WO2021031991A1 - Composition and method for treating hormone-dependent diseases and reducing drug tolerance of patients with hormone-dependent diseases - Google Patents

Abstract

A composition and a method for treating hormone-dependent diseases and reducing drug tolerance of patients with hormone-dependent diseases. The composition contains an agent capable of inhibiting expression and/or activity of 3βHSD and optionally an androgen receptor antagonist and/or a CYP17A inhibitor.

Description

Composition and method for treating hormone-dependent diseases and reducing drug tolerance of patients with hormone-dependent diseases Technical field

The present invention relates to a composition and method for treating hormone-dependent diseases and reducing drug tolerance of patients with hormone-dependent diseases.

Background technique

Steroids play an important role in a variety of physiological and pathological processes. Glucocorticoids play an important role in inflammation and bone development. Androgens and estrogen are closely related to diseases such as prostate cancer and breast cancer, respectively. Among them, prostate cancer is the cancer with the highest incidence and the second mortality among Western men, and the cancer with the fastest increase in incidence and mortality among men in my country. Androgen binds to androgen receptor (AR), activates the AR signaling pathway, and promotes the occurrence and development of prostate cancer. Early prostate cancer uses Testosterone (T) secreted by the testes and converts it into Dihydrotestosterone (DHT) to activate the AR signaling pathway and maintain tumor growth. Therefore, androgen deprivation therapy (ADT) is the first choice for advanced prostate patients. The initial effect of ADT is good, but most prostate cancer patients will develop tolerance after 1-2 years of ADT treatment, and progress to castration resistant prostate cancer (CRPC). CRPC directly threatens the lives of patients and is currently the main focus of basic research and clinical treatment.

CRPC still relies on androgens and AR signaling pathways. In the CRPC stage, cancer cells use the androgen precursor dehydroepiandrosterone (DHEA) secreted by the adrenal glands to synthesize DHT. The adrenal gland uses cholesterol as a raw material to produce the androgen precursor DHEA through the synergistic action of the mitochondria of adrenal cortex cells and multiple metabolic enzymes in the endoplasmic reticulum. Among them, the metabolic enzyme CYP17A1 is an important metabolic enzyme in the process of cholesterol turning into DHEA. It can continuously catalyze a two-step reaction, adding a hydroxyl group to the 17th carbon atom of cholesterol, and then cutting the cholesterol branch to produce DHEA. DHEA is then added with sulfate groups and released into the blood. Prostate (cancer) cells take DHEA in the blood and convert it into DHT. Androgen-metabolizing enzymes 3βHSD1, 5α-reductase (SRD5A) and 17βHSD are involved in the process of DHEA to DHT conversion.

The metabolic enzyme 3βHSD1 (3β-hydroxysteroid dehydrogenase type I) catalyzes the rate-limiting step of the conversion of DHEA to DHT. Preliminary studies found that the metabolic enzyme 3βHSD1 has genetic polymorphisms (A1245C). Different single nucleotide polymorphisms (single nucleotide polymorphism, SNP) will affect androgen metabolism by changing the protein stability of 3βHSD1. The 1245th base of the wild-type 3βHSD1 gene is adenine A, while in a few cells or patients, this site is thymine T, which causes the 367th amino acid to change from wild-type asparagine to threonine in the mutant . In the cell, the ubiquitin ligase AMFR can normally recognize wild-type 3βHSD1 and promote the degradation of wild-type 3βHSD1. The mutant 3βHSD1 cannot be recognized by AMFR, so the stability of related proteins is improved, which can better produce androgens and promote the growth of corresponding cells and tumors. Follow-up clinical studies found that patients with mutant 3βHSD1 disease progress faster, including mutant patients with carcinoma in situ are more likely to metastasize, relapse after surgical removal, patients with metastatic carcinoma are prone to drug resistance, etc., and the overall survival time is also better. short. Therefore, 3βHSD1 of different genotypes can be used as a biomarker to predict disease progression in patients. However, this mutation exists in a certain proportion of African Americans and Caucasian Americans, and is rarely found in Asians.

In 2011, the US FDA approved abiraterone and enzalutamide for the treatment of CRPC. Abiraterone treats prostate cancer by targeting the metabolic enzyme CYP17A and inhibiting the synthesis of DHEA. Enzalutamide treats prostate cancer by directly competing with the androgen DHT to bind to AR and prevent AR from being activated. Abiraterone and enzalutamide have achieved great success in clinical practice, but drug tolerance is inevitable. Drug-resistant patients are almost in a hopeless situation.

The structure of abiraterone is very similar to the androgen precursor DHEA, and the steroid ring structure of the two is almost identical. Therefore, abiraterone can be modified by the metabolic enzyme 3βHSD1 to produce small metabolic molecules D4A; D4A is further recognized by the metabolic enzyme SRD5A to produce 5α-Abi. 5α-Abi is further recognized by AKR1C2 or 3α-HSD to produce two new metabolites. In mice or patients, the metabolism of abiraterone is more complicated. In vivo, D4A can not only be recognized by SRD5A (5α-reductase activity), adding α-type hydrogen bonds to C5; it can also be recognized by AKR1D1 (5β-reductase activity), adding β-type hydrogen bonds on C5 to generate new Metabolite 5β-Abi. Due to the subtle differences in structure, new metabolites will have different new functions. The structure of D4A enables it to inhibit the activities of CYP17A and 3βHSD1, and at the same time, it can directly inhibit the function of AR as an antagonist. 5α-Abi can directly bind to AR as an agonist to promote tumor development. The further products of 5α-Abi and 5β-Abi are more hydrophilic due to the presence of more hydroxyl groups, and can be better recognized, modified and discharged by degradation-related metabolic enzymes.

Dutasteride, an inhibitor of SRD5A, is widely used in the treatment of prostate enlargement and alopecia. In the metabolic pathway of abiraterone, SRD5A is responsible for converting D4A into 5α-Abi, which converts a prostate cancer inhibitor into a prostate cancer agonist. Therefore, the combined use of abiraterone and dutasteride can inhibit the conversion of D4A to 5α-Abi. The significance of the combined use of the drug is that on the one hand, it can reduce the production of 5α-Abi and relieve drug tolerance; on the other hand, it can slow down the degradation of abiraterone, increase its blood concentration and half-life, and enable the drug to exert better effects. However, dutasteride can only inhibit the production of 5α-Abi-related metabolites and cannot affect the degradation of 5β-abi. 3βHSD1 catalyzes the first step in the metabolism of abiraterone. If 3βHSD1 can be targeted to inhibit 3βHSD1, it will better regulate the metabolism of abiraterone in the body and improve its clinical effects.

Summary of the invention

The present invention found that by inhibiting the activity of the metabolic enzyme 3βHSD1, thereby preventing androgen DHEA metabolism, inhibiting target gene activation and cell growth caused by DHEA, etc., tumor growth can be inhibited and hormone-dependent diseases can be treated.

Therefore, one aspect of the present invention provides a composition and method for treating or preventing 3βHSD-mediated diseases with 3βHSD as a target. In some embodiments, the present invention provides the use of an agent capable of inhibiting the expression and/or activity of 3βHSD in the preparation of a medicament for the treatment or prevention of diseases mediated by 3βHSD.

In one or more embodiments, agents capable of inhibiting the expression and/or activity of 3βHSD include, but are not limited to, proteins, nucleic acids, and small molecule compounds.

In one or more embodiments, the protein is an anti-3βHSD antibody, especially a monoclonal antibody.

In one or more embodiments, the nucleic acid is selected from the group consisting of siRNA, antisense RNA, ribozymes, homologous recombination vectors and gene editing vectors containing nucleotide sequences encoding mutant inactive or attenuated 3βHSD, such as CRISPR-CAS9 gene editing vector or TALEN gene editing vector.

In one or more embodiments, the small molecule compound is selected from the compound represented by the following formula I or a pharmaceutically acceptable salt thereof:

Where

R ₁ to R ₄ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

R ₅ , R ₇ and R ₉ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

R ₆ and R ₈ are each independently selected from H, hydroxyl, C _2-12 alkenyl, C _1-6 alkoxy, and C _1-6 alkyl; or, R ₅ and R ₆ , R ₆ and R ₇ , R ₇ and R ₈ or R ₈ and R ₉ together with the C atom to which they are each attached form an optionally substituted 5- or 6-membered heterocyclic ring.

In one or more embodiments, R ₁ is H.

In one or more embodiments, R _{2 is} selected from H, hydroxyl, and C _1-6 alkoxy. Preferably, in the compound of formula I of the present invention, R ₂ is hydroxy or C _1-6 alkoxy.

In one or more embodiments, R _{3 is} selected from H, hydroxyl, and C _1-6 alkoxy.

In one or more embodiments, R _{4 is} selected from H and hydroxyl.

In one or more embodiments, R ₅ is H.

In one or more embodiments, R _{6 is} selected from H, hydroxyl, and C _2-12 alkenyl.

In one or more embodiments, R _{7 is} selected from H, hydroxyl, and C _1-6 alkoxy.

In one or more embodiments, R _{8 is} selected from H, hydroxyl, and C _2-12 alkenyl.

In one or more embodiments, R ₉ is H.

In one or more embodiments, R ₆ and R ₇ together with the C atom to which they are attached form an optionally substituted oxygen-containing 6-membered heterocyclic ring. Preferably, the oxygen-containing 6-membered heterocyclic ring is:

Preferably, the R ₆ and R ₇ together with the benzene ring to which they are connected form an optionally substituted benzopyranyl group, including benzo-α-pyranyl and benzo-γ-pyranyl. Preferably, the substituent of the heterocyclic group is selected from the group consisting of hydroxy, C _1-6 alkyl and C _1-6 alkoxy; the number of substituents is 1-3; more preferably, the heterocyclic group is The substituents are 1-3 C _1-6 alkyl groups.

In one or more embodiments, in the compound of formula I _{, at least one of R 1 to} R ₄ is an oxygen-containing substituent, such as a hydroxyl group or an alkoxy group. In a preferred embodiment _{, at least one of R 3} -R ₄ is an oxygen-containing substituent, preferably at least R ₂ is an oxygen-containing substituent.

In one or more embodiments, in the compound of formula I, R ₁ , R ₅ and R ₉ are each independently H or C _1-4 alkyl, preferably H; R ₂ and R ₄ are each independently H or Hydroxy; R ₃ is H or C _1-6 alkoxy; R ₇ is H, C _1-6 alkyl, C _1-6 alkoxy or hydroxy, preferably C _1-6 alkoxy or hydroxy, more Preferably, it is C _1-4 alkoxy or hydroxyl; R ₆ and R ₈ are each independently selected from H, hydroxyl and C _2-12 alkenyl.

In one or more embodiments, in the R ₅ -R ₉ of the compound of formula I, at least one substituent is an oxygen-containing substituent, such as a hydroxyl group or a C _1-6 alkoxy group; preferably, R ₇ is a Oxygen substituents.

In one or more embodiments, in the compound of formula I, R ₁ , R ₅ and R ₉ are H; R ₂ is hydroxy or C _1-6 alkoxy; R ₃ is H or C _1-6 alkane Oxy; R ₄ is H or hydroxyl; R ₆ is H, hydroxyl or C _2-12 alkenyl; R ₇ is H, hydroxyl or C _1-6 alkoxy; R ₈ is H or C _2-12 chain Alkenyl.

In one or more embodiments, the compound of formula I is selected from:

In one or more embodiments, the disease mediated by the metabolic enzyme 3βHSD is a hormone-dependent disease. In one or more embodiments, the hormone-dependent disease is an androgen-dependent disease, an estrogen-dependent disease, or a glucocorticoid-dependent disease. Preferably, the metabolic enzyme 3βHSD-mediated disease is selected from: prostate cancer, benign prostatic hyperplasia, prostatic epithelioma, hirsutism, acne, androgenic alopecia, polycystic ovary syndrome, breast cancer, inflammation and allergies.

Another aspect of the present invention provides a pharmaceutical composition or kit, which contains:

(1) Reagents capable of inhibiting the expression and/or activity of 3βHSD; and

(2) Androgen receptor antagonist and/or CYP17A inhibitor.

In one or more embodiments, the reagent is selected from proteins, nucleic acids, and small molecule compounds.

In one or more embodiments, the protein is an anti-3βHSD antibody.

In one or more embodiments, the nucleic acid is selected from the group consisting of siRNA, antisense RNA, ribozymes, homologous recombination vectors containing nucleotide sequences encoding mutant inactive or attenuated 3βHSD, and gene editing vectors, Such as CRISPR-CAS9 gene editing vector or TALEN gene editing vector.

In one or more embodiments, the small molecule compound is selected from the compound represented by the following formula I or a pharmaceutically acceptable salt thereof:

Where

R ₁ to R ₄ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

R ₅ , R ₇ and R ₉ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

R ₆ and R ₈ are each independently selected from H, hydroxyl, C _2-12 alkenyl, C _1-6 alkoxy, and C _1-6 alkyl; or, R ₅ and R ₆ , R ₆ and R ₇ , R ₇ and R ₈ or R ₈ and R ₉ together with the C atom to which they are each attached form an optionally substituted 5- or 6-membered heterocyclic ring.

In one or more embodiments, it is characterized in that, in formula I,

R ₁ is H;

R _{2 is} selected from H, hydroxyl and C _1-6 alkoxy;

R _{3 is} selected from H, hydroxyl and C _1-6 alkoxy;

R _{4 is} selected from H and hydroxyl;

R ₅ is H;

R _{6 is} selected from H, hydroxyl and C _2-12 alkenyl;

R _{7 is} selected from H, hydroxyl and C _1-6 alkoxy;

R _{8 is} selected from H, hydroxyl and C _2-12 alkenyl; and/or

R ₉ is H.

In one or more embodiments, R ₆ and R ₇ together with the C atom to which they are connected form an optionally substituted oxygen-containing 6-membered heterocyclic ring; preferably, the R ₆ and R ₇ together with the benzene ring to which they are connected Form an optionally substituted benzopyranyl group; preferably, the substituent of the heterocyclic group is selected from hydroxyl, C _1-6 alkyl and C _1-6 alkoxy; the number of substituents is 1-3 .

In one or more embodiments _{, at least one of R 1 to} R ₄ is a hydroxyl group or an alkoxy group; preferably _{at least one of R 3 to} R ₄ is a hydroxyl group or an alkoxy group, preferably at least R ₂ is a hydroxyl group Or alkoxy; and/or

At least one substituent in R ₅ -R ₉ is a hydroxyl group or a C _1-6 alkoxy group; preferably, at least R ₇ is a hydroxyl group or an alkoxy group.

In one or more embodiments, R ₁ , R ₅ and R ₉ are each independently H or C _1-4 alkyl, preferably H; R ₂ and R ₄ are each independently H or hydroxyl; R ₃ is H or C _1-6 alkoxy; R ₇ is H, C _1-6 alkyl, C _1-6 alkoxy or hydroxy, preferably C _1-6 alkoxy or hydroxy, more preferably C _1-4 alkane Oxy or hydroxyl; R ₆ and R ₈ are each independently selected from H, hydroxyl and C _2-12 alkenyl; or

R ₁ , R ₅ and R ₉ are H; R ₂ is hydroxyl or C _1-6 alkoxy; R ₃ is H or C _1-6 alkoxy; R ₄ is H or hydroxyl; R ₆ is H, hydroxyl Or C _2-12 alkenyl; R ₇ is H, hydroxy or C _1-6 alkoxy; R ₈ is H or C _2-12 alkenyl.

In one or more embodiments, the compound of formula I is selected from:

In one or more embodiments, the androgen receptor antagonist includes enzalutamide, apalutamide, bicalutamide, and the like.

In one or more embodiments, the CYP17A inhibitor includes small molecule drugs such as abiraterone, ketoconazole, galeterone, and seviteronel.

The present invention also provides the application of an agent capable of inhibiting the expression and/or activity of 3βHSD in the preparation of drugs that enhance the clinical efficacy of androgen receptor antagonists or CYP17A inhibitors or overcome the drug resistance caused by them.

In one or more embodiments, the agent capable of inhibiting 3βHSD expression and/or its activity is as described in any of the embodiments herein.

In one or more embodiments, the androgen receptor antagonist includes enzalutamide, apalutamide, bicalutamide, and the like.

In one or more embodiments, the CYP17A inhibitor includes small molecule drugs such as abiraterone, ketoconazole, galeterone, and seviteronel.

The present invention also provides the application of reagents capable of inhibiting the expression and/or activity of 3βHSD and androgen receptor antagonists and/or CYP17A inhibitors in preparing drugs for treating hormone-dependent diseases.

In one or more embodiments, the hormone-dependent disease is an androgen-dependent disease, an estrogen-dependent disease, or a glucocorticoid-dependent disease.

In one or more embodiments, the hormone-dependent disease is selected from: prostate cancer, benign prostatic hyperplasia, prostate epithelioma, hirsutism, acne, androgenic alopecia, polycystic ovary syndrome, breast cancer, inflammation And allergies.

In one or more embodiments, the agent capable of inhibiting 3βHSD expression and/or its activity is as described in any of the embodiments herein.

In one or more embodiments, the androgen receptor antagonist includes enzalutamide, apalutamide, bicalutamide, and the like.

In one or more embodiments, the CYP17A inhibitor includes small molecule drugs such as abiraterone, ketoconazole, galeterone, and seviteronel.

Description of the drawings

Figure 1: The activity of the metabolic enzyme 3βHSD1 to mediate DHEA metabolism is related to the progression of prostate cancer. A, schematic diagram of tissue metabolism. B, the prostate tissue cannot metabolize pregnenolone. C. Most prostate cancer tissues can metabolize androstenedione (AD) into downstream products. D. Most prostate cancer tissues can metabolize dehydroepiandrosterone (DHEA) into downstream products. E, DHEA concentration and AD concentration in the patient's blood. F and G, DHEA metabolic pathway. H and I, oxidized DHEA cannot activate the androgen receptor. J, The puncture tissue of patients with metastatic cancer has a stronger ability to metabolize DHEA, suggesting that as the disease progresses, the activity of the metabolic enzyme 3βHSD1 gradually increases.

Figure 2: The small molecule compound Cory can inhibit the activity of the metabolic enzyme 3βHSD1. A, Cory inhibits the conversion of DHEA to AD. B, Cory can inhibit the activities of metabolic enzymes 3βHSD1 and 3βHSD2. C, Cory cannot inhibit the activity of metabolic enzymes CYP17A and SRD5A. D, Cory can inhibit AR target gene expression caused by DHEA. E, Cory inhibits the growth of prostate cancer cells caused by DHEA. F, Cory affects the stability of 3βHSD1 protein. Abi, abiraterone (abiraterone, an inhibitor of CYP17A); Dut, dutasteride (an inhibitor of SRD5A); Enz, enzalutamide (enzalutamide, an androgen receptor antagonist); Cory, corylin.

Figure 3: Inhibition of BCA, a Cory derivative, on the activity of the metabolic enzyme 3βHSD1. A, The effect of Cory derivatives on DHEA metabolism. B, BCA and Cory inhibition of EC ₅₀ 3βHSD1. C, BCA inhibits 3βHSD1 and 3βHSD2 enzyme activities. D, E, BCA cannot inhibit the activity of metabolic enzymes CYP17A and SRD5A. F, BCA can dose-dependently inhibit the regulation of AR target genes by DHEA, but does not affect the function of DHT. G, BCA can inhibit the growth of ectopic tumors in mice. BCA, biochanin A.

Figure 4: Cory and its analogues can overcome enzalutamide drug tolerance.

Figure 5: The metabolism of the drug abiraterone mediated by the metabolic enzyme 3βHSD1 is related to the clinical efficacy of abiraterone, and the inhibition of the activity of the metabolic enzyme 3βHSD1 by BCA affects the metabolism of abiraterone.

Figure 6: BCA can coordinate with abiraterone to regulate the metabolism of pregnenolone and inhibit the growth of prostate cancer cells caused by pregnenolone.

Figure 7: Daidzein regulates abiraterone metabolism and enhances its function in patients. a, b: Daidzein regulates Abi metabolism, in which VCaP(a) and Huh7(b) cells are treated with 100nM abiraterone; c. Patients with detectable plasma daidzein have higher plasma Abi concentration and relative percentage, Among them, n=20 in group I, n=12 in group II, *, P<0.05; d, changes in PSA of patients in groups I and II after three months of administration of Abi; e, with or without detectable plasma soybean The biochemical recurrence of patients with flavonoids is calculated by the Gehan-Breslow-Wilcoxon test method; schematic diagram of the role of f, 3βHSD1 and BCA in prostate cancer.

detailed description

It should be understood that, within the scope of the present invention, the above technical features of the present invention and the technical features specifically described in the following (such as the embodiments) can be combined with each other to form a preferred technical solution.

Unless otherwise specified, the following terms used herein have the following meanings:

"Hydrogen (H)" as used herein includes its isotopes D and T.

"Patient" and "subject" have the same meaning and include humans and animals. "Mammal" refers to humans and other mammals. Other animals include pets and domestic animals.

"Alkyl" refers to an aliphatic saturated hydrocarbon group, which can be straight or branched, and the carbon chain length is 1-12 carbon atoms, preferably 1-6 carbon atoms, more preferably 1-4 carbon atoms.

"Alkoxy" refers to an oxy group (-O-) substituted with an alkyl group as described herein. The alkoxy group generally includes a C _1-6 alkoxy group, preferably a C _1-4 alkoxy group.

"Alkenyl" refers to a hydrocarbon group having at least one carbon-carbon double bond in the chain. Generally, the carbon chain length of the alkenyl group is 2-12, preferably 2-10. The number of carbon-carbon double bonds in the alkenyl group can be 1, 2, or even 3. Exemplary alkenyl groups include, but are not limited to, vinyl, propenyl, 3-methyl-2-buten-1-yl, (2E)-3,7-dimethyloctyl-2,6-dienyl Wait.

"Heterocyclic group" or "heterocyclic group" refers to a heterocyclic group with 6-10 ring atoms containing at least one heteroatom selected from O, S and N. The ring of the heterocyclic group may be an unsaturated ring or Saturated ring. Exemplary heterocyclic groups include, but are not limited to, tetrahydrofuranyl, pyranyl, piperidinyl, piperazinyl, 1,4-diazepanyl, pyrrolidinyl, imidazolidinyl, imidazolinyl, two Indolyl, isoindolyl, quinuclidinyl, morpholinyl, isochromanyl, chromanyl, pyrazolidinyl, pyrazolinyl, tetrahydroisoquinolinyl, etc. In some preferred embodiments of the present invention, the ring atom of the heterocyclic group includes at least one O atom.

As used herein, "oxygen-containing substituents" are substituents with one or more O atoms in the group, including but not limited to hydroxyl, alkoxy, acyl (such as C _1-6 acyl), acyloxy (such as C _1-6 acyloxy) and oxygen-containing heterocyclic groups.

"Effective amount" refers to the amount of the compound or composition of the present invention effective to treat, ameliorate, inhibit or prevent hormone-dependent diseases or drug resistance.

The pharmaceutically acceptable salts described herein include inorganic and organic acid salts, such as hydrochloride, hydrobromide, phosphate, sulfate, citrate, lactate, tartrate, maleate, Malate, mandelate and oxalate; and inorganic and organic base salts formed with bases such as sodium hydroxy, tris(hydroxymethyl)aminomethane (TRIS, tromethamine) and N-methylglucamine .

The various metabolic enzymes referred to herein have well-known meanings in the art. For example, 3βHSD as used herein includes "3βHSD1" and "3βHSD2". "3βHSD1" refers to 3β-hydroxysteroid dehydrogenase type I, encoded by the gene HSD3B1, is an isoenzyme mainly expressed in peripheral tissues such as prostate, skin, breast and placenta, and is responsible for catalyzing the conversion of DHEA to DHT or estrogen The rate-limiting step is necessary for all pathways of dihydrotestosterone or estrogen synthesis. "3βHSD2" means 3β-hydroxysteroid dehydrogenase type II, which is encoded by the gene HSD3B2, which is mainly expressed in the adrenal gland and affects the production of glucocorticoids. The various metabolic enzymes of the present invention, especially 3βHSD1 and 3βHSD2, include not only human metabolic enzymes, but also in other animals, especially other mammals, the same as human metabolic enzymes (especially human 3βHSD1 and 3βHSD2). Source and have the same or similar biological functions of metabolic enzymes. The other animals can be domestic animals, such as pigs, sheep, cows, horses, etc., or pets, such as dogs and cats. The coding sequence and amino acid sequence of each metabolic enzyme of the present invention can be obtained from well-known databases in the art such as Genbank and the like. The purpose of the present invention is to regulate the expression of human and animal 3βHSD to treat or prevent hormone-dependent diseases. Therefore, the metabolic enzymes classified as 3βHSD by those skilled in the art are all within the scope of the present invention.

The 3βHSD-mediated diseases described herein include various diseases caused by the high expression, high activity, or high stability of 3βHSD in tissues, including 3βHSD1-mediated diseases and 3βHSD2-mediated diseases, especially 3βHSD-mediated diseases Hormone-dependent diseases. In a preferred embodiment, the hormone-dependent disease described herein may be a hormone-dependent disease mediated by 3βHSD. Hormone-dependent diseases mediated by 3βHSD include hormone-dependent diseases mediated by 3βHSD1 and hormone-dependent diseases mediated by 3βHSD2. Hormone-dependent diseases mediated by 3βHSD1 can include sex hormones (such as androgens and estrogen) dependent diseases, such as sex hormone-dependent diseases mediated by 3βHSD1, including prostate cancer, other androgen-dependent tumors, benign prostatic hyperplasia, prostate Epithelioma, hirsutism, acne, androgenic alopecia (ie, typical alopecia in men and women), breast cancer, and polycystic ovary syndrome. In some embodiments of the invention, the prostate cancer is castration-resistant prostate cancer. Hormone-dependent diseases also include glucocorticoid-dependent diseases, such as 3βHSD2-mediated glucocorticoid-dependent diseases, such as inflammation and allergies, including glucocorticoid-dependent dermatitis. As mentioned above, the 1245th base of the wild-type 3βHSD1 gene is adenine A, and in a few cells or patients, this site is thymine T, which causes the 367th amino acid to be changed from wild-type asparagine to a mutant Threonine in. Ubiquitin ligase AMFR can normally recognize wild-type 3βHSD1 and promote the degradation of wild-type 3βHSD1 in cells. The mutant 3βHSD1 cannot be recognized by AMFR, so the stability of 3βHSD1 is improved, which can better produce androgens and promote the growth of corresponding cells and tumors. Therefore, the "3βHSD1" described herein includes all "3βHSD1" expressed in humans or other animals, including wild-type 3βHSD1 and mutant 3βHSD1 (such as the aforementioned 3βHSD1 with a mutation in the 367th amino acid residue), as long as This mutation also leads to the diseases described herein due to its high expression, high activity or high stability in tissues.

The present invention relates to the treatment or prevention of 3βHSD-mediated diseases with 3βHSD as a target, especially 3βHSD1-mediated diseases. Specifically, the present invention relates to the use of an agent that inhibits the expression and/or activity of 3βHSD in the preparation of drugs for the treatment or prevention of 3βHSD-mediated diseases, as well as the use of agents for the treatment or prevention of 3βHSD-mediated diseases that can inhibit 3βHSD expression and / Or its active reagents.

The present invention also found that by inhibiting 3βHSD, hormone-dependent diseases can be treated, and at the same time, the drug resistance generated by drugs for treating hormone-dependent diseases can be reduced. Therefore, the present invention provides a pharmaceutical composition containing an agent that targets 3βHSD and can inhibit the expression and/or activity of 3βHSD (also referred to herein as 3βHSD inhibitor), as well as other treatments for hormone dependence Disease medicine. The other drugs for treating hormone-dependent diseases include androgen receptor antagonists and CYP17A inhibitors. Androgen receptor antagonists and CYP17A inhibitors are well known in the art. Such drugs that have been approved for marketing include but are not limited to enzalutamide as an androgen receptor antagonist and abiraterone as a CYP17A inhibitor. Other androgen receptor antagonists also include apalutamide and bicalutamide; other CYP17A inhibitors also include small molecule drugs such as ketoconazole, galeterone, seviteronel. As shown in Figure 1(F), given that 3βHSD1 is at the upstream of the entire reaction, it can be expected that 3βHSD inhibitors will cooperate with all androgen receptor antagonists and CYP17A inhibitors to achieve the treatment of hormone-dependent diseases and improve the use of androgens. Hormone receptor antagonists and CYP17A inhibitors cause drug resistance.

The agents or 3βHSD inhibitors for inhibiting the expression and/or activity of 3βHSD as described herein include, but are not limited to, proteins, nucleic acids, and small molecule compounds. For example, the protein may be an antibody to 3βHSD. The antibody is preferably a monoclonal antibody. The nucleic acid can be siRNA, antisense RNA, ribozyme and gene editing vector, such as CRISPR-CAS9 gene editing vector or TALEN gene editing vector. In some embodiments, the nucleic acid is a homologous recombination vector containing a nucleotide sequence encoding a mutant inactive or attenuated 3βHSD, and the wild-type 3βHSD gene is knocked out in the host cell to express the mutant inactive 3βHSD. Or 3βHSD with reduced activity. Therefore, homologous recombination technology can be used to express such mutant inactive or attenuated 3βHSD in the target cell, thereby achieving inhibition of its protein activity.

In some embodiments of the present invention, the small molecule compound is an isoflavone compound or a pharmaceutically acceptable salt thereof. It is well known in the art that isoflavones are phenolic compounds based on the phenylchromone ring formed by cinnamoyl-CoA side chain extension and cyclization during the metabolism of plant phenylalanine, and its 3-phenyl derivatives are isoflavones , Is a plant secondary metabolite. The structural formula of isoflavones is shown in the following formula:

The isoflavone compound of the present invention is the isoflavone on the 3-benzene ring and the benzene ring of the chromone, optionally one or more (such as 1-5 or 1-4) selected from hydroxyl, alkoxy, Compounds substituted with alkyl and alkenyl substituents. The two substituents on 3-phenyl can form 9- or 10-membered fused ring with 3-phenyl itself, for example to form benzo-α-pyranyl (α-chromenyl) and benzo-γ-pyran Group (γ-chromenyl), the condensed ring may be optionally substituted with 1 to 3 substituents selected from alkyl, alkoxy, hydroxy and alkenyl.

In some embodiments, the isoflavone compound of the present invention has the structure shown in the following formula I:

Where

R ₁ to R ₄ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

R ₅ , R ₇ and R ₉ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

R ₆ and R ₈ are each independently selected from H, hydroxyl, C _2-12 alkenyl, C _1-6 alkoxy, and C _1-6 alkyl; or, R ₅ and R ₆ , R ₆ and R ₇ , R ₇ and R ₈ or R ₈ and R ₉ together with the C atom to which they are each attached form an optionally substituted 5- or 6-membered heterocyclic ring.

In the compound of formula I of the present invention, preferred R ₁ is H; preferred R _{2 is} selected from H, hydroxyl and C _1-6 alkoxy; preferred R _{3 is} selected from H, hydroxyl and C _1-6 alkoxy ; Preferably R _{4 is} selected from H and hydroxyl; preferably R _{5 is} selected from H; preferably R _{6 is} selected from H, hydroxyl and C _2-12 alkenyl; preferably R _{7 is} selected from H, hydroxyl and C _{1- 6} Alkoxy; preferred R _{8 is} selected from H, hydroxyl and C _2-12 alkenyl; preferred R ₉ is H. Alternatively, R ₆ and R ₇ together with the C atom to which they are connected form an optionally substituted oxygen-containing 6-membered heterocyclic ring; preferably, the oxygen-containing 6-membered heterocyclic ring is:

Preferably, the R ₆ and R ₇ together with the benzene ring to which they are connected form an optionally substituted benzopyranyl group, including benzo-α-pyranyl and benzo-γ-pyranyl. Preferably, the substituent of the heterocyclic group is selected from hydroxy, C _1-6 alkyl and C _1-6 alkoxy; the number of substituents is 1-3. In a preferred embodiment of the compound of formula I of the present invention _{, at least one of R 1 to} R ₄ is an oxygen-containing substituent, such as a hydroxyl group or an alkoxy group. In a preferred embodiment _{, at least one of R 3} -R ₄ is an oxygen-containing substituent, preferably at least R ₂ is an oxygen-containing substituent.

In a preferred embodiment of the compound of formula I of the present invention _{, at least one of R 5 to} R ₉ is an oxygen-containing substituent, such as a hydroxyl group or a C _1-6 alkoxy group; preferably, R ₇ is an oxygen-containing substituent.

In some preferred embodiments, in the compound of formula I, R ₁ , R ₅ and R ₉ are each independently H or C _1-4 alkyl, preferably H; R ₂ and R ₄ are each independently H or hydroxyl; R ₃ Is H or C _1-6 alkoxy; R ₇ is H, C _1-6 alkyl, C _1-6 alkoxy or hydroxy, preferably C _1-6 alkoxy or hydroxy, more preferably C _{1 -4} Alkoxy or hydroxyl; R ₆ and R ₈ are each independently selected from H, hydroxyl and C _2-12 alkenyl. Preferably, _{at least one of R 3-} R ₄ is an oxygen-containing substituent, preferably at least R ₂ is an oxygen-containing substituent, and/or _{at least one of R 5-} R ₉ is an oxygen-containing substituent, preferably at least R ₇ is Oxygen-containing substituents.

In a preferred embodiment, in the compound of formula I, R ₁ , R ₅ and R ₉ are H; R ₂ is hydroxy or C _1-6 alkoxy; R ₃ is H or C _1-6 alkoxy; R ₄ R ₆ is H, hydroxyl or C _2-12 alkenyl; R ₇ is H, hydroxyl or C _1-6 alkoxy; R ₈ is H or C _2-12 alkenyl. Preferably, _{at least one of R 3-} R ₄ is an oxygen-containing substituent, preferably at least R ₂ is an oxygen-containing substituent, and/or _{at least one of R 5-} R ₉ is an oxygen-containing substituent, preferably at least R ₇ is Oxygen-containing substituents.

Furthermore, the compound of formula I of the present invention may be psoralen (CAS NO: 53947-92-5), Corylinin (CAS NO: 775351-88-7), formononetin (CAS NO: 485). -72-3), daidzein (CAS NO: 486-66-8), mullein (CAS NO: 20575-57-9), chickpea sproutin A (CAS NO: 491-80-5), Preflavone (CAS NO: 35212-22-7), New Psoralen Isoflavones (CAS NO: 41060-15-5), Glycine (CAS NO: 40957-83-3), and Genistein (CAS NO: 446-72-0) and so on.

The compound of the present invention can be obtained from commercial sources, or can be synthesized according to the disclosed method or with reference to the disclosed method.

In some embodiments, the present invention relates to the use of isoflavone compounds or pharmaceutically acceptable salts thereof to treat or prevent 3βHSD-mediated diseases, and also relates to isoflavone compounds in the preparation of drugs for the treatment or prevention of 3βHSD-mediated diseases. In the application. The present invention also relates to isoflavone compounds or pharmaceutically acceptable salts thereof for treating or preventing diseases mediated by 3βHSD.

In some embodiments, the medicament or pharmaceutical composition provided by the present invention contains an effective amount of the agent described herein, especially an isoflavone compound or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient Agent. In some embodiments, the pharmaceutical composition of the present invention contains the 3βHSD inhibitor and other drugs for treating hormone-dependent diseases. The 3βHSD inhibitor and other drugs for treating hormone-dependent diseases in the pharmaceutical composition can be provided independently. For example, the 3βHSD inhibitor and the other drugs for the treatment of hormone-dependent diseases may be provided in the pharmaceutical composition of the present invention in the form of separate pharmaceutical dosage forms. Alternatively, they can be provided as a mixture of them. For example, in certain embodiments, the pharmaceutical composition of the present invention may contain an independent formulation of a compound of formula I or a pharmaceutically acceptable salt thereof, an androgen receptor antagonist formulation, and/or a CYP17A inhibitor formulation, It may also contain a formulation of a compound of formula I or a pharmaceutically acceptable salt thereof and a compound of an androgen receptor antagonist and/or CYP17A inhibitor. It should be understood that when referring to enzalutamide and abiraterone in this article, it usually refers to their chemical molecules, namely two compounds with CAS numbers 915087-33-1 and 154229-19-3, respectively.

The pharmaceutical composition of the present invention usually contains an effective amount of the agents described herein, especially isoflavone compounds or pharmaceutically acceptable salts thereof, and androgen receptor antagonists and/or CYP17A inhibitors.

The pharmaceutical composition may also contain various pharmaceutically acceptable carriers or excipients known in the art. The pharmaceutically acceptable carrier can be solid or liquid. Suitable pharmaceutically acceptable carriers are known in the art, including but not limited to magnesium carbonate, magnesium stearate, talc, sugar, lactose, sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides or poly Ethylene glycol 400, hydrogenated castor oil, cyclodextrin, etc. Examples of pharmaceutically acceptable carriers and methods for preparing various compositions can be found in Remington's Pharmaceutical Sciences, 18th edition (1990), Mack Publishing Co., Easton, Pennsylvania written by A. Gennaro. When the reagent is a nucleic acid molecule, pharmaceutically acceptable excipients that are well-known in the art and suitable for nucleic acid molecules can be used to formulate the medicine or pharmaceutical composition of the present invention.

The medicament or pharmaceutical composition of the present invention can be in any suitable dosage form, including powders, tablets, dispersible granules, capsules, cachets, suppositories, solutions, suspensions, emulsions, and the like. When the 3βHSD inhibitor and other hormone-dependent disease treatment drugs in the pharmaceutical composition are separately packaged, the 3βHSD inhibitor and the other treatment drugs can be formulated into the same or different dosage forms, and can be used for sequential or simultaneous administration.

The pharmaceutical composition of the present invention can be administered in a manner known in the art, including but not limited to transdermal administration or oral administration.

The preferred pharmaceutical preparation is in unit dosage form. In this type of form, the preparation is divided into unit doses of appropriate sizes containing appropriate amounts of active ingredients, such as effective amounts for the desired purpose. Taking the compound of formula I of the present invention or a pharmaceutically acceptable salt thereof as an example, the amount of the active compound in a unit dose formulation may range from about 1 mg to about 100 mg, preferably about 1 mg to about 50 mg, and more preferably about 1 mg to about 25 mg. The actual dosage used can vary depending on the needs of the patient and the severity of the condition being treated. It is within the technical scope of the art to determine the appropriate dosage regimen under special circumstances. For convenience, if necessary, all daily doses can be divided into several parts and administered within the day.

In some embodiments, the invention also provides a kit containing the pharmaceutical composition of the invention. In the kit, 3βHSD inhibitors and other hormone-dependent disease treatment drugs can be made into pharmaceutical dosage forms and packaged separately. When individually packaged, each agent can be displayed in the kit in a suitable manner to provide patients with appropriate medication reminders; for example, different colors can be used to distinguish different formulations; or the amount of 3βHSD inhibitors taken at a time can be combined with Other medications for hormone-dependent diseases are physically separated from another dose of medication. Alternatively, 3βHSD inhibitors and other hormone-dependent disease treatment drugs are provided in the form of a pharmaceutical preparation.

A method for treating 3βHSD-mediated diseases or hormone-dependent diseases is also included in the present invention. The method includes administering to a subject in need a therapeutically effective amount of a 3βHSD inhibitor and optionally other hormone-dependent diseases. The 3βHSD inhibitor is especially a compound of formula I and/or a pharmaceutically acceptable salt or pharmaceutical composition thereof. The subject described herein can be any subject that expresses 3βHSD or its homologs, especially mammals, such as humans, domestic animals, and pets.

The dosage and frequency of the pharmaceutical composition of the present invention will be judged by clinicians considering factors such as the patient's gender, age, weight, and the type and severity of the disease.

The present invention also provides the application of an agent capable of inhibiting the expression and/or activity of 3βHSD in the preparation of drugs that enhance the clinical efficacy of androgen receptor antagonists or CYP17A inhibitors or overcome the drug resistance caused by them, and in the preparation of therapeutic hormones Drug application for dependent diseases. Also provided are reagents and males that are used to enhance the clinical efficacy of androgen receptor antagonists or CYP17A inhibitors or overcome the drug resistance caused by them or to treat hormone-dependent diseases that can inhibit the expression and/or activity of 3βHSD. Hormone receptor antagonist and/or CYP17A inhibitor, or a combination thereof. The agents, androgen receptor antagonists, CYP17A inhibitors and hormone-dependent diseases are as described in any of the preceding embodiments or as defined above.

Hereinafter, the present invention will be explained in the form of specific embodiments. It should be understood that these examples are merely illustrative and are not intended to limit the scope of the present invention. For the experimental methods without specific conditions in the following examples, follow conventional methods and conditions (for example, refer to "Molecular Cloning Experimental Guide" translated by J. Sambrook et al., Huang Peitang et al., third edition, Science Press), or Choose according to the product manual. Other methods and reagents used in the examples are conventional methods and reagents in the art. Those that do not indicate the manufacturer are conventional products that can be purchased on the market.

1. Materials and methods

Cell lines and cell culture:

LNCaP and HEK293T cells were purchased from the American Type Culture Collection (Manassas, VA). VCaP was generously provided by Dr. Jun Qin from the Institute of Health, Shanghai Academy of Biological Sciences, Chinese Academy of Sciences. The cells were cultured at 37°C in a medium containing 10% fetal bovine serum.

The cell lines all passed the cell genotype identification of Hybribio (Guangzhou, China) and tested for mycoplasma without mycoplasma contamination before being used in the experiment.

Plasmid construction and stable transgenic strain establishment

The viral vector pLVX-tight-puro (Clontech) was used to construct HSD3B1 (NM_000862.3) or CYP17A1 (NM_000102.3) overexpression plasmids. The constructed plasmids were verified by sequencing and used for stable transgenic strain construction.

After transfecting HEK293T cells with pLVX-tight-puro plasmid or tet-on plasmid and PEI (Promega) inserted with the target gene, the supernatant virus suspension was collected for 48 hours. The filtered virus suspension was mixed with normal culture medium 2:1 and then infected human prostate cancer cell lines. Stable cell lines were screened by puromycin (Sigma Aldrich, St. Louis, Missouri, USA) and G418 (Gibco).

High performance liquid chromatography (HPLC)

After spreading the cells on a 24-well plate at a density of 0.2M/mL, the cells were given different drug stimulation treatments. At the same time, non-isotope-labeled androgen and [ ³ H]-labeled androgen (PerkinElmer, Waltham, MA) were added at 37°C. Degree of culture response. After the cell culture solution is extracted with organic reagents, it is dried in a freeze dryer (Martin Christ Gefriertrocknungsanlagen, Germany), reconstituted with 50% methanol, and tested on the machine. All HPLC experiments have secondary hole detection and are repeated at least 3 independent experiments.

Gene expression detection (RT-PCR) and Western blotting (Western Blot)

The hungry-cultured cells were treated with specific androgens (DHEA, DHT, Cortisol) and small molecule compounds for a specified period of time, and the cells were collected.

For experiments to detect low-abundance genes (such as HSD3B1, HSD3B2, etc.), use TRIzol reagent (Ambion) to extract cellular RNA, and the obtained RNA is reversed into cDNA with M-MLV Reverse Transcriptase, RNase(H-)kit (Promega); Experiments used to detect high-abundance genes (such as RPLPO, PSA, etc.) use Cell to cDNA Kit (EZBioscience) to extract and reverse transcribe cellular RNA to cDNA. The qPCR experiment uses EZBioscience2 SYBR Green qPCR master mix (EZBioscience) to prepare the reaction system and use Bio-Rad CFX96 (Bio-Rad) to detect differences in gene expression.

The primers used are shown in the table below.

hs-RPLP0-F	ATGGCAGCATCTACAACCCT (SEQ ID NO: 1)
hs-RPLP0-R	AGGACTCGTTTGTACCCGTT (SEQ ID NO: 2)
hs-PSA-F	GCATGGGATGGGGATGAAGTAAG (SEQ ID NO: 3)
hs-PSA-R	CATCAAATCTGAGGGTTGTCTGGA (SEQ ID NO: 4)
hs-FKBP5-F	TAGGCTTCCCTGCCTCTCCAAA (SEQ ID NO: 5)
hs-FKBP5-R	GCGAAGGAGAAGACCACGACAT (SEQ ID NO: 6)
hs-TMPRSS2-F	CCATTTGCAGGATCTGTCTG (SEQ ID NO: 7)
hs-TMPRSS2-R	GGATGTGTCTTGGGGAGCAA (SEQ ID NO: 8)

The whole protein used in western blotting is obtained by lysing cells with RIPA lysis buffer containing protease inhibitors (Piece, Prod#88666). The primary antibodies used are as follows: anti-FLAG (1:1000, Sigma), anti-β-actin (1:2000, Abclone), anti-AR, anti-GR, anti-3βHSD1 (1:500, Abcam).

Cell growth experiment

In the cell growth experiment, the cell counting kit-8 (Dojindo, Kumamoto, Japan) reaction was performed and the OD450 absorbance value was measured on a microplate reader. Pave the cells on a 96-well plate at a density of 20,000 cells per well, add 100uL medium for starvation culture, add designated androgens and small molecule compounds, and test the cell culture solution after 1 and 2 days to react with CCK-8 for 3h OD450 absorbance value.

Mouse ectopic tumor experiment

male

(B-NSG) 6-8 week old mice (B: Biocytogen; N: NOD background; D: DNAPK (Prkdc) null; G: IL2rgknockout) were purchased from Beijing Biocytogen Company. All mouse studies were conducted in accordance with protocols approved by the Institutional Animal Care and Use Committee. VCaP cells and Matrigel (Corning, #354234) were mixed and injected subcutaneously into the armpit of mice. When the tumor volume reached 50-100mm ³ , the mice were castrated and implanted subcutaneously with DHEA sustained-release tablets. ^{The mice with tumor volume reached 150-200mm 3} were randomly divided into two groups: corn oil control group and BCA drug (30mg/ kg) Experimental group. The tumor size was measured by the same person every 2-3 days within 21 days of enrollment. After the experiment, the animals were sacrificed and the ectopic tumor was collected for the next analysis. The difference between the control group and the experimental group was analyzed by Kaplan-Meier survival analysis of SigmaStat3.5.

In vitro enzyme activity test

The HEK293T cells were plated on a 6cm culture dish at a density of 0.5M/mL, the target gene overexpression plasmid constructed by the pCDNA3.0 vector and PEI were premixed and then added to the cell culture medium to transfect the cells. After 24 hours, the cell pellet was collected. After cell disruption, a part of the supernatant was added to the in vitro enzyme reaction system (NAD+, PBS, and specific androgen) for in vitro enzyme reaction. After the reaction was terminated, the results of in vitro metabolism were detected by HPLC. All in vitro enzyme activity experiments were independently repeated at least three times.

Competitive experiment

The cells were plated on a 12-well plate (0.2M cells per well) at a density of 0.2M/mL. After starving the cells for 24 hours, the designated competitive molecule and the designated isotope-labeled competitive androgen were added to each well. After 30 minutes of reaction, the cells were lysed and the isotope radiation value of the lysate was measured. At the same time, take part of the supernatant for protein quantification. Analyze the ability of small molecules to compete with androgens based on the isotope radioactivity value and protein quantitative results. All competition experiments were independently repeated at least three times.

Clinical sample related experiments

All clinical samples related experiments have passed the ethics committee of hospitals and research institutes. In some patients, the punctured tissues were minced and cultured in vitro for a short period of time. At the same time, they were cultured and processed with isotope-labeled androgen. The culture fluid is used for subsequent androgen extraction and HPLC detection experiments. Patients taking abiraterone will draw blood for abiraterone metabolite testing 2-3 hours after taking the drug.

2. Results

1. Metabolic enzyme 3βHSD1 mediates the activity of DHEA metabolism and is related to prostate cancer disease progression

In patients, the source of the precursor of androgen synthesis in prostate tissue is controversial. The present invention uses prostate cancer tissue puncture samples, uses different androgen precursors to process prostate tissue and detects corresponding hormone metabolism (Figure 1, A). Experimental results show that the prostate tissue cannot directly use pregnenolone to synthesize androgen DHT, but can use DHEA or AD to synthesize DHT (Figure 1, B-D). Among them, the abundance of DHEA in the blood is much higher than that of AD (Figure 1, E). Therefore, DHEA is the main hormone precursor for the synthesis of DHT in prostate tissue under physiological conditions.

DHEA has multiple metabolites in prostate tissue (Figure 1, F and G). Among them, the oxidation product of DHEA cannot activate the androgen receptor AR, and has a limited impact on prostate cancer (Figure 1, H and I). The process of DHEA to the more active androgen metabolism is mainly initiated by the metabolic enzyme 3βHSD1 (Figure 1, G). At the same time, we found that the puncture tissue of patients with metastatic cancer has a stronger ability to metabolize DHEA, suggesting that as the disease progresses, the activity of the metabolic enzyme 3βHSD1 gradually increases (Figure 1, J). Therefore, the metabolic enzyme 3βHSD1 is a very important and promising target.

2. The small molecule compound Corylin can inhibit the conversion of DHEA to AD

We found that the small molecule compound Cory (Corylin) can inhibit the conversion of DHEA to AD (Figure 2, A). By overexpressing 3βHSD1 or 3βHSD2 in 293T cells and detecting DHEA metabolism, we found that Cory can inhibit the activities of metabolic enzymes 3βHSD1 and 3βHSD2 (Figure 2, B). Further androgen metabolism experiments showed that Cory did not inhibit other androgen metabolism steps (Figure 2, C). This shows that Cory is a specific inhibitor of the metabolic enzyme 3βHSD1. Therefore, Cory can specifically inhibit DHEA-induced target gene expression and cell growth, but will not affect DHT-related functions Figure 2 (D and E). The CETSA experiment showed that Cory can affect the stability of the over-expressed 3βHSD1 protein in the cell, suggesting that Cory directly binds to 3βHSD1 (Figure 2, F).

3. Cory derivatives can inhibit DHEA metabolism

We further screened the effects of Cory derivatives and related compounds on the metabolism of DHEA, including Corylinin (CAS NO: 775351-88-7), Formononetin (CAS NO: 485-72-3), and daidzein ( Daidzein, Calycosin, Biochanin A (BCA), Ipriflavone, Maackiain, Methylophiopogon, Soybean yellow Glycitein, Naringenin, Neobavaisoflavone, Bavachinin, Isobavachalcone, Genistein And D4A (where Mock refers to the control), it was found that Cory derivatives can inhibit DHEA metabolism, and BCA showed a better inhibitory effect (Figure 3, A). BCA metabolic inhibition EC ₅₀ was significantly lower than the EC Cory and D4A ₅₀ (FIG. 3, B). In vitro enzyme activity experiments showed that BCA can also effectively inhibit the activity of 3βHSD1 or 3βHSD2 (Figure 3, C). At the same time, BCA does not affect the activity of metabolic enzymes CYP17A or SRD5A, showing the specificity of its function (Figure 3, D and E). BCA can dose-dependently inhibit the regulation of AR target genes by DHEA, but does not affect the function of DHT (Figure 3, F). Experimental results of transplanted tumors in mice showed that BCA can inhibit the growth of ectopic tumors in mice (Figure 3, G). These results suggest that BCA can regulate androgen metabolism in prostate cancer cells by inhibiting the activity of 3βHSD1, and achieve the effect of treating prostate cancer.

Daidzein is an analog of BCA obtained in the diet. Experiments performed with daidzein showed that daidzein inhibited the metabolism of Abi in VCaP and Huh7 cells (Figure 7, a and b). The inventors further measured the plasma concentration of 32 patients who received Abi for about 12 weeks. Although no daidzein was detected in the plasma of 20 patients (group I), daidzein was detected in the plasma of the remaining 12 patients (group II). Interestingly, these 12 patients had relatively high Abi concentrations or relative percentages (Figure 7, c). In group II (where the initial PSA data of 1 patient was lost), 5 patients had a PSA drop of more than 90% (5/11, 45%); in group I, 7 patients had a PSA drop of more than 90% (7/ 20, 35%) (Figure 7, d). Of all these 32 patients, 15 patients achieved their respective PSA biochemical relapses. Patients with daidzein detected in plasma had a relatively good response to Abi treatment (Figure 7, e). These data indicate that BCA and its derivatives have the potential to enhance the clinical efficacy of Abi.

4. Cory and its analogues can be used to overcome enzalutamide drug tolerance

Long-term treatment of prostate cancer cells with enzalutamide to obtain enzalutamide-resistant strains. In this tolerant cell line, we found that compared with the control strain, enzalutamide can inhibit the cell growth caused by DHT, but not well the cell line growth caused by DHEA (Figure 4, A). We further found that in this drug-resistant strain, DHEA can better activate AR target gene expression (Figure 4, B). This is because in the drug-tolerant strain, the expression of the metabolic enzyme HSD3B1 increases, which results in the acceleration of DHEA metabolism and the ability to synthesize more androgens faster (Figure 4, C-E). The affinity of the androgen DHT and AR is much higher than that of the drug enzalutamide (Enz), so the increase in androgen synthesis can significantly reduce the efficacy of enzalutamide (Figure 4, F). Furthermore, we overexpress the metabolic enzyme 3βHSD1 in prostate cancer cells. Cell lines overexpressing 3βHSD1 can reproduce the experimental results in enzalutamide drug-resistant strains well. When Dox induced 3βHSD1 expression, enzalutamide could not well inhibit target gene expression and cell growth caused by DHEA (Figure 4, G and H). At the same time, experiments with ectopic tumors in mice showed that ectopic tumors overexpressing 3βHSD1 grew faster and showed a certain tolerance to enzalutamide treatment (Figure 4, I). Previous studies have shown that androgens can up-regulate the expression of the gene HSD3B1. In cells treated with VCAP drugs, we found that androgen R1881 stimulation can indeed up-regulate the expression of the gene HSD3B1 (Figure 4, J). In VCAP cells, we selected the first 1000 genes activated by DHT as the AR signal pathway activity markers, and found that the background AR signal pathway activity of enzalutamide drug-resistant cell lines is high (Figure 4, K). This explains why long-term treatment with enzalutamide will increase the expression of the metabolic enzyme 3βHSD1. Since Cory can well inhibit the activity of 3βHSD1, we used Cory and enzalutamide to treat enzalutamide drug-resistant strains at the same time. The results show that Cory can cooperate with enzalutamide to better inhibit cell growth caused by DHEA (Figure 4, L).

5. Cory and its derivatives can regulate abiraterone metabolism and overcome abiraterone drug tolerance

The drug abiraterone is another common drug for the treatment of advanced prostate cancer. About 30% of patients gradually develop acquired drug tolerance after taking the drug abiraterone for 3 months. Our previous work showed that abiraterone can be modified by androgen-metabolizing enzymes in the patient's body like androgen to produce 5α-Abi, a drug metabolite that promotes tumor growth. Among them, the metabolic enzyme 3βHSD1 catalyzes the first step in the metabolism of the drug abiraterone (Figure 5, A). By detecting the abundance of abiraterone metabolites in the patient’s blood, we found that as the patient develops drug tolerance to abiraterone, the proportion of active ingredients (abiraterone and D4A) in the patient’s blood decreases, and 5α-Abi and its The proportion of downstream metabolites remained unchanged, while the proportion of 5β-Abi and its metabolites increased significantly (Figure 5, B). At present, there is no effective clinical method to reduce the production of 5β-Abi and its metabolites. The inhibition of Cory and its derivatives on the activity of the metabolic enzyme 3βHSD1 may affect the metabolism of abiraterone. In the prostate cancer cell line LNCAP, we found that BCA can prevent the metabolic process of abiraterone in a dose-dependent manner (Figure 5, C).

In addition, because BCA and abiraterone target different targets in the process of regulating androgen metabolism, BCA can also coordinate with abiraterone to regulate the metabolism of pregnenolone, thereby inhibiting the expression of downstream AR target genes (Figure 6, A and B). Under the influence of multiple mechanisms, BCA can cooperate with abiraterone to inhibit the growth of prostate cancer cells caused by pregnenolone (Figure 6, C). These results show that Cory and its metabolites can synergize with abiraterone to treat prostate cancer by regulating androgen metabolism and abiraterone drug metabolism.

Claims (13)

1. Use of an agent capable of inhibiting the expression and/or activity of 3βHSD in the preparation of a medicine for treating or preventing diseases mediated by 3βHSD.
2. The use according to claim 1, wherein the reagent is selected from protein, nucleic acid and small molecule compound;

   Preferably, the protein is an anti-3βHSD antibody;

   Preferably, the nucleic acid is selected from the group consisting of siRNA, antisense RNA, ribozymes, homologous recombination vectors and gene editing vectors containing a nucleotide sequence encoding mutant inactive or attenuated 3βHSD, such as CRISPR-CAS9 gene editing vectors Or TALEN gene editing vector.
3. The use according to claim 2, wherein the small molecule compound is selected from the compound represented by the following formula I or a pharmaceutically acceptable salt thereof:

   

   Where

   R ₁ to R ₄ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

   R ₅ , R ₇ and R ₉ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

   R ₆ and R ₈ are each independently selected from H, hydroxyl, C _2-12 alkenyl, C _1-6 alkoxy, and C _1-6 alkyl; or, R ₅ and R ₆ , R ₆ and R ₇ , R ₇ and R ₈ or R ₈ and R ₉ together with the C atom to which they are each attached form an optionally substituted 5- or 6-membered heterocyclic ring.
4. The use according to claim 3, characterized in that:

   In formula I, R ₁ is H; R _{2 is} selected from H, hydroxyl and C _1-6 alkoxy; R _{3 is} selected from H, hydroxyl and C _1-6 alkoxy; R _{4 is} selected from H and hydroxyl; R ₅ is H; R _{6 is} selected from H, hydroxyl and C _2-12 alkenyl; R _{7 is} selected from H, hydroxyl and C _1-6 alkoxy; R _{8 is} selected from H, hydroxyl and C _2-12 alkenyl基; and/or R ₉ is H; or

   In formula I, R ₆ and R ₇ together with the C atom to which they are connected form an optionally substituted oxygen-containing 6-membered heterocyclic ring; preferably, the R ₆ and R ₇ together with the benzene ring to which they are connected form an optionally substituted Benzopyranyl; preferably, the substituent of the heterocyclic group is selected from hydroxy, C _1-6 alkyl and C _1-6 alkoxy; the number of substituents is 1-3; or

   In formula I, _{at least one of R 1 to} R ₄ is a hydroxyl group or an alkoxy group, preferably _{at least one of R 3 to} R ₄ is a hydroxyl group or an alkoxy group, and preferably at least R ₂ is a hydroxyl group or an alkoxy group; And/or, at least one of the substituents in _{R 5} -R _{9 is a hydroxyl group or a C 1-6} alkoxy group; preferably, at least R ₇ is a hydroxyl group or an alkoxy group; or

   In formula I, R ₁ , R ₅ and R ₉ are each independently H or C _1-4 alkyl, preferably H; R ₂ and R ₄ are each independently H or hydroxyl; R ₃ is H or C _1-6 alkane Oxy; R ₇ is H, C _1-6 alkyl, C _1-6 alkoxy or hydroxy, preferably C _1-6 alkoxy or hydroxy, more preferably C _1-4 alkoxy or hydroxy; R ₆ and R ₈ are each independently selected from H, hydroxyl and C _2-12 alkenyl; or

   In formula I, R ₁ , R ₅ and R ₉ are H; R ₂ is hydroxyl or C _1-6 alkoxy; R ₃ is H or C _1-6 alkoxy; R ₄ is H or hydroxyl; R ₆ Is H, hydroxyl or C _2-12 alkenyl; R ₇ is H, hydroxyl or C _1-6 alkoxy; R ₈ is H or C _2-12 alkenyl.
5. The use according to claim 3, wherein the compound of formula I is selected from:

   
6. The use according to any one of claims 1 to 3, wherein the 3βHSD-mediated disease is a hormone-dependent disease, preferably an androgen-dependent disease, an estrogen-dependent disease or a glucocorticoid-dependent disease More preferably, the 3βHSD-mediated disease is selected from: prostate cancer, benign prostatic hyperplasia, prostate epithelioma, hirsutism, acne, androgenic alopecia, polycystic ovary syndrome, breast cancer, inflammation and allergy.
7. A pharmaceutical composition or medicine box, which contains:

   (1) Reagents capable of inhibiting the expression and/or activity of 3βHSD; and

   (2) Androgen receptor antagonist and/or CYP17A inhibitor.
8. The pharmaceutical composition or kit according to claim 7, wherein the reagent is selected from protein, nucleic acid and small molecule compound;

   Preferably, the protein is an anti-3βHSD antibody;

   Preferably, the nucleic acid is selected from the group consisting of siRNA, antisense RNA, ribozymes, homologous recombination vectors containing a nucleotide sequence encoding a mutant inactive or attenuated 3βHSD, and gene editing vectors, such as CRISPR-CAS9 gene editing Vector or TALEN gene editing vector;

   Preferably, the small molecule compound is selected from the compound represented by the following formula I or a pharmaceutically acceptable salt thereof:

   

   Where

   R ₁ to R ₄ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

   R ₅ , R ₇ and R ₉ are each independently selected from H, hydroxyl, C _1-6 alkyl and C _1-6 alkoxy;

   R ₆ and R ₈ are each independently selected from H, hydroxyl, C _2-12 alkenyl, C _1-6 alkoxy, and C _1-6 alkyl; or, R ₅ and R ₆ , R ₆ and R ₇ , R ₇ and R ₈ or R ₈ and R ₉ together with the C atom to which they are each attached form an optionally substituted 5- or 6-membered heterocyclic ring.
9. The pharmaceutical composition of claim 8, wherein:

   In formula I, R ₁ is H; R _{2 is} selected from H, hydroxyl and C _1-6 alkoxy; R _{3 is} selected from H, hydroxyl and C _1-6 alkoxy; R _{4 is} selected from H and hydroxyl; R ₅ is H; R _{6 is} selected from H, hydroxyl and C _2-12 alkenyl; R _{7 is} selected from H, hydroxyl and C _1-6 alkoxy; R _{8 is} selected from H, hydroxyl and C _2-12 alkenyl基; and/or R ₉ is H; or

   In formula I, R ₆ and R ₇ together with the C atom to which they are connected form an optionally substituted oxygen-containing 6-membered heterocyclic ring; preferably, the R ₆ and R ₇ together with the benzene ring to which they are connected form an optionally substituted Benzopyranyl; preferably, the substituent of the heterocyclic group is selected from hydroxy, C _1-6 alkyl and C _1-6 alkoxy; the number of substituents is 1-3; or

   In formula I, _{at least one of R 1 to} R ₄ is a hydroxyl group or an alkoxy group, preferably _{at least one of R 3 to} R ₄ is a hydroxyl group or an alkoxy group, and preferably at least R ₂ is a hydroxyl group or an alkoxy group; And/or _{at least one substituent in R 5} -R ₉ is a hydroxyl group or a C _1-6 alkoxy group; preferably, at least R ₇ is a hydroxyl group or an alkoxy group; or

   In formula I, R ₁ , R ₅ and R ₉ are each independently H or C _1-4 alkyl, preferably H; R ₂ and R ₄ are each independently H or hydroxyl; R ₃ is H or C _1-6 alkane Oxy; R ₇ is H, C _1-6 alkyl, C _1-6 alkoxy or hydroxy, preferably C _1-6 alkoxy or hydroxy, more preferably C _1-4 alkoxy or hydroxy; R ₆ and R ₈ are each independently selected from H, hydroxyl and C _2-12 alkenyl; or

   In formula I, R ₁ , R ₅ and R ₉ are H; R ₂ is hydroxyl or C _1-6 alkoxy; R ₃ is H or C _1-6 alkoxy; R ₄ is H or hydroxyl; R ₆ Is H, hydroxyl or C _2-12 alkenyl; R ₇ is H, hydroxyl or C _1-6 alkoxy; R ₈ is H or C _2-12 alkenyl.
10. The pharmaceutical composition or kit according to claim 8, wherein the compound of formula I is selected from:

    
11. The pharmaceutical composition or kit of claim 7, wherein the androgen receptor antagonist comprises enzalutamide, apalutamide and bicalutamide; the CYP17A inhibitor comprises abiraterone, ketone Conazole, galeterone and seviteronel.
12. Application of a reagent capable of inhibiting the expression and/or activity of 3βHSD in the preparation of drugs that enhance the clinical efficacy of androgen receptor antagonists or CYP17A inhibitors or overcome the drug resistance caused by them;

    Preferably, the agent capable of inhibiting 3βHSD expression and/or its activity is as described in any one of claims 8-10;

    Preferably, the androgen receptor antagonist includes enzalutamide, apalutamide and bicalutamide; and the CYP17A inhibitor includes abiraterone, ketoconazole, galeterone and seviteronel.
13. Application of reagents capable of inhibiting the expression and/or activity of 3βHSD and androgen receptor antagonists and/or CYP17A inhibitors in the preparation of drugs for the treatment of hormone-dependent diseases;

    Preferably, the hormone-dependent disease is an androgen-dependent disease, an estrogen-dependent disease or a glucocorticoid-dependent disease. More preferably, the hormone-dependent disease is selected from: prostate cancer, benign prostatic hyperplasia, prostate Epithelioma, hirsutism, acne, androgenic alopecia, polycystic ovary syndrome, breast cancer, inflammation and allergies;

    Preferably, the agent capable of inhibiting 3βHSD expression and/or its activity is as described in any one of claims 8-10;

    Preferably, the androgen receptor antagonist includes enzalutamide, apalutamide and bicalutamide; and the CYP17A inhibitor includes abiraterone, ketoconazole, galeterone and seviteronel.

Images