WO2021027791A1

WO2021027791A1 - Application of zm5008 gene in regulation of plant height and internode distance of maize

Info

Publication number: WO2021027791A1
Application number: PCT/CN2020/108310
Authority: WO
Inventors: 普莉; 余佳; 徐帆
Original assignee: 中国农业科学院生物技术研究所
Priority date: 2019-08-13
Filing date: 2020-08-11
Publication date: 2021-02-18
Also published as: CN112390865A; CN112390865B; ZA202202997B

Abstract

Provided are applications of a Zm5008 gene and a protein ZM5008 encoded thereby in regulation of a plant height and/or an internode distance of maize. Further provided is an application of an RNA inhibiting ZM5008 protein activity or inhibiting Zm5008 gene expression in regulation of a plant height and/or an internode distance of maize.

Description

Application of Zm5008 gene in the regulation of maize plant height and node spacing

Technical field:

The invention belongs to the field of biotechnology, and in particular relates to an application of Zm5008 gene in the regulation of corn plant height and node spacing.

Background technique:

Plant height and node spacing are both important indicators for measuring good corn varieties. Plants that are too high will cause the planting density to decrease and are not resistant to lodging. If they are too short, they will affect the biomass and growth structure of the entire population, as well as the reasonable distribution of light in the population canopy, the ability to intercept light, and the rational use of light energy. Nodal spacing refers to the distance between two adjacent nodes of a plant stem. The corn node spacing has a very important influence on the plant height, yield and lodging resistance of corn.

Therefore, it is very important to study the key genes and regulation mechanism of corn plant height. However, the key genes and regulatory mechanisms that regulate the growth of maize plant height are currently unclear.

In recent years, domestic and foreign researchers have discovered a large number of quantitative trait loci (QTL) for plant height in maize by using different research groups and research programs. So far, the MaizeGDB (http://www.maizegdb.org/) website has included more than 200 plant height QTLs, which are distributed on 10 maize chromosomes. For example, Peiffer et al. (Peiffer et al., 2014) used 2815 inbred lines, a nested association mapping (NAM) population containing 4892 recombined inbred lines, and 2 near isogenic lines (near isogenic lines). , NILs), combined with the phenotypic data of 13 environments to study the genetic basis of maize plant height related traits, and found that plant height QTLs exist on all 10 chromosomes, and most of them are minor QTLs. In addition, about 50 genes involved in the regulation of corn plant height have been successfully reported on MaizeGDB. Most of these genes are involved in the synthesis and transportation of hormones such as gibberellin, brassinolide, auxin, strigolactone, etc. And signal conduction. These genes include maize Dwarf3 (D3) (Winkler and Helentjaris, 1995), Dwarf8 (D8) (Thornsberry et al., 2001), etc., as well as the dwarfing single gene BR2 (Multani et al., 2003), which is widely used in maize. And ZmGA3ox2 (Teng et al., 2013). Although these genes can regulate the plant height of maize, the introduction of maize dwarfing genes causes extreme plant dwarfing and cannot be successfully applied to maize breeding practice.

With the development of molecular biology, by analyzing the genetic structure of maize plant height, the key genes that regulate plant height can be located, cloned and functionally studied. These results can further guide breeders to select new varieties with moderate plant height. Provide an important theoretical basis for increasing corn production.

Summary of the invention

The purpose of the present invention is to discover genes that have the function of regulating plant height and/or node spacing in maize.

The present invention found that any of the following substances 1)-3) has the function of regulating the plant height and/or node spacing of corn:

1) Protein ZM5008, its amino acid sequence is shown in SEQ ID NO: 2;

2) The DNA molecule Zm5008 encoding protein ZM5008, and its nucleotide sequence is shown in SEQ ID NO:1;

3) Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing DNA molecules encoding protein ZM5008;

Another object of the present invention is to provide the use of a substance that inhibits the activity of ZM5008 protein or a substance that inhibits the expression of Zm5008 gene.

The present invention provides the application of a substance that inhibits the activity of ZM5008 protein or a substance that inhibits the expression of Zm5008 gene in any of the following a)-e);

a) Reduce corn plant height;

b) Cultivate corn with low plant height;

c) Cultivating low-stalk corn;

d) Reduce the distance between corn nodes;

e) Cultivating short pitch corn;

In the above application, the substance that inhibits the activity of the ZM5008 protein or the substance that inhibits the expression of the Zm5008 gene is the following a or b:

a) sgRNA is the RNA encoded by SEQ ID NO: 3;

b) Vectors or recombinant bacteria or recombinant viruses expressing sgRNA.

Another object of the present invention is to provide a method for cultivating transgenic corn with reduced plant height or shortened node spacing, which is characterized by: reducing the expression and/or activity of ZM5008 in wild-type corn; or reducing the content of protein ZM5008 in wild-type corn/ Or activity to obtain transgenic maize with plant height lower than wild type or node spacing smaller than starting plant.

In the above method, reducing the expression level and/or activity of ZM5008 in wild-type corn; or reducing the content/or activity of protein ZM5008 in wild-type corn is to introduce sgRNA that expresses cas9 and SEQ ID NO: 3 into the starting plant in.

CRISPR (regularly clustered short palindromic repeats) and CRISPR-Cas9 together form a system, which is a natural defense system used by bacteria to prevent phage DNA injection and plasmid transfer. SpyCas9 of Streptococcus is a multi-structured and multifunctional DNA endonuclease containing 1368 amino acids. Its cleavage site is the third base upstream of PAM through HNH (sgRAN complementary target sequence) and RuvC nuclease domain (non-target sequence). To identify a specific sequence and cut it, sgRNA and Cas9 are combined into a complex, where the combination of sgRNAy and Cas9 plays a key role, which can make Cas9 conformational reconstruction and become active. But now it has been re-used by humans to build a strong RNA-guided DNA targeting platform—mainly used for genome editing, transcription disruption, epigenetic regulation, etc.

Experiments have confirmed that the gene that affects the plant height of corn is Zm5008. Knock out its coding gene in corn to obtain a Zm5008 mutant line. Compared with normal corn, the plant shows a significant decrease in plant height, indicating that this gene is comparable to corn plants. High growth regulation is closely related, which helps to clarify the mechanism of Zm5008 in maize plant height. The study of this gene can further enrich the biological significance of crop plant type formation and obtain plants with altered plant types or improved varieties.

Description of the drawings

Figure 1 shows the phenotype of zm5008 mutant in Datian.

Figure 2 shows the sequencing results of the zm5008 mutant genome, where the uppercase letters are the Zm5008 exons; the lowercase sequences are the introns; the bolded sequences are the identification primers F and R for genotyping detection of transposon insertion.

Figure 3 shows the Genotyping identification and analysis of Zm5008 mutants.

Figure 4 shows the phenotype analysis of the Zm5008 mutant.

Figure 5 shows the expression analysis of mutant Zm5008.

Figure 6 shows the sequencing results of gene-edited Zm5008 maize.

Figure 7 shows the field phenotype of gene-edited Zm5008 transgenic maize.

Figure 8 is Zm5008 expression profile analysis (qTeller).

Figure 9 shows the expression profile analysis of Zm5008 in gene-edited maize.

Figure 10 shows the fine phenotype of gene-edited Zm5008 transgenic maize.

Figure 11 shows the determination of cell wall components in the stalk of gene-edited Zm5008 transgenic maize.

Sequence information

SEQ ID NO: 1 CDS coding sequence of Zm5008;

SEQ ID NO: 2 Zm5008 protein sequence;

SEQ ID NO: 3 crispr knockout target sequence.

detailed description

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

Example 1. Discovery of Zm5008 gene and its function study

1. Discovery of Zm5008 gene and phenotype study of zm5008 mutant

1. Through screening the maize AC/DS insertion mutant library, a mutant that regulates maize plant height was discovered and isolated, and it was named zm5008. Compared with wild-type maize W22 ("W22MODEL" SYN. This maize material was obtained from the National Germplasm Bank, http://www.cgris.net/) in the field, the zm5008 mutant showed a significantly lower plant height (Figure 1). Phenotype, 3:1 segregation ratio of heterozygous progeny (27 normal plants, 8 dwarfed plants).

2. Genotyping of the zm5008 mutant found that the transposon in the mutant was inserted into the second exon of the Zm5008 gene (Figure 3), resulting in a Zm5008 mutation and plant dwarfing.

This indicated that the gene insertion mutation caused the dwarf and slim phenotype of maize plants.

After sequencing, only the Zm5008 gene was different in the zm5008 mutant and wild-type maize genome, and the rest of the genes remained unchanged.

Using transposon sequencing primers, the sequencing results of the zm5008 mutant genome are shown in Figure 2. Uppercase sequence: Zm5008 exon; lowercase sequence: intron; yellow mark: genotyping primers F and R; transposon insertion sequence sequencing As a result, the genomic sequence was aligned, as shown in Figure 3; red: insertion position, indicating that the transposon was inserted into the second exon of Zm5008; indicating that the transposon was inserted into the second exon of the gene. This exon has resulted in the mutation of the gene.

3. Analyze the plant height phenotype of zm5008 mutant

The progeny of the heterozygous zm5008 mutant showed a clear 3:1 segregation ratio (zm5008 homozygous mutant and zm5008 heterozygous mutant), and the mutant zm5008 plants were dwarfed (Figure 4A) and the stems became thinner. The 100% homozygous mutant of zm5008 (mutant 1) is dwarfed and small (Figure 1). Compared with other mutants and wild-type maize, its powdering time is earlier (Figure 4B). Mutant 2 marked in Figure 1 is heterozygous

The plant heights of wild-type corn and zm5008 homozygous mutants were measured, and the results are shown in Fig. 4A. Compared with wild-type, the plant height of zm5008 homozygous mutants was 38.2% lower than that of wild-type corn (control).

The internode distance between wild-type corn and zm5008 homozygous mutants was measured. The results are shown in Figure 4C. Compared with wild-type corn (control 1, control 2), zm5008 homozygous mutants (mutant 1, mutant 2, mutant Body 3) The pitch between nodes is significantly shorter.

4. Clone the full length of Zm5008 gene

The full length of the Zm5008 gene was cloned. The size of the Zm5008 gene in the zm5008 homozygous mutant is 1497bp, and its nucleotide sequence is sequence 1 in the sequence table. The protein encoded by this gene is named Zm5008 protein, which consists of 498 amino acid residues. The amino acid sequence is sequence 2, and the molecular weight is 54229.1 Da. Figure 8 is Zm5008 expression profile analysis (qTeller).

2. The expression level of Zm5008 gene

Extract the various tissues of zm5008 homozygous mutant and wild-type corn W22 (control), including leaf (L), tassel (T), ear (E) before pollination, filament (S), stem (ST) and The RNA of the stem section (NO) and other tissues was reverse transcribed into cDNA with TaKaRa reverse transcriptase, and then 50-fold diluted cDNA was used as a template, using 5008-F (CAGCAGGTAACAGCAGGTGG) and 5008-R (ACCTCATCTGCTCGCGGTAT) primers, using promise Weizan Company SYBR qPCR mix does RT-qPCR. The internal reference selected maize actin (GRMZM2G126010). In qPCR detection, each sample was subjected to three technical repetitions, and the relative expression of genes was calculated using the 2- ^ΔΔCt method.

The above PCR reaction system is shown in Table 1:

Table 1

The PCR reaction conditions are shown in Table 2:

Table 2

The relative expression results of Zm5008 gene are shown in Figure 5. WT is W22, M1 is Zm5008 homozygous mutant, leaf (L), tassel (T), ear before pollination (E), filament before pollination (S) , Stem (ST) and stem node (NO); Zm5008 homozygous mutant leaves (L), tassel (T), stem (ST) and stem node (NO) compared to wild-type control, Zm5008 gene The amount of expression is reduced.

The above results indicate that the plant dwarf in the mutant may be caused by the mutation of this gene.

Example 2 Functional verification of Zm5008 gene

1. Construction of gene-edited Zm5008 maize

In order to verify the function of Zm5008 regulatory genes, the gene-edited transgenic Zm5008 maize was constructed to obtain the T0 generation gene-edited transgenic Zm5008 maize. The T0 generation gene editing transgenic Zm5008 maize is to replace the Zm5008sgRNA coding sequence shown in sequence 3 with the target sequence shown in sequence 4 in the Zm5008 gene of wild-type maize W22, and other sequences remain unchanged.

The specific construction method is as follows:

Entrusted corn transformation company Weimi Biotechnology (Jiangsu) Co., Ltd. to construct a gene-editing recombinant plasmid pGL3-U6-sgRNA-Zm5008, which inserts the Zm5008sgRNA coding sequence (sequence 3) for gene coding into the pGL3-U6-sgRNA vector backbone The specific insertion site behind the ZmU6 promoter (Bsa1 single restriction site), to obtain the recombinant plasmid pGL3-U6-sgRNA-Zm5008;

Among them, the Zm5008sgRNA coding sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (sequence 3), and the target sequence corresponding to the gene encoding is GCGCGTCGCAGGTGTACACG (sequence 4).

The recombinant plasmid pGL3-U6-sgRNA-Zm5008 was transformed into Agrobacterium AG1 to obtain recombinant bacteria AG1/pGL3-U6-sgRNA-Zm5008.

Then, the recombinant strain AG1/pGL3-U6-sgRNA-Zm5008 was used to infect wild-type corn KN5585 to obtain T0 gene-edited transgenic Zm5008 corn.

2. Functional verification of Zm5008 gene

1) PCR amplification and sequencing

Design primers near the gene editing site, the sequence is as follows: 5008-F' (GCTGTGGAAGCCGATGATAGA) and 5008-R' (ACAAGCTACCCAGCGAAATGA). Use Novozan PCR mix high-fidelity enzyme to detect target gene editing.

The genomic DNA of T0 generation gene-edited Zm5008 maize leaves was extracted as a template, and 5008-F' and 5008-R' were used for PCR amplification to obtain amplified products.

The above PCR reaction system is shown in Table 3:

table 3

PCR reaction conditions: 95°C for 3min, 95°C for 15sec, 60°C for 20sec, 72°C for 60sec, 72°C for 10min, 30cycles.

After the PCR product was sequenced, the editing effect was analyzed, and the result is shown in Figure 6: there is a homozygous mutant with a single base T insertion at the editing site (marked in red).

2) RT-PCR detection of gene expression

The RNA of the T0 generation gene-edited transgenic Zm5008 maize leaves was extracted, and the cDNA obtained by reverse transcription was used as a template. RT-qPCR was performed with 5008-F' and 5008-R'. The internal reference selected maize actin (GRMZM2G126010). In RT-qPCR detection, each sample was subjected to three technical repetitions, and the relative expression of genes was calculated by the 2- ^ΔCt method. Take wild-type corn W22 as a control.

The results are shown in Figure 9. It can be seen that compared with the control (wild-type corn KN5585), the expression of Zm5008 in the T0 gene-edited transgenic Zm5008 maize (mutant) is reduced, which also proves that the gene editing is successful and inhibits Zm5008. The expression of gene editing transfected Zm5008 maize.

3. Phenotype detection

The T0 generation gene-edited transgenic Zm5008 maize (Zm5008-cas) and wild-type maize KN5585 (control) were planted in the field, and the plant height traits were measured after the plants no longer grew tall after pollination.

The results are shown in Figure 7. It can be seen that compared with wild-type maize, the plant height of T0 gene-edited transgenic Zm5008 maize is reduced. In addition, the edited plants also showed obvious leaves becoming smaller and narrower, stalks becoming thinner, and node spacing shorter.

4. Leaf cell size and number statistics: Take the wild-type (control) material grown in the field and the upper ear leaf of the gene-edited insert into the homozygous mutant material, take the middle section of the leaf, about 1cm X 1cm, and tear the upper epidermis of the leaf after transparent Cells, observe the cell size on an optical microscope and count the number of cells.

The results are shown in Figure 10. It can be seen that compared with the wild type, the mutant cells of the inserted homozygous corn plant are smaller and the number of cells are reduced compared with the wild type. This indicates that Zm5008 may affect plant development by regulating cell development. , Leading to a dwarfed phenotype.

5. Characterization of stalk cell toughness. Determination of cellulose content in stalk cells. The cellulose content of corn was determined by the anthrone sulfate colorimetric method (Wang Xuekui., 2006).

Gradient dilution to draw a standard curve: each tube contains 0, 20, 40, 80, 120, 160, 200 μg cellulose, add 0.5ml% anthrone reagent to each tube, and then add 5.0ml concentrated H2SO4 along the tube wall, and stopper Stopper, shake slightly. When anthrone flocs appear in the tube, shake it vigorously to promote the dissolution of anthrone, and then immediately put it in a boiling water bath to heat for 10 minutes, and take it out to cool. Color comparison at 620nm wavelength on a spectrophotometer to measure the extinction value of each tube. Use the measured extinction value as the ordinate and the cellulose content as the abscissa to draw a cellulose standard curve.

Sample measurement: accurately weigh 0.1g of air-dried sample, put it into a 25ml measuring flask, put the measuring flask in an ice bath, add 15-20ml of 60% H2SO4 chilled, digest it under cold conditions for half an hour, then Dilute to the mark with concentrated H2SO4, shake well, and filter with a glass crucible funnel. Draw 5.0ml of the above-mentioned filtrate, put it into a 25ml measuring flask, place the measuring flask in an ice bath, add distilled water to the mark, and shake well. Aspirate 1.0ml of the upper liquid, add 0.5ml 2% anthrone reagent, add 5.0ml concentrated H2SO4 along the tube wall, cover the stopper, follow the same procedure as the cellulose standard solution, and measure the extinction value of the sample at a wavelength of 620nm.

Result calculation: Determine the extinction value of the sample, find out the corresponding cellulose content on the standard curve, and then calculate the cellulose content in the sample as follows:

X=A×D×10-3/m where:

A—The cellulose content value in the colorimetric tube found on the standard curve, μg;

D—Division multiple (extraction ml×dilution multiple/determining liquid volume ml);

10-3—The coefficient of converting μg into mg;

m—weight of the sample, g; X—cellulose content in the sample, mg/g.

According to the above method, the stalks of wild-type and edited insertion homozygous mutant plants were determined respectively. We divided the stalks into Upper (i.e., upper, which refers to the lower node of the tassel to 2-3 nodes above the ear position) from top to bottom. All the stem nodes are mixed), Middle (ie the middle, refers to the mixture of all the stem nodes from the upper down to the nodes 2-3 below the ear position) and Lower (ie the lower part, refers to the middle down to the node where the aerial roots are located) All the stem nodes between the mixed) three parts. The results showed that, as shown in Figure 11, the edited homozygous mutant had lower cellulose content in the three parts of the stem node than the wild type corn. This shows that editing homozygous mutant materials has lower toughness than wild-type maize, which shows that Zm5008 gene is involved in regulating stem development.

6. Characterization of the fragility of stem cells

1) Determination of hemicellulose content in stem cells

The hemicellulose content of stem cells was determined by hydrochloric acid hydrolysis method (Xiong Min et al., 2005).

Sample extraction: After crushing the sample, pass through a 30-mesh sieve, take 0.1～0.2g into a beaker, add 10ml of 80% calcium nitrate solution with mass fraction, heat it on an electric furnace, boil it on a low fire for 5 minutes, and centrifuge after cooling; heat the precipitation Rinse with water 3 times, then add 10ml of hydrochloric acid with a concentration of 2mol/L to the precipitate, cover with glass cover, mix well, place in a boiling water bath, boil for 45min under stirring occasionally; centrifuge after cooling, transfer the supernatant into a 25ml volumetric flask In the middle, the precipitate was rinsed 3 times, and the washing liquid was incorporated into the volumetric flask; 1 drop of phenolphthalein was added to the volumetric flask and neutralized with NaOH to a rose color, diluted to the mark, and then filtered into a beaker.

Reducing sugar determination: Use the DNS method to determine the reducing sugar in the solution, that is, take 1ml of the above filtrate into a test tube and add 1.5ml DNS reagent, place it in a boiling water bath for 5 minutes, cool, measure the absorbance at 540nm wavelength, and compare it to the glucose standard curve. analysis.

Result calculation: Hemicellulose content = reducing sugar content × 0.9.

According to the above method, the three parts of wild-type and edited homozygous corn, Upper, Middle, and Lower, were tested separately. The results are shown in Figure 11. The hemicellulose content of the three parts of edited homozygous corn was higher than that of wild-type corn.

2) Determination of lignin content in stem cells

The content of corn lignin was determined by titration (Xiong Min et al., 2005).

Sample extraction: After crushing the sample, pass through a 30-mesh sieve, take 0.1～0.2g into a centrifuge tube, add 10ml 1% acetic acid solution with mass fraction, shake well and centrifuge; wash the precipitate with 5ml 1% acetic acid, then add Mix 3-4ml of ethanol and ether (volume ratio 1:1), soak for 3min, discard the supernatant, and rinse for 3 times. Evaporate the precipitate in the centrifuge tube to dryness in a boiling water bath, then add 3ml of 72% sulfuric acid to the precipitate, stir it with a glass rod, and let it stand at room temperature for 16 hours to dissolve all the cellulose, and then add it to the test tube 10ml of distilled water, stir well with a glass rod, set in a boiling water bath for 5 minutes, add 5ml of distilled water and 0.5ml of 10% barium chloride solution after cooling, shake well, and centrifuge. The precipitate was washed twice with distilled water.

Titrimetric determination: Add 10ml of 10% sulfuric acid and 0.1mol/L potassium dichromate solution to the washed lignin precipitate, put the test tube in a boiling water bath for 15 minutes, stirring occasionally. After cooling, transfer all the materials in the test tube to a beaker for titration, and wash the remaining part with 15-20ml of distilled water. Then add 5ml of KI solution with a mass fraction of 20% and 1ml of a starch solution with a mass fraction of 0.5% into the beaker, and titrate with 0.2mol/L sodium thiosulfate.

Result calculation: lignin content=K(a-b)/(n×48)

among them:

48——1mol C11H12O4 is equivalent to the equivalent of sodium thiosulfate;

K——Sodium thiosulfate concentration, mol/L;

a——The volume of sodium thiosulfate consumed in blank titration, ml;

b——The volume of sodium thiosulfate consumed by the titration solution, ml;

n——The mass of the sample, g.

According to the above method, the stalk samples of the upper, middle and lower parts of wild-type and edited homozygous corn were determined respectively. The results are shown in Fig. 11. The lignin content of the three parts of edited homozygous corn was higher than that of wild-type corn.

Hemicellulose and lignin determine the fragility of cells. Compared with wild-type corn, edit homozygous corn plants are shorter and more resistant to lodging. Combining the above three content differences indicates that Zm5008 plays an important role in the development of maize stalk cells. It controls the brittleness and toughness of maize stalks, participates in the regulation of maize plant height and internode cell development, and is resistant to corn Lodging related.

Claims

The application of the Zm5008 gene in regulating the plant height and/or node spacing of maize, the Zm5008 gene is a DNA whose nucleotide sequence is shown in SEQ ID NO:1.
Use of the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the Zm5008 gene of claim 1 in the regulation of corn plant height and/or node spacing.
For the application of ZM5008 protein in regulating the plant height and/or node spacing of corn, the amino acid sequence of the ZM5008 protein is shown in SEQ ID NO: 2.
Substances that inhibit the activity of ZM5008 protein or inhibit the expression of Zm 5008 gene are as follows a or b:

a) RNA whose nucleotide sequence is shown in SEQ ID NO: 3;

b) A vector or recombinant bacteria or recombinant virus expressing the RNA of a).
The use of the substance of claim 4 in any one of the following a)-e);

a) Reduce corn plant height;

b) Cultivating dwarf and semi-dwarf corn;

c) Cultivating low-stalk corn;

d) Reduce the distance between corn nodes;

e) Cultivating short pitch corn.
The method for cultivating corn with reduced plant height or shortened nodal spacing is characterized by: reducing the expression and/or activity of Zm5008 gene in wild-type corn; or reducing the content/or activity of protein ZM5008 in wild-type corn, so that the plant height is lower than that of wild-type corn. Type or node spacing is smaller than wild-type transgenic corn.