WO2021032212A1 - Anti-aging medicine d/a targeting aging cells in tissue microenvironment and use thereof - Google Patents

Abstract

Provided are a pharmaceutical composition comprising dasatinib and aspirin and a cartridge or kit thereof and the use thereof. The pharmaceutical composition can down-regulate or eliminate natural aging cells or damaged cells, thereby prolonging the survival period of an organism.

Description

Anti-aging drug D/A targeting senescent cells in tissue microenvironment and its application Technical field

The present invention belongs to the field of biomedicine. More specifically, the present invention relates to an anti-aging drug D/A based on targeting senescent cells in a tissue microenvironment and its application.

Background technique

Senescent cells will continue to exist under the conditions of the body and have long-term effects on surrounding cells. This is mainly because senescent cells often develop a senescence-associated secretory phenotype (SASP), which makes these cells continue to secrete a large number of pro-inflammatory and microenvironmental remodeling molecules. Transcription analysis found that, like cancer cells, senescent cells enhance the expression of factors related to the "pro-survival network", thereby helping them resist apoptosis or other forms of programmed cell death.

Cell senescence usually manifests as nuclear membrane inflection, chromatin shrinkage, lipofuscin accumulation, cell volume increase, cell nucleus enlargement, β-galactosidase activity increase, and the secretion of various factors. Cell senescence is triggered by one or more factors, activating multiple downstream signaling pathways. In addition to entering permanent proliferation arrest, senescent cells are often associated with many pathological features, including local inflammation. Cell senescence occurs in damaged cells and prevents them from proliferating in the organism. Under the influence of various external stimuli and internal factors, cell damage can lead to obvious signs of cell aging; when the damage accumulates and reaches a certain limit, the tissue presents various visually distinguishable tissue degeneration changes and physiological aging phenotypes.

With age, senescent cells in most organs and tissues will increase; under clinical conditions, such cells will also appear in organs related to many chronic diseases, and after radiotherapy and chemotherapy. Cell senescence refers to the process in which cells lose their functions (including the ability to divide and replicate) but still resist death. It has been proven to drive a variety of age-related diseases, such as osteoporosis, osteoarthritis, atherosclerosis and idiopathic disease Pulmonary fibrosis and so on.

In 2015, a research team from the Scripps Research Institute (TSRI), Mayo Clinic and other institutions reported a new class of drugs that can significantly slow down the aging process in animal models, relieve symptoms of weakness, and improve heart function , Extend healthy life. Scientists collectively refer to these new drugs as "senolytics." Further cell culture experiments show that these compounds can indeed selectively induce the death of senescent cells. Interestingly, these two compounds have different specificities, that is, dasatinib can eliminate aging human adipocyte progenitor cells, while quercetin can more effectively fight aging human endothelial cells And mouse bone marrow stem cells; in general, the combination of the two is more effective. However, a large number of follow-up studies on an international scale have shown that this method needs more testing before it is officially used by humans. In addition to these two drugs may bring some unknown side effects during long-term treatment, but also because they cannot effectively remove the fibroblasts and other stromal cell populations that occupy a larger number in the tissue microenvironment, making them applicable and practical. restricted.

Therefore, the field still needs to further search for effective anti-aging drugs.

Summary of the invention

The purpose of the present invention is to provide an anti-aging drug D/A and its application based on targeting senescent cells in the tissue microenvironment.

In the first aspect of the present invention, there is provided the use of the composition in the preparation of drugs or preparations for down-regulating (including inhibiting) or eliminating senescent cells; wherein the composition includes dasatinib and aspirin.

In a preferred embodiment, the cells include: natural senescent cells; or damaged cells; preferably damaged cells in the tissue microenvironment; more preferably injured cells after chemotherapy or radiation treatment.

In another preferred embodiment, the radiation therapy includes ionizing radiation, alpha, beta or gamma radiation therapy.

In another preferred embodiment, the cells do not include (or, substantially do not include) proliferating cells.

In another aspect of the present invention, there is provided the use of the composition in the preparation of a medicament or preparation for prolonging the survival period (lifespan) of the body; wherein the composition includes dasatinib and aspirin.

In a preferred embodiment, the composition is also used to reduce the levels of senescence-associated secreted phenotype (SASP) and cellular senescence marker factors; preferably, the marker factors include (but are not limited to): IL6, IL8, MCP2, CXCL1, GM-CSF, MMP3, AREG, SFRP2, ANGPTL4, IL 1a (SASP marker factor), p16 ^INK4a , p21 ^CIP1 (Cell senescence marker factor).

In another preferred embodiment, the composition is also used to: improve body function and avoid ataxia of multiple organs.

In another preferred example, in the composition, in terms of molar ratio or mass ratio, Dasatinib: Aspirin is 1: (2-100); preferably 1: (4-80); more preferably The ground is 1:(5～50).

In another preferred example, according to the molar ratio or mass ratio, Dasatinib: Aspirin is 1:6; 1:8; 1:10; 1:12; 1:15; 1:20; 1:30; 1 :50; 1:60; 1:70; 1:90, etc.

In another preferred embodiment, the final concentration of dasatinib in the composition is 1 nM-10mM, such as 10nM, 100nM, 1uM, 10uM, 100uM, 1mM.

In another aspect of the present invention, there is provided a pharmaceutical composition for down-regulating or eliminating senescent cells, which includes dasatinib and aspirin.

In a preferred embodiment, the pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient.

In another preferred example, according to the molar ratio or mass ratio, the ratio of dasatinib: aspirin is 1:(2-100); preferably 1:(4～80); more preferably 1:(5～ 50).

In another aspect of the present invention, the use of the pharmaceutical composition is provided for preparing a kit or kit for down-regulating or eliminating senescent cells.

In another aspect of the present invention, a kit or kit for down-regulating or eliminating senescent cells is provided, which includes the pharmaceutical composition.

In another aspect of the present invention, a kit or kit for down-regulating or eliminating senescent cells is provided, which comprises a container 1 and a container 2, respectively containing dasatinib and aspirin; preferably, in terms of molar ratio or mass The ratio of dasatinib to aspirin is 1:(2-100); preferably 1:(4～80); more preferably 1:(5-50).

In another preferred embodiment, the composition, kit or kit uses dasatinib and aspirin as active ingredients, and the other ingredients are pharmaceutical carriers or excipients.

In another preferred embodiment, the composition consists only of dasatinib and aspirin.

In another preferred embodiment, the dosage form of the pharmaceutical composition is: oral agent, injection, infusion, tablet, powder, capsule, pill; preferably oral agent.

In another aspect of the present invention, there is provided a method for down-regulating or eliminating senescent cells, comprising treating senescent cells with a composition; wherein the composition includes dasatinib and aspirin.

In another aspect of the present invention, the use of aspirin is provided to promote the activity of dasatinib to down-regulate or eliminate the activity of senescent cells or to extend the activity of the body's survival period; or

In another aspect of the present invention, the use of aspirin is provided for the preparation of drugs or preparations that promote the activity of dasatinib to down-regulate or eliminate the activity of senescent cells or to prolong the activity of the body.

In another aspect of the present invention, a method for promoting the activity of dasatinib to down-regulate or eliminate senescent cells is provided, which includes the combined application of aspirin and dasatinib.

In another preferred embodiment, the above-mentioned uses or methods are not directly aimed at the treatment of clinical diseases.

Other aspects of the present invention are obvious to those skilled in the art due to the disclosure herein.

Description of the drawings

Figure 1. The human prostate primary stromal cell line PSC27 was treated with the chemotherapeutic drug BLEO on the 7th day, and RNA-Seq was used for whole transcriptome sequencing, and it was found that a large number of SASP factors showed an up-regulation trend. The asterisks indicate BCL2A1 and SERPINB2.

Figure 2. Using SA-β-Gal staining technique to analyze PSC27 cells. On the left, representative staining pictures, the upper and lower are proliferative (PRE) and senescent (SEN) cells, the scale is 20 μm; the right, based on a statistical comparison of 100 cells in each group. ***, P<0.001.

Figure 3. Determination of cell division and proliferation status by BrdU staining. Statistical comparison based on 100 cells per group. ***, P<0.001.

Figure 4. Parallel comparison of the degree of DNA damage after immunofluorescence staining. The primary antibody is γH2AX; it is graded according to the number of DNA damage foci in each nucleus (0foci; 1-3foci; 4-10foci; >10foci). ***, P<0.001.

Figure 5. After knocking out multiple survival-related genes in PSC27 cells using shRNA, ATPLite was used to detect cell signals and compare them in parallel. **, P<0.01; *, P<0.05.

Figure 6. Similar to Figure 5, after using shRNA to knock out multiple survival-related genes in WI38 cells, ATPLite was used to detect cell signals and compare them in parallel. **, P<0.01.

Figure 7. After knocking out multiple survival-related genes in PSC27 cells using shRNA, the number of survival cells was detected by crystal violet staining and compared in parallel. **, P<0.01; *, P<0.05.

Figure 8. Similar to Figure 7, after using shRNA to knock out multiple survival-related genes in WI38 cells, the crystal violet staining technique is used to detect cell signals and compare them in parallel. **, P<0.01.

Figure 9. Use Dasatinib to treat PSC27 cells in PRE and SEN states within a certain concentration range (0, 200, 400, 600, 800, 1000 nM), and analyze their survival. Each group of data normalizes the number of cells in this group at the beginning of the experiment. *, P<0.05; **, P<0.01.

Figure 10. Similar to Figure 9, Dasatinib was used to treat WI38 cells in PRE and SEN states within a certain concentration range (0, 200, 400, 600, 800, 1000 nM) and analyze their survival. Each group of data normalizes the number of cells in this group at the beginning of the experiment. *, P<0.05; **, P<0.01.

Figure 11. Use Aspirin to treat PSC27 cells in PRE and SEN states within a certain concentration range (0, 5, 10, 15, 20, 25, 30, 35, 40 uM), and analyze their survival. Each group of data normalizes the number of cells in this group at the beginning of the experiment.

Figure 12. Similar to Figure 11, Aspirin was used to treat WI38 cells in PRE and SEN states within a certain concentration range (0, 5, 10, 15, 20, 25, 30, 35, 40uM) and analyze their survival. Each group of data normalizes the number of cells in this group at the beginning of the experiment.

Figure 13. The micrograph shows that Dasatinib and Aspirin are used alone or in combination to treat PSC27 cells in the SEN state and analyze their survival. Ruler, 20μm. D, dasatinib; A, aspirin.

Figure 14. Use certain concentrations of Dasatinib (0, 400, 1000 nM) and Aspirin (0, 5, 10 uM) separately or in combination to treat PSC27 cells during proliferation or senescence, and analyze their survival. Green dotted line, the starting cell number is used as the baseline level of data analysis.

Figure 15. Dasatinib and Aspirin were treated with PSC27 cells in proliferation or senescence at concentrations of 1000 nM and 10 μM, respectively, and their apoptosis was analyzed. D, dasatinib; A, aspirin.

Figure 16. Immunofluorescence staining to analyze the signal intensity ^{of caspase3 (cleaved) and p16 INK4a} in PSC27 cells under proliferation and senescence conditions, respectively. Ruler, 20μm. D, dasatinib; A, aspirin.

Figure 17. Use gamma rays to treat wild-type mice at a certain dose (10 Gy) and analyze their aging progress in vivo after 3 months. The results of histochemical staining showed that the p16 ^INK4a positive and p21 ^CIP1 positive cells were statistically compared within and between groups. D, dasatinib; A, aspirin.

Figure 18. Staining analysis of mouse tissues irradiated by γ-rays by SA-β-Gal staining technique, the proportion of positive cells was compared in parallel between groups. D, dasatinib; A, aspirin. IR, Ionizing Radiation.

Figure 19. Representative pictures of mouse tissue sections after SA-β-Gal staining. Ruler, 200μm. D, dasatinib; A, aspirin. IR, ionizing radiation.

Figure 20. Technical flow chart of pre-clinical anti-aging test in aging mice. 20-month-old wild-type mice were selected for combined administration of Dasatinib (5mg/kg)/Aspirin (50mg/kg); oral administration was given once every two weeks, and after the end of the 4-month course of treatment, comprehensive analysis Physiological ability.

Figure 21. The system detects the average ability of each group of experimental mice in various aspects including left ventricular ejection frequency, maximum walking speed, suspension endurance, and bite force. N=10.

Figure 22. Parallel comparison of experimental mice in each group in conventional physical fitness items including crash endurance and daily activity; at the same time, basic physiological tests including body weight and food intake were also tested and the data obtained were comprehensively compared. N=10.

Figure 23. Technical schematic diagram of anti-aging treatment for wild-type mice in the extremely aging stage in the late life. Wild-type mice aged 24-27 months were selected for combined administration of Dasatinib (5 mg/kg)/Aspirin (50 mg/kg); oral administration was given every two weeks until pathological symptoms appeared.

Figure 24. Detection of the expression level of SASP typical exocrine factors by stromal cells in the mouse tissue microenvironment by qRT-PCR. Three-month-old mice were selected as the baseline for analysis and comparison, and the placebo (placebo) group and Dasatinib/Aspirin (D/A) group data were normalized and compared in parallel. RPL13a expression value is the internal control. N=3.

Figure 25. Disease-free survival curve analysis of mice after anti-aging treatment (healthspan). Dasatinib/Aspirin (D/A) group, n=80; median survival time=296 days; Placebo group, n=85. Median survival time = 244 days. P=0.0008.

Figure 26. Disease-free overall survival curve analysis of mice before and after anti-aging treatment (lifespan). Dasatinib/Aspirin (D/A) group, n=80, median survival time=1026 days; Placebo group, n=85, median survival time=974 days. P=0.0008.

detailed description

After long-term and extensive research, the inventors unexpectedly discovered that the combined application of dasatinib and aspirin has an extremely excellent effect on down-regulating or eliminating senescent cells in the body, and thus can be used to eliminate damaged cells in the tissue microenvironment. For example, damaged cells after chemotherapy or radiation treatment can also be used to remove cells that naturally age with age, thereby prolonging the body's survival time. The present invention was formed on this basis.

As used in the present invention, the "proliferative state (PRE) cell" refers to a cell that can maintain a state of continuous, active division and continuous proliferation.

As used in the present invention, the "senescent (SEN) cell" refers to a cell whose ability to proliferate and divide and whose physiological function is degraded.

Dasatinib

The English name of Dasatinib is Dasatinib; its CAS number is 302962-49-8; its molecular formula is C ₂₂ H ₂₆ ClN ₇ O ₂ S. The chemical structural formula is as follows (I):

In the present invention, the "dasatinib" may be a compound represented by formula (I) in a pure form, or a purity greater than 85% (preferably greater than 90%, such as 95%, 98%, 99%). %) of the compound represented by formula (I).

In the prior art, the compound of formula (I) is generally obtained by chemical synthesis. It is a commercial drug, so its finished product is easily obtained by those skilled in the art.

In the present invention, a pharmaceutically acceptable salt of the compound of formula (I) is also included, which also retains the chemical activity of dasatinib. The "pharmaceutically acceptable salt" may be a salt formed by the reaction of dasatinib with an inorganic acid or an organic acid.

In the present invention, the precursor of the compound of formula (I) is also included, and the "precursor" refers to the precursor of the compound undergoing metabolism or chemical reaction in the patient's body to transform into the structural formula ( A compound of I), or a salt or solution composed of a compound of formula (I).

In the prior art, it is known that dasatinib is a polytyrosine kinase inhibitor and is used in adult patients of all stages of chronic myelogenous leukemia who have been treated, including imatinib mesylate-resistant or intolerable. ; At the same time, it is also used to treat adult patients with Philadelphia chromosome-positive acute lymphoblastic leukemia who are resistant or intolerant to other therapies. However, the research or application effect of dasatinib in the field of cell aging is not very satisfactory.

aspirin

Aspirin is acetylsalicylic acid and its CAS number is 50-78-2. It is an antipyretic, analgesic, and antirheumatic drug widely used clinically. The chemical structure of aspirin is as follows:

The aspirin can be obtained by chemical synthesis. In addition, aspirin has been commercially available in the prior art, so it is easily available to those skilled in the art.

The present invention also includes a pharmaceutically acceptable salt of aspirin, which also retains the chemical activity of aspirin. The "pharmaceutically acceptable salt" may be a salt formed by the reaction of aspirin with an inorganic acid or an organic acid.

In the present invention, the precursor of aspirin is also included. The "precursor" refers to the precursor of the compound undergoing metabolism or chemical reaction in the patient's body to convert it into a formula (II) after being taken by a proper method. A compound, or a salt or solution composed of a compound of formula (II).

The combined use of dasatinib and aspirin

After in vitro pharmacodynamic screening and analysis based on a large number of small molecule drugs, the inventors found that Dasatinib (Dasatinib) within a certain concentration range can cause a significant decrease in the survival rate of senescent cells, while proliferating cells are basically Not affected.

On the other hand, the inventors found that aspirin, a derivative of salicylic acid, does not affect the survival of senescent cells within a limited concentration range.

However, it is surprising that when dasatinib and aspirin are used at the same time, the survival rate of senescent stromal cells is further reduced on the basis of the results caused by dasatinib alone treatment, but the proliferating cells are roughly unchanged. Therefore, the combination of the two drugs has a significant synergistic effect, and basically only targets senescent cells without affecting proliferating cells.

Therefore, the present invention provides the use of a mixture or composition of dasatinib and aspirin for the preparation of a pharmaceutical composition for downregulating or eliminating senescent cells or a pharmaceutical composition; and for preparing a pharmaceutical composition for prolonging the life span (life) of the body Drugs or preparations. The cells can be naturally senescent cells or damaged cells. The damaged cells may be damaged cells in the tissue microenvironment, or damaged cells after chemotherapy or radiation treatment.

Radiotherapy is a local treatment method that uses radiation to treat diseases, especially tumors. Radiation includes alpha, beta, and gamma rays produced by radioisotopes and x-rays, electron rays, proton beams and other particle beams produced by various x-ray treatment machines or accelerators. Approximately 70% of cancer patients need radiotherapy during the treatment of cancer, and about 40% of cancers can be cured with radiotherapy. The role and status of radiotherapy in tumor treatment have become increasingly prominent, and it has become one of the main methods for the treatment of malignant tumors. However, its side effects are also very significant, and the damage to tissues and organs can have a pathological impact that cannot be ignored. The mixture or composition of dasatinib and aspirin of the present invention is expected to be applied to alleviate this damage.

The mixture or composition of dasatinib and aspirin is also used to: reduce the level of senescence-associated secreted phenotype (SASP) marker factors; preferably, the marker factors include but are not limited to: IL6, IL8, MCP2, CXCL1, GM-CSF, MMP3, AREG, SFRP2, ANGPTL4, IL 1a, p16 ^INK4a , p21 ^CIP1 .

Composition or mixture

The present invention provides a mixture containing aspirin and dasatinib as active components. Preferably, in the mixture, the molar ratio or mass ratio of aspirin to dasatinib is 1:(2～100); preferably 1:(4～80); more preferably 1:( 5～50). For example, in terms of molar ratio or mass ratio, it is 1:6; 1:8; 1:10; 1:12; 1:15; 1:20; 1:30; 1:50; 1:60; 1:70; 1 :90 etc.

The present invention provides a pharmaceutical composition comprising: (a) an effective amount of dasatinib or a pharmaceutically acceptable salt thereof; (b) an effective amount of aspirin or a pharmaceutically acceptable salt thereof; and (c ) A pharmaceutically acceptable carrier or excipient.

In the present invention, the term "containing" means that various ingredients can be used together in the mixture or composition of the present invention. Therefore, the terms "mainly consisting of" and "consisting of" are included in the term "containing".

In the present invention, "pharmaceutically acceptable" ingredients are substances that are suitable for humans and/or animals without excessive adverse side effects (such as toxicity, irritation and allergic reactions), that is, substances that have a reasonable benefit/risk ratio.

In the present invention, "pharmaceutically acceptable carrier" is a pharmaceutically acceptable solvent, suspending agent or excipient used to deliver dasatinib and aspirin of the present invention to animals or humans. The carrier can be liquid or solid.

The pharmaceutical composition or mixture of the present invention can be prepared into any conventional formulation form by conventional methods. The dosage form can be various, as long as it can make the active ingredient reach the mammalian body effectively. For example, it can be selected from: injections, infusions, tablets, capsules, and pills. Wherein Dasatinib or aspirin can be present in a suitable solid or liquid carrier or diluent.

The mixture or pharmaceutical composition of dasatinib and aspirin of the present invention can also be stored in a sterile device suitable for injection or drip.

The effective dose of dasatinib and aspirin used can vary with the mode of administration and the severity of the disease to be treated, which can be based on the experience and recommendations of the clinician.

In the specific embodiment of the present invention, some mixtures of dasatinib and aspirin are given. For example, in an embodiment, in a cell experiment, a series of dasatinib and aspirin according to different molar ratios or mass ratios are proposed. Dosing regimen. In the present invention, mice are also used as experimental animals. The conversion from the dose of mice to the dose suitable for humans is easily made by those skilled in the art. For example, it can be calculated according to the Meeh-Rubner formula:

Meeh-Rubner formula: A=k×(W ^2/3 )/10,000.

In the formula, A is the body surface area, ^{calculated in m 2} ; W is the body weight, calculated in g; K is a constant, which varies with animal types, mouse and rat 9.1, guinea pig 9.8, rabbit 10.1, cat 9.9, dog 11.2, monkey 11.8, 10.6 people.

The dasatinib and aspirin and their mixtures or pharmaceutical compositions can be administered orally, intravenously, intramuscularly, or subcutaneously. Preferably it can be administered orally. Pharmaceutical forms suitable for oral administration include but are not limited to tablets, powders, capsules, sustained-release agents, and the like. Pharmaceutical forms suitable for injection include: sterile aqueous solutions or dispersions and sterile powders. In all cases, these forms must be sterile and must be fluid to facilitate the ejection of fluid from the syringe.

When necessary, dasatinib and aspirin can also be administered in combination with other active ingredients or drugs.

The present invention also provides a kit for down-regulating or eliminating senescent cells, or prolonging the survival period of the body. The kit contains: container 1 and dasatinib components placed in container 1; And container 2 and the aspirin component placed in container 2.

Alternatively, the kit contains the mixture of dasatinib and aspirin, wherein the ratio of aspirin to dasatinib is as described above.

Alternatively, the kit contains a pharmaceutical composition including a mixture of dasatinib and aspirin, and a pharmaceutically acceptable carrier.

In addition, there may be some auxiliary medication materials in the medicine box.

In addition, the kit may also contain instructions for use, explaining a method for treatment to down-regulate or eliminate senescent cells or prolong the survival period of the body.

The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods that do not specify specific conditions in the following examples are usually based on conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, Third Edition, Science Press, 2002, or according to the manufacturer The suggested conditions.

Example 1. Chemotherapeutic drugs induce senescence of human stromal cells and present a typical senescence-related secretory phenotype

The inventors used the genotoxic chemotherapy drug bleomycin (bleomycin, BLEO) to treat the human prostate primary stromal cell line PSC27. PSC27 cells were cultured in DMEM (containing 10% FBS) medium, and BLEO was added to a final concentration of 50 μg/ml. On the 7th day after treatment, RNA-Seq was used for whole transcriptome sequencing.

The definition of proliferative (PRE) and senescent (SEN) cells: For cultured cells, the SA-β-Gal and BrdU staining techniques are used to define the senescent cells are SA-β-Gal positive, and the proliferative cells are BrdU positive.

The results show that compared with proliferative state (PRE) cells, senescent (SEN) cells have profound changes in gene expression profiles. In the list of up-regulated genes, there are a large number of SASP typical exocrine factors, such as IL8, CSF2, CCL20, IL1a, etc. (Figure 1).

At the same time, the positivity of PSC27 cells after SA-β-Gal staining was significantly increased (Figure 2), while the positive rate of BrdU was significantly reduced (Figure 3). It shows that the degree of cell senescence has increased significantly, and cell proliferation has decreased significantly.

The inventors subsequently detected the degree of DNA damage, and the immunofluorescence staining (IF staining) results for γH2AX showed that after BLEO treatment (50μg/ml final concentration, treatment for 12 hours), PSC27 showed a higher proportion of damaged cells (Figure 4).

Example 2. Kinetic study of anti-aging drug candidates dasatinib and aspirin on cell survival under in vitro conditions

First, the inventors investigated the effects of selective knockout of some genes on stromal cells. Combined with the up-regulated expression of PSC27 after senescence and related anti-apoptotic genes such as PTGS2, BCL2A1, SERPINB2, the present inventors used shRNA to knock out ABL, EFNB1, EFNB3, PTGS2, BCL2A1, SERPINB2, ATPLite, respectively. The results show that only the deletion of ABL, PTGS2, and BCL2A1 can significantly reduce the survival rate of senescent stromal cells (PSC27, human embryo lung fibroblast WI38) (Figure 5, Figure 6). Similarly, crystal violet staining confirmed that PTGS2 and BCL2A1 had a significant impact on survival in these two cell lines (Figure 7, Figure 8). Since it affects both senescent (SEN) cells and proliferative (PRE) cells, it may affect the microenvironment under normal physiological conditions.

The shRNA targeting site sequence used to knock out ABL, PTGS2, and BCL2A1 is as follows:

ABL: CCGCCTTCATCCCTCTCATAT (SEQ ID NO:1);

PTGS2: AGAGTATGCGATGTGCTTAAA (SEQ ID NO: 2);

BCL2A1: GTTGCGGAGTTCATAATGAAT (SEQ ID NO: 3);

After screening and analysis of in vitro pharmacodynamics based on a large number of small molecule drugs, the inventors found that Dasatinib (Dasatinib) within a certain concentration range (400-1000 nM) can cause a significant decrease in the survival rate of senescent PSC27 and WI38 cells, and In contrast, proliferating cells were basically unaffected (Figure 9, Figure 10).

Aspirin, a derivative of salicylic acid, is a widely used antipyretic, analgesic, and antirheumatic drug in clinical practice. In vitro experiments, it failed to show a significant effect of inhibiting the survival of senescent cells. Under 5 μM conditions, the survival of senescent stromal cells could not be significantly reduced (Figure 11, Figure 12). When the concentration increased to 10 μM, the cell survival rate remained unchanged, and when the concentration was subsequently increased to 40 μM, the overall effect did not continue to rise. Both PSC27 and WI38 showed a similar trend (Figure 11, Figure 12). These results indicate that aspirin does not affect the survival of senescent cells within a limited concentration range.

Preliminary microscopic image analysis results show that dasatinib (1000nM) can greatly reduce the number of surviving senescent cells within 48 hours, while the remaining cells show typical apoptosis characteristics; in contrast, aspirin (1μM) causes senescence The degree of cell death is not as good as the former, but it makes the cells show more typical fibrous stretch instead of obvious apoptotic morphology; when the two are used together (Da/A, D/A), both PSC27 and WI38 are decreasing in number at the same time Appears as signs of apoptosis and traction (Figure 13). So, under which conditions are the survival of senescent cells most affected?

In subsequent pharmacodynamic experiments, dasatinib caused a significant decrease in the survival rate of stromal cells at concentrations of 400 nM and 1000 nM, although the latter was more significant (Figure 14). In contrast, aspirin did not significantly change the survival of senescent cells at 5 μM and 10 μM. However, surprisingly, when dasatinib (1000nM) and aspirin (10μM) were used at the same time, the survival rate of senescent stromal cells continued to decrease based on the results caused by dasatinib (1000nM) alone treatment, but Proliferating cells were almost unchanged (Figure 14).

At the same time, the results of apoptosis detection experiments confirmed that dasatinib (1000nM) can cause a significant increase in the proportion of senescent cell apoptosis, while aspirin (10μM) has no similar effect; the combination of the two will further significantly increase the degree of apoptosis of senescent cells. The effect of dasatinib alone (Figure 15). Under any of the above conditions, the control group, i.e. proliferating cells, were not significantly affected.

The results of immunofluorescence staining showed that compared with proliferating cells, senescent cells showed up-regulation of the cell cycle regulator p16 ^INK4a , and its high expression indicated that the degree of cell senescence increased; dasatinib combined with aspirin (Da/A) can The signal of Caspase 3 (cleaved) was significantly increased, while the proliferating cells were basically unchanged (Figure 16). Increased Caspase 3 (cleaved) signal means increased apoptosis of senescent cells.

Example 3. Senescent cells in the tissue microenvironment caused by radiotherapy can be removed in large quantities by the combination of dasatinib and aspirin

The inventors used gamma rays (10 Gy) to treat wild-type mice and conducted in-depth analysis after 3 months. One month after the radiation treatment, the dosage of dasatinib is 5 mg/kg and aspirin is 50 mg/kg.

The results of histochemical staining confirmed that about 57% of cells in the tissue microenvironment were p16 ^INK4a positive, but it was significantly reduced under the combined conditions of Da/Ar (the reduction was about 60%). At the same time, compared with the control (placebo group), the ^{proportion of p21 CIP1} positive cells in mouse tissues also significantly decreased (Figure 17).

The inventors performed SA-β-Gal staining analysis on tissue sections, and the evaluation results confirmed that ionizing radiation itself can significantly increase the proportion of senescent cells in the tissue, while anti-aging drugs cannot. However, when Da/A was administered orally to experimental mice, the number of senescent cells in the microenvironment was significantly reduced within 15 days after one use (Figure 18, Figure 19).

These results prove that Da/A, as an anti-aging combination drug, can effectively reduce the number of senescent cells in the body, and does not require multiple treatments or administrations, and it does not cause premature aging or premature aging in the microenvironment under normal physiological conditions. And so on.

Example 4. Under natural aging conditions, Da/A can improve the physiological functions of multiple organs by inducing the elimination of senescent cells in the tissue microenvironment

Even if the passive senescent cells in the tissues caused by anti-cancer treatments and other external stress factors can be eliminated, can similar goals be achieved under normal physiological conditions, especially under the background that natural aging has already occurred? Does Da/A need to be administered multiple times, that is, intermittent administration? Will it affect the body's physiological functions? This is studied in this embodiment.

The present inventors selectively used a group of experimental mice aged 20 months, and administered them for a period of 4 months with intermittent dosing of Da/A (orally once every two weeks, and each dosage is: Dasati Ni 5 mg/kg and aspirin 50 mg/kg were mainly divided into placebo group and da/a drug group at the same time (Figure 20). At the end of the 4-month treatment course, the inventors comprehensively evaluated the performance of these two groups of mice Physiological indicators.

Analytical data showed that the Da/A group of animals showed higher ability than the control group in many aspects including left ventricular ejection frequency, maximum walking speed, suspension endurance, bite force and other test results (Figure 21). At the same time, conventional physical fitness items such as car crash endurance (that is, the ability of mice to run autonomously on wheels, can be used to monitor the spontaneous activities of mice. The design of this running wheel: there is a magnetic indicator on the running wheel of each set of equipment, in the cage There is a Hall sensor outside to monitor the rotation of the running wheel). And daily activities also increased significantly, but a set of basic physiological tests such as body weight and food intake did not show significant changes (Figure 22).

The above results show that, without affecting the basic physiological functions, Da/A drugs can improve multiple indicators of the body by reducing senescent cells in tissues, and avoid ataxia in multiple organs.

Example 5. Under extreme aging conditions, Da/A can prolong the overall lifespan without causing pathological symptoms by inducing the elimination of senescent cells in the tissue microenvironment

So, can anti-aging drugs play a role in delaying aging even when the body is nearing the end of life? To answer this question, the inventors used a batch of mice (24-27 months old) in a more advanced stage.

Through oral administration once every two weeks, mice in the Da/A group showed a general and significant decrease in the expression levels of SASP marker factors, including but not limited to IL6, IL8, MCP2, CXCL1 (Figure 24). More importantly, this kind of oral da/a drug used every other week from the age of 24-27 months (each dose is: dasatinib 5mg/kg, aspirin 50mg/kg, which makes the mice's post-treatment The median survival time was significantly prolonged in this stage, from 244 days to 296 days (Figure 25, 21.3%, P<0.001). Correspondingly, the overall survival time of mice treated with oral Da/A drugs also increased significantly, from 974 days were significantly extended to 1026 days (Figure 26, 25.0%, P<0.001).

Therefore, for experimental animals in the late stage of life, Da/A drugs can reduce the number of senescent cells and reduce the expression of a broader spectrum of SASP exocrine factors, which ultimately significantly prolongs the body's survival time.

All documents mentioned in the present invention are cited as references in this application, as if each document was individually cited as a reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims (14)

1. Use of the composition in the preparation of a medicine or preparation for downregulating or eliminating senescent cells; wherein the composition includes dasatinib and aspirin.
2. The use according to claim 1, wherein the cell comprises:

   Naturally senescent cells; or

   Damaged cells; preferably damaged cells in the tissue microenvironment; more preferably injured cells after chemotherapy or radiation treatment.
3. The use according to claim 1, wherein the cells do not include proliferating cells.
4. Use of the composition in preparing a medicine or preparation for prolonging the survival period of the body; wherein the composition includes dasatinib and aspirin.
5. The use according to any one of claims 1 to 4, wherein the composition is also used to: reduce the level of senescence-related secreted phenotypes and cell senescence marker factors; preferably, the marker Factors include: SASP marker factors IL6, IL8, MCP2, CXCL1, GM-CSF, MMP3, AREG, SFRP2, ANGPTL4 or IL 1a; cell senescence marker factors p16 ^INK4a or p21 ^CIP1 .
6. The use according to any one of claims 1 to 4, wherein the composition is also used for: improving body function and avoiding ataxia of multiple organs.
7. The use according to any one of claims 1 to 4, characterized in that, in the composition, according to the molar ratio or mass ratio, the ratio of dasatinib: aspirin is 1: (2-100); preferably 1:(4～80); more preferably 1:(5～50).
8. A pharmaceutical composition for down-regulating or eliminating senescent cells, which includes dasatinib and aspirin; preferably, it also includes a pharmaceutically acceptable carrier or excipient.
9. The pharmaceutical composition according to claim 8, wherein the ratio of dasatinib: aspirin is 1:(2-100); preferably 1:(4-80) in terms of molar ratio or mass ratio; Preferably, it is 1: (5-50).
10. The use of the pharmaceutical composition according to claim 8 or 9 for preparing a kit or kit for down-regulating or eliminating senescent cells.
11. A kit or kit for down-regulating or eliminating senescent cells, which comprises the pharmaceutical composition according to any one of claims 8-9; or

    It includes container 1 and container 2, respectively containing dasatinib and aspirin; preferably, in terms of molar ratio or mass ratio, dasatinib: aspirin is 1: (2-100); preferably 1: (4～80); more preferably 1:(5～50).
12. A method for down-regulating or eliminating senescent cells includes treating senescent cells with a composition; wherein the composition includes dasatinib and aspirin.
13. The use of aspirin to promote the activity of dasatinib to down-regulate or eliminate the activity of senescent cells or to extend the activity of the body's survival;

    It is used to prepare drugs or preparations for promoting the activity of dasatinib to down-regulate or eliminate the activity of senescent cells or prolong the life of the body.
14. A method for promoting the activity of dasatinib to down-regulate or eliminate senescent cells includes the combined application of aspirin and dasatinib.

Images