WO2021048315A1 - Use of duox1 inhibitors for treating cancer - Google Patents

Abstract

The present inventors have demonstrated that it is possible to control the secretory profile and phagocytosis function of pro-inflammatory macrophages, notably after irradiation on injured sites, by silencing the expression of a tumor suppressor gene called DUOX1 (dual oxidase 1). They therefore propose to inhibit the expression of the DUOX1 gene or the activity of the DUOX1 enzyme in tumor-associated macrophages for inducing a strong anti-tumor effect. They also propose to combine this treatment with a radiotherapy treatment, as said treatment is potentiated when DUOX1 is inhibited.

Description

USE OF DUOX1 INHIBITORS FOR TREATING CANCER

Summary The present inventors have demonstrated that it is possible to control the secretory profile and phagocytosis function of pro-inflammatory macrophages, notably after irradiation on injured sites, by silencing the expression of a tumor suppressor gene called DUOX1 (dual oxidase 1). They therefore propose to inhibit the expression of the DUOX1 gene or the activity of the DUOX1 enzyme in tumor-associated macrophages for inducing a strong anti-tumor effect. They also propose to combine this treatment with a radiotherapy treatment, as said treatment is potentiated when DUOX1 is inhibited.

Description of the prior art

Macrophages, key cells in the innate immune system, are the main component of the mononuclear phagocyte system (MPS), which also include bone marrow progenitors and blood monocytes. Macrophage functions are as diverse as their lineages and play important roles in normal homeostasis and disease development. This is especially true in acute and chronic inflammatory disease states such as wounds, malignancy, and autoimmune disorders. There is also increasing evidence that macrophages play a central role in both normal and diseased tissue remodeling including angiogenesis, basement membrane breakdown, leukocyte infiltration, and immune suppression. As such, the macrophage has emerged as a central drug target in a variety of disease states, including the tumor microenvironment (TME).

Macrophages are a large component of the leukocyte infiltrate into the TME. Over the last several decades, tumor-associated macrophages (TAMs) have been a subject of intense study for their impact on leukocytes, cytokines, and inflammatory mediators that either block or propagate tumor progression. Interestingly, the macrophage has been identified as a driver for inflammation, not only in cancer but also, in other disease states. Indeed, chronic inflammation that arises from diseases such as inflammatory bowel disease, silicosis, and asbestosis, pre-dispose these sites to cancer development. Interestingly, macrophages seem to have divided loyalties, on one hand promoting tumor resolution (M1/M(LPS)) and on the other propagating tumorigenesis (M2/M(IL-4)). Studies done almost a half century ago have shown that Ml macrophages have the capacity to kill and remove tumor cells, in line with the primary physiological function of Ml macrophages to remove foreign materials. The Ml cells initiate cytokine production within the TME and facilitate tumor cell destruction through recruitment of pro-immunostimulating leukocytes and phagocytosis of tumor cells. However, studies within that same research period show that M2 macrophages can also have a central role in tumor propagation. The M2 cells drive tumor development in both primary and metastatic sites through their contributions in basement membrane breakdown and deposition, angiogenesis, recruitment of leukocytes, and overall immune suppression. The macrophage, regardless of polarization state, retains the capacity for plasticity, including the ability to switch between phenotypes as a function of microenvironmental cues (Ngambenjawong C et al, 2017).

It has been shown that, after irradiation, macrophages are recruited at the irradiated site and play an important role in pathophysiological tissue response to radiotherapy.

Radiation-induced normal tissue toxicity is a complex response, which depends on the microenvironment, on the dose and fractionation of the ionizing radiations (IR), on the target site and volume irradiated, on concomitant or sequential treatments (chemo and/or immunotherapy). Each of these parameters and their interplay is very complex and still needs to be completely understood.

Recent studies have confirmed earlier data reporting macrophage infiltration within the site of the radiation-induced toxicity in the heart and in the lung. Scientists have long wondered whether the recruitment of macrophages is the cause or the consequence of the development of the radiation-induced fibrosis. It has been shown that CTGF inhibitor protects against radiation-induced fibrogenesis via normalization of the expression of genes that is associated with anti-inflammatory macrophage influx.

The present inventors recently showed that radiation-induced fibrosis is also associated with a large increase in Argl mRNA (an anti-inflammatory marker) in IMs, and with an increase in membrane expression of CD206 suggesting that IMs adopt an anti- inflammatory profile during radiation induced lung toxicity. This explains the major role of macrophages in the development of IR-induced tissue injury (Meziani L. et al. 2018).

Conversely, identification of effective targets that can enhance the pro-inflammatory secretory profile of tumor-associated macrophages, especially in tissues injured by IR, would be of very high interest. By upregulating the presence or the number of immune- promoting macrophages in injured sites, one could indeed increase the phagocytosis of the target cancer cells, and therefore increase the antitumor efficacy of radiotherapy. The present invention addresses this need.

Detailed description of the invention

The present inventors have demonstrated that it is possible to control the secretory profile and phagocytosis function of pro-inflammatory macrophages, notably after irradiation on injured sites, by silencing the expression of a tumor suppressor gene called DUOX1 (dual oxidase 1). They herein show that the DUOX1 gene is expressed in macrophages infiltrating the human radiation-induced lung injuries (RILI) and controls the anti-tumor effect of these macrophages. Their data show for the first time a strong anti-tumor effect associated with the inhibition of the DUOX1 gene in tumor-associated macrophages. Associated with an IFNy response, this anti-tumor effect is more pronounced when combined with a radiotherapy treatment.

More precisely, it has been discovered here for the first time that inhibiting the expression or the activity of the DUOX1 enzyme in tumor-associated macrophages (TAMs) promotes their secretion of pro-inflammatory cytokines IFNy, MCSF, MIP1A, and MTP IB, increases the Ml polarization of these cells and therefore the anticancer immune response in the host. Without being bound by this theory, it is thought that this pro- inflammatory behaviour shift is triggered by a decreased of Src phosphorylation that is observed when DUOX1 is inhibited in tumor-associated macrophages. As a matter of fact, it has been recently demonstrated that Src phosphorylation promotes the anti inflammatory profile of these macrophages (Hu et al, 2018).

The present invention first encompasses in vitro methods for promoting the secretion of pro-inflammatory cytokines such as IFNy, MCSF, MIP1A, or MIP IB in activated macrophages, or for increasing the number of Ml polarized macrophages in a monocyte population, said method comprising the step of contacting said cells with an inhibitor of the activity and/or expression of the DUOX1 enzyme.

DUOX1 (dual oxidasel) is a NOX homolog expressed mainly in the airway epithelium. It has been shown to contribute to epithelial responses for various environmental triggers, such as allergens, by an oxidant-dependent cell signaling mechanism. It has been implicated in the allergen-induced epithelial production of the cytokine IL-33, which is a strong determinant of allergic asthma. Chemical and peptidic inhibitors have been identified and produced in this context (see e.g. in US 10,143,718).

This NOX homolog is often downregulated in cancer cells, primarily due to epigenetic mechanisms (through hypermethylation of its promoter). Earlier studies have indeed shown that the expression of DUOX1 is suppressed in lung cancer cell lines compared to normal epithelial cells, and other studies have confirmed this down-regulation also in hepatic, NSCLC, adenocarcinomas and skin cancers. This therefore suggests the potential broad relevance of DUOX1 silencing in cancer biology. Authors have therefore suggested to enhance the level of DUOX1 in cancer cells in order to favor its anti-tumorigenic effect.

Based on analogous roles of the phagocyte oxidase NOX2, the main function of DUOX at mucosal surfaces (e.g. in the lung) is thought to be innate host defense against infection, by promoting direct luminal oxidative antimicrobial mechanisms catalyzed by locally secreted lactoperoxidase (Little et al, 2017). Importantly, its role on the activation of pro- inflammatory macrophages has never been highlighted so far.

In a first aspect, the present invention therefore relates to an inhibitor of the DUOX1 enzyme activity or expression, for its use for treating subjects suffering from cancer.

As used herein the term “inhibitor of DUOX1 enzyme activity or expression” (also called “the inhibitor of the invention”) refers to a compound that reduces or abolishes the biological function or activity of the DUOX1 enzyme. This inhibitor may perform any one or more of the following effects in order to reduce or abolish the biological function or activity of DUOX1: (i) the transcription of the gene encoding the DUOX1 enzyme is lowered, i.e. the level of the mRNA of the DUOX1 gene is lowered, (ii) the translation of the mRNA encoding the DUOX1 enzyme is lowered, (iii) the DUOX1 enzyme performs its biochemical function with lowered efficiency in the presence of the inhibitor, and (iv) the DUOX1 enzyme performs its cellular function with lowered efficiency in the presence of the inhibitor. In a preferred embodiment, said inhibitor is a chemical inhibitor, a peptide, a methylation agent, an antibody, an aptamer, a ribozyme, a small interfering nucleic acid, etc.

Inhibitors of the invention

In a preferred embodiment, the inhibitor of the invention is a peptide or another moiety having a reactive electrophile that can target the cysteine or other reactive residues within DUOX1 enzyme, to inhibit its activity, e.g., by covalently binding to this residue. Non limiting examples of suitable inhibitors are disclosed in US 10,143,718.

In another embodiment, the inhibitor of the invention is a chemical molecule.

Suitable chemical inhibitors include: VAS2870, acrolein (2,3-propenal), hydroxynonenal, curcumin ((IE, 6E)-l,7-Bis(4-hydroxy-3-methoxyphenyl)l-6- heptadiene-3,5-dione), sulforaphane (l-Isothiocyanat-4-methylsulinylbutane), cinnamaldehyde ((2E)-3 -phenyl -prop-2-enal), dimethyl fumarate, diphenyleneiodonium (DPI) or phenyl vinyl sulfonate.

DUOX proteins are expressed primarily at the apical surface of differentiated epithelial cell lineages, which relies largely on the co-expression of DUOX maturation factors, DUOXA1 and DUOXA2, which control their transport from the endoplasmic reticulum to the plasma membrane, resulting in a mature enzymatic complex. It has been demonstrated that activation of DUOX proteins to generate H2O2 as their primary product relies on Ca²⁺ signalling. Although DUOX enzymes do not require any additional co- factors for activation, other regulatory mechanisms have been also identified (ATP).

Structurally, the DUOX1 enzyme includes an internal domain with two calcium binding EF-hands, an additional transmembrane spanning sequence and an extracellular N- terminal peroxidase homology (PHD) domain. Sequence alignment of the two DUOX isoforms indicates relatively low sequence identity within regions of their PHD, EF-hand containing domains, and DUOXA a-helical regions, suggesting that isoform-specific functions may largely depend on unique regulatory elements within these regions (Little et al, 2017).

In another embodiment, the inhibitor of the invention can be a peptide inhibitor that impairs the DUOX1 activity by occupying the binding site (or a portion thereof) of the DUOX1 enzyme, thereby making the receptor inaccessible to its natural ligand (e.g. ATP). Consequently, its normal biological activity is prevented or reduced. The antagonistic activity of compounds towards the DUOX1 enzyme may be determined using various methods well known in the art. For example, the agents may be tested for their capacity to block the interaction of DUOX1 enzyme with ATP.

Upon initial discovery of DUOX silencing in lung cancer, it was shown that this is primarily due to increased DNA methylation within the DUOX promoter regions.

DNA hypermethylation has been well characterized as a signature mode of regulation for cancer cell. DNA methylation typically involves methylation of cytosine within CpG-rich regions that are prominently present in promoter regions of tumor suppressor genes. The intergenic promoter regions of DUOX1/DUOXA1 were found to be rich in CpG islands, and their hypermethylation in cancer results in reduced expression likely due to interference with binding of transcription factors such as Spl and Sp3. Therefore, DUOX1 has been considered to function as a tumor suppressor. In addition to DNA methylation, other epigenetic modifications such as methylation or acetylation of histones serve to control their interactions with DNA and thereby regulate gene expression (Little et al, 2017).

In another embodiment, the inhibitor according to the present invention can also promote the hypermethylation of the DUOX1 promoter. In some embodiments, the inhibitor of the invention consists in an antibody (the term including antibody fragment). In particular, the inhibitor may consist in an antibody directed against the DUOX1 enzyme in such a way that said antibody impairs the activation of said enzyme or the subsequent generation of H2O2. Antibodies can be raised according to known methods by administering the appropriate antigen (here DUOX1) or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique; the human B-cell hybridoma technique; and the EBV-hybridoma technique. Alternatively, techniques described for the production of single chain antibodies (see, e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti-DUOXl, single chain antibodies.

The inhibitor of the invention also includes anti-DUOXl antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to the receptor or channel.

Humanized antibodies and antibody fragments therefrom can also be prepared according to known techniques. “Humanized antibodies” are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described in the art.

After producing antibodies as above described, the skilled man in the art can easily select those blocking the DUOX1 enzyme.

In another embodiment, the inhibitor of the DUOX1 enzyme activity of the invention is an aptamer. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods. After raising aptamers directed against the DUOX1 enzyme as above described, the skilled man in the art can easily select those blocking the DUOX1 enzyme.

The chemical and peptide inhibitors mentioned above are used to inhibit the DUOX1 enzyme in tumor-associated macrophages in patients suffering from cancer. In a particular embodiment, these inhibitors are administered systemically (preferentially intravenously), or intra-tumorally, in order to be uptaken in vivo by the patient’s macrophages in situ. In another particular embodiment, these inhibitors are used ex vivo in order to inhibit the activity of the target enzyme in macrophages that have been collected from said patient. In any of these embodiments, the inhibitors can advantageously be encapsulated in liposomes that are put in contact, in vitro or in vivo , with the macrophages.

The inhibitor of the invention can also prevent or reduce the expression of the DUOX1 gene. The two mammalian DUOX genes and corresponding DUOXA genes (which encode for their specific partner proteins known as DUOX maturation factors) are oriented in a head- to-head fashion, in tandem on chromosome 15 (Little et al, 2017).

An “inhibitor of gene expression” refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of a gene.

Inhibitors of gene expression for use in the present invention are for example anti-sense oligonucleotide constructs. Anti-sense oligonucleotides, including anti-sense RNA molecules and anti-sense DNA molecules, act to directly block the translation of the mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of the protein (e.g. the DUOX1 protein), and thus its activity, in the target cell. Antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding the targeted DUOX1 protein can be used.

They can be synthesized, e.g., by conventional phosphodi ester techniques, and administered to the patients, by e.g., intravenous injection or infusion. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732).

In particular, small inhibitory RNAs (siRNAs) can function as inhibitors of the DUOX1 gene expression for use in the present invention. DUOX1 gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that DUOX1 gene expression is specifically inhibited (i.e. by RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known.

The DUOX1 enzyme, also called Dual oxidase 1 or Thyroid oxidase 1 (ThOXl), is encoded in humans by the DUOX1 gene located on the Chrl5:45.13 - 45.17, whose mRNA has the sequence NM_017434 (variant 1, SEQ ID NO:l) or NM_175940 (variant 2, SEQ ID NO:2). The encoded enzyme has the polypeptide sequence NP 059130 (SEQ ID NO:3).

In mice, DUOX1 is encoded by the DUOX1 gene located on the Chr2: 122.32 - 122.35, whose mRNA has the sequence NM_001099297 (SEQ ID NO:4). The encoded enzyme has the polypeptide sequence NP_001092767(SEQ ID NO:5).

Exemplary siRNAs targeting DUOX1 are known in the art, see e.g., in Dickinson et al, 2018. Some are commercially available, notably by Dharmacon (ref number: L-008126- 00-0005).

More generally, in the context of the invention, it is possible to use any anti-sense oligonucleotides that impairs, reduces or prevents the formation of the mRNAs of SEQ ID NO:l or 2, or of SEQ ID NO:4. Consequently, the formation of the proteins of SEQ ID NO: 3 or SEQ ID NO: 5 will be reduced or prevented.

The decreased expression level of the DUOX1 gene in macrophage cells can be assessed by any conventional mean, e.g. by RT-PCR using dedicate oligonucleotide primers such as those described in Donko et al, 2010 and in Dickinson et al, 2018.

In particular, the primer pairs SEQ ID NO: 11-12 and SEQ ID NO: 13-14, having the following sequences, can be used by RT-PCR:

- Sense strand : GGAACGGUCUCAUUUCCAATT (SEQ ID NO : 11)

- Antisense strand: UUGGAAAUGAGACCGUUCCCA (SEQ ID NO: 12)

And/or:

- Sense strand: CGAUUUGAUGGAUGGUAUATT (SEQ ID NO: 13)

- Antisense strand: UAUACCAUCCAUCAAAUCGCT (SEQ ID NO: 14)

The skilled person well knows the conditions and the settings of RT-PCR assays that should be used to detect the expression level of the DUOX1 gene in macrophage cells.

In another embodiment, it is possible to inhibit the activity of DUOX1 by inhibiting the activity or the expression of the maturation factor DUOXA1. In this embodiment, the inhibitor of the invention can therefore inhibit the expression of the DUOXA1 gene whose mRNA has the sequence NM_144565 (variant 1, SEQ ID NO:6), NM_001276264 (variant 2, SEQ ID NO:7) or NM_001276265.1 (variant 3, SEQ ID NO:8) or NM_00 1276266.1 (variant 4, SEQ ID NO:9) or NM_001276267.2 (variant 5, SEQ ID NO: 10) in humans. Said inhibitor can be for example an any anti-sense oligonucleotide as defined above.

Ribozymes can also function as inhibitors of gene expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalysing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyse endonucleolytic cleavage of mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays.

Both antisense oligonucleotides and ribozymes useful as inhibitors of gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

Antisense oligonucleotides siRNAs and ribozymes of the invention may be delivered into macrophages in association with a vector. In its broadest sense, a “vector” is any vehicle capable of facilitating the transfer of the antisense oligonucleotide siRNA or ribozyme nucleic acid to the cells and preferably cells expressing the targeted DUOX1 proteins. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide siRNA or ribozyme nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art.

These various nucleic acid inhibitors can be administered systemically, preferentially intravenously, or intra-tumorally, in order to be uptaken in vivo by the patient’s tumor- associated macrophages in situ.

Yet, in a preferred embodiment, these inhibitors are used ex vivo in order to inhibit the expression of the target enzyme in macrophages that have been collected from said patient.

In any case, these nucleic acid inhibitors can be encapsulated in liposomes before being put in contact with the macrophages.

In another embodiment, these nucleic acid inhibitors are carried by a vector chosen in the group consisting of: adenovirus, adeno-associated virus (AAV), herpesvirus, lentivirus, vaccinia virus, cytomegalovirus (CMV) and the like, that have been shown to effectively transfect macrophages. They can thus advantageously be used for preparing the cell compositions of the invention, said compositions comprising recombinantly modified macrophages in which the expression of the DUOX1 gene is reduced or abolished.

Preferably, said virus should be a defective virus. The term “defective virus” denotes a virus incapable of replicating in the target cell. Generally, the genome of the defective viruses used in the context of the present invention hence lacks at least the sequences needed for the replication of the said virus in the infected cell. These regions may be either removed (wholly or partially), or rendered non-functional, or replaced by other sequences, in particular by the recombinant nucleic acid. Preferably, the defective virus nevertheless retains the sequences of its genome which are needed for encapsulation of the viral particle.

Said defective virus can be an AAV vector virus. The AAV vector display several advantages such as i) a long lasting expression of synthesized genes, ii) a low risk for pathogenic reactions (because they are artificially manufactured and not toxic), iii) they trigger low immunogenic response and iv) they do not integrate the human genome. In order to increase the efficacy of gene expression, and prevent the unintended spread of the virus, genetic modifications of AAV can be performed. These genetic modifications include the deletion of the El region, deletion of the El region along with deletion of either the E2 or E4 region, or deletion of the entire adenovirus genome except the cis- acting inverted terminal repeats and a packaging signal. Such vectors are advantageously encompassed by the present invention.

Another advantageous vector for the preparation of the cell compositions according to the invention is an adenoviral vector. Indeed, Haddada H. et al. Biochem. Biophys. Res. Commun (1993) showed that adenoviruses are capable of very effectively infecting cells of the monocyte-macrophage line, of being maintained stably therein and of expressing a therapeutic gene. Different serotypes of adenovirus exist, the structure and properties of which vary somewhat but which are not pathogenic for man, and in particular for non- immunosuppressed subjects. Moreover, these viruses do not integrate in the genome of the cells they infect, and can incorporate large fragments of exogenous DNA. Among the different serotypes, it is preferable in the context of the present invention to use adenoviruses type 2 or 5 (Ad 2 or Ad 5). In the case of Ad 5 adenoviruses, the sequences needed for replication are the E1A and E1B regions. These sequences are preferable deleted from the recombinant nucleic acid used in the present invention.

Another advantageous vector for the preparation of the cell compositions according to the invention is a lentivirus. Lentiviruses like HIV have the capacity to infect non-dividing and dividing cells and to integrate into the host cell genome. Due to these characteristics, HIV-based lentiviral vectors have been proposed as good delivery system candidates for gene therapy, but the attempt to use them in clinical trials has raised concerns about their safety including the risk of genetic recombination leading to the generation of replication- competent retrovirus in humans. Further modifications in the packaging and genetic components of viral genes have been carried out to develop safer HIV-based lentiviral vector systems. Today, a number of safe HIV-based lentiviral vectors have been designed for efficiently transducing target genes into differentiated monocyte-derived macrophages (Leyva F. et al, BMC biotechnology (2011). Any of these vectors can be used in the context of the present invention.

Preferred lentiviral vectors are those that have been modified so as to be safely administered into mammals. These vectors are for example the HIV / SIV vectors known to be useful in human or mammal gene therapy, as disclosed in Neschadim A. et al. Biol Blood Marrow Transplant. 2007 Dec; 13(12): 1407-16. The most interesting vectors to use are the HIV and SIV based lentiviral Self Inactivating vectors (Neschadim A. et al. Biol Blood Marrow Transplant. 2007 Dec; 13(12): 1407-16.), the adenoviral vectors (Haddada H. et al. Biochem. Biophys. Res. Commun (1993)) and the sleeping Beauty transposon non- viral vectors (Aronovich et al. Human. Molecular. Genetics (2011)).

Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al., 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.

Typically, the nucleic acid molecule or the vector of the present invention include “control sequences”, which refers collectively to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (“IRES”), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control sequences need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell. Another nucleic acid sequence, is a “promoter” sequence, which is used herein in its ordinary sense to refer to a nucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding RNA polymerase and initiating transcription of a downstream (3 - direction) coding sequence. Transcription promoters can include “inducible promoters” (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), “repressible promoters” (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and “constitutive promoters”. Acellular pharmaceutical compositions

In one particular embodiment, the inhibitors of the invention are administered systemically or locally directly in the tumour. They are the only active principle of the composition of the invention. In this case, said inhibitors are preferentially antibodies, or any of the chemical or peptide inhibitors described above. In other words, in this embodiment, the pharmaceutical composition of the invention contains, as active principle, only the inhibitors of the invention, along with a pharmaceutically acceptable excipient, as defined below. It does not contain any cell.

In this composition, the inhibitor of the invention is preferably complexed with a stabilizing moiety or encapsulated, e.g., in liposomes. The inhibitor is provided to the subject, systemically or intratum orally, and the encountered macrophages engulf them by phagocytosis in vivo.

In this embodiment, the inhibitors of the invention can be passively or actively targeted to tumor-associated macrophages by any known delivery systems. Active delivery systems encompass complexing the inhibitors of the invention with targeting ligands such as anti-CD206 antibodies, folic acid, etc. Passive delivery systems include micro or nanoparticles and liposomes (for a review, see Ngambenjawong et al., 2018).

In particular, the inhibitors of the invention can be encapsulated in liposomes so as to protect them from environmental degradation, and favour their phagocytose by the encountered macrophages. Liposomes have indeed been shown to efficiently target and be uptaken by macrophages, thereby efficiently delivering their content into macrophages in vivo (Meziani et al, 2018).

When the patient suffers from a lymphoid / myeloid cancer, such as leukemia, then the pharmaceutical composition of the invention, as disclosed above, is preferably injected systemically, e.g., by intravenous route. Said lymphoid / myeloid cancer is for example a lymphoid leukemia; a plasma cell leukemia; an erythroleukemia; a lymphosarcoma cell leukemia; a myeloid leukemia; a basophilic leukemia; an eosinophilic leukemia; a monocytic leukemia; a mast cell leukemia; a megakaryoblastic leukemia; a myeloid sarcoma; or a hairy cell leukemia.

When the patient suffers from a solid cancer, then the pharmaceutical composition of the invention, as described above, is preferably injected directly inside the tumor, by conventional harmless means. Said solid cancer is for example a breast, lung, renal, thyroid, prostate, adenocarcinoma, head and neck cancer, or a gastrointestinal cancer including esophageal cancer, stomach cancer, colon cancer, intestinal cancer, colorectal cancer, rectal cancer, pancreatic cancer, liver cancer, cancer of the bile duct or gall bladder; malignancies of the female genital tract, including ovarian carcinoma, uterine endometrial cancers, vaginal cancer, and cervical cancer; bladder cancer; brain cancer, including neuroblastoma; sarcoma, osteosarcoma; and skin cancer, including malignant melanoma or squamous cell cancer. By a “therapeutically effective amount” is herein meant a sufficient amount of the inhibitor at a reasonable benefit/risk ratio applicable to the medical treatment. It will be understood that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific polypeptide employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per Kg body weight, per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the inhibitor for the symptomatic adjustment of the dosage to the subject to be treated.

This acellular composition can also be used in vitro for treating collected macrophages and inhibit the expression or activity of DUOX1 in same.

Cell compositions of the invention In another particular embodiment, the inhibitors of the invention are used in vitro in order to inhibit the target DUOX1 enzyme in macrophages that have been collected from the subject. In this embodiment, these macrophages are thus modified ex vivo. The modified macrophages are then reintroduced in the patient. In this embodiment, the pharmaceutical composition of the invention therefore essentially contains modified macrophages in which the DUOX1 enzyme has been inactivated (either genetically or chemically). More precisely, in this case, the pharmaceutical composition of the invention contains monocyte-derived macrophages (i.e., monocytes that have been ex vivo differentiated into macrophages) in which the expression or the activity of the DUOX1 enzyme is inhibited or decreased by the inhibitors of the invention (as listed above).

As used herein, the term “monocyte-derived macrophages” designates mononuclear cells that have been cultivated and differentiated into macrophages from peripheral blood monocytes (PBMCs), or from their bone marrow or blood precursors, under the conditions detailed in the prior are (see Bartholeyns J et al., Anticancer Res. (1991)). As precursors, it is also possible to use pluripotent stem cells, myeloid stem cells (CFU- GEMM), myelomonocytic stem cells (CFU-GM), CFU-M, monoblasts or promonocytes.

Since PBMCs are found in the blood, a PBMC sample can be obtained by a completely harmless and non-invasive blood collection from the subject. It is therefore preferred. Bone-marrow samples can also be collected.

Withdrawal and isolation of PBMCs / monocyte-macrophage cells or their precursors may be performed by any technique known to a person skilled in the art. These different techniques can involve physical separation steps (centrifugation, cell sorting (FACS), and the like), and selection with immunological compounds (specific antibodies for cell markers and the like) or biochemical compounds (membrane receptor ligands), and the like. Cultivating the isolated cells may be performed in different media known to a person skilled in the art (for example RPMI, IMDM), supplemented, inter alia, with serum and amino acids. The culture of the cells is carried out under sterile conditions, preferably at 37° C, as illustrated in the examples. It may be performed in culture plates, or preferably in teflon bags.

Monocytes can be recovered from the peripheral blood of an individual by conventional means. These monocytes are positive for the markers: CD 14, Ly6C and CD 16 but negative for the markers CD56 (which is a marker of NK cells), CD3 (marker of T cells) and CD19 (marker of B cells). The presence of these markers can be assessed by any conventional means, e.g., by cytometry (FACS). To generate macrophages, PBMCs are then cultivated under suitable conditions permitting their differentiation. Human blood monocyte differentiation into macrophages can for example be induced in vitro using three different methods, namely by culturing PBMCs in 1) human serum (HS), 2) fetal bovine serum (FBS) with granulocyte- macrophage colony-stimulating factor (GM-CSF) or 3) FBS with macrophage colony- stimulating factor (M-CSF).

Differentiated macrophages are positive for the markers: CD64, F4/80, but negative for the markers Ly6C (which is a marker of monocytes), CD3 (marker of T cells) and CD19 (marker of B cells). Preferably, the cell composition of the invention contains more than 90%, preferably more than 95% and ideally more than 99% of such cells. The presence of these markers can be assessed by any conventional means, e.g., by cytometry (FACS).

Furthermore, the differentiated macrophages are then to be activated in vitro by putting them in contact with an activating agent such as recombinant GM-CSF, recombinant IFNy, recombinant IL2 or recombinant TNFa. For example, the macrophages can be contacted with recombinant GMCSF at 205 ng/mL during 1 to 10 days, preferably during 6 days.

In this embodiment, the monocytes-derived activated macrophages are contacted with the inhibitors of the invention prior to their administration to the patient. In particular, the macrophages can be contacted with chemical inhibitors of DUOX1 activity, or with the recombinant nucleic acids inhibiting the expression of the DUOX1 gene, as described above. They can also be contacted with the acellular composition described above, preferably with a composition containing the DUOX1 chemical inhibitors of the invention, encapsulated in liposomes.

The contacting step can occur before the monocytes are differentiated into macrophages. Preferably, the inhibition occurs before the monocytes are differentiated into macrophages (i.e., the contacting step occurs ex vivo on a population of macrophages directly).

The inhibited macrophages are then conditioned for their administration in the patient, and the “cell pharmaceutical composition of the invention” is produced. The cell pharmaceutical composition of the invention therefore contains monocyte- derived activated macrophages in which the expression or the activity of the DUOX1 enzyme has been inhibited, and a pharmaceutically acceptable excipient. More precisely, the cell compositions of the invention possess more than 80% of macrophages or, more preferably more than 90% of macrophages, still more preferably more than 99% of macrophages, in which the expression or the activity of the DUOX1 enzyme has been inhibited, and a pharmaceutically acceptable excipient. This means that the cell composition of the invention contains very few other cells, if any.

This cell pharmaceutical composition is conditioned so as to be administered systemically (e.g. in patients suffering from leukemia) or intra-tumorally (e.g., in patients suffering from solid cancers). Appropriate vehicles and excipients are provided below.

When the patient suffers from a lymphoid / myeloid cancer, such as leukemia, then the cell pharmaceutical composition of the invention, as disclosed above, is preferably injected systemically, e.g., by intravenous route. Said lymphoid / myeloid cancer is for example a lymphoid leukemia; a plasma cell leukemia; an erythroleukemia; a lymphosarcoma cell leukemia; a myeloid leukemia; a basophilic leukemia; an eosinophilic leukemia; a monocytic leukemia; a mast cell leukemia; a megakaryoblastic leukemia; a myeloid sarcoma; or a hairy cell leukemia.

When the patient suffers from a solid cancer, then the cell pharmaceutical composition of the invention, as described above, is preferably injected directly inside the tumor, by conventional harmless means. Said solid cancer is for example a breast, lung, renal, thyroid, prostate, adenocarcinoma, head and neck cancer, or a gastrointestinal cancer including esophageal cancer, stomach cancer, colon cancer, intestinal cancer, colorectal cancer, rectal cancer, pancreatic cancer, liver cancer, cancer of the bile duct or gall bladder; malignancies of the female genital tract, including ovarian carcinoma, uterine endometrial cancers, vaginal cancer, and cervical cancer; bladder cancer; brain cancer, including neuroblastoma; sarcoma, osteosarcoma; and skin cancer, including malignant melanoma or squamous cell cancer. Treatment methods of the invention

In a further aspect, the present invention relates to the use of the above-mentioned pharmaceutical compositions (acellular or cell compositions) in methods for treating subjects in need thereof.

As used herein, the term "subject" relates to any mammal including a mouse, rat, pig, monkey and horse. In a specific embodiment, it refers to a human. A "subject in need thereof" or a "patient" in the context of the present invention is intended to include any subject that will benefit or that is likely to benefit from the methods and pharmaceutical compositions of the present invention. The subject may suffer from a cancer of any stage such that it could be an early non-invasive cancer or could be a late stage cancer that has already progressed to form metastases in the body. Said “cancer” are detailed below.

In a preferred embodiment, the “subject” to be treated according to the present invention is a subject suffering from an advanced / established cancer, i.e., a late stage cancer, that has potentially already progressed to form metastases in the body (metastatic cancer).

In these methods, the pharmaceutical compositions of the present invention can be administered in the form of injectable compositions (e.g., intravenously, intramuscularly, subcutaneously and intra-articularly), either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. These preparations may also be emulsified.

Said pharmaceutical compositions can also be administered by other routes such as orally, nasally, rectally, topically, intravenously, intramuscularly, subcutaneously, sublingually, intrathecally, intraperitoneally, intra-articularly or intradermally. Preferably, the pharmaceutical compositions of the invention are administered intravenously or intra arterially. When the subject suffers from an accessible solid cancer, the preferred route is intra -tumorally.

In a particular embodiment, the compounds of the invention can be administered in a slow-release formulation, that is able to release the inhibitors or the inhibited cells to the surroundings (typically the TME) in a controlled, non-instant manner, time-dependent manner. This slow-release formulation may comprise a biodegradable polymer, for example selected from the group consisting of a homopolymer of lactic acid; a homopolymer of glycolic acid; a copolymer of poly-D,L, -lactic acid and glycolic acid; a water-insoluble peptide salt of a luteinizing hormone-releasing hormone (LHRH) analogue; a poly(phosphoester); a bis(p- carboxyphenoxy)propane (CPP) with sebacic acid copolymer; a polyanhydrides polymer; poly(lactide)-co-glycolide)polyethylene glycol copolymers; and an ethylene-vinyl acetate copolymer.

The compositions of the present invention are administered in amounts and at frequencies sufficient to treat or diminish cancer. A patient's progress can be determined by measuring and observing changes in the concentration of cancer markers; by measuring the actual size of the tumor over time and/or by determining any other relevant clinical markers which are well-known in the art. The determination, measurement, and evaluation of such characteristics and markers associated with clinical progress are well- known to those of ordinary skill in the art. In a particular embodiment, as disclosed in the examples of the present application, the compositions of the invention are intended to enhance the tumor immunogenicity of a radiotherapy treatment. While not being bound to any particular theory, it is believed that inhibiting DUOX1 enhances the pro-inflammatory behavior of macrophages in tumors (probably by diminishing the phosphorylation of Src, known to promote the pro-tumoral profile of macrophages and by increasing IFNg production), thereby inducing a significant protective anticancer immune response that enhances the effect of the radiation therapy.

In other words, the present invention targets the use of the inhibitors mentioned above or of the inhibited macrophages described above, for manufacturing a pharmaceutical composition intended to be administered prior or after radiotherapy to a subject in need thereof. It is also drawn to the use of the inhibitors mentioned above or of the inhibited macrophages described above for manufacturing a pharmaceutical composition intended to potentiate a radiotherapy treatment to a subject in need thereof. It is finally drawn to the use of the inhibitors mentioned above, or of the inhibited macrophages described above, for manufacturing a pharmaceutical composition intended to treat cancer, in conjunction with radiotherapy, in a subject in need thereof.

For the definition of “cancer” and “radiotherapy”, please refer to the section below.

Exemplary radiotherapeutic protocols are well-known in the art. They are for example from 50 to 80 Grays (Gy) for solid tumors, and from 20 to 40 Gy for lymphomas.

Preventive (adjuvant) doses are typically around 45-60 Gy in 1.8-2 Gy fractions (for breast, head, and neck cancers.) Many other factors are considered by radiation oncologists when selecting a dose, including whether the patient is also receiving chemotherapy, patient comorbidities, whether radiation therapy is being administered before or after surgery, and the degree of success of surgery.

In a second aspect, the present invention is drawn to the inhibitors mentioned above, or the pharmaceutical compositions described above,

• for their use for enhancing tumor immunogenicity in subj ects that will or that have received a radiotherapy treatment,

• for their use for inducing a significant protective anticancer immune response in subjects that will or that have received a radiotherapy treatment,

• for their use for potentiating a radiotherapy treatment in a subj ect in need thereof,

• for their use for treating cancer, in conjunction with radiotherapy, in a subject in need thereof. In one embodiment, administering the compositions of the invention will enable to reduce the dose of irradiation and therefore results in the alleviation of the side effects incurred by the radiation treatment.

In an embodiment, the compositions of the present invention are administered after the radiotherapy treatment, typically 24h after radiotherapy. It is indeed believed that the radiotherapy treatment will destroy the intratumor originate TAMs, so that the administered inhibited macrophages can access and propagate easily inside the tumor. The time of administration will depend on the specific formulation and on the time necessary for the inhibitors to reach the target macrophages. The time of administration will be chosen so as to provide the optimal concentration of the inhibitors or of the cell compositions of the invention, at the time of irradiation.

In another embodiment, the compositions of the present invention are administered prior the radiotherapy treatment has been applied to the patient, typically 24h prior the radiotherapy treatment has been applied.

In another embodiment, the administration of the compositions of the present invention and the radiotherapy treatment are performed concomitantly.

The present disclosure also provides methods aiming at treating patients suffering from cancer, enhancing tumor immunogenicity in subjects that will or that have received a radiotherapy treatment, inducing a significant protective anticancer immune response in subjects that will or that have received a radiotherapy treatment, potentiating a radiotherapy treatment in a subject in need thereof, in a subject in need thereof.

Useful definitions

As disclosed herein, the terms “in vitro” and “ex vivo ” are equivalent and refer to studies or experiments that are performed using biological components (e.g. cells or population of cells) that have been isolated from their usual host organisms (e.g. animals or humans). By contrast, the terms “in vivo ” or “in situ ” refer to studies that are conducted on whole living organisms (e.g., humans), after administration of the composition of the invention in a living subject.

As used herein, the term “pharmaceutically” or “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. In the pharmaceutical compositions of the present invention, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings. Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.

Preferably, the pharmaceutical compositions of the invention contain excipients or vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Solutions comprising compounds of the invention as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The active ingredient can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active agent in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations of the invention are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.

As used herein, the term “nucleic acid molecule” has its general meaning in the art and refers to a DNA or RNA molecule. However, the term captures sequences that include any of the known base analogues of DNA and RNA such as, but not limited to 4- acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil, 5-fiuorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethyl-aminomethyluracil, dihydrouracil, inosine, N6-isopentenyl adenine, 1-methyladenine, 1-methylpseudouracil, 1 -methyl guanine, 1-methylinosine, 2, 2-dimethyl guanine, 2-methyladenine, 2- methylguanine, 3 -methyl cytosine, 5 -methyl cytosine, N6-methyladenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyamino-methyl-2-thiouracil, beta- D-mannosylqueosine, 5 '-methoxycarbonylmethyl uracil, 5-methoxyuracil, 2-methylthio- N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2- thiouracil, 4-thiouracil, 5-methyluracil, -uracil-5-oxyacetic acid methylester, uracil-5- oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.

As used herein, the term “cancer” has its general meaning in the art and includes, but is not limited to, solid tumors and blood-born tumors. The term “cancer” encompasses both primary and metastatic cancers. Examples of cancers that may be treated by methods and compositions of the invention include, but are not limited to, cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type (though it is not limited to these): carcinoma; undifferentiated carcinoma; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; malignant gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; malignant carcinoid tumor; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous; adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; mammary Paget's disease; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; malignant thymoma; ovarian stromal tumor; thecoma; granulosa cell tumor; and roblastoma; Sertoli cell carcinoma; Leydig cell tumor; lipid cell tumor; paraganglioma; extra-mammary paraganglioma; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus; sarcoma; fibrosarcoma; fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma; brenner tumor; phyllodes tumor; synovial sarcoma; mesothelioma; dysgerminoma; embryonal carcinoma; teratoma; struma ovarii; choriocarcinoma; mesonephroma; hemangiosarcoma; hemangioendothelioma; kaposi's sarcoma; hemangiopericytoma; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor; ameloblastic odontosarcoma; ameloblastoma; ameloblastic fibrosarcoma; pinealoma; chordoma; glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma; neurofibrosarcoma; neurilemmoma; granular cell tumor; malignant lymphoma ( Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; small lymphocytic; large cell, diffuse; follicular; mycosis fungoides; other specified non- Hodgkin's lymphomas); malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia (lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia). The term "irradiation therapy" is commonly used in the art to refer to multiple types of radiation therapy including internal and external radiation therapy, radio-immunotherapy, and the use of various types of radiation including X-rays, gamma rays, alpha particles, beta particles, photons, electrons, neutrons, radioisotopes, and other forms of ionizing radiation. As used herein, the terms “irradiation therapy”, "radiation therapy", “radiation” and "irradiation" are inclusive of all of these types of radiation therapy, unless otherwise specified. There are different types of radiotherapy machines, which work in slightly different ways. The number and duration of the radiotherapy sessions depend on the type of cancer and where it is located in the body. A superficial skin cancer may need only a few short treatments, whereas a cancer deeper in the body may need more prolonged treatment.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

Figure legends

Figure 1 A and B: Duoxl (red) and CD163 (brown) staining in human biopsies from irradiated and non-irradiated human lung. C and D: mouse BMDMS (WT and DUOX1 KO) treatment in vitro , using mouse recombinant MCSF and GMCSF. After 5 days, culture supernatants were analyzed using cytokine arrays. E: WT and Duoxl KO BMDMs were treated using recombinant GMCSF and MCSF six days and 5 minutes after activation. Activated BMDMs were incubated or not with catalase. Src phosphorylation was evaluated by Western blotting.

Figure 2 discloses the evaluation of phagocytosis in the tested animal models. A: Fluorescent beads were administered intra-nasally for WT and KO mice. After 4 hours, pulmonary macrophages were harvested. B: Fluorescent beads were administered intra- peritoneally for WT and KO mice. After 2 hours, peritoneal macrophages were harvested. C: WT and KO BMDMs were incubated with fluorescent beads during 30 minutes at 37°C. Phagocytosis was analyzed by flow cytometry and presented as percent (%) of cells phagocyting the fluorescent beads and the mean fluorescence intensity (MFI) of phagocyted fluorescent beads.

Figure 3 discloses the DUOX-1 involvement in the anti -tumor effect of macrophage. MC38 cells were injected subcutaneously in C57BL/6 mice. Day 9, GMCSF-induced pro- inflammatory WT and DUOX-1 KO BMDMs were injected intra-tumorally. A: Tumor growth. B: survival rate.

Figure 4 discloses the DUOX-1 involvement in macrophage and tumor response to radiotherapy. MC38 cells were injected subcutaneously in C57BL/6 mice. Day 8, tumors were irradiated or not locally at 8Gy. At day 9, GMCSF-induced pro-inflammatory WT and DUOX-1 KO BMDMs were injected intra-tumorally. A: Tumor growth. B: survival rate.

Figure 5 further demonstrates the biological antitumoral effect of a combination of macrophages and radiotherapy treatment. MC38 cells were injected subcutaneously in C57BL/6 mice. Day 8, tumors were irradiated or not locally at 8Gy. At day 9, GMCSF- induced pro-inflammatory WT and DUOX-1 KO BMDMs were injected intra-tumorally. Three days after intra-tumor injection of BMDMs, tumor-infiltrating immune cells were characterized by flow cytometry. A, B and C represent the percent (%) of lymphoid cell producing IFNy. D, E and F represent the mean fluorescence intensity (MFI) of IFNy in lymphoid cells. G and H represent the percent (%) of myeloid cell producing IFNy I and J represent the mean fluorescence intensity (MFI) of IFNy in myeloid cells.

Figure 6 discloses additional data showing that DUOX1 controls macrophage differentiation, activation and secretion in vitro. (A) Macrophage precursors from WT or Duox ^~ bone marrow were cultured for 6 days in the presence of recombinant GM-CSF. (B) Supernatants from cultured bone marrow-derived macrophages (BMDMs) were analyzed for cytokine secretion. (C) The phenotype of cultured BMDMs was analyzed by flow cytometry. Figure 7 discloses additional data showing that DUOX1 controls the phagocytotic function of macrophages both in vitro and in vivo. (A) Macrophage precursors from WT or Duoxl bone marrow were cultured in the presence of M-CSF. After 6 days, fluorescent beads (FluoSpheres) were added to the BMDMs for 30 minutes. (B) M-CSF cultured BMDMs were analyzed by flow cytometry for their ability to take up the FluoSpheres, which is represented as the fold increases in mean fluorescence intensity (AMFI= MFI of the specific fluorescence of beads - MFI of control (nontreated BMDMs)). The right panels show histograms of FluoSphere (Ctrl) and FluoSphere⁺ BMDMs.

Figure 8 shows that RT enhances the antitumor effect of ΌiiocG proinflammatory macrophages in TCI tumor model. (A) Tumor growth was monitored in WT mice treated with PBS, WT proinflammatory BMDMs or ΌiiocG proinflammatory BMDMs. (B) The Kaplan-Meier survival curves for the treated mice are shown (C) Tumor growth is shown for individual mice in each treatment group.

Figure 9 shows that Duoxt proinflammatory macrophages induce IFNy production by myeloid cells in irradiated tumors. (A) The numbers of tumor-infiltrating cDCl are shown. (B) The percentages of IFNy- tumor-infiltrating cDCl are presented for each treatment group. (C) Representative histograms of åFNy⁺ tumor-infiltrating cDCl are shown.

Figure 10 discloses the expression of the inhibitory costimulatory receptors CTLA4 and PD-1 on lymphoid cells. (A) Mean fluorescence intensity (AMFI= mean fluorescence intensity of antibody-mean fluorescence intensity of isotype control) of CTLA4 expression on tumor Tregs, CD4⁺ T cells, CD8⁺ T cells and NKs and representative histograms of CTLA4⁺ tumor-infiltrating Tregs, CD4⁺ T cells, CD8⁺ T cells and NK cells are shown. (B) Mean fluorescence intensity (AMFI= mean fluorescence intensity of antibody-mean fluorescence intensity of isotype control) of PD-1 expression on tumor Tregs, CD4⁺ T cells, CD8⁺ T cells and NKs and representative histograms of PD-1⁺ tumor-infiltrating Tregs, CD4⁺ T cells, CD8⁺ T cells and NKs are shown. Figure 11 discloses the cytokine profile analysis in the tumor tissue. Tumor tissue from mice treated with BMDMs and radiotherapy were analyzed for cytokine secretion.

Materials and methods Animal models

Animal procedures were performed according to the protocols approved by the Ethical Committee CEEA 26 and in accordance with recommendations for the proper use and care of laboratory animals. For sub-cutaneous tumor model, female C57BL/6 (8 weeks old) were purchased from Janvier Laboratories (France) and housed in the Gustave Roussy animal facility.

For bone morrow, Duoxl knockout (KO) mice, previously described (Donko etal, 2010) were used. Duoxl knockout mice were backcrossed onto C57BJ/6F background for more five generations to obtain wild type (WT) littermate as control. C57BL/6F background was from Charles River Laboratories (France). Mice are housed in a pathogen-free facility at Gustave Roussy.

Bone morrow isolation and differentiation into macrophages

Femur and tibia of Duoxl KO and WT mice (8-10 weeks old) were flushed and bone morrow was obtained. Erythrocytes were lysed using ACK Lysing Buffer (Gibco) during 5 minutes at room temperature. After a wash with phosphate buffered saline (PBS) and a centrifugation (400g, 20°C, 5 minutes), cells were suspended and cultured in DMEM-F12 medium supplemented with both fetal bovine serum (FBS, 10%) and penicillin/streptomycin (1%). Bone morrow cells were incubated in indicated medium at 37°C, 5% CO2, during 30 minutes. Then, adherent cells were washed using PBS and non adherent cells were discarded. Adherent cells were incubated in a new medium (DMEM- F12 medium, FBS10% and penicillin/streptomycin 1%) supplemented with either recombinant mice GMCSF or recombinant mice MCF (R&D) at 250 ng/mL. Recombinant GMCSF was used to induce the pro-inflammatory bone morrow derived macrophages (BMDMs) and recombinant MCF was used to induce anti-inflammatory BMDMs (Overmeire et ah, 2016). After 6 days of culture, BMDMs were obtained as homogenous adherent population (Valledor et al, 2004) and used for subsequent experiments. BMDMs staining using celltracker

BMDMs were incubated for 45 minute with CellTracker™ Green CMFDA Dye (ThermoFisher) at 37°C. Then, BMDMs were washed and used in subsequent experiments.

Cytokine profiling

For the simultaneous determination of the relative levels of selected mouse cytokines and chemokines, the Mouse Cytokine Array Panel A kit (R&D Systems) was used to analyse the culture supernatant from differentiated/activated BMDMs culture. The assay was performed according to the manufacturer's instructions. The reactive proteins were visualized using chemiluminescence detection. The images were acquired and quantified using GeneSys imagers coupled to Synoptic 1.4MP cameras (Ozyme).

Protein isolation and Western blotting

Six days after in vitro treatment of BMDMs using recombinant mice GMCSF/MCSF, BMDMs was lysed in RIPA buffer containing protease and phosphatase inhibitors (Roche) for Western blotting. At the indicated time point, Western blotting was performed after electrophoresis using 10% Tris-HCl SDS-PAGE, and electrotransferred to nitrocellulose membranes (Biorad). The membranes were blocked with TBS-Tween containing 0,l%-5% BSA (Sigma) and incubated with primary antibodies, including anti- Phospho-Src (Tyr418, 1:500, Millipore), anti-Src (1:1000, Cell signalling). The membranes were incubated with the corresponding HRP-conjugated secondary antibody (GE Healthcare Life Sciences; diluted at 1:5000 in TBST containing 5% BSA). The reactive proteins were visualized using chemiluminescence detection. The images were acquired using GeneSys imagers coupled to Synoptic 1.4MP cameras (Ozyme). The membranes were incubated with mouse monoclonal Actin (1:10000; Millipore) to normalize the chemiluminescence levels and exposure times. The reactive proteins were visualized using chemiluminescence detection. The images were acquired and quantified using GeneSys imagers coupled to Synoptic 1.4MP cameras (Ozyme).

In vivo and in vitro Phagocytosis assays

For phagocytosis assays, FluoSpheres™ Carboxylate-Modified Microspheres, 0.2 pm, red fluorescent (580/605), 2% solids (ThermoFisher) was used. Intranasal administration of FluoSpheres: The mice were immobilized through anesthesia (2% isoflurane) and 20pL of diluted FluoSpheres (1:2, in Physiological serum) was administered intra-nasally for WT and Duoxl KO mice. Four hours after, lungs were harvested and digested. FluoSpheres uptack by both CD45⁺ CDl lb Ly6G CDl lc⁺ SiglecF⁺ CD64⁺ AMs and CD45⁺ CDl lb⁺ Ly6G CDl lc ^/+ SiglecF CD64⁺ IMs was assessed via flow cytometry.

Intra-peritoneal injection of FluoSpheres: 200pL of diluted FluoSpheres (1:20, in physiological serum) was injected intra-peritoneally for WT and Duoxl KO mice. Two hours after, peritoneal lavage was performed to peritoneal macrophage isolation. FluoSpheres uptack by CD45⁺ CD64⁺ macrophage was assessed via flow cytometry.

In vitro assay: lpL of diluted FluoSpheres was added to 2.10⁶ BMDMs (WT and Duoxl KO). 30 minutes after, FluoSpheres uptack by CD45⁺ BMDMs was assessed via flow cytometry.

Subcutaneous tumor model

For subcutaneous tumors, 10⁶ cells (MC38) in 50 mΐ (PBS) were injected subcutaneously. When the tumors reached ~80 mm³, the mice were allocated to different treatment groups. The tumor size was measured with an electronic caliper. The tumor volume was estimated from two-dimensional tumor measurements (volume=lengthxwidth²/2). The ethical endpoint for survival was a tumor exceeding 1200 mm³.

Tumor irradiation

Subcutaneous tumors were irradiated locally using a Varian Tube NDI 226 (X-ray machine; 250 Kev, tube current: 15 mA, beam filter: 0,2 mm Cu). A single dose of 8 Gy was locally administered to the tumors.

Intra-tumoral injection of BMDMs

The mice were immobilized through anesthesia (2% isoflurane). BMDMs or PBS (as control) were injected within the tumor at 3,5.10⁵ cells/ 100mnr725pL (PBS). Lung and tumor dissociation

Lungs from WT and duoxl KO mice were digested using Lung Dissociation Kit (Miltenyi Biotec) during 30 minutes at 37° and 1500 rpm. Tumors were digested using Tumor Dissociation Kit (Miltenyi Biotec) during 30 minutes at 37°C and 1500 rpm. Cells from lungs and tumors were filtered, using strainers (70pm, Miltenyi biotec) and cells were used for flow cytometry experiments.

Flow cytometry protocol staining

For pulmonary macrophage staining: CD45 FITC, CDl lb BV650, CDl lcPE-Cy7, Ly6G PerCp Cy5.5, Ly6C AlexaFluor700, CD64 BV605 (Biolegend) and SiglecF PE-CF594 (BD Horizon™) were used. Alveolar Macrophages (AMs) were identified as CD45⁺ CDl lb Ly6G CDl lc⁺ SiglecF⁺ CD64⁺. Interstitial Macrophages (IMs) were identified as CD45⁺ CD1 lb⁺ Ly6G CD1 lc ^/+ SiglecF CD64⁺. CD45 FITC and CD64 BV605 were used to peritoneal macrophages staining and identified as CD45⁺ CD64⁺.

For tumor-infiltrating immune cell staining: CD45 APC-Vio770, Ly6G PerCp-Vio700, CDl lc PE-Vio770 (Miltenyi Biotec), CDl lb BUV395 (BD Horizon™), Ly6C Alexa Fluor700 and D64 BV605 (Biolegend) were used to identify macrophages (CD45⁺ CDl lb⁺ Ly6G Ly6C ^/low CD64⁺) and inflammatory monocytes (CD45⁺ CDl lb⁺ Ly6G LybC^¹¹ CD64⁺). CD45 APC-Vio770, CD4 VioBlue, CD8 VioGreen, NK1.1 VioBright 515, CD25 PE-Vio770 (Miltenyi Biotec), CDl lb BV605 (Biolegend) were used to identify lymphocyte TCD4 (CD45⁺ CDllb CD4⁺), lymphocyte TCD8 (CD45⁺ CDl lb CD8⁺), natural killer (NKs, CD45⁺ CD1 lb NKl.1⁺) and lymphocyte T regulators (CD45⁺ CD1 lb CD4⁺ CD25⁺). For the Fc receptor blocking, cells were incubated with purified anti-mouse CD16/32 (Biolegend) during 10 minutes at 4°C. For the membrane staining, cells were incubated with antibodies cited above, during 20 minutes at 4°C. Then, cells were fixed using PFA 4% during 15 minutes at 4°C and permeabilized using Perm/Wash Buffer (BD Perm/Wash™) for the cytokine intracellular staining. IFNy BV786 (BD Horizon) was used to intracellular IFNy staining in both myeloid and lymphoid cells. For intracellular staining, cells were activated before membrane staining, using Cell Activation Cocktail (with Brefeldin A, Biolegend) during 2 hours at 37°C. Propidium iodide (PI, Merck) was used to identify dead cells. Absolute number calculation of different cell populations was performed by adding a fixed number (10,000) of nonfluorescent 10-pm Polybead Carboxylate Microspheres (Polysciences) to each sample and the absolute number was defined according to the following formula: number of cells = number of acquired cells x 10,000/number of acquired beads. Obtained cell number was extrapolated to the tumor weight for each sample.

The samples were acquired on LSR Fortessa X20 (BD, Franklin Lakes, NJ) with DIVA Flow Cytometry software, and data analyzed with FlowJo 10.0.7 software (Tree Star, Inc, Ashland, OR).

Statistical analysis

Statistical analyses were performed using GraphPad Prism 7. Student’s t-test was used to detect differences between two groups. One-way ANOVA and Tow- way ANOVA were used to detect differences among multiple treated groups. A P value equal or less than 0.05, was considered significant (*P<0.05, **P<0.01, ***P<0.001). The data were expressed as the mean±SEM.

Results

Duoxl controls macrophage differentiation/activation and their secretory profile in vitro

As shown on Figure 1, Duoxl is expressed in macrophages infiltrating the human radiation-induced lung injuries (RILI).

It was consequently investigated whether Duoxl is involved in macrophage activation and their response to the microenvironment stimuli.

Bone morrow from wild type (WT) and Duoxl deficient (KO) C57BL6 mice, were harvested and differentiated in vitro using either recombinant mice GMCSF to induce pro-inflammatory profile or recombinant mice MCSF to induce anti-inflammatory profile. Six days after in vitro activation in the presence of recombinant proteins, both culture supernatant and cell activation has been analyzed. Cytokine profiling, using cytokine arrays, of culture supernatant from WT and Duoxl KO cells showed that Duoxl inhibition affect the secretory profile (such as IFNg, a powerful pro-inflammatory cytokine) of bone morrow derived macrophages (BMDMs, Figure 1C and D) promoting an efficiency anti-tumor effect.

Because Duoxl controls Src phosphorylation in airway epithelial cells (Habibovic et ah, 2016), it was assessed by Western blotting whether Duoxl is involved in Src phosphorylation in activated BMDMs in vitro. Src is indeed found activated in anti inflammatory macrophages but not in pro-inflammatory one (Figure IE). Interestingly, Duoxl inhibition was found to decrease Src phosphorylation in anti-inflammatory activated BMDMs compared to WT BMDMs.

All together, these results showed that Duoxl is involved in macrophage differentiation/activation and their secretory profile in response to the microenvironment stimuli in vitro.

Duoxl controls the phagocytosis function in macrophages in both in vitro and in vivo

In order to investigate whether Duoxl is involved in macrophage phagocytosis, fluorescent beads were used, which have been injected either intra-nasally or intra- peritoneally in WT and Duoxl KO mice. Then, both pulmonary and peritoneal macrophages have been harvested for analyzing the uptack of the FluoSpheres by flow cytometry.

The results showed that Duoxl KO alveolar macrophages (AMs) and Duoxl KO interstitial macrophages (IMs) undergo more phagocytosis (represented by both % of phagocyting cells and mean fluorescence intensity of phagocyted Fluospheres) than WT AMs and WT IMs (Figure 2A). Furthermore, Duoxl KO peritoneal macrophages increased significantly their FluoSphere uptack than WT peritoneal macrophages (Figure 2B). These results showed that Duoxl is involved in macrophage phagocytosis in vivo at steady state. The involvement of Duoxl in the phagocytosis function was then assessed on activated macrophages in vitro. First, WT and Duoxl KO bone morrow were differentiated in vitro, using recombinant mice GMCSF to induce the pro-inflammatory profile. After six days, fluorescent beads were added to the BMDMs culture during two hours. Surprisingly, phagocytosis analysis by flow cytometry showed that Duoxl KO pro-inflammatory BMDMs decreased significantly their phagocytosis function in vitro , compared to WT pro-inflammatory BMDMs (Figure 2C).

Duoxl inhibition in pro-inflammatory macrophages improves their anti-tumor function

It was then investigated whether Duoxl is involved in the anti-tumor function of pro- inflammatory macrophages. To do so, WT and Duoxl KO pro-inflammatory BMDMs have been injected intra-tum orally in MC38 sub-cutaneous tumors. Phosphate-buffered saline (PBS) was used as vehicle.

After gating on tumor-infiltrating macrophages, injected BMDMs were detectable using a cell tracker Green CMFDA, 1 and 3 days post intra-tumor injection of stained BMDMs, by flow cytometry. Injected BMDMs were viable at indicated times. Then, the tumor growth was assessed after intra-tumor BMDMs injection.

The results showed that Duoxl KO pro-inflammatory BMDMs induced a significant delay in tumor growth at day 7 and then, the tumor growth evolved similarly to other treatment groups (Figure 3A).

Radiotherapy enhances the anti-tumor function of Duoxl KO macrophages

In order to improve the anti -turn or effect of injected KO pro-inflammatory BMDMs, the tumor bed was irradiated before BMDMs injection within the tumor.

MC38 sub-cutaneous tumors were irradiated at 8Gy. One day after, WT and Duoxl KO pro-inflammatory BMDMs (10⁶ cells) were injected intra-tumorally and tumor growth was followed. Our results showed that irradiation combination with Duoxl KO pro- inflammatory BMDMs induced a significant delay in the tumor growth compared to eithers irradiation plus PBS combination or irradiation plus WT pro-inflammatory BMDMs combination (Figure 4A). Furthermore, the survival rate was improved by irradiation plus Duoxl KO pro-inflammatory BMDMs combination (Figure 4B).

Interestingly, these data suggest a strong anti -turn or effect for Duoxl KO pro- inflammatory BMDMs after irradiation.

Duoxl KO macrophages and radiotherapy combination induces IFNy production in tumor-infiltrating myeloid and lymphoid cells

In order to determine the mechanism by which Duoxl KO pro-inflammatory BMDMs and irradiation combination induced the anti -turn or effect, in vivo MC38 sub-cutaneous tumors were irradiated at 8Gy. One day after, WT and Duoxl KO pro-inflammatory BMDMs were injected intra-tumorally. Three days after BMDMs injection, tumor were harvested and the tumor-infiltrating immune cells were characterized by flow cytometry. Three days post BMDMs injection was chosen, as an early point during which there is no difference in the tumor size regardless of the treatment group.

Irradiated plus Duoxl KO pro-inflammatory BMDMs combination had no effect on the total number of TCD4, TCD8, NKs and lymphocyte T regulators (reg) (not shown). However, there is a significant increase in the percent of TCD4, TCD8 and NKs producing the IFNy compared to other treatment groups (Figure 5A, B and C).

In the same way, the amount of produced IFNy (represented by the mean fluorescence intensity (MFI)) was increased in TCD4, TCD8 and NKs infiltrating the tumors, which have received Duoxl KO pro-inflammatory BMDMs and irradiation combination compared to other treatment groups (Figure 5D, E and F).

Furthermore, myeloid cell analysis by flow cytometry, showed that like lymphoid cells, the total number of macrophages and inflammatory monocytes was not affected regardless the treatment (not shown). However, the percent of both macrophages and Ly6C^hlgh inflammatory monocytes producing the IFNy was increased in the tumors treated by Duoxl KO pro-inflammatory BMDMs and irradiation combination, compared to other treatment groups (Figure 5G and H).

Similarly, the amount of produced IFNy was increased in both macrophages and Ly6C^hlgh inflammatory monocytes after irradiation and Duoxl pro-inflammatory BMDMs treatment (Figure 51 and J), compared to other treatment groups. These data suggest that the anti -turn or effect of Duoxl KO pro-inflammatory BMDMs and radiotherapy combination is mediated by an IFNy response.

Additional data showing that Duoxl controls macrophage differentiation/activation and their secretory profile in vitro , as well as their phagocytic function: Bone marrow from wild-type (WT) and DUOX1 -deficient {Duoxl ) C57BL6 mice was harvested to isolate macrophage precursors, which were treated in vitro using GM-CSF to induce the pro-inflammatory bone marrow derived macrophages (BMDMs) (Figure 6A).

Six days after in vitro activation, GM-CSF-activated Duoxl BMDMs increased the secretion of åFNy, CXCL9, CCL3, CCL5, IL-17 and TNFa and decreased secretion of CCL2, CCL4, CXCL1 and CXCL2, compared to GM-CSF-activated WT BMDMs (Figure 6B). Furthermore, MHC class II was more highly expressed in the GM-CSF- activated Duoxl BMDMs than in the GM-CSF activated WT BMDMs (Figure 6C).

Subsequently, the phagocytotic function in the anti-inflammatory macrophages was analyzed (Figure 7A) and showed that anti-inflammatory Duoxl BMDMs performed more phagocytosis than anti-inflammatory WT BMDMs, as demonstrated by their increased uptake of fluorescent beads (Figure 7B). Additional data showing that RT enhances the anti-tumor effect of DUOXl-deficient macrophages in another tumor model: TCI

In order to confirm the Duox 1 ^_/ macrophages-mediated anti-tumor effect, TCI/Luc subcutaneous tumor model was used. Tumors were irradiated at 8 Gy, and one day later, WT or ΌiiocG proinflammatory BMDMs were injected intratum orally. Compared to control PBS injection, proinflammatory WT BMDM injection into irradiated tumors had no effect in tumor volume, while proinflammatory ΌiiocG BMDMs exerted a significant antitumor effect at day 8 (when all mice were still alive) (Figure 8A), and a delay in tumor regrowth was also observed (Figure 8C). Furthermore, the injection of Duoxl BMDMs improved the survival of irradiated mice compared to that of WT BMDMs and PBS- injected mice (Figure 8B).

Myeloid cell analysis showed that the total numbers of type 1 conventional dendritic cells (cDCl) were not affected regardless of the treatment approach (Figure 9 A). However, the percentages of macrophages, Ly6C^hlgh Mo and cDCl producing IFNy were increased in the tumors treated with the Duox proinflammatory BMDMs post RT compared with those given the other treatments (Figure 9B and C).

The membrane expression of the inhibitory coreceptors cytotoxic T lymphocyte antigen (CTLA) 4 and programmed cell death (PD)-l was analyzed on lymphoid cells at the indicated time (3 days post BMDM injection). It was shown that, in contrast to WT proinflammatory BMDMs, Duox G proinflammatory BMDMs post RT induced a decrease in CTLA4 expression on Tregs, CD4⁺ T cells, CD8⁺ T cells and NKs (Figure 10A). Further, Duox G proinflammatory BMDM injection post RT induced a trend toward decreased expression levels of PD-1 on Tregs compared to WT proinflammatory BMDM injection (Figure 10B).

Subsequently, cytokine profiling of tumors was performed 3 days after BMDM injection and showed increasing trends in the IFNy levels in tumor tissue receiving RT plus Duox proinflammatory BMDMs (Figure 11). No differences were observed in the levels of type 2 T helper (Th2) cytokines such as IL-10 and IL-13. Bibliographic references

Aronovich et al.. The Sleeping Beauty transposon system: a non-viral vector for gene therapy. Human. Molecular. Genetics (2011) Apr 15;20(Rl):R14-20

Bartholeyns J et al., Adoptive immunotherapy of solid tumors with activated macrophages: experimental and clinical results. Anticancer Res. (1991) 11(3): 1201-4.

Dickinson et al, Autophagy regulates DUOX1 localization and superoxide production in airway epithelial cells during chronic IL-13 stimulation. Redox Biol. 2018 Apr;14:272- 284

Donko et al, Urothelial cells produce hydrogen peroxide through the activation of Duoxl. Free Radic Biol Med. 2010 Dec 15;49(12):2040-8.

Habibovic et al., DUOX1 mediates persistent epithelial EGFR activation, mucous cell metaplasia, and airway remodeling during allergic asthma. JCI Insight. 2016 Nov 3 ; 1 (18):e88811.

Haddada H. et al. Efficient adenovirus-mediated gene transfer into human blood monocyte-derived macrophages. Biochem. Biophys. Res. Commun (1993) Sep 30;195(3):1174-83.

Hu et al, Src promotes anti-inflammatory (M2) macrophage generation via the IL- 4 /ST AT 6 pathway. Cytokine. 2018 Nov;l 11:209-215

Klug et al. Low-dose irradiation programs macrophage differentiation to an iNOSVMl phenotype that orchestrates effective T cell immunotherapy. Cancer Cell. 2013 Nov 11;24(5):589-602

Leyva F. et al, Evaluation of transduction efficiency in macrophage colony-stimulating factor differentiated human macrophages using HIV-1 based lentiviral vectors. BMC biotechnology (2011) Jan 31;ll:13.

Little et al, Paradoxical roles of dual oxidases in cancer biology. Free Radic Biol Med. 2017 Sep;110:117-132

Meziani et al., Macrophages in radiation injury: a new therapeutic target. Oncoimmunology. 2018 Jul 23;7(10):el494488.

Meziani L. et al. 2018. CSF1R inhibition prevents radiation pulmonary fibrosis by depletion of interstitial macrophages. Eur Respir J. 2018 Mar 1 ;51 (3).

Neschadim A. et al. A roadmap to safe, efficient, and stable lentivirus-mediated gene therapy with hematopoietic cell transplantation. Biol Blood Marrow transplant. 2007 Dec; 13(12): 1407-16.

Ngambenjawong C et al, Progress in tumor-associated macrophage (TAM)-targeted therapeutics. Adv Drug Deliv Rev. 2017 May 15; 114:206-221

Van Overmeire et al., M-CSF and GM-CSF Receptor Signaling Differentially Regulate Monocyte Maturation and Macrophage Polarization in the Tumor Microenvironment. Cancer Research 2016 Jan l;76(l):35-42.

Claims

Claims

1. An inhibitor of the DUOX1 enzyme activity or expression, for use for treating tumor associated macrophages in subjects suffering from cancer, wherein said inhibitor is an aptamer, a ribozyme or a small interfering nucleic acid.

2. The inhibitor for use according to claim 1, wherein it is a small interfering nucleic acid.

3. The inhibitor for use according to claim 1 or 2, wherein it is an anti-sense oligonucleotide that inhibits the expression of the DUOX1 gene, or a vector containing same.

4. The inhibitor for use according to any of claims 1 to 3, wherein it is administered systemically in subjects suffering from a lymphoid / myeloid cancer such as leukemia, in order to contact tumor-associated macrophages in vivo.

5. The inhibitor for use according to any of claims 1 to 3, wherein it is administered inside the tumor in subjects suffering from a solid tumour such as breast cancer in order to contact tumor- associated macrophages in vivo.

6. The inhibitor for use according to any of claims 1 to 5, wherein it is encapsulated in liposomes.

7. A pharmaceutical composition containing i) activated monocyte-derived macrophages in which the expression or the activity of the DUOX1 enzyme has been inhibited with an aptamer, a ribozyme or a small interfering nucleic acid, and ii) a pharmaceutically acceptable excipient.

8. The pharmaceutical composition of claim 7, wherein said macrophages have been differentiated and activated in vitro from peripheral blood monocyte cells (PBMC), after being contacted with the inhibitor as defined in any of claims 1-3.

9. The pharmaceutical composition of claim 7 or 8, for use for treating patients suffering from cancer.

10. The pharmaceutical composition of claim 7 or 8, for use for enhancing the tumor immunogenicity of a radiotherapeutic treatment.

11. The pharmaceutical composition of claim 7 or 8, for use for treating cancer in combination with a radiotherapeutic treatment.

12. The pharmaceutical composition for use according to claims 9-11, wherein it is administered systemically in subjects suffering from a lymphoid / myeloid cancer such as leukemia.

13. The pharmaceutical composition for use according to claims 9-11, wherein it is administered inside the tumor in subjects suffering from a solid cancer such as breast cancer.

14. The pharmaceutical composition for use according to claims 9-13, wherein it is administered after the radiotherapy treatment, preferably 24 hours after the radiotherapy treatment.