light chain variable region It could be a competitive combination.

In addition, the claudin-3 binding domain of the present invention is a heavy chain complementarity determining region 1 (VH-CDR1) comprising an amino acid sequence represented by SEQ ID NO: 9, and a heavy chain complementarity determining region 2 comprising an amino acid sequence represented by SEQ ID NO: 10 ( VH-CDR2), and a heavy chain variable region comprising a heavy chain complementarity determining region 3 (VH-CDR3) comprising an amino acid sequence represented by SEQ ID NO: 11; And light chain complementarity determining region 1 (VL-CDR1) comprising the amino acid sequence represented by SEQ ID NO: 12, light chain complementarity determining region 2 (VL-CDR2) comprising the amino acid sequence represented by SEQ ID NO: 13, and SEQ ID NO: 14. The epitope that includes the light chain variable region including the light chain complementarity determining region 3 (VL-CDR3) containing the indicated amino acid sequence or recognized by the claudin-3 binding domain including the heavy chain variable region and the light chain variable region It could be a competitive combination.

In one embodiment, the heavy chain variable portion (VH) and the corresponding light chain variable portion (VL) may be linked through a peptide linker, preferably through a peptide linker comprising an amino acid sequence (GGGGS)3.

The chimeric antigen receptor of the present invention comprises a transmembrane domain. The transmembrane domain can be derived from natural or synthetic sources known in the art. The transmembrane domain is, for example, the transmembrane domain is TCR alpha chain, TCR beta chain, TCR zeta chain, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80 , CD86, CD134, CD137, CD154, and CD8 may be a transmembrane domain derived from a protein selected from the group consisting of, but is not limited thereto. According to one embodiment of the present application, the transmembrane domain may be derived from NKG2D or CD8, and may include a sequence selected from SEQ ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 21.

According to one embodiment of the present application, the chimeric antigen receptor of the present invention may include an intracellular signaling domain. The term “intracellular signaling domain” as used herein transmits information for inducing cell activation through an associated signaling pathway by generating a second messenger or functioning as an effector in response to the secondary messenger. It refers to a functional part of a protein that acts by doing so. The “cell activation” means that the activity of the corresponding cell is increased, and the type of such activation is not particularly limited, but may be, for example, promoting an immune response of a cell. In particular, when the cell is an immune cell, the activation may be understood as including both promoting an immune response of the cell itself and increasing the number of immune cells.

The intracellular signal transduction domain is specially provided as long as it can transmit a signal capable of activating cells (especially immune cells) when the antigen is bound to an antigen-binding site (antibody of the present invention or a functional fragment thereof) located outside the cell. It is not limited to its kind. Various types of intracellular signaling domains can be used, such as immunoreceptor tyrosine-based activation motif or ITAM, and the ITAM is CD3 zeta, TCR zeta, FcR gamma, Includes those derived from FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, CD278, CD66d, DAP10, DAP12, Fcε, in particular, γ) and combinations thereof (one or two or more). It can be, but is not limited thereto. According to an embodiment not limited herein, the chimeric antigen receptor of the present invention may include a signaling domain within a CD3ζ cell. Specifically, the chimeric antigen receptor of the present invention may include the sequence of SEQ ID NO: 17.

In addition, the chimeric antigen receptor of the present invention may further include a costimulatory domain together with an intracellular signaling domain, depending on the cell type.

The co-stimulatory domain is included in the chimeric antigen receptor of the present invention, and in addition to the primary signal by the intracellular signaling domain, the co-stimulatory domain plays a role of transmitting a maximum activation signal to the corresponding cell (especially, an immune cell), It refers to the intracellular portion of a chimeric antigen receptor, which contains the intracellular domain of a costimulatory molecule. That is, some immune cells, such as T lymphocytes and NK cells, require two signals for maximum activation, namely a primary activation signal and a costimulatory signal, and chimeric antigen receptors also require antigen binding to the extracellular domain. It may optionally include a co-stimulation domain to cause transmission of both a primary activation signal and a co-stimulation signal.

The co-stimulatory molecule is a cell surface molecule, which means a molecule necessary to bring about a sufficient response of an immune cell to an antigen, and its kind is not particularly limited as long as it is known in the art. For example, MHC class I molecules (MHC class I molecules), TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, SLAM proteins (signaling lymphocytic activation molecules), NK cell activation Receptors (NK cell activating receptors), BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a/CD18, lymphocyte function- associated antigen-1), 4-1BB(CD137), B7-H3, CDS, ICAM-1, ICOS(CD278), GITR, BAFFR, LIGHT, HVEM(LIGHTR), KIRDS2, SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL , CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE/RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4) , CD84, CD96(Tactile), CEACAM1, CR TAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162) , LTBR, LAT, GADS, SLP-76, PAG/Cbp, CD19a, a ligand that specifically binds to CD83, PD-1, and a combination thereof. The co-stimulatory domain may be an intracellular portion of a molecule selected from the group consisting of such co-stimulatory molecules and combinations thereof (one or two or more). According to an embodiment not limited herein, the chimeric antigen receptor of the present invention may include SLAMF4 (CD244, 2B4) as a costimulatory domain. Specifically, the costimulatory domain of the present invention may include the amino acid sequence of SEQ ID NO: 18.

The costimulatory domain may be connected to the N-terminus or C-terminus of the signaling domain, and may also be included between a plurality of signal transduction domains.

The chimeric antigen receptor of the present invention may further comprise such a hinge. In general, the hinge is a linking site in which the antigen-binding domain is introduced between the antigen-binding domain and the transmembrane domain so that the target antigen can be more flexibly recognized at a certain distance from the cell membrane of the cell into which the chimeric antigen receptor has been introduced. The hinge is selected from the group consisting of CD8, CD28, CD3ζ, CD40, 4-1BB, OX40, CD84, CD166, CD8a, CD8b, ICOS, ICAM-1, CTLA-4, CD27, CD40/My88, NKGD2, and combinations thereof. It may include those derived from proteins. According to one embodiment of the present application, the hinge may be a hinge derived from CD8a, and may include SEQ ID NO: 22.

The chimeric antigen receptor of the present invention may further include such a leader sequence at the N-terminus. The leader sequence is also called a signal peptide, and exists at the N-terminus of the protein to allow the protein to move to the secretory pathway. In general, it is at the N-terminus to allow the chimeric antigen receptor to be expressed on the cell membrane. Include. The leader sequence consists of CD8, Megf10, FcRγ, Bai1, MerTK, TIM4, Stabilin-1, Stabilin-2, RAGE, CD300f, Integrin subunit αv, Integrin subunit β5, CD36, LRP1, SCARF1, C1Qa and Axl, and combinations thereof. It may include those selected from the group. According to one embodiment of the present application, the leader sequence may be derived from CD8, and may include SEQ ID NO: 23.

Each domain constituting the chimeric antigen receptor may be directly connected, and optionally, may be connected by a short oligopeptide or polypeptide linker. The linker is not particularly limited to its length or type, as long as it is a linker capable of inducing cell activation through an intracellular domain when the antigen is bound to an antibody located outside the cell, such as (G4S)3 linker, that is, GGGGSGGGGSGGGGS, etc. Can be used.

The chimeric antigen receptor of the present invention may include a sequence selected from the group consisting of SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.

According to one embodiment of the present application, the chimeric antigen receptor of the present invention may be present by being expressed in NK cells or T cells. The NK cells or T cells expressing the chimeric antigen receptor bind to the claudin-3 region present on the cancer cells to induce activation of the NK cells or T cells, and the activated NK cells or T cells release cytotoxic factors. And induces cell lysis and/or cell death of cancer cells.

As another aspect for achieving the above technical problem, the present invention provides a polynucleotide encoding the above-described chimeric antigen receptor. The polynucleotide is not particularly limited in its base combination as long as it encodes the chimeric antigen receptor protein of the present invention, and may be prepared by a polynucleotide synthesis technique known in the art. Here, the description of the chimeric antigen receptor is as described above.

According to an embodiment not limited herein, the polynucleotide of the present invention may include the nucleotide sequence of SEQ ID NO: 34 or SEQ ID NO: 35 encoding scFv that specifically binds to claudin-3. In addition, the polynucleotide of the present invention may include the nucleotide sequence of SEQ ID NO: 36 encoding the hinge derived from CD8. In addition, the polynucleotide of the present invention may include one of the nucleotide sequences of SEQ ID NO: 37 (from NKG2D), SEQ ID NO: 38 (modification from NKG2D) and SEQ ID NO: 39 (from CD8) encoding the transmembrane domain. In addition, the polynucleotide of the present invention may include the nucleotide sequence of SEQ ID NO: 40 encoding the intracellular signaling domain derived from CD3ζ. In addition, the polynucleotide of the present invention may include the nucleotide sequence of SEQ ID NO: 41 encoding the costimulatory domain derived from SLAMF4 (CD244, 2B4). In addition, the polynucleotide of the present invention may include the nucleotide sequence of SEQ ID NO: 42 encoding the CD8 leader.

As another aspect for achieving the above technical problem, the present invention provides a recombinant vector comprising the polynucleotide described above. Here, the description of the polynucleotide is as described above.

As used herein, the term “vector” refers to a carrier that delivers the polynucleotide of the present invention to a host cell in order to transform the host cell to express the chimeric antigen receptor of the present invention. The vector of the present invention may be selected from any commercially available expression vector, and “recombinant” means that such vector has been prepared to have the desired configuration. The vector may be DNA, RNA, or plasmid, and may be a viral vector such as a lentiviral vector, adenovirus vector or retroviral vector. The recombinant vector of the present invention may include a promoter for expressing a chimeric antigen receptor in a state operably linked to a polynucleotide encoding the chimeric antigen receptor. The recombinant vector of the present invention may further include a construct capable of expressing differentiation factors and growth factors necessary for differentiation and growth of transformed cells in addition to the chimeric antigen receptor.

The vector of the present invention can be delivered to the safe harbor of the host cell genome. As a non-limiting example, the vector of the present invention may include attB, attP, attL or attR, and thus may be introduced into an insertion site recognized in the host cell gene by bacteriophage integrase. .

As another aspect for achieving the above technical problem, the present invention provides an isolated host cell comprising the chimeric antigen receptor. The terms used herein are as described above.

The host cell can then be administered to a subject in need thereof. For example, since the host cell of the present invention contains a chimeric antigen receptor that specifically binds to claudin-3, when administered to a patient with a neoplasm that exposes claudin-3, in particular, a malignant tumor These neoplasms can be selectively removed. At this time, the host cell may be obtained from a subject to which the host cell is to be administered, that is, an autologous cell, or may be obtained from an allogeneic subject other than the subject to which the host cell is to be administered.

The host cell herein may be an immune cell or a less differentiated cell. In the present invention, the genome-engineered differentiated immune cells can be obtained through the process of differentiating the transformed less differentiated cells after the genome manipulation of the less differentiated cells. Specifically, the host cells include mesenchymal stem cells (MSCs), dedifferentiation inducing stem cells (iPSCs), CD34 cells, hematopoietic endothelial cells, hematopoietic stem cells (HSCs), hematopoietic pluripotent progenitor cells, embryonic stem cells (ESCs), Or it may be an immune cell. The immune cells may be selected from the group consisting of T cell precursors, NK cell precursors, T cells, NK (Natural Killer) cells, NKT (Natural Killer T) cells, B cells, monocytes, macrophages and dendritic cells.

The term “NK cells” as used herein refers to mononuclear cells arising from lymphoid progenitor cells in the bone marrow, and the morphological and biological properties typically include the expression of cluster determinant (CD) CD16, CD56, and/or CD57; Absence of alpha/beta or gamma/delta TCR complexes on the cell surface; The ability to bind and kill target cells that fail to express the “self” major histocompatibility complex (MHC)/human leukocyte antigen (HLA) protein; And the ability to kill tumor cells or other diseased cells that express a ligand for the activating NK receptor. NK cells are characterized by their ability to bind and kill several types of tumor cell lines without the need for prior immunization or activation. NK cells can also release soluble proteins and cytokines that exert a modulating effect on the immune system; Multiple rounds of cell division can produce daughter cells with similar biological properties to the parent cell. Upon activation by interferons and/or cytokines, NK cells mediate the lysis of tumor cells and cells infected by intracellular pathogens by mechanisms that require direct, physical contact between NK cells and target cells. Lysis of target cells involves the release of cytotoxic granules from NK cells to the surface of the bound target, and effector proteins such as Perforin and Granzyme B that pass through the target plasma membrane and induce apoptosis or programmed cell death. . Normal, healthy cells are protected from lysis by NK cells. NK cell activity is regulated by a complex mechanism involving both stimulating and inhibitory signals.

In the present invention, the term “T cell” refers to a lymphocyte derived from the thymus gland and refers to a lymphocyte that plays a major role in the immunity of cells. The T cells include CD4+ T cells (helper T cells, TH cells), CD8+ T cells (cytotoxic T cells, CTL), memory T cells, regulatory T cells (Treg cells) natural killer T cells, and the like. The T cell into which the antigen receptor is introduced may preferably be a CD8 + T cell, but is not limited thereto.

For example, antigen-specific CD8 + T cells are evaluated as the most effective immune cells for immunotherapy of cancer. However, a complicated process and a long period are required to isolate antigen-specific CD8 + T cells for use in cancer immunotherapy. Accordingly, a chimeric antigen receptor (CAR)-modified T cell was designed as one of the methods for mass-producing antigen-specific CD8 + T cells in a short time (Porter DL et al ., N Engl J Med. 2011;365:725-33.). Although not limited thereto, as a general example, the chimeric antigen receptor is a form in which the scFv of an antibody that recognizes a specific antigen is combined with a signaling domain that causes T cell activation, preferably a co-stimulatory molecule and a signaling domain of CD3ξ. As a protein, when the antibody portion constituting the chimeric antigen receptor recognizes a specific antigen, it induces strong T cell proliferation signaling to selectively proliferate CD8 + T cells. These proliferated cells contribute to the immunotherapy of cancer.

As another aspect for achieving the above technical problem, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the host cell as an active ingredient. The terms used herein are as described above.

In the present invention, the host cell expressing the chimeric antigen receptor may be administered to an individual as an immune cell by itself or differentiated to exhibit anticancer activity. Specifically, immune cells modified to express the chimeric antigen receptor of the present invention specifically recognize and bind to claudin-3 (particularly, ECL-2 region) exposed to cancer cells compared to normal cells, and thus immunity It can be seen that it can have a cancer cell therapeutic effect according to cell activation. In the past, many technologies for treating hematologic cancer-oriented chimeric antigen receptor-expressing immune cells have been made, and considering that the existing chimeric antigen receptor technologies have a high possibility of targeting normal cells, the present invention is specific to only solid cancer cells compared to normal cells. Since it can be targeted specifically, it can have an excellent therapeutic effect against solid cancer while having few side effects (especially, toxicity to normal cells). Accordingly, the present invention can provide a pharmaceutical composition for preventing or treating cancer comprising the chimeric antigen receptor-expressing cells of the present invention as an active ingredient. Solid cancer to be treated by the pharmaceutical composition of the present invention is ovarian cancer, colon cancer, bladder cancer, lung cancer, liver cancer, gastric cancer, esophageal cancer, breast cancer, prostate cancer, pancreatic cancer, uterine cancer, cervical cancer, melanoma, colon cancer, kidney cancer and metastatic pleura It may be selected from the group consisting of tumors, but is not limited thereto.

The pharmaceutical compositions of the present invention may comprise host cells expressing the aforementioned chimeric antigen receptor in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. The composition may include buffering agents such as neutral buffered saline, phosphate buffered saline, and the like; Carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; protein; Polypeptides or amino acids such as glycine; Antioxidants; Chelating agents such as EDTA or glutathione; Adjuvant (eg, aluminum hydroxide); And preservatives. The pharmaceutical composition of the present invention is formulated for intravenous administration in one aspect.

The pharmaceutical composition of the present invention can be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by factors such as the patient's condition, the type and severity of the patient's disease, but the appropriate dosage will be determined by clinical trials.

In one embodiment, the pharmaceutical composition is for example endotoxin, mycoplasma, replication competent lentivirus (RCL), p24, VSV-G nucleic acid, HIV gag, residual anti-CD3/anti-CD28 coated beads, mouse antibody , Contaminants selected from the group consisting of aggregated human serum, bovine serum albumin, bovine serum, culture medium components, vector packaging cells or plasmid components, bacteria and fungi, for example, free of detectable levels of contaminants.

The'individual' may be an animal, preferably an animal including a mammal, particularly a human, and may be a cell, tissue, organ, etc. derived from an animal. The individual may be a patient in need of the effect.

The'treatment' of the present invention refers generically to improving the symptoms of cancer or cancer, which may include curing, substantially preventing, or improving the condition, and one originating from cancer. It includes, but is not limited to, alleviating, curing, or preventing symptoms or most of the symptoms.

Hereinafter, exemplary embodiments of the present invention will be described in detail with reference to the accompanying drawings.

실시예 1: 클라우딘-3(CLDN3)에 특이적으로 결합하는 ScFv 스크리닝Example 1: ScFv screening specifically binding to claudin-3 (CLDN3)

1-1 항원의 준비1-1 Preparation of antigen

In the process of screening the claudin-3 binding domain of the present invention, claudin-3 was provided in the form of an expression cell line and claudin-3 lipoparticles. CHO-K1 cell line was used to make a cell line expressing claudin-3 (NCBI reference number_O15551 (see SEQ ID NO: 1)). To construct a claudin-3 expression vector, the claudin-3 gene was inserted into pcDNA3.1 (invitrogen) using restriction enzymes HindIII and BamH1. The prepared claudin-3 expression vector was transfected and treated with 400 µg/ml geneticin (g418) to select transformants. The lipoparticles exposing the claudin-3 to the surface (hereinafter referred to as claudin-3 lipoparticles) were ordered and used by Integralmolecular (Cat. No. RR-0733A).

1-2. scFv phage 선별1-2. scFv phage screening

In order to screen for antibodies that specifically bind to claudin-3, a phage library display was used. The library was a synthesized human scFv library, and for specific information on the library, see A Novel Human scFv Library with Non-Combinatorial Synthetic CDR Diversity (Bai X. et al ., PLoS ONE., 10(10):e0141045 (2015) ). The scFv expressed in the scFv library was tagged with an HA tag so that it could be detected by an anti-HA FITC antibody (Genscript, A01621). Biopanning was performed as follows using the scFv library.

First, biopanning was performed using the claudin-3 expressing CHO-K1 cell line (hereinafter referred to as CHO-CLDN3) prepared in Example 1-1. The scFv library stock was blocked with 3% FBS/PBS at room temperature. Prepare 1×10 ⁷ CHO-CLDN3 cells and CHO-K1 cells (negative cell line) each using trypsin. CHO-K1 cells (negative cell line) are mixed with the blocking library stock, and depletion is performed at room temperature for 1 hour. After the depletion is over, the supernatant obtained by centrifugation is mixed with the antigen CHO-CLDN3 cells and reacted at room temperature for 1 hour. The cell pellet obtained by centrifugation was washed with 3% FBS/PBS, and then reacted with 100 mM TEA (triethylamine) for 5 minutes at room temperature so that only specifically bound scFv-phages could be eluted, and neutralized with pH 8.5 Tris. After the reaction, it was prepared in the form of an scFv-antigen conjugate. The prepared scFv-antigen conjugate (conugate) was added to E. coli TG1 cells for infection, and then incubated overnight at 37°C in LB/ampicillin/glucose agar medium. The E. coli TG1 cells were transferred to SB/Ampicillin medium and cultured until the OD600 value reached 0.5, and then 1×10 ¹¹ to 1×10 ¹² helper phage was added, followed by 37 for 1 hour. After incubation at °C, kanamycin was added and cultured again overnight. After the overnight culture was centrifuged, the supernatant was reacted with the PEG solution at 4°C, and then centrifuged again to separate the pellet. After dissolving the pellet in PBS, the supernatant obtained by centrifugation was obtained as a scFv library solution. This process was repeated 4 times to obtain a scFv candidate group that specifically binds to the claudin-3 antigen.

Next, biopanning was performed using lipoparticles. The scFv library stock was mixed with lipoparticle null (lipoparticle not containing claudin-3), and blocking and depletion were simultaneously performed for 1 hour at room temperature with 4% skim milk. 1 ml of PBS containing claudin-3 lipoparticles was added to an immunotube and reacted at 4° C. for 16 hours to coat the inner surface of the tube. The antigen solution was decanted and washed once to remove uncoated antigen. The antigen (Cludin-3 lipoparticle) coated on the immune tube was blocked with 4% skim milk for 1 hour at room temperature. After blocking was completed, the skim milk was removed, mixed with scFv library stock, and reacted at room temperature for 1 hour. After washing with PBS, reacted with 100 mM TEA for 5 minutes at room temperature so that only specifically bound scFv-phages could be eluted, and neutralized with pH 8.5 Tris to prepare a scFv-antigen conjugate form. The prepared scFv-antigen conjugate (conugate) was added to E. coli TG1 cells for infection, and then incubated overnight at 37°C in LB/ampicillin/glucose agar medium. The E. coli TG1 cells were transferred to SB/Ampicillin medium and cultured until the OD600 value reached 0.5, and then 1×10 ¹¹ to 1×10 ¹² helper phage was added, followed by 37 for 1 hour. After incubation at °C, kanamycin was added and cultured again overnight. After the overnight culture was centrifuged, the supernatant was reacted with the PEG solution at 4°C, and then centrifuged again to separate the pellet. The pellet was dissolved in PBS, and then centrifuged to obtain the supernatant as an scFv library solution. This process was repeated 4 times to obtain a scFv candidate group that specifically binds to the antigen of claudin-3.

1-3. 클라우딘-3(CLDN3)에 특이적으로 결합하는 scFv 항체 선별1-3. Screening for scFv antibodies that specifically bind to claudin-3 (CLDN3)

In order to select the scFv having excellent binding ability from the scFv candidate group obtained in Example 1-2, ELISA analysis was performed on the claudin-3 expressing cell line. The claudin-3 expressing cell line (hereinafter referred to as L-claudin-3 cells) was transfected with the claudin-3 expression vector prepared in Example 1-1 to L cells, and then 600 μg/ml of geneticin ( geneticin, g418) was used to select transformants. Each of the panned library stocks in each step in Example 1-2 (screening results using a claudin-3 expressing cell line or claudin-3 lipoparticles separately) was used as SB/ampicillin/glucose agar. After overnight incubation in the medium, each single colony was inoculated in 200 µl of SB/Ampicillin medium, incubated at 37°C for 3 hours, and then mixed so that the IPTG concentration became 1 mM, and then again at 30°C. Incubate overnight. When the culture was completed, the culture medium was centrifuged to separate only the cells, and then the cells were lysed using a TES buffer to obtain scFv. The obtained scFv was treated on a plate in which L-cladin-3 cells ^{were dispensed at 1×10 5} each, reacted at room temperature for 1 hour, and then a secondary antibody (anti-HA HRP, santacruz, Cat. No. sc-7392) was added. It was added and reacted for 40 minutes. When the secondary antibody reaction was completed, TMB was added to perform a color reaction and analyzed using an ELISA reader (450 nm). By comparing the ELISA analysis values, the top 23 excellent scFvs were primarily selected (1C4, 1F11, 2A12, 2B4, 2E5, 2E12, 2F8, 3A2, 3H8, 4A2, 4A3, 4B7, 4B10, 4D7, 3D2, 3D7, 3F11, 4A8, 4A9, 4A12, 4E4, 4G3, 4G7).

With respect to the scFv candidates selected through the ELISA, binding to CHO-CLDN3 cells was confirmed using flow cytometry. As a control, native CHO-K1 cells were used. Cells being subcultured were separated into single cell units using trypsin and prepared in 3% FBS/PBS. The selected scFv candidates were inoculated into 5 ml of SB/Ampicillin medium, incubated at 37°C for 3 hours, mixed so that the IPTG concentration was 1 mM, and cultured again at 30°C overnight. When the culture was completed, the culture medium was centrifuged to separate only the cells, and then the cells were lysed using a TES buffer to obtain scFv. CHO-K1 cells (negative cell line, control) and CHO-CLDN3 cells (experimental group) were ^{prepared in 3% FBS/PBS to enter 2×10 5} cells for each group, and then treated with the obtained scFv at room temperature. It reacted for 1 hour. Upon completion of the reaction, after washing with 3% FBS/PBS, the anti-HA taq FITC antibody was diluted 1:100 (diluted with 100 μl of 3% FBS/PBS), treated with 100 ul, and reacted at room temperature for 1 hour. After completion of the reaction, it was washed and analyzed with BD FACS Calibur. At this time, commercially available anti-CLDN3 (FAB4620F, R&D systems) antibody was used as a control group. Compared to the control group (see FIG. 1), scFv candidate groups in which peak shift occurred only in the experimental group (see FIG. 2) were selected (2B4, 4A2, 4B7, 4B10, 4D7, 4A8, 4A9, 4A12, 4E4, 4G3, 4G7).

Next, the final biopanning results (data not shown) using claudin-3 lipoparticles were compared with the results of the scFv candidate group selected in the experimental steps. Sequencing was performed on the selected scFv, and two 2B4 and 4G3 clones in experiments on claudin-3 lipoparticles and claudin-3 expressing cell lines (CHO-CLDN3 cell line or/and L- claudin-3 cell line) Was secured. The entire sequence of 2B4 and 4G3 scFv was the same as SEQ ID NO: 16 and SEQ ID NO: 15, respectively. The results of analyzing the amino acid sequence of 2B4 and 4G3 scFv are shown in Table 1 below.

AntibodyAntibody	중쇄가변영역Heavy chain variable region
AntibodyAntibody	CDRH1CDRH1	CDRH2CDRH2	CDRH3CDRH3
2B42B4	GYYWS(서열번호 9)GYYWS (SEQ ID NO: 9)	TIHPGDSDTRYNPSLQTIHPGDSDTRYNPSLQ G(서열번호 10)G (SEQ ID NO: 10)	RQGYSLFDI(서열번 호 11)RQGYSLFDI (SEQ ID NO: 11)
4G34G3	SYAMS (서열번호 3)SYAMS (SEQ ID NO: 3)	IINPSGASTSHAQRFQG(서열번호 4)IINPSGASTSHAQRFQG (SEQ ID NO: 4)	RYGRYGSFDI(서열RYGRYGSFDI (SEQ ID NO: 번호 5)Number 5)
AntibodyAntibody	경쇄가변영역Light chain variable region
AntibodyAntibody	CDRL1CDRL1	CDRL2CDRL2	CDRL3CDRL3
2B42B4	RASQSVASDLA(RASQSVASDLA( 서열번호 12)SEQ ID NO: 12)	AASRLQS(서열번호 13)AASRLQS (SEQ ID NO: 13)	QQYNSYPPT(서열번 호 14)QQYNSYPPT (SEQ ID NO: 14)
4G34G3	SGSTSNIGRNYVS(서열번호 6)SGSTSNIGRNYVS (SEQ ID NO: 6)	DTSNKHF(서열번호 7)DTSNKHF (SEQ ID NO: 7)	QSYDSSKVV(서열번QSYDSSKVV (SEQ ID NO: 호 8)Issue 8)

실시예 2: 4G3 scFv를 포함하는 항체 IgG의 제조Example 2: Preparation of antibody IgG containing 4G3 scFv 2-1. 4G3 IgG 클로닝2-1. 4G3 IgG cloning

The previously selected 4G3 scFv was converted to the form of IgG, which is a more commonly used antibody. An expression vector capable of expressing the entire IgG form was constructed based on the CDR regions of the scFv. First, a light chain variable region and a heavy chain variable region of scFv were obtained through PCR, respectively, and the primers shown in Table 2 below were used for 4G3. The light chain variable region sequence is cloned into pOptiVec (Invitrogen), an expression vector into which a light chain constant region sequence is inserted, and the heavy chain variable region sequence is inserted into a heavy chain constant region. Each was cloned into the expression vector pcDNA 3.3 (Invitrogen). When the light and heavy chain constant regions of the scFv cloned from the vector are expressed together with the light and heavy chain variable regions, a whole IgG antibody including the CDR regions of the scFv is produced.

가변부위Variable area	프라이머 서열Primer sequence	서열번호Sequence number
경쇄 FLight chain F	5'-ATTCGATCGATATGGAGACAGACACACTCCTG CTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCA CGTGGCAGAGCGTGCTGACCCAGCCT-3'5'-ATTCGATCGATATGGAGACAGACACACTCCTG CTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCA CGTGGCAGAGCGTGCTGACCCAGCCT-3'	3030
경쇄 RLight chain R	5'-AGCCACCGTACGCAGCACGGTCAGCTTGGTACC-3'5'-AGCCACCGTACGCAGCACGGTCAGCTTGGTACC-3'	3131
중쇄 FHeavy chain F	5'-ATTCGATCGATATGGAGACAGACACACTCCTG CTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACGTGGGAAGTGCAGCTGCTGGAAAGT-3'5'-ATTCGATCGATATGGAGACAGACACACTCCTG CTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACGTGGGAAGTGCAGCTGCTGGAAAGT-3'	3232
중쇄 RHeavy chain R	5'-CTTGGTGCTAGCGCTGCTCACGGTCACCAGAGT-3'5'-CTTGGTGCTAGCGCTGCTCACGGTCACCAGAGT-3'	3333

2-2. Total IgG antibody-expressing CHO-S cell line production (pool) Using CHO-S cells (Life Technologies Inc.), each 4G3 IgG antibody-expressing cell line was prepared. Codon optimization was performed with Cricetulus griseus species for the gene sequences encoding the heavy and light chains obtained in Example 2-1, and ^{these sequences were cloned into Freedom ®} pCHO1.0Vector, and then a transfection reagent ( CHO-S cells were transduced with FreeStyle™ MAX Reagent; Life Technologies Inc.). In order to select the antibody-expressing cell line after transduction, puromycin and MTX (methotrexate) were used to select through two steps. Specifically, in the first screening, puromycin 10 ug/ml, MTX 100 nM or puromycin 20 ug/ml, MTX 200 nM was performed, and the second process was performed when the cell viability was within the standard. In the second screening, proceed with puromycin 30 ug/ml, MTX 500 nM or puromycin 50 ug/ml, MTX 1000 nM, and when the final cell viability criterion is reached, the second screening is terminated and the expression level through SFB (Simple Fed Batch). The higher group was selected.

2-3. 전체 IgG 항체 생산 및 정제2-3. Total IgG antibody production and purification

Each antibody-producing cell line prepared in 2-2 was subjected to CO2 8%, 37°C, 100-120 rpm conditions in CD FortiCHO™ medium, and glucose was 4 g/L, 4 g/L, respectively on the 3rd, 5th, and 7th days. It was cultured for a total of 14 days while adding g/L and 6 g/L each. After completion of the culture, the culture solution was centrifuged with an ultra-centrifuge 6000g, and the supernatant was filtered using a 0.2 um filter. Protein A resin (Mabselect SuRe, 11-0026-01 AD, GE Healthcare Life Sciences) was used for purification, and an equilibrium buffer (20 mM Sodium Phosphate, 150 mM NaCl, pH 7.2), washing buffer (35 mM Sodium Phosphate, 500 mM NaCl, pH 7.2), elution buffer (0.1 M Sodium Citrate, pH 3.6) was used. Using AKTA™avant, the equilibrium buffer was 2 times the column volume, the washing buffer was 5 times the column volume, and the elution buffer was 5 times the column volume. I put /5 in each. After converting the buffer twice to PBS using a filtration membrane (CelluSep, 1430-45), it was concentrated with a centrifugal filter (Amicon Ultra-15, UFC905024, Merck).

IgG antibody proteins produced under reducing and non-reducing conditions, respectively, were confirmed by a conventional SDS-PAGE technique, and it was confirmed that both the light and heavy chains of each antibody were well expressed at the expected molecular weight. 3 shows the results of SDS-PAGE confirmation for 4G3 IgG antibody.

실시예 3: 항-클라우딘-3 CAR 컨스트럭트의 제조 및 세포 형질전환Example 3: Preparation of Anti-Claudin-3 CAR Construct and Cell Transformation

3-1.3-1. 발현 벡터의 제작Construction of expression vector

A construct of chimeric antigen receptor (CAR) including scFv in a puC vector (CAR construct 1: SEQ ID NO: 24; CAR construct 2: SEQ ID NO: 25) is synthesized and ordered to IDT, and an expression vector (vector construct in sequence Tree 1: SEQ ID NO: 27; Vector construct 2: SEQ ID NO: 28; all can be schematically illustrated as in Figure 12) was completed. RFP635 and luciferase gene were included after CAR gene using translational insulators T2A and P2A so that expression could be confirmed.

3-2.3-2. 세포 형질전환Cell transformation

The completed vector was transformed into each of Jurkat cells and NK cells, which are cell lines derived from T cell leukemia, to confirm expression and activity. Transformation was performed by electroporation using Thermo Fisher's Neon transfection system kit. Transformation conditions for each cell line provided by Thermo were optimized and used (1500 V, 10 ms/3 pulses), followed by stabilization at _{37° C. and 5% CO 2 for one day.}

실험예 1: 항- 클라우딘-3항체의 결합 특이성(binding specificity) 및 결합력 평가Experimental Example 1: Evaluation of binding specificity and binding ability of anti- claudin-3 antibody

1-1. 여러 가지 클라우딘에 대한 CLDN/HEK293 세포주 제작1-1. Construction of CLDN/HEK293 cell lines for various claudins

In order to confirm the antigen specificity of the antibody produced in Example 2-3, claudins located phylogenetic close to human CLDN3, in particular human CLDN4 (NCBI accession number: O14493), CLDN5 (O00501), CLDN6 (P56747), The presence or absence of binding to CLDN8 (P56748), CLDN9 (O95484), and CLDN17 (P56750) was compared and evaluated (see FIGS. 4A and 4B). In addition, although the distance is systematically analyzed than the above-described claudin types, CLDN1 (O95832), a typical claudin, was used as a comparative group for this experiment. In addition, it was examined whether the developed antibody also binds to mouse CLDN3 (Q9Z0G9) (see 4b). Each of the genes encoding the aforementioned claudins was cloned into pcDNA3.1(+) (Invitrogen). Each of the claudin expression vectors thus prepared was transduced into HEK293 (KCLB) using Fugene HD (E231A, Promega) transfection reagent, and then resistant cell lines were selected with G418. For the cell lines (hCLDN/HEK293) that sustained expression of human claudin thus produced, confirmation of whether each claudin is well expressed was commercially available anti-CLDN1 (FAB4618G, R&D systems), anti-CLDN3 (FAB4620F, R&D systems), anti-CLDN4 (FAB4219F, R&D systems), anti-CLDN5 (ab131259, Abcam), anti-CLDN6 (ABIN1720916, Antibodies-online), anti-CLDN8 (MAB5275, R&D systems), anti-CLDN9 (ab187116, Abcam), anti-CLDN17 (MAB4619, R&D systems) antibodies.

1-2. CLDN/HEK293 세포주들에 대한 본 발명 항체의 교차반응성 평가1-2. Evaluation of cross-reactivity of antibodies of the present invention against CLDN/HEK293 cell lines

For the hCLDNs/HEK293 cell lines and mCLDN3/HEK293s for various claudins prepared in Experimental Example 1-1, cross reactivity of the antibodies prepared in Example 2-3 was confirmed. Native HEK293 cells were used as a negative control. First, the cells were separated into single cells using a cell dissociation buffer (Gibco, 13151-014), and then 2.5×10 ^{5 were} seeded, and 5 ug/ml of each antibody was added thereto and iced for 1 hour. It was reacted above. After the reaction, it was washed with 1% BSA/PBS and treated with a secondary antibody, goat anti-human IgG-FITC (109-095-098, Jackson Immunoresearch), 1:100, and reacted on ice for 1 hour. After the reaction, it was washed with 1% BSA/PBS, and analyzed using BD FACS Calibur as a flow cytometer.

5A and 5B are the results of the flow cytometry, comparatively showing the binding specificity of the 4G3 antibody to claudin-3. There was no peak shift in any experimental group using CLDN4, CLDN5, CLDN6, CLDN8, CLDN9 and CLDN17, which were phylogenetic close to CLDN3. The experimental results using mouse CLDN3 are shown in Fig. 5c, and it was confirmed that the antibody of the present invention also binds to mouse CLDN3, which has high homology with mouse human CLDN3.

Accordingly, it was confirmed that each antibody of the present invention did not bind to other claudin families other than human CLDN3 and mouse CLDN3. That is, it was confirmed that each antibody of the present invention specifically binds only CLDN3 without cross-reaction with other claudin types having high homology.

1-3. 1-3. in vitro in vitro 암세포 검출 능력 확인: 유세포분석Confirmation of cancer cell detection ability: flow cytometry

The binding power of the antibodies prepared in Example 2-3 to cancer cells was confirmed. OVCAR-3 (ATCC) and Caov-3 (ATCC), cell lines overexpressing claudin-3 as ovarian cancer, and TOV-112D (ATCC), cell lines with very low claudin-3 expression, transformed to overexpress CLDN3. The prepared hCLDN3/TOV-112D cells were used. The production of hCLDN3/TOV-112D cells was performed in the same manner as described in Experimental Example 1-1. Antibody treatment and flow cytometry for the cells were performed in the same manner as in Experimental Example 1-2.

As a result of the experiment, a peak shift was observed in the claudin-3 expressing cells OVCAR-3, Caov-3, and hCLDN3/TOV-112D, and no peak shift was observed in the negative cell line, TOV-112D. Representatively, FIG. 6 comparatively shows the binding specificity of the 4G3 antibody to the cancer cells.

1-4. 클라우딘-3 특이적 결합 재확인: 면역침강(Immumnoprecipitation)1-4. Reconfirmation of claudin-3 specific binding: Immunoprecipitation

It was reconfirmed that the antibody of the present invention binds to claudin-3 in the cancer cells through immunoprecipitation. As an antibody negative control (control IgG), a commercially available whole human antibody (009-000-003, Jackson Immunoresearch) was used. Each cell of OVCAR-3 (ATCC), Caov-3 (ATCC), TOV-112D (ATCC), hCLDN3/TOV-112D was released with PBS added with protease inhibitor (11697498001, Roche), and then 2 with an ultrasonic grinder. After performing the second on/5 second off 10 times, the supernatant was taken by centrifugation at 15000 rpm for 15 minutes at 4°C. After measuring the protein concentration of each cell lysate (supernatant) by the BCA quantification method, 1 mg of protein was taken, 1 ug of each antibody was added and reacted while rotating at 4° C. for 1 hour. Protein A bead (11719408001, Roche) was equilibrated with PBS, and the beads were blocked with 5% BSA/PBS while rotating at 4° C. for 1 hour. 50 ul of beads were added to the sample after the antibody reaction was completed, and the reaction was performed while rotating at 4° C. for 1 hour. When the reaction between the antibody and the beads was complete, after washing with PBS 3 times, 30 ul of 2X SDS loading buffer was added, boiled at 100° C. for 10 minutes, centrifuged at 12000 rpm for 3 minutes, and the supernatant was subjected to 15% SDS gel electrophoresis. Western blotting was performed by a conventional method, and at this time, anti-CLDN3 (341700, Invitrogen) was used as the primary antibody.

As a result of the analysis, no band was observed in the control IgG-treated group, and the band was observed only in the experimental group using OVCAR-3, Caov-3, and hCLDN3/TOV-112D cells of the antibody of the present invention. 7 shows the degree of binding of the 4G3 antibody to claudin-3 expressed by the cells. This confirmed that each antibody of the present invention binds to the claudin-3 protein of cancer cells.

1-5. 클라우딘-3 특이적 결합 재확인: 면역형광(Immunofluorescence)1-5. Reconfirmation of claudin-3 specific binding: Immunofluorescence

Through immunofluorescence, it was reconfirmed that the antibody of the present invention specifically targets claudin-3 in the cancer cells. Each of the cells of OVCAR-3 (ATCC), Caov-3 (ATCC), TOV-112D (ATCC), and hCLDN3/TOV-112D was added to a 4 well cell culture slide by 2×10 ⁵ cells and cultured for 24 hours. A control antibody (ChromePure Human IgG, 009-000-003, Jackson ImmonoResearch) or the antibody of the present invention was added to the culture medium at a concentration of 5 ug/ul, followed by stirring at 4° C. for 1 hour to react. After washing with PBS, 4% cells were fixed with formaldehyde for 15 minutes at room temperature. After washing with PBS, blocking was performed for 1 hour at room temperature with 5% BSA/PBS. After washing with PBS, goat anti-human IgG-FITC (109-095-098, Jackson Immunoresearch) as a secondary antibody was added to a ratio of 1:100 and reacted at room temperature for 1 hour. After washing with PBS, Hoechst 33342 (H3570, Invitrogen) was added to 1:5000 for nuclear staining and reacted at room temperature for 10 minutes, and then washed twice with PBS. After ^{mounting with Fluoromount TM} Aqueous Mounting Medium (F4680, SIGMA), the cover slide was covered and fluorescence was observed with a confocal microscope (LSM700, Carl Zeiss, Inc.).

As a result of the analysis, fluorescence was not observed in all cell lines in the control antibody (control IgG) treatment group (see Fig. 8A), whereas in the antibody treatment group of the present invention, the CLDN3 expressing cell lines hCLDN3/TOV-112D, OVCAR-3, Caov- All fluorescence was observed on the cell surface of 3, and no fluorescence was observed in the TOV-112D cell line without CLDN3 expression. Figure 8b shows the experimental results representatively for the 4G3 antibody.

1-6. 클라우딘-3에 대한 결합력 비교 및 결합 친화성(binding kinetics) 확인1-6. Comparison of binding force to claudin-3 and confirmation of binding kinetics

For the 4G3 IgG antibodies prepared according to Example 2-3, their binding ability to claudin-3 was confirmed. Flow cytometry was performed using CHO-CLDN3 cells, and specific experiments were performed in the same manner as in Experimental Examples 1-3. As a control, native CHO-K1 cells were used, and commercially available anti-CLDN3 (FAB4620F, R&D systems) antibody was used as a control group.

In addition, in order to confirm the binding affinity of the antibody to claudin-3, it was measured using LigandTracer Green (ridgeview). LignadTrcer Green (ridgeview) is a cell-based measurement device that can measure in real time whether an antibody conjugated with FITC binds to an antigen on antigen-expressing cells. FITC was conjugated to the developed antibody using the FITC Antibody Labeling Kit (53027, Pierce). 500 ul of 5% milk/PBS as a blank the day before, reference cell line with very low expression of claudin-3, and cell line overexpressing CLDN3 at ^{a concentration of 3×10 5} cells/ml in a 100 mm culture dish (172931, Thermo scientific) 4 quadrants After incubation for 6 hours at 5% CO2 and 37°C, the medium was removed, washed with PBS, and then cultured overnight by adding 10 ml of the medium again. HEK293 (KCLB) and TOV-112D (ATCC) were used as reference cell lines, and hCLDN3/HEK293 and hCLDN3/TOV-112D were used as CLDN3 overexpressing cell lines. On the day of the experiment, all the medium was removed, replaced with 3 ml medium, and the culture dish was mounted on the equipment. After stabilization, FITC-conjugated antibodies were sequentially added to the final concentration of 3 nM and 9 nM, respectively, when the fluorescence values reached equilibrium And finally, after replacing with 3 ml new medium, the degree of dissociation was checked. The fluorescence measurement time was 15 seconds, the measurement delay time was 4 seconds, and the measurement interval was 72 seconds, and the fluorescence values in hCLDN3/HEK293 cells compared to HEK293 cells and hCLDN3/TOV-112D cells compared to TOV-112D cells were repeated three times. The fluorescence value at was analyzed with a one to one two state fitting model model. The resulting values are shown in Fig. 9C and Table 3.

CLDN3 cell linesCLDN3 cell lines	Fitting modelFitting model		k _a1 (M ^-1s ^-1)k _a 1 (M ^-1 s ^-1 )	k _d1 (s ^-1) k _d 1 (s ^-1 )	k _a2 (s ^-1) k _a 2 (s ^-1 )	k _d1 (s ^-1) k _d 1 (s ^-1 )	KD (nM)KD (nM)	Chi2 (%)Chi2 (%)
hCLDN3/HEK293 hCLDN3/HEK293	1:1, 2 state1:1, 2 state	4.66X10 ⁴ 4.66X10 ⁴	6.71X10 ^-4 6.71X10 ^-4	1.56X10 ^-4 1.56X10 ^-4	4.35X10 ^-5 4.35X10 ^-5	4.034.03	34.2734.27
hCLDN3/TOV-112DhCLDN3/TOV-112D	1:1, 2 state1:1, 2 state	4.74X10 ⁴ 4.74X10 ⁴	3.37X10 ^-4 3.37X10 ^-4	7.77X10 ^-4 7.77X10 ^-4	2.57X10 ^-5 2.57X10 ^-5	2.352.35	10.1510.15

As shown in FIGS. 9A and 9B, it was confirmed that peak shifts appeared in all of the 4G3 IgG antibodies and bound to claudin-3. At this time, the difference in peak shift was greater in the 4G3 IgG antibody-treated group, and as a result, it was confirmed that the 4G3 IgG antibody had better claudin-3 specific binding power than the conventional commercially available antibody. In addition, binding affinity analysis Results As shown in Figure 9c and Table 3, the kinetic value (KD) for the claudin-3 expressing cells of 4G3 is represented by 4.03 nM (hCLDN3/HEK293) and 2.35 nM (hCLDN3/TOV-112D) in two cell lines, respectively. This confirmed the high affinity of 4G3 for claudin-3. These results show that the 4G3 IgG antibody of the present invention has significantly better affinity than the existing anti-cladin-3 antibodies, for example, the existing'Chiara Romani et al . Oncotarget. The affinity is more than 5 times better than the 2015' IgGH6 antibody.

실험예 2: 항-클라우딘-3 항체의 항원 결합부위 확인Experimental Example 2: Identification of antigen binding site of anti-cladin-3 antibody

Among the regions in which CLDN3 naturally expressed in cells is exposed to the outside of the cell, specifically, it was attempted to determine where the antigen-binding site to which the antibody of the present invention binds. Thus, each of the regions corresponding to the extracellular 1st loop and the extracellular 2nd loop of CLDN3 was made and confirmed by substituting the corresponding region in CLDN1. Genes expressing amino acids 1 to 104 and CLDN3 amino acids 104 to 220 of CLDN1 (hCLDN1-3) or genes expressing CLDN1 amino acids 105 to 211 and CLDN3 amino acids 1 to 103 (hCLDN3-1) are respectively pcDNA 3.1 It was cloned into (+) (Invitrogen). Each gene was transduced into HEK293 (KCLB), and then a resistant cell line was selected with G418 to produce a cell line continuously expressing the fusion protein of hCLDN1-3 or hCLDN3-1. These were designated as hCLDN1-3/HEK293 and hCLDN3- 1/HEK293, respectively (see FIG. 10A). Whether the desired fusion protein was expressed in each cell line was confirmed by a conventional Western blotting method using anti-CLDN3 (341700, Invitrogen), anti-CLDN1 (sc-137121, Santa Cruz Biotechnology, Inc.) (FIG. 10B) See the bottom of). Treatment of the 4G3 antibody and flow cytometry for hCLDN1-3/HEK293 or hCLDN3-1/HEK293 cells were performed in the same manner as in Experimental Example 1-2.

As a result of the analysis, as shown in FIG. 10B, a shift of the peak was observed in the experiment for hCLDN1-3/HEK293, and no shift of the peak was observed in the experiment for hCL DN3-1/HEK293. As a result, it was confirmed that the 4G3 antibody binds to the extracellular 2 ^nd loop portion of hCLDN3.

실험예 3: 항-클라우딘-3 항체의 Experimental Example 3: Anti-Claudin-3 Antibody in vivo in vivo 종양 표적능 확인 Confirmation of tumor targeting ability

The tumor xenograft animal model is a human ovarian cancer cell OVCAR-3 (ATCC) and human breast cancer cell T47D (ATCC) 5 × 10 ⁶ were suspended in 100 ul PBS, and this was the lower part of a 6-week-old Athymic nude female mouse. It was produced by subcutaneous injection on the side. In the case of T47D, 17β-estradiol pellet (SE-121, Innovative Research of America) was planted subcutaneously.

In order to confirm the in vivo tumor targeting ability of the antibody of the present invention, a control antibody (ChromePure Human IgG, 009-000-003, Jackson ImmonoResearch) and a CF750 fluorophore to the 4G3 antibody were used in VivoBriteTM Rapid Antibody Labeling Kit (92161, Biotium). It was joined by using. The fluorescence/antibody molar ratio (degree of labeling, DOL) was measured to be 2.29 and 2.82, respectively, according to the recommended expected ratio according to the formula provided in the kit.

On the 60th day after tumor implantation in the animal model, a control antibody or 4G3 antibody labeled with CF750 fluorescence was intravenously injected at a dose of 100 ug/100 ul. Fluorescent signals emitted from mice were detected using a small animal in vivo imaging system (In Vivo Imaging System, IVIS SpectrumCT, PerkinElmer) at 6 hours, 24 hours, 48 hours, 72 hours, and 96 hours, and the last time point Liver, kidney, lung, spleen, small intestine, and tumor were excised and the fluorescence signal of antibody distribution by tissue was confirmed. Fluorescence signals were analyzed using Living Imaging Software supplied by the manufacturer.

As shown in FIGS. 11A and 11B, it was confirmed that the 4G3 antibody of the present invention specifically targets the transplanted tumor over time compared to the control antibody (control IgG), and is accumulated in the tumor compared to other tissues. Was confirmed.

실험예 4: 항-클라우딘-3 CAR의 Experimental Example 4: Anti-Claudin-3 CAR in vitro in vitro 발현 및 활성 확인 Expression and activity confirmation

4-1. 항-클라우딘-3 CAR 벡터의 활성 확인4-1. Confirmation of the activity of anti-Claudin-3 CAR vector

In order to confirm the activity of the vector (vector constructs 1 and 2) introduced in the transformed Jurkat cell line prepared according to Example 3-2, the expression of RFP635 in the vector was confirmed using Incucyte after stabilization after transformation. . As a result, as shown in FIG. 13, both vector constructs were successfully introduced into the Jurkat cell line, and it was found that RFP635 could be expressed.

4-2. 유세포 분석을 통한 활성 마커의 발현 증가 확인4-2. Confirmation of increased expression of active markers through flow cytometry

In Experimental Example 4-1, the effect of CAR was tested using cells in which the transduction and the expression activity of the construct in the vector were confirmed. At this time, a cell activation experiment was performed with a cell line expressing claudin-3 and a cell line not expressing, and hCLDN3/TOV-112D and TOV-112D (co-culture negative control) used in Experimental Example 1-3 were used as the cell lines, respectively. I did.

Through flow cytometry, when co-cultured with cells expressing claudin-3, the expression of the active markers CD69 and CD25 was increased to confirm that the cells expressing each CAR were activated when co-cultured with the cells expressing claudin-3. hCLDN3/TOV-112D was seeded and stabilized for one day, and then co-cultured with Jurkat cells expressing each CAR at a ratio of 1:3. At this time, the experiment was conducted using Jurkat cells not expressing CAR as a negative control. After 6 hours, the co-cultured Jurkat cells were harvested, labeled with antibodies that recognize CD69 and CD25 (Biolegend), respectively, and analyzed with BD FACS Calibur. As a result, as shown in Figs. 14 (data from Jurkat cells expressing CAR construct 1) and 15 (data from Jurkat cells expressing CAR construct 2), the two markers showing cell activation only in cells expressing anti-claudin-3 CAR. It was confirmed that the expression increased in response to a specific response to cells expressing claudin-3.

The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the technical field to which the present invention pertains will be able to understand that other specific forms can be easily modified without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative and non-limiting in all respects. For example, each component described as a single type may be implemented in a distributed manner, and similarly, components described as being distributed may also be implemented in a combined form.

The scope of the present invention is indicated by the claims to be described later, and all changes or modified forms derived from the meaning and scope of the patent claims and their equivalent concepts should be construed as being included in the scope of the present invention.

Claims

i) Claudin-3 binding domain;

ii) transmembrane domain; And

iii) a chimeric antigen receptor comprising an intracellular signaling domain.
The method of claim 1,

The binding domain specifically binds to the region of the second extracellular loop (ECL-2) of claudin-3, a chimeric antigen receptor.
The method of claim 2,

The extracellular second loop region of the claudin-3 will contain the amino acid sequence represented by SEQ ID NO: 2, chimeric antigen receptor.
The method of claim 1,

The claudin-3 binding domain is an antibody or a functional fragment thereof, chimeric antigen receptor.
The method of claim 4,

The antibody is selected from the group consisting of IgG, IgA, IgM, IgE and IgD, and the functional fragment is a diabody, Fab, F(ab'), F(ab')2, Fv, dsFv, and scFv. Which is selected from the group consisting of, chimeric antigen receptor.
The method of claim 1,

The claudin-3 binding domain is a heavy chain complementarity determining region 1 (VH-CDR1) comprising an amino acid sequence represented by SEQ ID NO: 3, a heavy chain complementarity determining region 2 (VH-CDR2) comprising an amino acid sequence represented by SEQ ID NO: 4 , And a heavy chain variable region comprising a heavy chain complementarity determining region 3 (VH-CDR3) comprising an amino acid sequence represented by SEQ ID NO: 5; And

Light chain complementarity determining region 1 (VL-CDR1) comprising the amino acid sequence represented by SEQ ID NO: 6, light chain complementarity determining region 2 (VL-CDR2) comprising the amino acid sequence represented by SEQ ID NO: 7, and SEQ ID NO: 8 Light chain variable region including light chain complementarity determining region 3 (VL-CDR3) including the amino acid sequence

Or

The chimeric antigen receptor that competitively binds to an epitope recognized by the claudin-3 binding domain including the heavy chain variable region and the light chain variable region.
The method of claim 1,

The claudin-3 binding domain is a heavy chain complementarity determining region 1 (VH-CDR1) comprising an amino acid sequence represented by SEQ ID NO: 9, a heavy chain complementarity determining region 2 (VH-CDR2) comprising an amino acid sequence represented by SEQ ID NO: 10. , And a heavy chain variable region comprising a heavy chain complementarity determining region 3 (VH-CDR3) comprising the amino acid sequence represented by SEQ ID NO: 11; And

Light chain complementarity determining region 1 (VL-CDR1) comprising the amino acid sequence represented by SEQ ID NO: 12, light chain complementarity determining region 2 (VL-CDR2) comprising the amino acid sequence represented by SEQ ID NO: 13, and SEQ ID NO: 14 Light chain variable region including light chain complementarity determining region 3 (VL-CDR3) including the amino acid sequence

Or

The chimeric antigen receptor that competitively binds to an epitope recognized by the claudin-3 binding domain including the heavy chain variable region and the light chain variable region.
The method of claim 1,

The claudin-3 binding domain is a scFv comprising an amino acid of SEQ ID NO: 15 or 16 or an amino acid having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% complementarity with the amino acid sequence Phosphorus, chimeric antigen receptor.
The method of claim 1,

The intracellular signaling domain is CD3 zeta (ξ, zeta), TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, CD278, CD66d, DAP10, DAP12, FcεRI And combinations thereof

Chimeric antigen receptor, characterized in that derived from a protein selected from the group consisting of.
The method of claim 1,

The chimeric antigen receptor further comprises a costimulatory domain.
The method of claim 10,

The costimulatory domains are MHC class I molecules, TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, SLAM proteins (signaling lymphocytic activation molecules), NK cell activating receptors, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1 , LFA-1(CD11a/CD18, lymphocyte function-associated antigen-1), 4-1BB(CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR) , KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6 , CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE/RANKL , DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108 ), S LAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, CD19a, a ligand that specifically binds to CD83, PD-1 and Chimeric antigen receptor, characterized in that it is derived from a costimulatory molecule selected from the group consisting of a combination thereof.
The method of claim 1,

The transmembrane domain is TCR alpha chain, TCR beta chain, TCR zeta chain, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, Chimeric antigen receptor, characterized in that derived from a protein selected from the group consisting of CD154 and CD8.
The method of claim 1,

The chimeric antigen receptor further comprises a hinge (hinge), chimeric antigen receptor.
The method of claim 1,

The chimeric antigen receptor further comprises a leader sequence at the N-terminus, chimeric antigen receptor.
The method of claim 1,

The chimeric antigen receptor is a chimeric antigen receptor comprising a sequence selected from the group consisting of SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.
A polynucleotide encoding the chimeric antigen receptor of claim 1.
A recombinant vector comprising the polynucleotide of claim 16.
An isolated host cell comprising the chimeric antigen receptor of claim 1.
19. The isolated host cell of claim 18, wherein the host cell is obtained from a subject to which the host cell is to be administered, or from an allogeneic subject to which the host cell is not to be administered.
The method of claim 18, wherein the host cells are mesenchymal stem cells (MSCs), dedifferentiation inducing stem cells (iPSCs), CD34 cells, hematopoietic endothelial cells, hematopoietic stem cells (HSCs), hematopoietic pluripotent progenitor cells, and embryonic stem cells ( ESCs), or immune cells.
The group consisting of T cell precursors, NK cell precursors, T cells, NK (Natural Killer) cells, NKT (Natural K iller T) cells, B cells, monocytes, macrophages and dendritic cells. The isolated host cell is selected from.
A pharmaceutical composition for preventing or treating cancer comprising the host cell of claim 18 as an active ingredient.
The method of claim 22,

The cancer is selected from the group consisting of ovarian cancer, colon cancer, bladder cancer, lung cancer, liver cancer, gastric cancer, esophageal cancer, breast cancer, prostate cancer, pancreatic cancer, uterine cancer, cervical cancer, melanoma, colon cancer, kidney cancer, and metastatic pleural tumor. , Pharmaceutical composition.