WO2021014398A1

WO2021014398A1 - Integrated human cytomegalovirus / glioblastoma vaccine

Info

Publication number: WO2021014398A1
Application number: PCT/IB2020/056946
Authority: WO
Inventors: Stipan Jonjic; Hrvoje Simic; Berislav LISNIC; Lea HIRSL; Marija MAZOR
Original assignee: University Of Rijeka Faculty Of Medicine
Priority date: 2019-07-23
Filing date: 2020-07-23
Publication date: 2021-01-28

Abstract

A recombinant human cytomegalovirus expressing specific proteins and tumor antigens is provided as well as pharmaceutical compositions and methods of vaccination against tumors, particularly glioblastoma.

Description

INTEGRATED HUMAN CYTOMEGALOVIRUS / GLIOBLASTOMA VACCINE

FIELD OF THE INVENTION

The invention is in the field of cancer immunotherapy and tumor vaccines.

BACKGROUND OF THE INVENTION

Glioblastoma multiforme (GBM) is the most dangerous type of brain tumors (Roche Annual report, 2009). It affects an enormous number of patients every year and the average survival is approximately 14 to 16 months. GBM has driven by complex signaling pathways and considered as a most challenging to treat. The standard treatment includes surgical resection followed by radiation therapy and the drug temozolamide (Temodal). Complete surgical excision is made impossible by the tumor's ability to disseminate outside its visible borders. Only 4 medications are currently approved for GBM treatment by the US Food and Drug Administration (FDA) and neither improves the survival for more than several months (Readron et al., 2013, Expert Rev Vaccines, 12(6): 597-615).

Development of cancer diseases can be defined as the inability of the immune system to recognize and destroy the tumor cells, despite the fact that tumor cells have certain properties that differentiate them from healthy-self cells. Recent studies show that human glioblastoma cells are frequently infected with cytomegalovirus (CMV), which helps tumor cells escape immune response and enables their more aggressive growth. Latest research demonstrates the important role of human cytomegalovirus (HCMV) in glioma spread and immune evasion. Experimental models of cancer treatment with antiviral therapeutics have shown efficiency in recent clinical studies (Stragliotto et al., 2013, Int J Cancer, 1 ; 133(5): 1204-13). Moreover, vaccines based on tumor- specific peptide sequences have shown to effect tumor growth (Gedeon et al., 2013, Drugs Future, 38(3): 147-155).

Currently, there are ongoing clinical trials which show some promising results using peptide-based vaccines and antiviral drugs. Different vaccination tactics are evaluated for GBM treatment, for example, a vaccine comprising the epidermal growth factor receptor class III variant (EGFRvIII) coupled to keyhole limpet hemocyanin (KLH) or a vaccine comprising tumor lysate enriched dendritic cells. So far, none of them has demonstrated high efficacy in inducing protective immune response against the cancer cells.

The research on HCMV is strongly affected by species specificity of cytomegaloviruses. A widely used model for the study of HCMV is the infection of mice with mouse CMV (MCMV). This model is convenient due to the high similarity in the genome and virus immunobiology between the human and mouse viruses. Previous research has shown that the insertion of a gene for NKG2D ligand in viral genome facilitates the induction of a strong and specific immune response against CMV infection (Slavuljica et ah, 2010, J Clin Invest., 120(12):4532-45). More specifically, a recombinant MCMV expressing the NKG2D ligand RAE-Ig in place of its viral inhibitor, ml52 protein, was generated. This recombinant virus, RAE-lyMCMV, was profoundly attenuated in vivo as a consequence of strong NK cell-mediated control early post infection. RAE-lyMCMV infection was efficiently controlled even by immunocompromised hosts, including mice lacking type I interferon receptors, mice immunosuppressed by sublethal g-irradiation and newborn mice. Despite strong attenuation, RAE-lyMCMV demonstrated tremendous potential for enhancing the efficiency of MCMV-specific T cell response. Furthermore, this virus demonstrated the ability to serve as a highly efficient CD8 T cell-based vaccine vector. Using RAE-lyMCMV as a backbone, recombinant viruses have been constructed bearing immunodominant CD8 T cell epitopes such as listeriolysin of Listeria monocytogenes or a peptide derived from ovalbumin. Such recombinant viral vectors provided outstanding CD8 T cell-dependent protective capacity against respective pathogens and maintained this specific response long-term (Trsan et ah, 2013 PNAS, 8;110(41): 16550-5).

The epidermal growth factor receptor class III variant (EGFRvIII), a constitutively activated mutant of the wild-type tyrosine kinase, is present in a substantial proportion of malignant gliomas and other human cancers, yet completely absent from normal tissues. This receptor variant consists of an in-frame deletion, the translation of which produces an extracellular junction with an additional glycine residue, flanked by amino acid sequences that are not typically adjacent in the normal protein. Active and passive vaccination strategies targeted against msEGFRvIII have also been proven to be effective (Choi et ah, 2009, Brain Pathol., 19(4): 713-723).

A point mutation in isocitrate dehydrogenase 1 (IDH1R132H), expressed in gliomas and other tumors, has been shown to be presented on human MHC class II and induces a mutation- specific CD4+ antitumor T cell response in patients and a syngeneic effect in tumor model in MHC -humanized mice. IDH1 is mutated in more than 70% of lower-grade gliomas (grade II and grade III) and therefore represents an epitope suitable for vaccine development. The most common IDH1 mutation occurs at arginine 132 (R132H). It was recently shown that patients with gliomas with a high prevalence of the IDH1(R132H) mutation may benefit from a tumor vaccine based on this antigen (Schumacher et ah, 2014 Nature 512, 324-327). US2013/0156808, issued as US 10,537,621, discloses a vaccine comprising beta- herpesvirus produced from a vector based on attenuated CMV expressing a cellular ligand for the NKG2D receptor.

W02006/004661 discloses recombinant HCMV viruses engineered to express a viral matrix polypeptide pp65 or fragment thereof, fused to a heterologous or non-native polypeptide, such as tumor-associated antigens, for use as cancer vaccines.

W02017/075440 discloses targeted cancer therapy using tumor- selective vehicles, including viruses, to deliver to the subject an immune cell expressing a receptor that binds to the antigen.

W02016/120415 discloses a recombinant herpesvirus-based vector comprising a controllable promoter for use in vaccines.

There is an unmet need for more effective and safer vaccines against GBM that would overcome the limitations of the therapies currently available for this harmful disease.

SUMMARY OF THE INVENTION

The present invention provides combined tumor vaccines, comprising recombinant human cytomegalovirus (HCMV) in conjunction with specific tumor-associated antigens. HCMV of the present invention not only serves as a carrier and immune stimulator to specific tumor antigens, but also and simultaneously boosts the anti-tumor response against CMV antigens expressed on the tumor cells.

The recombinant viruses of the present invention utilize the immunologically attenuated ULBP2-HCMV as a powerful vaccine vector that can be employed, together with tumor antigens of choice, to combat intracellular pathogens and tumors with improved efficacy.

It is herein disclosed that simultaneous stimulation of CMV, using the ULBP2 vector and anti tumor- specific GBM peptides, leads to effective and robust T cell activation and/or maturation with a significant anti-tumor response.

Without wishing to be bound by any theory or mechanism of action, it is postulated that the combined use of the viral IE1 protein with two tumor antigens, EGFrvIII and IDH1, in an engineered human CMV vector, provides a highly effective anti-tumor response.

The present invention provides according to one aspect a recombinant human cytomegalovirus (HCMV) vector expressing a polynucleotide encoding human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding viral IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one tumor peptide antigen.

According to some embodiments, the polynucleotide encoding at least one peptide tumor antigen is fused to the 3’ end of the polynucleotide sequence encoding the viral IE1 protein.

According to some embodiments, the encoded IE1 protein or fragment thereof is fused to the at least one encoded tumor peptide antigen. According to certain embodiments, the at least one encoded tumor peptide antigen is fused to the C terminus of the encoded viral IE1 protein or fragment thereof.

According to some embodiments, the encoded IE1 protein or fragment thereof is directly fused to the at least one encoded tumor peptide antigen. According to other embodiments, the encoded IE1 protein or fragment thereof is indirectly fused to the at least one encoded tumor peptide antigen. According to certain embodiments, a linker connects the encoded IE1 protein or fragment with the at least one encoded tumor peptide antigen.

According to some embodiments, the tumor is glioma. According to certain embodiments, the tumor is glioblastoma multiforme (GBM). According to other embodiments, the tumor is a pancreatic tumor.

According to some embodiments, the at least one GBM peptide antigen is selected from epidermal growth factor receptor class III variant (EGFRvIII) and isocitrate dehydrogenase 1 (IDH1) mutant.

According to some embodiments, the heterologous polynucleotide encodes at least two GBM peptide antigens.

According to some embodiments, the heterologous polynucleotide encodes the at least two GBM peptide antigens EGFRvIII and IDH1.

According to some embodiments, the at least one GBM peptide antigen comprises an EGFRvIII peptide having a sequence selected from the group consisting of LEEKKGNYV (SEQ ID NO: 7) and LEEKKGNYVVTDHC (SEQ ID NO: 1).

According to some embodiments, the at least one GBM peptide antigen consists of a EGFRvIII sequence selected from the group consisting of LEEKKGNYV (SEQ ID NO: 7) and LEEKKGNYVVTDHC (SEQ ID NO: 1).

According to some embodiments, the GBM peptide antigen comprises an IDH1 peptide having a sequence selected from the group consisting of SGWVKPIIIGHHAYG (SEQ ID NO: 8) and KPIIIGHHAYGD (SEQ ID NO: 2). According to some embodiments, the GBM peptide antigen consists of an IDH1 sequence selected from the group consisting of SGWVKPIIIGHHAYG (SEQ ID NO: 8) and KPIIIGHHA Y GD (SEQ ID NO: 2).

According to some specific embodiments, the heterologous polynucleotide encodes two GBM peptide antigens: (i) an EGFRvIII peptide comprising the sequence:

LEEKKGNYV (SEQ ID NO: 7); and (ii) IDH1 peptide comprising the sequence: SGWVKPIIIGHHAYG (SEQ ID NO: 8).

LEEKKGNYVVTDHC (SEQ ID NO: 1); and (ii) IDH1 peptide comprising the sequence: KPIIIGHHA YGD (SEQ ID NO: 2).

According to some specific embodiments, the heterologous polynucleotide encodes the two GBM peptide antigens: (i) an EGFRvIII peptide consisting of the sequence: LEEKKGNYV (SEQ ID NO: 7); and (ii) an IDH1 peptide consisting of the sequence: SGWVKPIIIGHHAYG (SEQ ID NO: 8).

According to some specific embodiments, the heterologous polynucleotide encodes the two GBM peptide antigens: (i) an EGFRvIII peptide consisting of the sequence: LEEKKGNYVVTDHC (SEQ ID NO: 1); and (ii) an IDH1 peptide consisting of the sequence: KPIIIGHHA YGD (SEQ ID NO: 2).

According to some embodiments the virus is attenuated.

According to some embodiments, said heterologous polynucleotide is operatively linked to a specific promoter. According to some specific embodiments, the specific promoter is a CMV IE1 promoter.

According to some embodiments, the IE1 sequence is directly fused to a heterologous polynucleotide encoding at least one tumor peptide antigen. According to some embodiments, the IE1 sequence is indirectly fused to a heterologous polynucleotide encoding at least one tumor peptide antigen. According to some embodiments, the HCMV comprises an additional heterologous polynucleotide between the IE1 sequence and the heterologous polynucleotide encoding for the at least one tumor peptide antigen.

The present invention also provides antigenic presenting cells (APCs) infected with recombinant HCMV expressing a polynucleotide encoding human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one GBM peptide antigen. According to some embodiments, the APCs are autologous.

According to some embodiments, the antigen presenting cells are dendritic cells.

The present invention provides, according to another aspect, a pharmaceutical composition comprising at least one recombinant HCMV expressing a polynucleotide encoding human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one GBM peptide antigen.

According to some embodiments, the GBM peptide antigen is IDH1 or EGFRvIII.

According to some embodiments, the pharmaceutical composition comprising at least two different recombinant HCMV, each expressing a polynucleotide encoding a human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one GBM peptide antigen, and wherein the two recombinant HCMV comprising different GBM peptide antigen.

According to some embodiments, the pharmaceutical composition comprising at least one recombinant HCMV comprising a polynucleotide encoding an IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding an IDH1 peptide, and at least one recombinant HCMV comprising a polynucleotide encoding an IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding an EGFRvIII peptide.

Pharmaceutical compositions according to the present invention optionally comprise at least one excipient, diluent, adjuvant, delivery system or carrier.

According to some embodiments, the pharmaceutical composition is a vaccine composition.

According to some embodiments, the vaccine composition does not comprise an adjuvant.

According to some embodiments, the vaccine composition comprises autologous antigen presenting cells infected with recombinant HCMV expressing a polynucleotide encoding human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one GBM peptide antigen.

According to some embodiments, the vaccine composition comprises at least two different recombinant HCMV vectors, each comprising a heterologous polynucleotide encoding a different GBM peptide antigen, fused to a polynucleotide encoding viral IE1 protein or fragment thereof.

According to some embodiments, the vaccine composition comprises a recombinant HCMV vector expressing an EGFRvIII peptide and a recombinant HCMV vector expressing an IDH1 peptide.

According to some embodiments, the vaccine composition comprises at a population of antigen presenting cells infected with recombinant HCMV expressing a polynucleotide encoding human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one GBM peptide antigen. According to some embodiments, the antigen presenting cells are autologous.

According to some specific embodiments, the EGFRvIII peptide comprises a sequence selected from the group consisting of LEEKKGNYV (SEQ ID NO: 7) and LEEKKGNYVVTDHC (SEQ ID NO: 1).

According to some embodiments the IDH1 peptide comprises a sequence selected from the group consisting of S GW VKPIIIGHH A Y G (SEQ ID NO: 8) and KPIIIGHHA Y GD (SEQ ID NO: 2).

According to some specific embodiments, the EGFRvIII peptide consists of the sequence: LEEKKGNYV (SEQ ID NO: 7); and the IDH1 peptide consists of the sequence: S GW VKPIIIGHH AY G (SEQ ID NO: 8).

According to some specific embodiments, the EGFRvIII peptide consists of the sequence: LEEKKGNYVVTDHC (SEQ ID NO: 1); and the IDH1 peptide consists of the sequence: KPIIIGHHA YGD (SEQ ID NO: 2).

Pharmaceutical compositions according to the present invention may be administered to a subject in need thereof by any method known in the art, including parenteral and non- parenteral routes.

According to some embodiments, the pharmaceutical composition is formulated for parenteral administration. For example, the pharmaceutical compositions may be formulated for injection administration, including but not limited to intravenous, intramuscular, subcutaneous, intradermal or intrathecal. Each possibility represents a separate embodiment of the present invention.

According to some embodiments, the pharmaceutical composition is administered via a route selected from the group consisting of: subcutaneous, intravenous and intramuscular. According to other embodiments, the pharmaceutical composition is formulated for enteral administration.

According to some particular embodiments, the vaccine composition comprises a delivery system.

According to some embodiment, the pharmaceutical composition of the invention is administered as part of a treatment regimen, in conjunction with one or more chemotherapeutic agents, immuno therapeutic agents, or radiotherapy.

The present invention provides according to yet another aspect, a method of preventing or treating cancer, comprising administering to a subject in need thereof, a pharmaceutical composition comprising at least one recombinant HCMV expressing a polynucleotide encoding a human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding an IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one GBM peptide antigen.

According to some embodiments, the cancer cells expresses at least one antigen selected from EGFRvIII and a mutant IDH1.

According to some embodiments, the cancer is glioma.

According to some specific embodiments, the cancer is glioblastoma multiforme.

According to some embodiments, the polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding two different GBM peptide antigens.

According to some embodiments, the GBM peptide antigens are selected from the group consisting of an EGFRvIII peptide and an IDH1 peptide. According to certain embodiments, the GBM peptide antigens are EGFRvIII peptide and IDH1 peptide.

According to some specific embodiments, the EGFRvIII peptide consists of the sequence: LEEKKGNYV (SEQ ID NO: 7); and the IDH1 peptide consists of the sequence: S GW VKPIIIGHH AY G (SEQ ID NO: 8). According to some specific embodiments, the EGFRvIII peptide consists of the sequence: LEEKKGNYVVTDHC (SEQ ID NO: 1); and the IDH1 peptide consists of the sequence: KPIIIGHHA Y GD (SEQ ID NO: 2).

According to some embodiments, the method comprises administering to a subject in need thereof a vaccine composition comprising at least two different recombinant HCMV vectors, each comprising a heterologous polynucleotide encoding a different GBM peptide antigen, fused to a polynucleotide encoding viral IE1 protein or fragment thereof.

According to some embodiments, the vaccine composition comprises a recombinant CMV population expressing EGFRvIII peptide and a recombinant CMV population expressing IDH1 peptide.

According to some embodiments the IDH1 peptide comprises a sequence selected from the group consisting of S GW VKPIIIGHH A Y G (SEQ ID NO: 8) and KPIIIGHHA YGD (SEQ ID NO: 2).

According to yet other embodiments, the method comprises separate administration of one composition comprising a recombinant CMV expressing EGFRvIII peptide and another composition comprising a recombinant CMV expressing IDH1 peptide.

According to some embodiments, the method comprises administration of the pharmaceutical composition via a route selected from the group consisting of: intramuscularly, subcutaneously, intradermally, intravenously, intraperitoneally, intraventricularly, intracisternally, topically, orally and any combination thereof. Each possibility represents a separate embodiment of the invention.

According to some embodiments, the method comprises administration of the pharmaceutical composition via a route selected from the group consisting of: subcutaneous, intravenous and intramuscular.

According to some embodiments, the subject is human. The methods of the present invention are preferably beneficial for treatment of subjects having a mutation specific to or frequent in glioblastoma.

According to some embodiments, the method comprises administering to a subpopulation of GBM subjects expressing the constitutively activated mutant EGFRvIII, a recombinant ULBP2-HCMV comprising an EGFRvIII peptide fused to an IE1 protein or fragment thereof.

According to some embodiments, the method comprises administering to a subpopulation of GBM subjects expressing a mutated IDH1, a recombinant ULBP2-HCMV comprising a polynucleotide encoding for an IDH1 peptide fused to an IE1 protein or fragment thereof.

Treatment or prevention using methods according to the present invention may result in at least one improvement including but are not limited to: increasing the duration of survival of a subject having glioblastoma, increasing the progression free survival of a subject having glioblastoma, increasing the duration of response of a subject having glioblastoma, preventing or inhibiting development of metastasis in a patient having glioblastoma.

According to some embodiment, the method further comprises treating the subject with an additional anticancer therapy. According some embodiments, the anticancer therapy is selected from surgery, radiotherapy, biological therapy or immunological therapy and/or chemotherapy.

The present invention also provides a composition comprising at least one recombinant HCMV expressing a polynucleotide encoding human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one GBM peptide antigen, for use in preventing or treating glioblastoma.

According to some embodiments, the composition for use in preventing or treating glioblastoma is a vaccine composition.

According to some embodiments, the vaccine composition for use in preventing or treating glioblastoma comprises at least one of: an EGFRvIII peptide, an IDH1 peptide, or a combination thereof.

According to some embodiments, the vaccine composition for use in preventing or treating glioblastoma comprises at least one of: an EGFRvIII peptide consisting of the sequence: LEEKKGNYV (SEQ ID NO: 7); an IDH1 peptide consisting of the sequence: S GW VKPIIIGHH A Y G (SEQ ID NO: 8), or a combination thereof. According to some embodiments, the vaccine composition for use in preventing or treating glioblastoma comprises at least one of: an EGFRvIII peptide consisting of the sequence: FEEKKGNYVVTDHC (SEQ ID NO: 1); an IDH1 peptide consisting of the sequence: KPIIIGHHAYGD (SEQ ID NO: 2), or a combination thereof.

Other objects, features and advantages of the present invention will become clear from the following description and drawings.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Schematic representation of integrated HCMV ULBP2 based vaccine. Vaccine 1 represents HCMV ULBP2 EGFRvIII and Vaccine 2 represents HCMV ULBP2 IDH1.

Figures 2A-2B. Experimental setup (2A) and results (2B) of the first step in the construction of recombinant viruses HCMV ULBP2 EGFRvIII and HCMV ULBP2 IDH1.

Figure 3. Targeting of epitope insertion cassettes leads to homologous recombination and integration into the target loci in the 3’ end of the IE1 coding sequence within the HCMV- ULBP2 genome. Flanking homologies used for targeting of the insertion cassette into the 3’ end of IE1 coding sequence are indicated with dotted lines.

Figure 4. Identification of clones harboring homologously integrated epitope cassettes. Five different clones of HCMV UFBP2 BAC (Bacteria Artificial Chromosome) transformed either with EGFR or IDH1 epitope cassette were analyzed. The figure shows two successfully transformed clones of each epitope which were used for the following procedure.

Figure 5. Removal of marker and plasmid sequences from the IE1 gene in the final step of recombinant virus construction.

Figure 6. PCR genotyping of recombinant HCMV UFBP2 BACs expressing antigenic epitopes IDH1 or EGFRvIII. Predicted size of fragments was: WT 268 bp, epitope EGFRvIII -i-Kan 1333 bp, epitope IDH1 -i-Kan 1356 bp, epitope EGFRvIII 295 bp, epitope IDH1 313 bp.

Figure 7. Restriction analysis of recombinant IDH1 and EGFRvIII BACs compared with wildtype HCMV UFBP2 BAC (WT).

Figure 8. Sequencing results of the modified region within the IE1 gene of HCMV UFBP2 encoding antigenic determinants.

Figure 9. Active CMV infection, characterized by CMV inclusions with cytopathic effect, in infected Human foreskin fibroblast (HFF) cells compared to uninfected HFF cells. No differences in growth rate were observed amongst the different viruses (HCMV ULBP2 EGFRvIII, HCMV ULBP2 IDH1 or HCMV ULBP2 WT).

Figure 10. Identification of the expression of the cloned IDH1 and EGFRvIII epitopes at protein level by western blot analysis. Blot performed with polyclonal Ab (mouse anti IDH1 sera 1:250 and mouse anti EGFRvIII sera 1:750), and an antibody specific for HCMV IE1 protein as a positive control for infection and protein size orientation.

Figure 11. Schematic overview of experimental setup including tumor cells intracranial injection, humanization and vaccination, of an in-vivo study analyzing GBM xenografts in NSG humanized mice after vaccination with monocyte-derived dendritic cells (moDCs) infected with recombinant HCMV-ULBP2 expressing EGFRvIII and HCMV- ULBP2 expressing IDH1.

Figure 12A. Flow cytometry analysis of monocyte-derived dendritic cells (moDCs) differentiated from CD 14+ fraction of patient-derived PBMCs and infected with HCMV- UFBP2-EGFRvIII, HCMV-UFBP2-IDH1 or none.

Figure 12B. Humanization of mice as analyzed by flow cytometry. Cells were stained for expression of the mouse CD45 and human CD45. Humanization was calculated as a number of human cells (hCD45-positive) per ml of blood.

Figures 13A-13B. Histological staining for anti-human-CD45, indicating leukocyte infiltration in GBM xenografts, of brain sections (thickness of 5 pm), in mice receiving HCMV -UFBP2-EGFRvIII and HCMV -UFB P2 -IDH 1 infected vs. non infected (mock) DCs. The immuno staining is indicated by photos of cells from the two groups (Figure 13 A) and a graph showing CD45 stained Feukocyte cells (FCA+) per tumor area (Figure 13B).

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides recombinant human cytomegalovirus (HCMV) vectors expressing polynucleotide sequences encoding i. human ULBP2 protein and ii. a viral IE1 protein or fragment thereof fused to at least one GBM peptide antigen.

It is herein disclosed that the combination of specific tumor antigens and HCMV ULBP2 has improved properties over other combinations of tumor antigens and and carrier systems, in eliciting T-cell response against glioblastoma cells.

Recent research shows that a subpopulation of HCMV infected tumor cells exists in glioblastoma tumor cells (Cobbs, 2013 Curr Opin Oncol. 25(6):682-8). CMV infected tumor cells have higher malignancy properties and contribute to invasiveness of GBM. Patients with low CMV antigen expression have significantly higher life expectancy (Rahbar et ah, 2013 J Clin Virol 57(1):36-4210). Presence of HCMV antigens in GBM cells thus offer unique opportunity to activate already existing antiviral T cell response (Schuessler et al.,

2014 Cancer Res. 74(13):3466-76). Results showed that autologous CMV specific T cells can eliminate tumor cells in vitro (Nair et al., 2014 Clin Cancer Res 20(10):2684-9410).

The HCMV-ULBP2 vaccines of the present invention, being HCMV specific and tumor specific, lead to effective and robust T cell activation/maturation with significant anti tumor response, regardless the amount of HCMV antigen expression on tumor cells.

The results of the present invention indicate that ULBP2-HCMV represents a powerful vaccine vector employed, together with specific peptide antigens, to combat various tumors, in particular gliomas.

The present invention provides recombinant HCMV immunogenic preparations that are able to stimulate a robust cellular immune response to specific tumor antigens inserted into the HCMV genome by fusion to the virus IE 1 -encoding polypeptide. In a specific embodiment, the present invention provides a recombinant HCMV immunogenic preparation that is able to stimulate a T-cell response simultaneously against viral and tumor antigens. The present invention provides for the first time a vaccine comprising a recombinant HCMV expressing a human ULBP2, a viral IE1 and at least one GBM peptide antigen fused to a viral IE1 polypeptide. The present invention further provides for the first time a vaccine comprising a recombinant HCMV expressing a human ULBP2 and the two GBM peptide antigens EGFRvIII and IDH1. The present invention relates to recombinant HCMV and DNA engineered to express IE1 polypeptide or fragment thereof fused to at least one tumor peptide antigen present in GBM, and a human ULBP2 stimulatory protein.

The HCMV that is used according to the present invention can be a wild-type strain, a clinical strain, an attenuated strain, and/or a genetically engineered strain. According to some embodiments, the HCMV of the present invention is a recombinant attenuated strain.

In accordance with the present invention, the recombinant virus of the invention is a HCMV that further comprises one or more heterologous nucleotide sequences, including for example, polynucleotide sequences encoding ULBP2 protein and antigenic GBM peptides.

The recombinant viruses may be used to prepare immunogenic preparations (e.g., vaccines) suitable for administration to humans or animals. For example, the recombinant viruses of the invention may be used in vaccine formulations to confer protection against intracellular pathogens or viral infections or to treat a tumor related disorder, in particular glioblastoma. In one embodiment, the present invention relates to recombinant HCMV constructs that are engineered to express one, two, three or more heterologous polypeptides or peptides, such as stimulatory and/or antigenic determinant.

It will be appreciated that it is not necessary (or always desirable) to express the entire polypeptide encoded by, for example, a tumor related protein and typically, one or more immunogenic fragments of the polypeptides are expressed. When fragments are used, suitable immunogenic sequences are known or can be determined using routine art-known methods. Typically, the expressed immunogenic polypeptide is at least 6 amino acids in length, more often at least about 8, and sometimes at least about 10, at least about 20, at least about 50 residues, or even full-length.

In accordance with the invention, a recombinant virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequences have been added to the genome.

The present invention also provides vaccines and immunogenic preparations comprising recombinant HCMV expressing more than one heterologous antigenic sequence. These immunogenic compositions may be administered in the form of one recombinant HCMV expressing each heterologous antigenic sequence or two or more recombinant HCMV each encoding different heterologous antigenic sequences. In one embodiment, the immunogenic preparation of the invention comprises recombinant HCMV expressing one, two or three heterologous polypeptides, wherein the heterologous polypeptides can be encoded by polynucleotide sequences derived from different tumor antigens.

In certain embodiments, the invention provides a vaccine formulation comprising at least one recombinant virus of the invention and a pharmaceutically acceptable excipient. In specific embodiments, the vaccine formulation of the invention is used to modulate the immune response of a subject, such as a human, a primate, a horse, a cow, a sheep, a pig, a goat, a dog, a cat, a rodent or a subject of avian species. In a more specific embodiment, the vaccine is used to modulate the immune response of a human. In another embodiment, the present invention relates to vaccine formulations for veterinary uses wherein the recombinant CMV would be derived from the appropriate species. The vaccine preparation of the invention can be administered alone or in combination with other vaccines or other prophylactic or therapeutic agents.

Human ULBP2 (UniProtKB - Q9BZM5, also denoted N2DL2 or RAET1H), is a gene encoding NKG2D ligand 2 (also termed N2DL-2 or NKG2DL2). NKG2D ligand 2 is a ligand for the KLRK1/NKG2D receptor, together with at least ULBP1 and ULBP3. ULBPs activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. Binding of ULBPs ligands to KLRK1/NKG2D induces calcium mobilization and activation of the JAK2, STAT5, ERK and PI3K kinase/Akt signal transduction pathway.

IE1 (UniProtKB - B8Y6N6), is a human CMV regulatory protein also termed Immediate early transcriptional regulator.

The recombinant viruses of the invention can be further genetically engineered to exhibit an attenuated phenotype. In particular, the recombinant viruses of the invention exhibit an attenuated phenotype in a subject to which the virus is administered. Attenuation can be achieved by any method known to a skilled artisan (for example U.S. Patent 3,959,466). Without being bound by any particular theory, the attenuated phenotype of the recombinant virus can be created, for example, by using a virus that naturally does not replicate well in an intended host, by reduced replication of the viral genome, by reduced ability of the virus to infect a host cell, by reduced ability of the viral proteins to assemble to an infectious viral particle relative to the wild type strain of the virus, or by modification of the immune response to the virus. The attenuated phenotypes of a recombinant virus of the invention can be tested by any method known to the artisan. A candidate virus can, for example, be tested for its ability to infect a host or for the rate of replication in a cell culture system.

In certain embodiments, the attenuated virus of the invention is capable of infecting a host, and replicating in the host such that infectious viral particles are produced. In comparison to the wild type strain, however, the attenuated strain grows to lower titers or grows more slowly. Any technique known to the skilled artisan can be used to determine the growth curve of the attenuated virus and compare it to the growth curve of the wild type virus.

In certain embodiments, the ability of the attenuated mammalian virus to infect a host is reduced compared to the ability of the wild type virus to infect the same host. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a host.

Vaccine formulation and administration

When used for vaccination, vaccination with the compositions of the invention may be prophylactic vaccination (wherein the vaccine is administered prior to exposure, or anticipated exposure, to the target antigen, e.g., to a subject susceptible to or otherwise at risk of exposure to a disease) and/or immunotherapeutic vaccination (wherein the vaccine is administered after exposure to the target antigen to accelerate or enhance the immune response).

The vaccine preparations of the invention can be administered in a variety of ways, including orally, by injection (e.g., intradermal, subcutaneous, intramuscular, intraperitoneal and the like), by inhalation, by topical administration, by suppository, using a transdermal patch. According to some embodiments the vaccines are administered via subcutaneous, intravenous or intramuscular routes.

When administration is by injection, the compositions may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. The solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

In some instances, multiple preparations of recombinant viruses (e.g., each encoding and expressing a different antigen or immunogenic polypeptide) can be administered.

Typically, an amount of the viral composition will be administered to the subject that is sufficient to immunize an animal against an antigen (i.e., an "immunologically effective dose" or a "therapeutically effective dose"). The effective dose can be formulated in animal models to achieve an induction of an immune response using techniques that are well known in the art. Exemplary doses are 10 to 10⁷ pfu per dose, e.g., 10 to 10⁶ or 10³ to 10⁶ pfu. One having ordinary skill in the art can readily optimize administration to humans (e.g., based on animal data and clinical studies).

According to some embodiment, the vaccine comprises antigen presenting cells comprising the HCMV described herein. According to certain embodiments, the antigen presenting cells are dendritic cells.

A population of antigen presenting cells, optionally autologous cells, infected with recombinant HCMV expressing a polynucleotide encoding human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one GBM peptide antigen, is provided according to additional aspect of the invention.

The attenuated recombinant viral vectors and antigen presenting cells comprising them of the present invention as active ingredients are dissolved, dispersed or admixed in an excipient that is pharmaceutically acceptable and compatible with the active ingredient as is well known. Suitable excipients are, for example, water, saline, phosphate buffered saline (PBS), dextrose, glycerol, ethanol, or the like and combinations thereof. Other suitable carriers are well known to those skilled in the art. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, and/or pH buffering agents.

In various embodiments, the compositions include carriers and excipients (including but not limited to buffers, carbohydrates, mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, bacteriostats, chelating agents, suspending agents, thickening agents and/or preservatives), other pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as buffering agents, tonicity adjusting agents, wetting agents and the like, and/or a conventional adjuvant (e.g., Freund's Incomplete Adjuvant, Freund's Complete Adjuvant, Merck Adjuvant 65, AS-2, alum, aluminum phosphate, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). It will be recognized that, while any suitable carrier known to those of ordinary skill in the art may be employed to administer the compositions, the type of carrier will vary depending on the mode of administration.

Live attenuated HCMV-ULBP2 vaccines of the present invention, can infect variety of cells including antigen presenting cells and therefore, according to some embodiments classical adjuvants are not required. However, in some instances, vaccine compositions according to the invention may contain an adjuvant.

According to several embodiments, the vaccine compositions according to the present invention may contain one or more adjuvants, characterized in that it is present as a solution or emulsion which is substantially free from inorganic salt ions, wherein said solution or emulsion contains one or more water soluble or water-emulsifiable substances which is capable of making the vaccine isotonic or hypotonic. The water soluble or water-emulsifiable substances may be, for example, selected from the group consisting of: maltose; fructose; galactose; saccharose; sugar alcohol; lipid; and combinations thereof.

Compounds may also be encapsulated within liposomes using well known technology.

In pharmaceutical and medicament formulations, the active agent is preferably utilized together with one or more pharmaceutically acceptable carrier(s) and optionally any other therapeutic ingredients. The carrier(s) must be pharmaceutically acceptable in the sense of being compatible with the other ingredients of the formulation and not unduly deleterious to the recipient thereof. The active agent is provided in an amount effective to achieve the desired pharmacological effect, as described above, and in a quantity appropriate to achieve the desired exposure.

It will be apparent to those of ordinary skill in the art that the therapeutically effective amount of the pharmaceutical compositions according to the present invention will depend, inter alia upon the administration schedule, the unit dose of composition administered, whether the composition is administered in combination with other therapeutic agents, the immune status and health of the patient, the therapeutic activity of the composition administered, its persistence in the blood circulation, and the judgment of the treating physician.

Suitable dosing regimens of combination chemotherapies are known in the art and described in, for example, Douillard et ah, 2000, Lancet 355, 1041-7.

As used herein the term "therapeutically effective amount" refers to an amount of a drug effective to treat a disease or disorder in a mammal whether directly or through activation of an immune response. In the case of cancer, the therapeutically effective amount of the drug may reduce the number of cancer cells; reduce the tumor size; inhibit (i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the disorder. To the extent the drug may prevent growth and/or kill existing cancer cells, it may be cytostatic and/or cytotoxic. For cancer therapy, efficacy in vivo can, for example, be measured by assessing the duration of survival, time to disease progression (TTP), the response rates (RR), duration of response, and/or quality of life.

The term "treatment" as used herein refers to both therapeutic treatment and prophylactic or preventative measures.

The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia.

According to some embodiments, the method of preventing or treating cancer comprises administering a pharmaceutical composition as part of a treatment regimen comprising administration of at least one additional anti-cancer agent.

According to some embodiments, the anti-cancer agent is selected from the group consisting of an antimetabolite, a mitotic inhibitor, a taxane, a topoisomerase inhibitor, a topoisomerase II inhibitor, an asparaginase, an alkylating agent, an antitumor antibiotic, and combinations thereof. Each possibility represents a separate embodiment of the invention. As use herein, the terms“administration of’ and/or“administering” a composition should be understood to mean providing a compound of the invention to a subject in need of treatment. The terms also refer to providing a compound of the invention to a subject suspected of having cancer.

Administration of a substance, a compound or an agent to a subject can be carried out using one of a variety of methods known to those skilled in the art. For example, a compound or an agent can be administered enterally or parenterally. Enterally refers to administration via the gastrointestinal tract including per os, sublingually or rectally. Parenteral administration includes administration intravenously, intradermally, intramuscularly, intraperitoneally, subcutaneously, ocularly, sublingually, intranasally, by inhalation, intraspinally, intracerebrally, and transdermally (by absorption, e.g., through a skin duct). A compound or agent can also appropriately be introduced by rechargeable or biodegradable polymeric devices or other devices, e.g., patches and pumps, or formulations, which provide for the extended, slow or controlled release of the compound or agent. Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods. In some embodiments, the administration includes both direct administration, including self-administration, and indirect administration, including the act of prescribing a drug. For example, as used herein, a physician who instructs a patient to self-administer a drug, or to have the drug administered by another and/or who provides a patient with a prescription for a drug is administering the drug to the patient.

In some embodiments, the vaccine is formulated for parenteral administration, for example intramuscular or subcutaneous administration. According to yet another embodiment the administration is intradermal.

Liposomes provide another delivery system for antigen delivery and presentation. Liposomes are bilayered vesicles composed of phospholipids and other sterols surrounding a typically aqueous center where antigens or other products can be encapsulated. The liposome structure is highly versatile with many types range in nanometer to micrometer sizes, from about 25 nm to about 500 pm. Liposomes have been found to be effective in delivering therapeutic agents to dermal and mucosal surfaces. Liposomes can be further modified for targeted delivery by for example, altered to encapsulate viruses. The average survival time or half-life of the intact liposome structure can be extended with the inclusion of certain polymers, for example polyethylene glycol, allowing for prolonged release in vivo. Liposomes may be unilamellar or multilamellar. Microparticles and nanoparticles employ small biodegradable spheres which act as depots for vaccine delivery and can be also used to deliver the vaccine formulations of the present invention. The major advantage that polymer microspheres possess over other depot- effecting adjuvants is that they are extremely safe and have been approved by the Food and Drug Administration in the US for use in human medicine as suitable sutures and for use as a biodegradable drug delivery system (Langer et ah, 1990 Science, 249(4976): 1527-33). The rates of copolymer hydrolysis are very well characterized, which in turn allows for the manufacture of microparticles with sustained antigen release over prolonged periods of time (O’Hagen et al., 1993 Vaccine, l l(9):965-9). Parenteral administration of microparticles elicits long-lasting immunity, especially if they incorporate prolonged release characteristics. The rate of release can be modulated by the mixture of polymers and their relative molecular weights, which will hydrolyze over varying periods of time. Without wishing to be bound to theory, the formulation of different sized particles (1 pm to 200 pm) may also contribute to long-lasting immunological responses since large particles must be broken down into smaller particles before being available for macrophage uptake. In this manner a single- injection vaccine could be developed by integrating various particle sizes, thereby prolonging antigen presentation and greatly benefiting livestock producers.

1 herapeutic vaccination or immunotherapy

Several options exist in cancer immunotherapies. The prevalent one is the use of repeated boost injections of antibodies directed against tumor antigens or proteins that play a major role in tumor promotion. Examples of such treatments are the use of anti-VEGF (Avastin™) or anti-Her2/neu (Herceptin™). This passive immunization strategy employs the effector functions of antibodies that may target tumor cells and tag them for destruction (e.g. complement, macrophages, ADCC), or inhibit protein activity (e.g. blocking of angiogenesis). However, it circumvents the full activation of the immune response and the generation of immune memory.

In contrast, active vaccination strategies rely on presentation of the antigenic determinant to T cells, activating both the innate and adaptive arms of the immune response, and generating immune memory. Today, vaccinations against tumor antigens use injections of tumor cell lysates, genetically modified tumor cells, antigen binding cells, such as dendritic cells, loaded with the antigen, purified proteins or other macromolecules, or peptide-based vaccinations. Most such vaccination strategies also employ an adjuvant to enhance the potency of the immune response. Vaccines are most commonly used as prophylactic agents, to prevent or dampen the deleterious effect of a future infection with the desire to maintain prolonged protection. However, vaccines may also be used therapeutically, to treat an existing disease, and since they evoke an immune response, they may also provide lasting protection. Thus, the term therapeutic vaccination was coined. Several examples of cancer therapeutic vaccination have been published (Gonzalez et al., 2011 Curr. Cancer Drug targets, 11(1): 103-10; Van Poppel et al., 2009 Eur. Urol., 55(6): 1333-42; Berge et al., 2010 Cancer Immunol. Immunother., 59(8): 1285-94). Therapeutic vaccination may prevent the progression of an existing disease, or may reverse the disease.

Therapeutic vaccination and passive immunization may be combined to a single treatment regimen.

The term "subject" includes humans and animals afflicted with cancer and human or animals amenable to therapy with the pharmaceutical compositions described herein. According to additional embodiments, the subject is a subject suspected of having cancer.

The term "about" means that an acceptable error range, e.g., up to 5% or 10%, for the particular value should be assumed.

The tumor antigens of the invention include analogs of EGFRVIII or IDH1 tumor peptides.

The term“analog” indicates a molecule which has the amino acid sequence according to the invention except for one or more amino acid changes. The design of appropriate "analogs" may be computer assisted. Analogs of the antigenic peptides are included in the invention as long as they remain antigenic and therapeutically active.

Conservative substitutions of amino acids as known to those skilled in the art are within the scope of the present invention. Conservative amino acid substitutions include replacement of one amino acid with another having the same type of functional group or side chain, e.g., aliphatic, aromatic, positively charged, negatively charged. These substitutions may enhance oral bioavailability, penetration into the islets, targeting to specific beta cell populations, immunogenicity, and the like. One of skill will recognize that individual substitutions, deletions or additions to a peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another:

1) Alanine (A), Serine (S), Threonine (T);

2) Aspartic acid (D), Glutamic acid (E);

3) Asparagine (N), Glutamine (Q);

4) Arginine (R), Lysine (K);

5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and

6) Phenylalanine (L), Tyrosine (Y), Tryptophan (W).

The following examples are intended to illustrate how to make and use the compounds and methods of this invention and are in no way to be construed as a limitation. Although the invention will now be described in conjunction with specific embodiments thereof, it is evident that many modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such modifications and variations that fall within the spirit and broad scope of the appended claims.

EXAMPLES

Example 1: Generation of vaccines

Exemplary vaccine constructs were designed expressing the tumor antigenic peptides EGLRvIII and/or IDH1 as fused to the HCMV IE1 gene. The viral protein IE1 is an immunodominant T cell epitope that has strong translation and is essential for virus growth.

The vector ULBP2-HCMV BAC, described in US 20130156808, was used as a starting vector. Ligure 1 provides a schematic illustration of the constructs now produced using this basic construct. The tumor specific peptides were inserted at the C terminus of IE1 protein.

The epitopes were inserted into the HCMV IE1 gene by PCR amplification and integration using standard methods. DNA sequences encoding the epitopes EGLRvIII and IDH1 were incorporated into the following cloning primers:

EGFRvIII IE1 Forward:

CTGGAGGCAAGAGCACCCACCCTATGGTGACTAGAAGCAAGGCTGACCAGCTGG AGG A A A AG A A AGGT A ATT AT GT G AGG AT G ACG ACG AT A AGT AG (SEQ ID NO: 3). EGFRvIII IE1 Reversed: T AGT G ACGT GGG AT CC AT A AC AGT A ACT GAT AT AT AC AC AC A AT AGTTT AC AC AT AATTACCTTTCTTTTCCTCCAGCTGGTCAGCCTTGCAACCAATTAACCAATTCTG

(SEQ ID NO: 4).

IDH1 IE1 Forward:

CTGGAGGCAAGAGCACCCACCCTATGGTGACTAGAAGCAAGGCTGACCAGAGTG GAT GGGT A A A ACCT AT CAT CAT AGGT CAT CAT GCTT AT GGG AGG AT G ACG ACG A T A AGT AG (SEQ ID NO: 5).

IDH1 IE1 Reversed:

T AGT G ACGT GGG AT CC AT A AC AGT A ACT GAT AT AT AC AC AC A AT AGTTT ACCC AT A AGC AT GAT G ACCT AT GAT GAT AGGTTTT ACCC AT CC ACT C A ACC A ATT A ACC A A TTCTG (SEQ ID NO: 6).

The amino acid sequences of some exemplary epitopes according to the present invention are:

EGFRvIII: LEEKKGNYV (SEQ ID NO: 7) or LEEKKGNYVVTDHC (SEQ ID NO:

1); and

IDH1 : S GW VKPIIIGHH A Y G (SEQ ID NO: 8) or KPIIIGHHA Y GD (SEQ ID NO:

2).

As shown in Figure 2 A, insertions of EGFRvIII epitope (EGFR) and mutant IDH1 epitope (IDHlmut) were amplified by PCR, using the kanamycin resistance selection marker (KAN resistance). As shown in Figure 2B, the fragments of 1162 bp for EGFR and 1185bp for IDH1, were successfully inserted.

Following amplification, PCR products were purified from agarose gel and used to transform E. coli harboring HCMV ULBP2 genome within bacterial artificial chromosome (Figure 3). Targeting of epitope insertion cassettes leads to homologous recombination and their integration into the target loci in the 3’ end of IE1 gene within the HCMV ULBP2 vector. Expected fragment sizes were 268 bp for PCR fragment from untransformed HCMV ULBP2 BAC and 1333 bp (EGFR) or 1356 bp (IDH1) for PCR fragment from HCMV ULBP2 BAC transformed with epitope cassettes containing selection marker. Out of five clones of HCMV ULBP2 BAC transformed either with EGFR or IDH1 epitope cassette that were analyzed, two successfully transformed clones of each epitope were found (Figure 4).

In the final construction step (Figure 5), a removal of the marker“KAN resistance”, used for the selection of successfully integrated epitope sequences, was performed. As described in Figure 6, a removal of the marker resulted in the desired epitope sequence in the 3’ end of IE1 gene, without any additional leftover or missing sequences. As PCR analysis explored only the epitope cassette integration site of HCMV ULBP2 BAC, further analysis was done to verify that the rest of the BAC genome remained intact after epitope insertion. Using the restriction enzyme BamHI, a restriction analysis of IDH1 BAC and EGFRvIII was performed. The results demonstrated in Figure 7 indicate that restriction fragments of the wildtype and mutant vectors look the same.

Since PCR and restriction analysis suggested successful insertion of the desired epitope sequence within the IE1 gene of HCMV UFBP2, a sequencing analysis was performed to the modified region. The goal of the analysis was to ensure the cloned epitopes have successfully merged and no unwanted mutations have occurred during the whole multi- step procedure. The modified region was sequenced in one clone of EGFRvIII BAC and two clones of IDH1 BAC. As shown in Figure 8, the sequencing results confirmed successful insertion of the desired epitope sequence in all analyzed clones.

Example 2: Production of recombinant viruses in cells

Following successful restriction and sequencing analyses of the vectors carrying the tumor epitopes, production of the recombinant viruses was performed by transfecting these clones into Human foreskin fibroblast (HFF) cells according to methods known in the art, for example those described in: Methods in molecular medicine: Cytomegalovirus Protocols, ed. John Sinclair, 2000, or Krishna et ah, 2017 Nat Commun. 2;8: 14321. HFF cells were transfected by electroporation and after a few days the cells were characterized with an active CMV infection comprising with both CMV inclusions and cytopathic effect (Figure 9).

No major differences in growth rate of HCMV UFBP2 EGFRvIII or HCMV UFBP2 IDH1 compared with wild type (WT HCMV UFBP2) virus were detected.

Western blot analysis was performed in order to show that tumor specific peptides were translated into protein sequences following insertion of their encoding genes into the CMV vector and transfection into HFF cells. HFF cell protein lysates were used for the analysis. Polyclonal Ab's against the cloned peptide epitopes IDH1 and EGFRvIII (mouse anti IDH1 sera 1:250 and mouse anti EGFRvIII sera 1:750) were used to identify the expression of the epitopes at protein level and an antibody specific for HCMV IE1 protein was used as a positive control for infection and protein size orientation. The results demonstrated in Figure 10 confirm the epitope insertion. The data indicates that there is simultaneous peptide expression with IE1 protein and that this intervention did not reduce native IE1 function. Example 3: Antitumor effect of recombinant viruses in mouse model

The efficacy of the recombinant vectors of the invention is determined in vivo in mouse model. NOD scid gamma (NSG) mice are adoptively transferred with PBL isolated from glioblastoma multiforme (GBM)-bearing patients and grafted intracranially with autologous GBM cells. The mice are then vaccinated with HCMV/ULBP2 expressing EGFRvIII and/or IDH1 or left unvaccinated. The immune response to virus and tumor antigens in vaccinated mice is monitored, together with tumor growth.

Prophylactic effect is tested as follows: GBM samples from patients are processed in order to obtain single-cell suspensions that are later used for establishment of cancer stem cells. GBM cells are thus either inoculated s.c. into NSG mice or maintained in vitro in culture conditions favoring development of so-called neurospheres. Highly proliferating cells (cancer stem cells) selected either by in vitro or in vivo propagation are used for intracranial engraftment into different NSG mice groups: mice adoptively transferred with peripheral blood mononuclear cells (PBMCs)-of GMB-bearing patients (as described below), mice vaccinated with the recombinant vectors of the invention and control unvaccinated mice.

PBMCs are isolated from whole blood collected from GBM-bearing patients. After isolation, part of the PBMCs are used for monocyte isolation using CD 14 magnetic-activated cell sorting. CD 14+ cells are in vitro differentiated into monocyte-derived dendritic cells (moDCs) by cultivating them in the presence of GM-CSF and IF-4. Remaining PBMCs and CD 14 negative fraction are adoptively transferred into NSG mice.

moDCs used for vaccination of mice (s.c. inoculation of infected moDCs) are infected with HCMV/UFBP2 expressing EGFRvIII and IDH1 or left uninfected. Some of the mice remain non-vaccinated as a control.

At the experimental endpoint, human immune system reconstitution efficiency and immune response to virus and tumor antigens in vaccinated mice are analyzed. Brains of mice are collected, and tumor size is measured along with histopathological analysis.

The therapeutic effect is analyzed for the same procedure but in a different order. NSG mice are first engrafted intracranially with GBM cancer stem cells, followed by adoptive transfer of human PBMCs and moDC vaccination.

Example 4: Analysis of GBM xenografts in NSG humanized mice after vaccination with recombinant HCMV-ULBP2 vectors expressing EGFRvIII and IDH1

The efficacy of the recombinant HCMV-UFBP2 vectors expressing EGFRvIII and/or IDH1 was tested in-vivo in NSG humanized mice bearing human GBM xenografts. Materials and methods:

Isolation of tumor cells from patient derived glioblastoma multiforme (GBM)

Tumor tissues from confirmed glioblastoma multiforme cases was received in the DMEM/F12 medium supplemented with penicillin/streptomycin and fungizone shortly after surgical resection. Processing of the tumor tissue was performed as previously described by Hasselbach et ah, J Vis Exp. 2014 Jan 7;(83):e51088. Shortly, upon arrival, tissue was weighed, minced with a sterile surgical scalpel, divided into 0.5 g pieces, and transferred to a 15 ml tube. To disassociate tissue in single-cell suspension, tissue was incubated at 37°C with moderate shaking in enzymatic tissue dissociation solution (0.025% Trypsin-EDTA (Lonza), lmg/ml collagenase D (Roche)) for 30 min. Digestion was stopped by adding two volumes of stop solution (soybean trypsin inhibitor, DNase I 250 U/ml) and cells were pelleted by centrifugation at 500 x g for 5 minutes. Subsequently, digested tissue was washed 2 times in 5 ml DMEM/F12 and strained through a mesh to remove larger pieces of debris. If the cell suspension still contained visible cell debris, it was additionally purified by centrifugation on 22% Percoll (GE Healthcare) at 600 x g for 10 min with cells pelleting on the bottom of the tube (PMID: 29516026). After determination of cell number, 2 x 10⁶ isolated tumor cells were cultivated to obtain neurospheres and 1-3 x 10⁶ tumor cells were injected subcutaneously into NSG mice. The rest of the cells was cryopreserved in freezing medium containing 90% FSC/10% DMSO in a gradual freezing container. For long term storage, cells were stored in liquid nitrogen.

Neurospheres formation from glioblastoma tumor cells

To induce neurosphere formation, tumor cells were seeded at a density of 10⁵ cells/ ml in DMEM/F12 medium supplemented with BSA (0.5 mg/ml), G418 (25 pg/ml), Penicillin- Streptomycin (100 U Potassium Penicillin/ 100 pg Streptomycin Sulfate, Lonza), Fungizone (1.25 pg/ml, Pan-Biotech), recombinant human FGF-basic (20 ng/ml, Perpotech), recombinant human EGF (20 ng/ml, Peprotech) and N-2 supplement (lx, Sigma- Aldrich). Fresh medium was replenished every two days by replacing half amount of existing medium with a fresh medium containing a double concentration of cytokines and N-2 supplement. When reached the size of approximately 100 pm in diameter, neurospheres were dissociated into single-cell suspension by incubation in 1 ml of Accutase™ for 10 minutes at 37° C. Afterward, cells were washed, counted, and reseeded in a new cell culture flask. Isolation of PBMCs

Blood containing anticoagulant was diluted 1:1 (V/V) with PBS and layered over 15 ml of Lymphoprep (GA Healthcare). After centrifugation at 400 x g for 20 min without break, the ring containing mononuclear cells was carefully collected and transferred to a 50 ml tube containing 2 volumes of RPMI/10% FCS medium. Cells were centrifuged at 300 x g for 10 min and resuspended in RPMI/10% FCS medium. Enriched CD 14 - positive monocytes were enriched using MACS human CD 14+ isolation kit (Miltenyi) for magnetic separation according to manufacturer instructions. Both monocytes and CD 14 - negative fraction was cryopreserved in freezing medium containing 90% FSC/10% DMSO in the gradual freezing container. For long term storage, cells were stored in liquid nitrogen.

Culture and infection of human foreskin fibroblasts (HFF)

HFF were thawed and seeded in 145/20 mm petri dish in DMEM/5% FCS medium supplemented with Penicillin-Streptomycin (100 U Potassium Penicillin/ 100 pg Streptomycin Sulfate, Lonza), L-Glutamine (IX, Gibco) and recombinant human FGF-basic (0.5 ng/ml). Upon reaching the confluence, HFF were infected with supernatant of HCMV-ULBP-2- EFGRvIII and HCMV-ULBP-2-IDH1 in 5 ml of DMEM/5% FCS medium. Eight to nine days after infection, cells were scraped, infectious supernatants were collected in a 50 ml tube and centrifuged for 10 min at 1000 x g to remove cell debris. Cell-free infectious supernatant was ultracentrifuged at 51000 x g for 1:45 h at 4° C. Subsequently, the viral pellet was collected and layered over 15% (w/v) sucrose cushion and ultracentrifuged at 70000 x g for 1:45 h at 4° C. Viral pellets were resuspended in 200-500 pi of the medium.

Differentiation and infection of monocyte derived dendritic cells (moDCs)

CD14-positive cells sorted from PBMCs were seeded in 6-well plates at density 2xl0⁶ cells/well. Cells were differentiated by cultivation for 5-7 days in RPMI/10% FSC medium supplemented with recombinant human IL-4 (40 ng/ml, Miltenyi) and recombinant human GM-CSF (100 ng/ml, Miltenyi). Fresh cytokines were replenished every second day of the cell culture. Infection of differentiated moDCs was performed in a way that cells were incubated in 1 ml/well of viral supernatant (DMEM 5% FCS L Glu, Pen/strep (HFF culture medium)), containing either HCMV-ULBP2-IDH1 or HCMV-ULBP2-EGFRvIII, for 3-4 hours after which the rest of the cell culture medium was added. Mock infected moDCs were incubated in the same volume of cell culture medium without the virus. Two days after infection, cells were collected by pipetting and trypsinization, washed, resuspended in RPMI/10% FSC medium and counted. A fraction of cells from each group (HCMV-ULBP2- IDH1 infected, HCMV-ULBP2-EGFRvII infected and mock-infected) was analyzed by flow cytometry to determine the percentage of infected cells by intranuclear staining of HCMV IE 1/2 antigen (clone E13, Argene) using Foxp3 intranuclear staining kit (eBio science). Cells used in intravenous vaccination of animals were additionally washed twice and resuspended in PBS in the desired concentration (2-10 x 10⁵ per 0.5 ml).

The cells used in intracranial injection were washed and resuspended in PBS in the desired concentration of 1-3 x 10⁵ in 5 pi. Stereotaxic intracranial injection of primary tumor cells was performed as previously described by Angela M. Pierce and Amy K. Keating (PMID: 25285381). Briefly, animals were anesthetized with Xylapan/Narcetan (xylazine 12 mg/kg, ketamine 100 mg/kg, Vetoquinol), positioned in a stereotaxic frame and a small incision (~8 mm long) through the skin of the head was made to expose the bregma and the desired site of injection. Desired injection site was defined in the frontal region of the cerebral cortex. The coordinates corresponded to a site 2.5 mm lateral (right), 15 mm anterior, and 3.5 mm ventral with respect to the bregma. The handheld rotary drill was used to make a hole in the animal skull at the site of the injection. Navigated by stereotaxic device, 5 mΐ of primary tumor cells were injected at the depth of 3 mm into the mouse brain. The skin above the injection site was sewed and post - operative recovery was monitored every day for one week.

Since growth kinetics of tumor is donor-dependent, apart from experimental groups, an additional group of mice was intracranially injected with the tumor. Once a week, one of those animals was sacrificed and the brain was analyzed by HE staining to follow the appearance of the minimal tumor mass in the brain. After presence of the tumor was observed, mice were subjected to humanization and vaccination.

Humanization and vaccination of mice

CD 14 - negative fraction of patient - derived PBMCs was thawed, washed in RPMI/10% FCS and counted. The 10⁷ of cells in 0.5 ml PBS were injected intravenously to induce reconstruction of the human immune system in NSG mice. One week following humanization, the animals were vaccinated with each of with both HCMV-ULBP2-EGFRvIII - infected DCs and HCMV-ULBP2-IDH1 - infected DCs. In the combined treatment group, the DCs infected with the two clones were injected in 1:1 ratio to vaccinate each animal with an equal number of cells infected with each virus. Untreated control group of mice received an equal number of mock infected moDC. MoDCs were washed, resuspended in PBS and injected intravenously into humanized mice (5 x 10⁵ - 10⁶ cells/mouse).

The animals which underwent the intracranial injection of the tumor cells, humanization and vaccination were closely monitored every second day for the signs of GVHD or neurological symptoms. With the first signs of GVHD pathology or neurological symptoms, animals were sacrificed, and blood and brain were collected. The blood was used to determine the humanization level in each animal while the brain was used for the histological analysis.

Flow cytometry

Humanization of animals at the endpoint of the experiment was analyzed by flow cytometry. After mice had been anesthetized, blood was collected and transferred to the tube containing an anticoagulant (5 mM EDTA). After lysis of erythrocytes, cells were stained for expression of the following antigens using directly conjugated antibodies: viability dye eFluor780 (eBio science), anti-mouse CD45-APC (clone 30-F11, eBioscience), anti-human CD45 PE-Cy7 (clone HI30, eBioscience), anti-human CD3 eFluor700 (clone UCHT1, eBioscience), anti-human CD8 FITC (clone SKI, eBioscience), anti-human CD4 eFluor610 (clone RPA-T-4, eBioscience), anti-human CD14 PE (clone 61D3, eBioscience) and anti human CD19 PerCP-Cy5.5 (clone HIB19, eBioscience). Samples were analyzed on BD FACSAria™ III (BD Biosciences) and humanization was calculated as a percentage of human cells (hCD45-positive) of all hematopoietic cells (hCD45-positive + mCD45-positive).

Following fixation in 4% paraformaldehyde and paraffin embedding, 5 pm thin sections of the brain were processed for HE histological staining and immunohistochemistry. Immuno staining was performed for CD45 (monoclonal mouse anti - human CD45, Clones 2B11 + PD7/26, lot 20045566, Agilent Dako, USA) and CD3 (Monoclonal Mouse Anti- Human CD3, Clone F7.2.38, lot 20043699, Agilent Dako, USA) in order to analyze leukocyte infiltration in the mouse brain containing GBM xenografts. The antigen retrieval for CD45 and CD3 immuno staining was performed in citrate buffer for 20 min at sub - boiling temperature (97°C) and in Tris-EDTA pH 9 for 20 min at sub - boiling temperature (97°C), respectively. Primary antibody staining was performed overnight at 4 °C. Polyclonal goat anti-mouse IgG Horseradish Peroxidase conjugated antibody (Peroxidase AffiniPure Goat Anti-Mouse IgG (H+L), Jackson Immunoresearch, Europe LTD, UK) was used as a secondary antibody for both CD45 and CD3.

Criteria to define tumor cells in Hematoxylin and Eosin (HE) histological sections

To perform morphometric analysis of tumor xenografts in the mouse brain, criteria to distinguish pathological cells from normal cells were established. Tumor cells were distinguished from the healthy cells based on their specific morphology including polymorphic, hyperchromatic nuclei and presence of the pathological mitosis characteristic for tumor cells. Atypical tumor cells were found in both brain parenchyma and ventricles in clusters - like solid formations or individually. The presence of so-called“giant cells” characterized with polymorphic and hyperchromatic nucleolus and abundant cytoplasm were present mostly in the areas plentiful with tumor cells what served as additional criteria to distinguish the tumor from healthy tissue.

The HE staining performed on every second section of the complete mouse brain was used for morphologic analysis of the tumor xenografts. Morphometric analysis included measurement of the extension and the surface (area) of the tumors. The tumor extension referred to the number of slides on which presence of the tumor cells was observed multiplied by the thickness of the HE section (5 pi). Cell B software was used to measure area of tumor, in both parenchyma and ventricles, on every sixth slide of the total brain cuts. Finally, tumor volume was calculated as an average of all analyzed tumor areas (parenchyma and ventricles) multiplied by thickness and the number of analyzed slides. the quantitication ot the CD45 and CD3 positive ceils in the glioblastoma xenograft

To analyze the differences in leukocyte infiltration in the tumor xenograft in mock vaccinated versus HCMV-ULBP2-EGFRvIII and HCMV-ULBP2-IDH1 -vaccinated NSG mice the IHC staining on CD3 and CD45 was performed. The quantification analysis was expressed as a number of CD45 - positive and CD3 - positive cells per area of tumor, as a number of positive cells in the tumor - free brain tissue and as a total number of the CD45 and CD3 in the whole brain (tumor + tumor free- brain tissue). The IHC staining was performed on 3 histological slides per animal, each slide containing 3 sections. Tumor area was measured on each section on 3 slides divided by the number of sections and expressed as average tumor area. The number of positive cells in the tumor was divided with the average area what represented the number of positive cells per tumor area.

Results

NSG mice were injected with the HCMV infected dendritic cells. The infected dendritic cells were analyzed by flow cytometry. As shown in Figure 12A, the percentage of infected DCs for both viruses was comparable (~60 %). Humanization of animals at the endpoint of the experiment was also analyzed by flow cytometry. Cells were stained for expression of the mouse CD45 and human CD45. Humanization was calculated as a number of human cells (hCD45-positive) per ml of blood. There was no statistical difference in humanization between mock and vaccinated groups of animals (Figure 12B).

Next, the effect of vaccination with HCMV-ULBP2-EGFRvIII and HCMY-ULBP2-IDH1 on GBM was tested. NSG mice were injected with tumor cells and later treated with the HCMY vaccines as described in Figure 11. Brain sections (thickness of 5 mhi) were used for HE histological staining and immunohistochemistry (Figure 13 A). Immunostaining performed using anti human CD45 (FCA+) in order to analyze leukocyte infiltration in GBM xenografts. The group of animals that received HCMV-UFBP2-EGFRvIII and HCMV-UFBP2-IDH1 - infected DCs showed significantly higher infiltration of hCD45+ cells (FCA+) in the GBM xenografts compared to animals which received non infected DCs (mock) (Figure 13B).

Claims

1. A recombinant human cytomegalovirus (HCMV) expressing a polynucleotide encoding human ULBP2 protein and a polynucleotide encoding viral IE1 protein or fragment thereof, wherein said polynucleotide encoding IE1 protein or fragment thereof is fused to a heterologous polynucleotide encoding at least one glioma tumor antigen.

2. The recombinant HCMV of claim 1 wherein the tumor antigen is a glioblastoma multiforme (GBM) peptide antigen.

3. The recombinant HCMV of claim 2 wherein the GBM peptide antigen is selected from epidermal growth factor receptor class III variant (EGFRvIII) and isocitrate dehydrogenase 1 (IDH1).

4. The recombinant HCMV of any one of claims 1 to 3 wherein the heterologous polynucleotide encodes at least two GBM peptide antigens.

5. The recombinant HCMV of claim 4 wherein the heterologous polynucleotide encodes at least the GBM peptide antigens EGFRvIII and IDH1.

6. The recombinant HCMV of any one of claims 2 to 5 wherein the GBM peptide antigen comprises an EGFRvIII peptide having a sequence selected from the group consisting of LEEKKGNYV (SEQ ID NO: 7) and LEEKKGNYVVTDHC (SEQ ID NO: 1).

7. The recombinant HCMV any one of claims 2 to 5 wherein the GBM peptide antigen consists of an EGFRvIII sequence selected from the group consisting of LEEKKGNYV (SEQ ID NO: 7) and LEEKKGNYVVTDHC (SEQ ID NO: 1).

8. The recombinant HCMV any one of claims 2 to 5 wherein the GBM peptide antigen comprises an IDH1 peptide having a sequence selected from the group consisting of S GW VKPIIIGHH A Y G (SEQ ID NO: 8) and KPIIIGHHAYGD (SEQ ID NO: 2).

9. The recombinant HCMV any one of claims 2 to 5 wherein the GBM peptide antigen consists of an IDH1 sequence selected from the group consisting of S GW VKPIIIGHH AY G (SEQ ID NO: 8) and KPIIIGHHAYGD (SEQ ID NO: 2).

10. The recombinant HCMV of any one of claims 1 to 9 wherein the heterologous polynucleotide encodes the two GBM peptide antigens: (i) an EGFRvIII peptide comprising the sequence: LEEKKGNYV (SEQ ID NO: 7); and (ii) IDH1 peptide comprising the sequence: S GW VKPIIIGHH A YG (SEQ ID NO: 8).

11. The recombinant HCMV of claim 10 wherein the heterologous polynucleotide encodes the two GBM peptide antigens: (i) an EGFRvIII peptide consisting of the sequence: LEEKKGNYV (SEQ ID NO: 7); and (ii) an IDH1 peptide consisting of the sequence: S GW VKPIIIGHH A Y G (SEQ ID NO: 8).

12. The recombinant HCMV of any one of claims 1 to 9 wherein the heterologous polynucleotide encodes the two GBM peptide antigens: (i) an EGFRvIII peptide comprising the sequence: LEEKKGNYVVTDHC (SEQ ID NO: 1); and (ii) IDH1 peptide comprising the sequence: KPIIIGHHAYGD (SEQ ID NO: 2).

13. The recombinant HCMV of claim 12 wherein the heterologous polynucleotide encodes the two GBM peptide antigens: (i) an EGFRvIII peptide consisting of the sequence: LEEKKGNYVVTDHC (SEQ ID NO: 1); and (ii) an IDH1 peptide consisting of the sequence: KPIIIGHHAYGD (SEQ ID NO: 2).

14. The recombinant HCMV of any one of claims 1 to 13, wherein the encoded IE1 protein or fragment thereof is fused to the encoded glioma tumor antigen.

15. The recombinant HCMV of any one of claims 1 to 14, wherein the encoded glioma tumor antigen is fused to the N terminus of the encoded IE1 protein.

16. The recombinant HCMV of any one of claims 1 to 15, wherein the encoded IE1 protein or fragment thereof is directly fused to the encoded glioma tumor antigen.

17. The recombinant HCMV of any one of claims 1-16 wherein the HCMV is attenuated.

18. An autologous antigen presenting cell comprising at least one recombinant HCMV according to any one of claims 1-16.

19. A pharmaceutical composition comprising at least one recombinant HCMV according to any one of claims 1-17.

20. The pharmaceutical composition of claim 19, comprising at least two different recombinant HCMV.

21. The pharmaceutical composition of claim 20, comprising at least one recombinant HCMV having a heterologous polynucleotide encoding a GBM antigen EGFRvIII peptide; and at least one recombinant HCMV having a heterologous polynucleotide encoding a GBM antigen IDH1 peptide.

22. The pharmaceutical composition of any one of claims 19 to 21 comprising at least one excipient, diluent, adjuvant or carrier.

23. The pharmaceutical composition according to any one of claims 19 to 22 wherein the composition is a vaccine composition.

24. The pharmaceutical composition of claim 23 comprising at least one adjuvant or a delivery system.

25. The pharmaceutical composition of claim 23 or 24 comprising at least two different recombinant HCMV vectors, each comprising a heterologous polynucleotide encoding a different GBM peptide antigen, fused to a polynucleotide encoding viral IE1 protein or fragment thereof.

26. The pharmaceutical composition of claim 25 comprising a recombinant HCMV vector expressing EGFRvIII peptide and a recombinant HCMV vector expressing IDH1 peptide.

27. The pharmaceutical composition of claim 26 wherein the EGFRvIII peptide comprises a sequence selected from the group consisting of LEEKKGNYV (SEQ ID NO: 7) and LEEKKGNYVVTDHC (SEQ ID NO: 1).

28. The pharmaceutical composition of claim 26 wherein the IDH1 peptide comprises a sequence selected from the group consisting of SGWVKPIIIGHHAYG (SEQ ID NO: 8) and KPIIIGHHA Y GD (SEQ ID NO: 2).

29. The pharmaceutical composition of claim 26 wherein the EGFRvIII peptide consists of the sequence: LEEKKGNYV (SEQ ID NO: 7); and the IDH1 peptide consists of the sequence: SGWVKPIIIGHHAYG (SEQ ID NO: 8).

30. The pharmaceutical composition of claim 26 wherein the EGFRvIII peptide consists of the sequence: LEEKKGNYVVTDHC (SEQ ID NO: 1); and the IDH1 peptide consists of the sequence: KPIIIGHHA YGD (SEQ ID NO: 2).

31. A pharmaceutical composition according to any one of claims 19-30 comprising at least one recombinant HCMV expressed in autologous antigen presenting cells.

32. A method of preventing or treating a tumor or cancer comprising administering to a subject in need thereof, a pharmaceutical composition according to any one of claims 19- 31.

33. The method of claim 32, wherein the tumor is glioma.

34. The method of any one of claims 32 and 33, wherein the tumor is glioblastoma multiforme (GBM).

35. The method of claim 34, comprising administering a composition comprising a recombinant HCMV expressing EGFRvIII peptide and a separate composition comprising a recombinant HCMV expressing mutant IDH1 peptide.

36. The method of any one of claims 32-35 comprising administering autologous antigen presenting cells infected with said at least one recombinant HCMV.

37. The method of any one of claims 32-36 wherein the subject is human.

38. The method of any one of claims 32-37 wherein the subject has a mutation specific to or frequent in glioblastoma.

39. The method of claim 38, comprising administering to a subpopulation of GBM subjects expressing the constitutively activated mutant EGFRvIII, a recombinant ULBP2-HCMV, comprising an EGFRvIII peptide fused to an IE1 protein or fragment thereof.

40. The method of claim 38 comprising administering to a subpopulation of GBM subjects expressing a mutated IDH1, a recombinant ULBP2-HCMV, comprising a mutant IDH1 peptide fused to an IE1 protein or fragment thereof.

41. The method of any one of claims 32-40 wherein treatment results in at least one improvement selected from the group consisting of: increasing the duration of survival of a subject having glioblastoma, increasing the progression free survival of a subject having glioblastoma, increasing the duration of response of a subject having glioblastoma, and preventing or inhibiting development of metastasis in a patient having glioblastoma.

42. The method of any one of claims 32-41 further comprising treating the subject with an additional anticancer therapy.

43. The method of claim 42 wherein the anticancer therapy is selected from the group consisting of: surgery, radiotherapy, biological therapy, immunological therapy, chemotherapy and any combination thereof.

44. A composition comprising at least one recombinant HCMV according to any one of claims 1-17, for use in preventing or treating GBM.

45. The composition for use of claim 44 wherein the composition is a vaccine composition.

46. The composition for use of claim 44 or 45 comprising two different HCMV vectors, a recombinant HCMV expressing EGFRvIII peptide and a a recombinant HCMV expressing mutant IDH1 peptide.

47. The composition for use of any one of claims 44 to 46, wherein the recombinant HCMV comprises a heterologous polynucleotide encoding at least one GBM peptide antigens selected from: (i) an EGFRvIII peptide comprising the sequence: LEEKKGNYV (SEQ ID NO: 7); and (ii) IDH1 peptide comprising the sequence: S GW VKPIIIGHH A Y G (SEQ ID NO: 8).

48. The pharmaceutical composition of any one of claims 19 to 31, for use in preventing or treating a tumor or cancer.

49. The pharmaceutical composition for use of claim 48, wherein the tumor is glioma.

50. The pharmaceutical composition for use of claim 49, wherein the glioma is glioblastoma multiforme (GBM).