WO2021013277A2

WO2021013277A2 - Fungus claviceps purpurea with increased ergot alkaloid production, method of preparation thereof, expression cassette

Info

Publication number: WO2021013277A2
Application number: PCT/CZ2020/050049
Authority: WO
Inventors: Michaela KRALOVA; Josef VRABKA; Ivo Frebort
Original assignee: Univerzita Palackeho V Olomouci
Priority date: 2019-07-19
Filing date: 2020-07-07
Publication date: 2021-01-28
Also published as: CZ308933B6; CZ2019474A3; EP3999640A2; WO2021013277A3

Abstract

The present invention provides a fungus Claviceps purpurea with an increased production of ergot alkaloids, comprising in its genome an inserted nucleotide sequence comprising at least one gene selected from the gene TrpE ^S76L which is a gene encoding α-subunit of anthranilate synthase having an S76L mutation, and the gene dmaW which is a gene encoding dimethylallyltryptophan synthetase, wherein the inserted nucleotide sequence of the said at least one gene is under the control of a constitutive promoter. Furthermore, a method of production of such fungus is described, as well as an expression cassette for use in the said method.

Description

Fungus Claviceps purpurea with increased ergot alkaloid production, method of preparation thereof, expression cassette

Field of Art

The invention relates to a genetically modified fungus Claviceps purpurea. This fungus species is widely used in the pharmaceutical industry as a production microorganism for its ability to produce ergot alkaloids. The invention further relates to a method of genetic modification of said fungus.

Background Art

Claviceps purpurea, a sac fungus from the order Hypocreales, is one of the best known producers of ergot alkaloids. These secondary metabolites, derivatives of D-lysergic acid, are widely used in the pharmaceutical industry. The utility of these compounds in medicine is due to their structural similarity to the neurotransmitters adrenaline, noradrenaline and serotonin, and the interaction of ergot alkaloids with receptors for these neurotransmitters. Currently, ergot alkaloids are mainly used in obstetrics, and to treat headache and prolactin-related diseases. Last but not least, ergot alkaloids are used in the treatment of Parkinson's and Alzheimer's disease.

The ergot alkaloid production for the pharmaceutical industry is equally divided between field production and production in submerged cultures. Since the 1960s, C. purpurea strains capable of producing ergot alkaloids in submerged cultures or fungi capable of producing higher amounts of alkaloids in planta have been obtained by UV mutagenesis, chemical mutagenesis using ethyl methanesulfonate (EMS) or N-methyl-N'-nitro-N-nitrosoquanidine (NTG) (Brauer KL, Robbers JE. (1987), Applied and Environmental Microbiology, 53(1), 70-73), nitric acid treatment (Strnadova K., Kybal J. (1976), Planta Medica, 30(8), 395-398) or X-ray or gamma irradiation. C. purpurea strain PI derived from strain 1029 was also obtained in this way (Keller U. (1983), Applied and Environmental Microbiology, 46(3), 580-584). Furthermore, a cluster of ergot alkaloid biosynthetic genes (EAS cluster) was identified for the first time in this C. purpurea strain (Tudzynski P, Fldlter K, Correia T, Arntz C, Grammel N, Keller U. (1999), Molecular and General Genetics, 261(1), 133-141). The EAS cluster contains a total of 13 genes and one pseudogene, wherein the dmaW gene encodes dimethylallyltryptophan synthetase (DMATS, EC: 2.5.1.34), which catalyzes the first pathway specific step leading to ergot alkaloids, the prenylation of L-tryptophan withdimethylallyl diphosphate (DMAPP)producing 4-g,g-dimethyl allyl tryptophan (DMAT). It has been already demonstrated in C. paspali SD-58 (formely named C. purpurea SD-58) that DMATS is regulated (activated) by its substrate, tryptophan (Krupinski VM, Robbers JE, Floss HG. (1976), Journal of Bacteriology, 125(1), 158-165). . Besides activating DMATS, the amino acid tryptophan also inhibits (in a feedback loop manner) anthranilate synthase (EC: 4.1.3.27), a key enzyme involved in tryptophan biosynthesis, which catalyses the conversion of chorismic acid to anthranilic acid (Krupinski VM., Robbers JE, Floss HG. (1976), Journal of Bacteriology, 725(1), 158-165). The second step of ergot alkaloid biosynthesis is methylation of DMAT to produce N-methyl-di methyl al I ytryptophan (MeDMAT). This step is catalyzed by 4-dimethylallyltryptophan N-methy I transferase encoded by EasF gene. Subsequently, the formation of chanoclavin-I occurs, the reaction being catalyzed by two enzymes, chanoclavin-I synthase encoded by EasE gene and catalase encoded by EasC gene. Chanoclavin-I is further oxidized to chanoclavin-1 -aldehyde by chanoclavin-1 -dehydrogenase encoded by EasD gene. In C. purpurea, chanoclavine-I-aldehyde is isomerised and reduced to agroclavine by orthologs of the flavin-dependent oxidoreductase encoded by easA gene and the reductase encoded by easG, respectively. This is followed by oxidation of agroclavin to elymoclavin and its subsequent oxidation to D-lysergic acid. These three rounds of 2-electron oxidations are catalyzed by NADPH-dependent cytochrome P450 monooxygenase encoded by cloA gene. Finally, ergopeptines are formed in C. purpurea. Together four genes ( IpsAl , lpsA2, IpsB and IpsC) encoding four different non-ribosomal peptide lysergyl synthetases have been found in the genome of C. purpurea 20.1. The IpsAl gene encodes trimodular lysergyl peptide synthetase LPS 1 , whichhas a similar function to the enzyme LPS4 encoded by the lpsA2 gene. The difference between these two enzymes is probably only in their ability to bind various amino acids that are part of the ergopeptines. The IpsB gene encodes monomodular enzyme LPS2, which activates the D-lysergic acid chain. Upon activation of D-lysergic acid by LPS2, the acid is transferred to LPS1 or LPS4, both containing three domains for binding three amino acids. After their binding, a peptide lactam is formed, the subsequent cyclisation of which is catalyzed by a dioxygenase encoded by the easH gene. The IpsC gene encodes monomodular synthetase LPS3, which, together with LPS2, catalyzes ergometrine biosynthesis (Florea S., Panaccione D. G., Schardl C. L. (2017), Phytopathology, 107(5), 504-518).

Method of genetic transformation of C. purpurea using polyethylene glycol (PEG) was first used in 1989 (van Engelenburg F, Smit R, Goosen T, van den Broek H, Tudzynski P. (1989), Applied Microbiology and Biotechnology, 30(4), 364-370). For example, deletion mutant AeasE of C. purpurea PI and subsequent complemented strain expressing easE-gfp were obtained by this method (Lorenz N., Olsovska J., Sulc M., Tudzynski P. (2010), Applied and Environmental Mikrobiology, 76(6), 1822-1830), as well as deletion mutant AlpsAl of Aku70 C. purpurea PI (Haarmann T., Lorenz N., Tudzynski P. (2008), Fungal Genetics and Biology, 45(1), 35-44).

In 2012, vectors containing trpC promoter from A. nidulans and an ogfp gene encoding green fluorescent protein (egfp codon-optimized for expression in the fungus Botrytis cinerea) were prepared using yeast recombinational cloning method (Schumacher J. (2012), Fungal Genetics and Biology, 49, 483-497). These vectors were further used to transform C. purpurea to localize or overexpress selected genes, including CpNoxR, CpNoxl, CpNox2 and CpPlsl encoding regulatory, two catalytic subunits of NADPH oxidase complex, and tetraspanin, respectively (Schiirmann J., Buttermann D., Herrmann A., Giesbert S., Tudzynski P. (2013), Molecular Plant-Microbe Interactions, 26(10), 1151-1164), or CpRac and CpCdc42 encoding Rho-GTPases, CpCdc24 and CpDockl80 encoding Rho-GTPase- related GEFs, or CpSte20 encoding GTPase effector (Herrmann A, Tillmann BA, Schiirmann J, Bdlker M, Tudzynski P. (2014), Eukaryotic Cell, 13(4), 470-482). These vectors have also been used, for example, for overproduction and localization of tRNA-IPT (Hinsch J., Galuszka P., Tudzynski P. (2016), New Phytologist, 211(3), 980-992) and ZmCkxl in C. purpurea 20.1 (Kind S., Hinsch J., Vrabka J., Hradilova M., Majeska-Cudejkova M., Tudzynski P., Galuszka P. (2018), Current Genetics, 64(6), 1303-1319).

The PI strain is not the only C. purpurea strain that produces ergot alkaloids (namely ergotamine a- ergocryptine and their stereoisomers ergotaminine and a-ergocryptinine) in submerged culture. This characteristic is possessed also by, for example, ergotamine producing strain 275 FI (Arcamone F., Cassinenelli G., Femifni G., Penco S., Pennella P., Pol C. (1970), Canadian Journal of Microbiology, 16(10), 923-931) or strain 59 (Kfen V., Pazoutova S., Sedmera P., Rylko V., Rehacek Z. (1986), FEMS Microbiology Letters, 37(1), 31-34). Further development of the technique has been significantly promoted by obtaining the genome sequence of C. purpurea strain 20.1 (Schardl CF et al. (2013), PLoS Genetics, 9(2), el003323).

It is an object of the present invention to increase the production of ergot alkaloids by C. purpurea fungus in a reproducible manner.

Disclosure of the Invention

The present invention provides genetically engineered transformants of Claviceps purpurea with increased ergot alkaloid production. The transformants comprise in their genome an inserted nucleotide sequence comprising at least one gene selected from TrpE gene encoding a-subunit of anthranilate synthase having S76F mutation, and dmaW gene encoding dimethylallyltryptophan synthetase, wherein the inserted gene is under the control of a constitutive promoter. The manipulation of genes for biosynthesis of the amino acid tryptophan and for its subsequent transformation into a key intermediate of ergot alkaloid biosynthesis significantly increases the production of ergopeptines in the genetically modified fungus, thus enabling their more efficient and more economical production.

In Claviceps purpurea, insertion of the gene encoding a-subunit of the key enzyme for the production oftryptophan, i.e., a-subunit of anthranilate synthase with the S76F mutation, under the control of a constitutive promoter, unblocks the feedback loop inhibition of tryptophan biosynthesis, thereby enhancing the biosynthetic pathway leading to ergot alkaloid production. The ergot alkaloid biosynthesis is also enhanced by inserting the gene for transformation of tryptophan to dimethylallyltryptophan, a key intermediate in ergot alkaloid biosynthesis, under the control of a constitutive promoter. Such genetically modified microorganisms are suitable for use in the manufacture of ergot alkaloids for the pharmaceutical industry.

The gene encoding a-subunit of anthranilate synthase (TrpE) with the S76L mutation, i.e. the gene carrying the mutation of the codon for serine (codon AGC) at position 76 to the codon for leucine (CTC codon), has a sequence with at least 90% identity to SEQ ID NO. 1, wherein a mutation of the serine codon at position 76 to the leucine codon (S76L) must be present. More preferably, the gene encoding a-subunit of anthranilate synthase having the S76L mutation has the sequence SEQ ID NO. 1.

The gene encoding dimethylallytryptophan synthetase ( dmaW) has a sequence with at least 90% identity to SEQ ID NO. 2. More preferably, the gene encoding dimethylallytryptophan synthetase has the sequence SEQ ID NO. 2.

Both above discussed genes are genes derived from Claviceps purpurea, optionally modified by introduction of a mutation, and inserted into the genome of Claviceps purpurea under the control of a constitutive promoter. Thus, the resulting microorganism carries its original TrpE and dmaW genes, and also carries the additional at least one gene ( TrpE S76L and/or dmaW) inserted through said genetic transformation under the control of a constitutive promoter.

The inserted nucleotide sequence further comprises a terminator (e.g., a Glue terminator) and may contain an ogfp gene encoding a green fluorescent protein codon-optimized for expression in Botrytis cinerea.

Reducing the sequence identity to at least 90% may be due to replacing nucleotides with other nucleotides, especially nucleotides resulting in a codon encoding the same amino acid (synonymous mutations), natural differences and mutations in Claviceps purpurea genes, and replacing nucleotides with other nucleotides in non-coding portions of the gene (introns). Preferably, the sequence identity is at least 95%.

Within the framework of the present invention, it has been found that the amount of ergot alkaloids in submerged culture, mycelium and medium of transformed Claviceps purpurea according to the present invention is significantly higher than the amount of ergot alkaloids in the unmodified Claviceps purpurea strain.

The inserted nucleotide sequences are under the control of a constitutive promoter. Particularly preferred constitutive promoters are an OliC promoter of the nuclear gene encoding mitochondrial ATP synthetase subunit 9 or a gpdA promoter of the gene encoding glyceraldehyde-3-phosphate dehydrogenase, both promoters are derived from Aspergillus nidulans.

In one preferred embodiment, the genetically engineered transformants of Claviceps purpurea with increased ergot alkaloid production according to the present invention are selected from the group comprising strains designated in the examples as OE TrpE S76L 4, OE ogfp_dmaW 8 and deposited with the Czech Collection of Microorganisms (CCM) on 25.06.2019 as CCM 8984 ( Claviceps purpurea PN with TrpE gene inserted with S76L mutation (Cp TrpE SL)) and CCM 8983 ( Claviceps purpurea PN with inserted gene ogfp-dmaW (Cp ogfp-dmaW)).

The present invention also provides a method for producing genetically engineered transformants of Claviceps purpurea comprising preparing an expression cassette comprising a nucleotide sequence comprising at least one gene selected from a gene encoding a-subunit of anthranilate synthase having the S76L mutation and a gene dmaW encoding dimethylallyltryptophan synthetase, said gene being under the control of a constitutive promoter, and a terminator, said expression cassette optionally further comprising an ogfp gene encoding a green fluorescent protein codon-optimized for expression in Botrytis cinerea, and this expression cassette is inserted into the genome of Claviceps purpurea.

The expression cassette can be prepared, for example, by yeast recombinational cloning method.

Preferably, the expression cassette is inserted using a protoplast transformation method.

The invention further provides an expression cassette comprising a constitutive promoter, at least one gene selected from a gene encoding a-subunit of anthranilate synthase having the S76L mutation, and a gene dmaW encoding dimethylallyltryptophan synthetase, and a terminator. The promoter is preferably the OliC promoter of the nuclear gene encoding the mitochondrial ATP subunit 9 of Aspergillus nidulans or the gpdA promoter of the gene encoding glyceraldehyde-3-phosphate dehydrogenase from Aspergillus nidulans. The terminator is preferably a Glue terminator.

The expression cassette may optionally further comprise an ogfp gene encoding a green fluorescent protein, codon-optimized for expression in Botrytis cinerea, which serves as the N-terminal fusion domain of the target enzyme.

In one preferred embodiment, the expression cassette comprises: OliC promoter ::TrpE^S76L::Gluc terminator and has a sequence with at least 90% identity, more preferably with at least 95% identity, to sequence SEQ ID NO. 3. In another preferred embodiment, the expression cassette comprises: OliC promotor: :ogfp- dmaWv.Gluc terminator and has a sequence with at least 90% identity, more preferably with at least 95% identity, to sequence SEQ ID NO. 4.

Another object of the present invention is the use of the said expression cassettes for the preparation of the fungus Claviceps purpurea as a production microorganism for producing ergot alkaloids.

Nucleotide sequence of the TrpE gene encoding a-subunit of anthranilate synthase with S76L mutation (1840 bp, SEQ ID NO. 1):

ATGGCGAGCCCGGTAAGTACTGCATGCGCCCCTCTGGCCGAATTGGCCCTCTTCCCGGCGCGGCGCAG

TAGGAATAGCCTCCAAAAAGACACAAAGCCTGACTCTTGAGAATCGCGAATCCAAAAAAACACAGCAG

GCCATCGTCCCTACGCTCGAGACCGTGCGATCCATCATTGCGAAACCCCCCGTCGGATCCGCCAAAAA

AGCCACCCTCGTGCCCGTATACCGCCAAATCTCCTCGGACCTCATCACCCCCTCGGCGGCCTACCTCA

AAATCTCAGCCGCCTCCTCCTCCGACTACTCCTTCCTCTTCGAGTCCGCCGCCACAGAGCAAGTCGGC

CGGTATCTCTTCGTAGGCGCCGGCCCGCGCAAAGTCCTCGCCACCGGACCAGGCTACGGCCCCGAAAC

AGACCCCCTTCCCGCACTGGAAGCAGAACTAGCTCAACATGTCGTCGCGCATGTGCCAGGTCTCCAGC

TGCCTCCTCTTACCGGCGGCGCAATCGGCTACGTGGGCTACGACTGCGTACGGTACTTTGAGCCCAAG

ACCGCGCGGCCCATGAAAGATGTCCTACAAATCCCAGAATCACTCTTCATGCTCTTCGACACAATTGT

CGCGTTTGATCGCTTCTACGGCATCATCAAGGTCATCAGCTACGTGGCCGTTCCGGAAGACGACGGTA

CCACCAGCCTAGAAGAGGCCTACGAAAAAGCCGAGCGCGCAATCCACCAACTCGTCCAGGTCCTCAAC

TCAACAGAGATTGACCTCCCGACCCAAGACCCCATCCAGCTCGGCCACGAAGCCACCTCGAATATCGG

CCAAGCGGGCTACGAGGCCCACGTGACCAAACTCAAGGAGCACATCGTCAAGGGGGATATCTTCCAGT

GTGTGCCCTCGCAGCGGTTTGCGCGCCCGACGAGTCTGCACCCGTTCAATATCTACAGGCATCTCCGG

ACGGTGAATCCCTCGCCGTACCTCTTTTATGTGAATTGCAAGGATTTCCAGATTGTAGGTGCCTCGCC

TGAATTGCTCGTCAAGTCCGAGGCCGGGCGTATCATCACGCATCCCATTGCTGGGACAGTCAAGCGCG

GCAGCACACCCGAGGAGGACCAGCGCTTGGCGGATGAGCTGAGTAGTTCGCTCAAGGACCGCGCGGAG

CATGTCATGCTTGTTGATTTGGCTCGGAATGACATCAACCGCGTAGGGGACCCGTATTCCGTCCGCGT

GGACCGCCTTATGGTCGTGGAGAAGTTTAGCCATGTCCAGCATCTTGTTTCGCAGGTCTCAGGGGTGC

TGCGGCCGGATAAGACGCGCTTTGATGCGTTTCGATCGGTTTTCCCCGCGGGGACGGTCTCGGGAGCG

CCCAAGGTGCGGGCGATGGAACTGATTGCCGAGTTGGAGAAGGAGAAGAGGGGGGTGTATGCTGGCGC

GGTGGGCTACTTTGGGTATGGGAGCCAGGATGAGAATGGGGGCGCTGTGGAGGGGGCTATGGATACGT

GTATTGCGTTGAGGACGATGTTGGTCAAGGACGGGGTGGCGTATTTGCAGGCAGGTTCGTACAGATCT

TGGTTGAGCCAAGGATTCCCCCCCCTCTCTTCCCCTTTTCTTGCTGTCACGTTACGCATTTCTATGCA

CGGTACGCACTCCTGAGAGAAAATACAGTTTGCTAACACTTCCCCCCCCTTTTTTTTTGCTTTCGATT

TAGGAGGCGGAATTGTGTTTGATTCAGACGAATACGATGAGTGGATCGAGACGATCAACAAGCTCGGC

AGCAACATGACGTGCATCAAGTCAGCAGAGGAGATGTATTACCAGCAGCAGCAAAACGAGAAAACCAC

ATAG Nucleotide sequence of the dmaW gene encoding dimethylallyltryptophan synthetase (1466 bp, SEQ ID NO. 2):

ATGTCGACCGCAAAGGACCCAGGAAACGGTGTGTACGAAATTTTGAGTCTGATTTTTGATTTCCCCAG

CAATGAACAGCGACTATGGTGGCACAGTACCGCGCCTATGTTTGCGGCGATGCTTGACAATGCCGGCT

ACAATATCCACGACCAATACCGGCATCTGGGCATTTTCAAGAAGCACATTATCCCTTTTCTTGGTGTC

TATCCAACAAAAGACAAGGAAAGATGGCTCAGCATCCTCACCAGATGTGGCCTTCCTTTGGAATTGAG

CTTGAATTGTACCGACTCTGTTGTTCGATATACATACGAGCCCATCAATGAAGTGACGGGGACGGAGA

AAGATCCGTTCAATACATTGGCAATTATGGCAAGTGTCCAAAAACTTGCACAGATTCAAGCGGGTATC

GACTTGGAGTGGTTTAGTTACTTCAAAGATGAGCTGACGCTGGACGAATCGGAATCGGCCACACTTCA

AAGTAATGAGCTGGTCAAGGAGCAGATAAAGACGCAGAACAAGTTGGCCTTGGATCTCAAAGAAAGCC

AGTTCGCGCTCAAAGTTTACTTCTATCCGCATCTTAAATCGATCGCGACCGGCAAATCCACACACGAT

CTCATCTTCGACTCTGTGTTCAAACTGTCGCAGAAGCATGACAGCATACAGCCCGCGTTCCAGGTATT

GTGCGACTATGTTTCGCGGCGAAATCATTCCGCAGAATCAGACCAACACATAGCCCTACATGCGCGAC

TCTTGTCATGCGATTTGATCGATCCCGCCAAGTCTCGCGTCAAGATATACCTGCTGGAGAAGACGGTC

TCGTTGTCCGTGATGGAAGATCTGTGGACGCTGGGCGGCCAACGAGTCGACGCATCCACCATGGACGG

CCTTGACATGCTTCGCGAGCTCTGGAGCCTGCTAAAAGTTCCCACTGGCCACTTGGAGTATCCAAAAG

GGTATCTGGAATTGGGAGAAATTCCGAACGAGCAGCTCCCATCCATGGCCAACTATACACTGCACCAC

AACAACCCCATGCCTGAGCCCCAGGTGTATTTCACGGTTTTCGGCATGAATGACGCCGAAATCAGCAA

TGCTTTGACCATCTTCTTCCAACGTCACGGATTTGACGACATGGCGAAAAAGTACCGAGTCTTTCTTC

AGGATTCATAGTGAGTGCTCCGAGCCCGATCGATAGGCAACAGGTGTCTAACAATTAGCCCCCTTTCT

CCTACAGCCCGTATCATGACTTTGAGTCATTGAACTACCTCCACGCATATATCTCATTCTCTTACCGT

CGAAACAAGCCGTATTTGAGCGTATATTTGCATACGTTTGAGACTGGTCGTTGGCCCGTTGGTGAGTC

TACCGAACTTTATCAACATGGGCTCCGCAAGCTGAACAATTTCCTAGTTGCCGACAGCCCAATTTCTT

TCGACGCCTACCGGCGCTGTGACCTCTCAACGAAGTAG

SEQ ID NO. 3

Position of individual functional sections:

OliC promoter - 1 - 845 bp

TrpE S76L - 846 - 2685 bp

Glue terminator - 2686 - 3185 bp

TGCAGCTGTGGAGCCGCATTCCCGATTCGGGCCGGATTGGTCAAGATTTGCGTCCGAGGTGCCGTCTA

TCATTCTAGCTTGCGGTCCTGGGCTTGTGACTGGTCGCGAGCTGCCACTAAGCGGGGCAGTACCATTT

TATCGGACCCATCCAGCTATGGGACCCACTCGCAAATTTTTACATCATTTTCTTTTTGCTCAGTAACG

GCCACCTTTTGTAAAGCGTAACCAGCAAACAAATTGCAATTGGCCCGTAGCAAGGTAGTCAGGGCTTA

TCGTGATGGAGGAGAAGGCTATATCAGCCTCAAAAATATGTTGCCAGCTGGCGGAAGCCCGGAAGGTA

AGTGGATTCTTCGCCGTGGCTGGAGCAACCGGTGGATTCCAGCGTCTCCGACTTGGACTGAGCAATTC AGCGTCACGGATTCACGATAGACAGCTCAGACCGCTCCACGGCTGGCGGCATTATTGGTTAACCCGGA

AACTCAGTCTCCTTGGCCCCGTCCCGAAGGGACCCGACTTACCAGGCTGGGAAAGCCAGGGATAGAAT ACACTGTACGGGCTTCGTACGGGAGGTTCGGCGTAGGGTTGTTCCCAAGTTTTACACACCCCCCAAGA CAGCTAGCGCACGAAAGACGCGGAGGGTTTGGTGAAAAAAGGGCGAAAATTAAGCGGGAGACGTATTT AGGTGCTAGGGCCGGTCTCCTCCCCATTTTTCTTCGGTTCCCTTTCTCTCCTGGAAGACTTTCTCTCT CTCTTCTTCTCTTCTTCCATCCTCAGTCCATCTTCCTTTCCCATCATCCATCTCCTCACCCCCATCTC AACTCCATCACATCACAATCGATCCAACCATGGCGAGCCCGGTAAGTACTGCATGCGCCCCTCTGGCC GAATTGGCCCTCTTCCCGGCGCGGCGCAGTAGGAATAGCCTCCAAAAAGACACAAAGCCTGACTCTTG AGAATCGCGAATCCAAAAAAACACAGCAGGCCATCGTCCCTACGCTCGAGACCGTGCGATCCATCATT GCGAAACCCCCCGTCGGATCCGCCAAAAAAGCCACCCTCGTGCCCGTATACCGCCAAATCTCCTCGGA CCTCATCACCCCCTCGGCGGCCTACCTCAAAATCTCAGCCGCCTCCTCCTCCGACTACTCCTTCCTCT TCGAGTCCGCCGCCACAGAGCAAGTCGGCCGGTATCTCTTCGTAGGCGCCGGCCCGCGCAAAGTCCTC GCCACCGGACCAGGCTACGGCCCCGAAACAGACCCCCTTCCCGCACTGGAAGCAGAACTAGCTCAACA TGTCGTCGCGCATGTGCCAGGTCTCCAGCTGCCTCCTCTTACCGGCGGCGCAATCGGCTACGTGGGCT ACGACTGCGTACGGTACTTTGAGCCCAAGACCGCGCGGCCCATGAAAGATGTCCTACAAATCCCAGAA TCACTCTTCATGCTCTTCGACACAATTGTCGCGTTTGATCGCTTCTACGGCATCATCAAGGTCATCAG CTACGTGGCCGTTCCGGAAGACGACGGTACCACCAGCCTAGAAGAGGCCTACGAAAAAGCCGAGCGCG CAATCCACCAACTCGTCCAGGTCCTCAACTCAACAGAGATTGACCTCCCGACCCAAGACCCCATCCAG CTCGGCCACGAAGCCACCTCGAATATCGGCCAAGCGGGCTACGAGGCCCACGTGACCAAACTCAAGGA GCACATCGTCAAGGGGGATATCTTCCAGTGTGTGCCCTCGCAGCGGTTTGCGCGCCCGACGAGTCTGC ACCCGTTCAATATCTACAGGCATCTCCGGACGGTGAATCCCTCGCCGTACCTCTTTTATGTGAATTGC AAGGATTTCCAGATTGTAGGTGCCTCGCCTGAATTGCTCGTCAAGTCCGAGGCCGGGCGTATCATCAC GCATCCCATTGCTGGGACAGTCAAGCGCGGCAGCACACCCGAGGAGGACCAGCGCTTGGCGGATGAGC TGAGTAGTTCGCTCAAGGACCGCGCGGAGCATGTCATGCTTGTTGATTTGGCTCGGAATGACATCAAC CGCGTAGGGGACCCGTATTCCGTCCGCGTGGACCGCCTTATGGTCGTGGAGAAGTTTAGCCATGTCCA GCATCTTGTTTCGCAGGTCTCAGGGGTGCTGCGGCCGGATAAGACGCGCTTTGATGCGTTTCGATCGG TTTTCCCCGCGGGGACGGTCTCGGGAGCGCCCAAGGTGCGGGCGATGGAACTGATTGCCGAGTTGGAG AAGGAGAAGAGGGGGGTGTATGCTGGCGCGGTGGGCTACTTTGGGTATGGGAGCCAGGATGAGAATGG GGGCGCTGTGGAGGGGGCTATGGATACGTGTATTGCGTTGAGGACGATGTTGGTCAAGGACGGGGTGG CGTATTTGCAGGCAGGTTCGTACAGATCTTGGTTGAGCCAAGGATTCCCCCCCCTCTCTTCCCCTTTT CTTGCTGTCACGTTACGCATTTCTATGCACGGTACGCACTCCTGAGAGAAAATACAGTTTGCTAACAC T TC CC CCCCCTTTTTTTTTGCTTTC GATT TAGGAGGCGGAATTGTGTTT GATT CAGACGAATACGATG AGTGGATCGAGACGATCAACAAGCTCGGCAGCAACATGACGTGCATCAAGTCAGCAGAGGAGATGTAT TACCAGCAGCAGCAAAACGAGAAAACCACATAGCGTATGTAGATAAGATGTATGATTAGGGGTTGAGG GGAAGGATTATGGCTGAGGAAGTGGTTTCTGATTCGTCTTGTACATAAGTATTAGCATGGACCCTTGT

GGAGGTATTTGCTCAAAGGGGGTGTTTTAGCGGAAGACAAAAGAGGGCGGAATTAAATCTCAATCCGT

TTTCAACTTTGAAAATCTTGATCCAACATTGTGATTCCATGTATTTGTGCAACCAAGTTTTTCATCAT TGATTCTGCTGTAATGTGAACAAACTACAAGTAGGAGGACATTTGTTTAAAGTTTTCAGCTCACGTGG

TATTGTGGCCTGACAGGAGCACAAACGCCGTTTTTGAGAAAACGAAAGTTTGGAATTGACCATCCACA

ACCACATGCGTTTCCTATGATACACCTCATGTGGCGTTACCATATGATATTCGGTTTCATATCTAGGC

AAAGAGGAGAACATCATACGTACATCTGATTTGACAACCCCTTCCCCCCAACAAGAT

SEQ ID NO. 4

Position of individual functional sections:

OliC promoter - 1 - 845 bp

ogfp without a stop codon - 846 - 1622 bp

dmaW - 1623 - 3088 bp

Glue terminator - 3089 - 3588 bp

TGCAGCTGTGGAGCCGCATTCCCGATTCGGGCCGGATTGGTCAAGATTTGCGTCCGAGGTGCCGTCTA

TCATTCTAGCTTGCGGTCCTGGGCTTGTGACTGGTCGCGAGCTGCCACTAAGCGGGGCAGTACCATTT

TATCGGACCCATCCAGCTATGGGACCCACTCGCAAATTTTTACATCATTTTCTTTTTGCTCAGTAACG

GCCACCTTTTGTAAAGCGTAACCAGCAAACAAATTGCAATTGGCCCGTAGCAAGGTAGTCAGGGCTTA

TCGTGATGGAGGAGAAGGCTATATCAGCCTCAAAAATATGTTGCCAGCTGGCGGAAGCCCGGAAGGTA

AGTGGATTCTTCGCCGTGGCTGGAGCAACCGGTGGATTCCAGCGTCTCCGACTTGGACTGAGCAATTC

AGCGTCACGGATTCACGATAGACAGCTCAGACCGCTCCACGGCTGGCGGCATTATTGGTTAACCCGGA

AACTCAGTCTCCTTGGCCCCGTCCCGAAGGGACCCGACTTACCAGGCTGGGAAAGCCAGGGATAGAAT

ACACTGTACGGGCTTCGTACGGGAGGTTCGGCGTAGGGTTGTTCCCAAGTTTTACACACCCCCCAAGA

CAGCTAGCGCACGAAAGACGCGGAGGGTTTGGTGAAAAAAGGGCGAAAATTAAGCGGGAGACGTATTT

AGGTGCTAGGGCCGGTCTCCTCCCCATTTTTCTTCGGTTCCCTTTCTCTCCTGGAAGACTTTCTCTCT

CTCTTCTTCTCTTCTTCCATCCTCAGTCCATCTTCCTTTCCCATCATCCATCTCCTCACCCCCATCTC

AACTCCATCACATCACAATCGATCCAACCATGGTTTCCAAGGGTGAGGTAAGTAATCCCGTGCAATGT

CCCAAGACTCTTCTCTAATACTTCTACCAGGAGCTTTTCACTGGCGTCGTTCCAATCTTGGTCGAACT

CGATGGTGACGTCAATGGCCATAAGTTCTCAGTCAGCGGAGAGGGTGAGGGAGACGCTACATATGGTA

AATTGACTCTTAAGTTCATCTGCACCACAGGTAAATTGCCTGTACCTTGGCCTACACTCGTCACCACC

CTCACCTACGGAGTTCAATGCTTTTCCCGTTACCCAGATCACATGAAACAACATGACTTTTTCAAGTC

TGCAATGCCAGAGGGATATGTCCAAGAGAGAACAATCTTCTTTAAGGATGACGGAAATTATAAGACTC

GTGCCGAGGTTAAGTTCGAGGGTGATACTCTCGTCAACCGTATTGAGTTGAAGGGCATCGATTTCAAG

GAAGACGGAAATATCCTCGGCCATAAGCTTGAATACAACTACAACAGTCACAACGTTTATATCATGGC

CGACAAGCAAAAAAATGGAATCAAGGTCAACTTCAAAATCAGACACAACATTGAGGATGGCTCTGTTC

AATTGGCAGATCACTACCAACAGAATACTCCAATTGGTGATGGTCCAGTCTTGCTCCCAGATAACCAT

TACCTCTCCACTCAATCTGCTCTTTCAAAGGACCCTAACGAAAAGCGTGACCACATGGTTCTTCTCGA

ATTTGTCACAGCAGCCGGAATTACCTTGGGAATGGATGAACTTTACAAAGCGGCCGCTATGTCGACCG

CAAAGGACCCAGGAAACGGTGTGTACGAAATTTTGAGTCTGATTTTTGATTTCCCCAGCAATGAACAG

CGACTATGGTGGCACAGTACCGCGCCTATGTTTGCGGCGATGCTTGACAATGCCGGCTACAATATCCA CGACCAATACCGGCATCTGGGCATTTTCAAGAAGCACATTATCCCTTTTCTTGGTGTCTATCCAACAA

AAGACAAGGAAAGATGGCTCAGCATCCTCACCAGATGTGGCCTTCCTTTGGAATTGAGCTTGAATTGT

ACCGACTCTGTTGTTCGATATACATACGAGCCCATCAATGAAGTGACGGGGACGGAGAAAGATCCGTT

CAATACATTGGCAATTATGGCAAGTGTCCAAAAACTTGCACAGATTCAAGCGGGTATCGACTTGGAGT

GGTTTAGTTACTTCAAAGATGAGCTGACGCTGGACGAATCGGAATCGGCCACACTTCAAAGTAATGAG

CTGGTCAAGGAGCAGATAAAGACGCAGAACAAGTTGGCCTTGGATCTCAAAGAAAGCCAGTTCGCGCT

CAAAGTTTACTTCTATCCGCATCTTAAATCGATCGCGACCGGCAAATCCACACACGATCTCATCTTCG

ACTCTGTGTTCAAACTGTCGCAGAAGCATGACAGCATACAGCCCGCGTTCCAGGTATTGTGCGACTAT

GTTTCGCGGCGAAATCATTCCGCAGAATCAGACCAACACATAGCCCTACATGCGCGACTCTTGTCATG

CGATTTGATCGATCCCGCCAAGTCTCGCGTCAAGATATACCTGCTGGAGAAGACGGTCTCGTTGTCCG

TGATGGAAGATCTGTGGACGCTGGGCGGCCAACGAGTCGACGCATCCACCATGGACGGCCTTGACATG

CTTCGCGAGCTCTGGAGCCTGCTAAAAGTTCCCACTGGCCACTTGGAGTATCCAAAAGGGTATCTGGA

ATTGGGAGAAATTCCGAACGAGCAGCTCCCATCCATGGCCAACTATACACTGCACCACAACAACCCCA

TGCCTGAGCCCCAGGTGTATTTCACGGTTTTCGGCATGAATGACGCCGAAATCAGCAATGCTTTGACC

ATCTTCTTCCAACGTCACGGATTTGACGACATGGCGAAAAAGTACCGAGTCTTTCTTCAGGATTCATA

GTGAGTGCTCCGAGCCCGATCGATAGGCAACAGGTGTCTAACAATTAGCCCCCTTTCTCCTACAGCCC

GTATCATGACTTTGAGTCATTGAACTACCTCCACGCATATATCTCATTCTCTTACCGTCGAAACAAGC

CGTATTTGAGCGTATATTTGCATACGTTTGAGACTGGTCGTTGGCCCGTTGGTGAGTCTACCGAACTT

TATCAACATGGGCTCCGCAAGCTGAACAATTTCCTAGTTGCCGACAGCCCAATTTCTTTCGACGCCTA

CCGGCGCTGTGACCTCTCAACGAAGTAGCGTATGTAGATAAGATGTATGATTAGGGGTTGAGGGGAAG

GATTATGGCTGAGGAAGTGGTTTCTGATTCGTCTTGTACATAAGTATTAGCATGGACCCTTGTGGAGG

TATTTGCTCAAAGGGGGTGTTTTAGCGGAAGACAAAAGAGGGCGGAATTAAATCTCAATCCGTTTTCA

ACTTTGAAAATCTTGATCCAACATTGTGATTCCATGTATTTGTGCAACCAAGTTTTTCATCATTGATT

CTGCTGTAATGTGAACAAACTACAAGTAGGAGGACATTTGTTTAAAGTTTTCAGCTCACGTGGTATTG

TGGCCTGACAGGAGCACAAACGCCGTTTTTGAGAAAACGAAAGTTTGGAATTGACCATCCACAACCAC

ATGCGTTTCCTATGATACACCTCATGTGGCGTTACCATATGATATTCGGTTTCATATCTAGGCAAAGA

GGAGAACATCATACGTACATCTGATTTGACAACCCCTTCCCCCCAACAAGAT

Brief Description of Drawings

Fig 1: Scheme of preparation of expression vectors by yeast recombinational cloning: pNDH-OGG vector containing ogfp (A), cloning of mutated TrpE (amplification of the TrpE gene from genomic DNA in two parts, the position of the mutation is shown by an asterisk) into pNDH-OGG with cleaved ogfp (B), cloning of dmaW (N-terminal fusion of DMATS with OGFP) into pNDH-OGG (C). 3": 3 "flank Botrytis cinerea reductase nitrate, 5': 5 "flank Botrytis cinerea reductase nitrate.

Fig. 2: PCR detection of transgenes in the genetically modified C. purpurea (strain PI) fungi expressing a mutated version of TrpE ( TrpE^S76L ) under the control of the constitutive promoter OliC ( PoliC ). The detected transgenic DNA region is represented by arrows. Black arrows show the primers annealing to the OliC promoter and the GluC terminator, flanking the inserted TrpE gene with a mutation. Gray arrows indicate primers annealing to the hph gene reading frame, 3": 3 "flank Botrytis cinerea reductase nitrate, 5': 5 "flank Botrytis cinerea reductase nitrate (A). Detection of part of the Olic promoter, the gene and part of the GluC terminator. Amplicon size 2353 bp (B). Detection of hph gene. Amplicon size 366 bp (C). M: 1 kb Plus DNA marker, 4, 12: independent C. purpurea transformants with the integrated transgene, PC positive control (plasmid DNA carrying the transgene), NC: negative control (genomic DNA of a wild type fungus).

Fig. 3: PCR detection of a transgene in the genetically modified C. purpurea (strain PI) fungus expressing ogfp under the control of the constitutive promoter OliC { PoliC ). The detected transgenic DNA region is represented by arrows. Black arrows show the primers annealing to the OliC promoter and the GluC terminator flanking the inserted ogfp gene. Gray arrows indicate primers annealing to the hph gene reading frame, 3": 3 "flank Botrytis cinerea reductase nitrate, 5': 5 "flank Botrytis cinerea reductase nitrate (A). Detection of part of the Olic promoter, the gene and part of the GluC terminator. Amplicon size 1292 bp (B). Detection of hph gene. Amplicon size 366 bp (C). M: 1 kb Plus DNA marker, 1: C. purpurea transformant with the integrated transgene, PC: positive control (plasmid DNA carrying the transgene), NC: negative control (genomic DNA of a wild type fungus).

Fig. 4: PCR detection of transgenes in genetically modified C. purpurea (strain PI) fungi expressing dmaW fused to ogfp { ogfp-dmaW) under the control of the constitutive promoter OliC {PoliC). The detected transgenic DNA region is represented by arrows. Black arrows show the primers annealing to the OliC promoter and the GluC terminator with the inserted ogfp and dmaW genes. Gray arrows indicate primers annealing to the hph gene reading frame, 3": 3 "flank Botrytis cinerea reductase nitrate, 5': 5 "flank Botrytis cinerea reductase nitrate (A). Detection of part of the Olic promoter, the gene and part of the GluC terminator. Amplicon size 3098 bp (B). Detection of hph gene. Amplicon size 366 bp (C). M:1 kb Plus DNA marker, 8, 13: independent C. purpurea transformants with the integrated transgene, PC: positive control (plasmid DNA carrying the transgene), NC: negative control (genomic DNA of a wild type fungus).

Fig. 5: RT-PCR detection of transgenes in genetically modified C. purpurea (strain PI) fungi expressing a mutated version of TrpE {TrpE ^S76L) or dmaW fused to ogfp {ogfp-dmaW), and free ogfp under the control of the constitutive promoter OliC {PoliC). Detection of hph gene. Amplicon size 366 bp (A). Detection of g-actin. Amplicon size 636 bp (B). M: 1 kb Plus DNA marker, NC: negative control (genomic DNA of a wild type fungus), 4, 12: independent C. purpurea transformants expressing the mutated TrpE ^S76L; 1: ogfp-ex pressing C. purpurea transformant; 8, 13: independent C. purpurea PI transformants expressing ogfp-dmaW.

Fig. 6: PCR detection of transgenes in my celia of wild type and genetically modified C. purpurea (strain PI) fungi expressing the mutated version of TrpE {TrpE ^S76L) under the control of the constitutive promoter OliC {PoliC) after 10 days of incubation in T25N induction medium. The detected transgenic DNA region is represented by arrows. Black arrows show the primers annealing to the OUC promoter and the GluC terminator, flanking the inserted TrpE gene wit a mutation, 3': 3 'flank Botrytis cinerea reductase nitrate, 5': 5 'flank Botrytis cinerea reductase nitrate (A). Detection of part of the Olic promoter, the gene and part of the GluC terminator. Amplicon size 2353 bp (B). M:1 kb Plus DNA marker, 4, 12: independent C. purpurea transformants expressing the mutated TrpE ^S76L, PC: positive control (plasmid DNA carrying the transgene TrpE ^S76L), NC: negative control (genomic DNA of a wild type fungus control), A-F: 6 biological replicates.

Fig. 7: PCR detection of transgenes in wild type my celia and in genetically modified C. purpurea (strain PI) fungi expressing a mutated version of TrpE { TrpE ^S76L ) under the control of the constitutive promoter OUC { PoliC) after 10 days of incubation in T25N induction medium. The detected transgenic DNA region is represented by arrows. Gray arrows indicate primers annealing to the hph gene reading frame, 3': 3 'flank Botrytis cinerea reductase nitrate, 5': 5 'flank Botrytis cinerea reductase nitrate (A). Detection of hph gene. Amplicon size 366 bp (B). M:1 kb Plus DNA marker; 4, 12: independent C. purpurea transformants expressing a mutated version of TrpE ^S76L, PC: positive control (plasmid DNA carrying a transgene - a mutated version of TrpE ^S76L NC: negative control (genomic DNA of a control wild type fungus), A-F: 6 biological replicates.

Fig. 8: PCR detection of transgenes in wild type mycelia and in genetically modified C. purpurea (PI strain) expressing ogfp or dmaW fused to ogfp { ogfp-dmaW) under the control of the constitutive promoter OUC {PoliC) after 14 days of incubation in T25N induction medium. The detected transgenic DNA region is represented by arrows. Black arrows show the primers annealing to the OUC promoter and the GluC terminator, with the inserted ogfp and dmaW genes, 3': 3 'flank Botrytis cinerea reductase nitrate, 5': 5 'flank Botrytis cinerea reductase nitrate (A). Detection of part of the Olic promoter, the gene and part of the GluC terminator. Amplicon size of 1292 bp or 3098 bp (B). M: 1 kb Plus DNA marker, 1: ogfp-expressing C. purpurea transformant; 8, 13: independent C. purpurea transformants expressing ogfp-dmaW, PCI: positive control 1 (ogfp-carrying plasmid DNA), PC2: positive control 2 (ogfp-dma VF-carrying plasmid DNA), NC: negative control (genomic DNA of a wild type fungus control), A-F: 6 biological replicates.

Fig. 9: PCR detection of transgenes in wild type mycelia and in genetically modified C. purpurea (PI strain) expressing ogfp or dmaW fused to ogfp {ogfp-dmaW) under the control of the constitutive promoter OUC {PoliC) after 14 days of incubation in T25N induction medium. The detected transgenic DNA region is represented by arrows. Gray arrows indicate primers annealing to the hph gene reading frame, 3': 3 'flank Botrytis cinerea reductase nitrate, 5': 5 'flank Botrytis cinerea reductase nitrate (A). Detection of hph gene. Amplicon size 366 bp (B). M: 1 kb Plus DNA marker, 1: ogfp expressing C. purpurea transformant, 8, 13: ogfp-dmaW expressing C. purpurea independent transformants, PCI: positive control 1 ( ogfp-carrying plasmid DNA), PC2: positive control 2 (plasmid DNA carrying the transgene dmaW with ogfp), NC: negative control (genomic DNA of a wild type fungus control), A-F: 6 biological replicates. Examples of carrying out the Invention

Example 1: Preparation of genetically modified fungi 1. Preparation of expression vectors

Two expression vectors were prepared (SEQ ID NO. 4, SEQ ID NO. 3): the first vector contained the dmaW gene, which encodes dimethylallyltryptophan synthetase, DMATS ( EnsemblFungi : CPUR_04076, SEQ ID NO. 2), the other vector contained a mutated version of the TrpE gene ( TrpE^S76L ) for a-subunit of anthranilate synthase ( EnsemblFungi : CPUR_05013, SEQ ID NO. 1). Each of the above genes was placed under the control of the constitutive OliC promoter of the Aspergillus nidulans nuclear gene encoding mitochondrial ATP synthetase subunit 9. In the case of the dmaW gene, ogfp, i.e. codon-optimized egfp for expression in Botrytis cinerea, was kept at the N-terminus of DMATS (Leroch M, Mernke D, Koppenhoefer D, Schneider P, Mosbach A, Doehlmann G, Hahn M. (2011), Applied and Environmental Microbiology 77(9), 2887-2897).

Each of the above expression vectors was prepared by yeast recombinational cloning method (Fig. 1) (Colot HV, Park G, Turner GE, Ringelberg C, Crew CM, Litvinkova L, Weiss RL, Borkowich KA, Dunlap JC. (2006), Proceedings of the National Academy of Sciences USA 103(21), 10352-10357) using the vector pNDH-OGG (Schumacher J (2012), Fungal Genetics and Biology, 49(6), 483-497). The dmaW and TrpE gene sequences were amplified from the genomic DNA of Claviceps purpurea strain 20.1, using Phusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA). In the case of the TrpE gene with the S76L mutation, the sequence of this gene was amplified in two steps, the desired mutation being introduced into the sequence of the primers used.

Sequences of primers used to amplify the dmaW gene with an overlap to the ogfp and with an overlap to the Glue terminator

5'- GAACTTTACAAAGCGGCCGCTATGTCGACCGCAAAGGACCCAGGAAAC - 3' (SEQ ID NO. 5)

5'- GT G ACCTCTC A ACG A AGT AGCGT AT GT AG AT A AG AT GT AT GATT AGG - 3' (SEQ ID NO. 6)

Sequences of primers used to amplify the TrpE gene with the S76L mutation - part 1 with an overlap to the OliC promoter and with the said mutation

5'- CCATCACATCACAATCGATCCAACCATGGCGAGCCCGGTAAGTACTGC - 3' (SEQ ID NO. 7)

5'- TACGAAGAGATACCGGCCGACTTGCTCTGTGGCGGCGGACTCGAA - 3' (SEQ ID NO.

8)

Sequences of primers used to amplify the TrpE gene with the S76L mutation - part 2 with the said mutation and with an overlap to the Glue terminator

5'- C AC AGAGC A AGT CGGCCGGT ATCT CTT CGT AGGC - 3' (SEQ ID NO. 9) 5'- CATACATCTTATCTACATACGCTATGTGGTTTTCTCGTTTTGCTGCTGCTG GTA- 3 (SEQ ID NO. 10)

For the cloning of the mutated version TrpE ^S76L, the pNDH-OGG vector was digested with restriction endonucleases Notl and Ncol (New England Biolabs), and for the cloning of the dmaW gene, the vector pNDH-OGG was digested with restriction endonuclease Notl (New England Biolabs).

The obtained DNA fragments were transformed into uracil-auxotrophic strain of Saccharomyces cerevisiae (strain FGSC 9721, Fungal Genetics Stock Center, Manhattan, USA). The transformation was performed according to Winston F, Dollard C, Ricupero-Hovasse SF. (1995), Yeast, 11(1), 53-55. In a microtube, 50% PEG 3350, 1M lithium acetate, the digested pNDH-OGG vector, and a PCR fragment amplified from C. purpurea 20.1 genomic DNA were mixed. S. cerevisiae FGSC 9721 cells, pre-washed with distilled water and 100 mM lithium acetate, were added to this mixture, and resuspended in 100 mM lithium acetate. A microtube with undigested vector pNDH-OGG served as a positive control, and the negative control microtube contained only the digested vector without the DNA amplicon. Denaturated salmon sperm DNA (Sigma-Aldrich) was added to the microtubes. The mixture was incubated at 30 °C, then at 42 °C and then plated on uracil-free SD agar plates (20 g D- glucose monohydrate, 6.7 g yeast nitrogen base without amino acids, 0.77 g amino acid mixture and nutrients without uracil, made up to 1 liter with distilled water, pH adjusted to 5.8, autoclaved for 20 min at 120 °C). After three days of incubation at 30 °C, the grown colonies of S. cerevisiae FGSC 9721 were harvested from the agar plates, plasmid DNA was isolated using the QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany) and subsequently used to transform Escherichia coli (strain TOP 10) (New England Biolabs). Plasmid DNA was pipetted into a microtube with E. coli TOP 10. After incubation on ice, the cells were heat shocked at 42 °C and the mixture was again transferred to ice. Then, SOC medium (20 g of tryptone, 5 g of yeast extract and 0.5 g of sodium chloride dissolved in 950 ml of distilled water, followed by addition of 10 ml of 250 mM potassium chloride, the mixture was adjusted to pH 7.0, and made up to 1 liter with distilled water; after autoclaving for 20 min at 120 °C, 20 ml of 1 M D-glucose and 5 ml of 2 M magnesium chloride were added to the solution) was added to the mixture, and after 1 h incubation at 37 °C, E. coli TOP10 cells were plated on FB agar plates (9.5 g sodium chloride, 15.5 g FB Broth, 15 g agar, made up to 1 liter with distilled water, pH adjusted to 7.2, autoclaved for 20 min at 120 °C) with ampicillin (Sigma-Aldrich) of the final concentration 100 mg/ml. The plates were incubated until the next day at 37 °C. Plasmid DNA was then isolated from the grown E. coli TOP10 colonies using the QIAprep Spin Miniprep kit (Qiagen). The resulting constructs were verified by restriction analysis and commercial sequencing (SEQme, Dobns, Czech Republic).

2. Transformation of Claviceps purpurea and subsequent selection of obtained fungi

The plasmid DNA and also vector pNDH-OGG containing free ogfp were used for the transformation of C. purpurea (strain PI) protoplasts (Tudzynski P, Hdlter K, Correia T, Arntz C, Grammel N, Keller U. (1999), Molecular and General Genetics MGG, 261(1), 133-141). Prior to transformation, the vectors were linearized with Pstl restriction endonuclease (New England Biolabs), and the restriction mixtures were purified using a NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL GmbH and Co. KG, Berlin, Germany). Purified linearized vectors were then transformed into C. purpurea (strain PI), which produces ergotamine, ergotaminine, a-ergocryptine and a-ergocryptinine in submerged culture (Haarmann T, Lorenz N, Tudzynski P. (2008), Fungal Genetics and Biology, 45(1), 35-4). Transformation of C. purpurea (strain PI) protoplasts was performed as follows. After 3 days, the culture of C. purpurea PI in BII cultivation medium (100 g sucrose, 5 g peptone, 5 g L- asparagine monohydrate, 1 g potassium dihydrogen phosphate, 0.5 g magnesium sulphate heptahydrate, 0.01 g ferrous sulphate heptahydrate, made up to 1 liter with distilled water, pH adjusted to 5.8, autoclaved for 20 min at 120 °C) was centrifuged and then washed with SmaC buffer (123.88 g sorbitol, 5.88 calcium chloride, made up to 800 ml with 0.2 M potassium malate, autoclaved for 20 min at 120 °C). A protoplastization solution (100 mg of Trichoderma harzianum lysing enzyme in 20 ml of SmaC buffer, sterilized through a 0.22 pm pore size filter) was added to the mycelium. After 2 h incubation at 28 °C, the mixture was filtered through a Nytex membrane (Fluka, Germany). The filtrate was centrifuged and washed twice with STC buffer (154.84 g sorbitol, 1.22 g Tris, 7.36 g calcium chloride, made up to 1 liter with distilled water, pH adjusted to 7.5, autoclaved for 20 min at 120 °C), in which the pellet was subsequently resuspended. Purified linearized plasmid DNA, STC buffer and C. purpurea PI protoplasts were mixed in a microtube and after 20 min of incubation, PEG 6000 was added to the tube. After another 5 min of incubation, STC buffer was added. To verify protoplast preparation process, 20 ml of BII transformation agar (200 g sucrose, 5 g peptone, 5 g L- asparagine monohydrate, 1 g potassium hydrogen phosphate, 0.5 g magnesium sulphate heptahydrate, made up to 1 liter with distilled water, pH adjusted to 8.0, autoclaved for 20 min at 120 °C) was poured into a first petri dish together with C. purpurea PI protoplasts). To verify transformation process, 20 ml of transformation BII agar were together with a transformation mixture containing DNA and protoplasts poured into a second petri dish. 160 ml of transformation BII agar were together with a transformation mixture containing DNA and protoplasts were poured into eight petri dishes which were after 24 h overlaid with BII transformation agar containing Hygromycin gold (InvivoGen, San Diego, CA, USA) after 24 h so that the final antibiotic concentration in the medium was 200 mg/ml. The hygromycin resistance gene (hph), which is present in the pNDH-OGG vector, was used as a marker for selection of transgenic fungi. Fungi grown after transformation were transferred to new BII cultivation medium containing Hygromycin gold at a final concentration of 200 mg/ml . The fungi were cultivated in the dark at 26 °C.

3. Isolation of genomic DNA, detection of the transgene using PCR

Genomic DNA was isolated from the mycelia of C. purpurea (strain PI) transformants (Cenis JL. (1992), Nucleic Acids Res 20:2380). Lysis buffer (4.84 g Tris, 2.92 g sodium chloride, 1.86 g EDTA, 1 g SDS, made up to 200 ml with distilled water, pH adjusted to 8,5) was added to the lyophilized mycelia of C. purpurea PI transformants in a microtube. After 15 min of incubation at room temperature, 5 M potassium acetate was added to the mixture. After 20 min incubation at -20 °C, the samples were centrifuged, and the supernatant was mixed with isopropanol. After 45 min incubation at -20 °C, the samples were centrifuged and the pellet was washed with 70% ethanol (-20 °C). The pellet was dried and resuspended in nuclease-free water.

Transgene integration was verified at the genomic level by PCR using GoTaq G2 Flexi DNA polymerase (Promega corporation, Madison, Wisconsin, USA) and two sets of primers. The presence of the hph gene, which is part of the pNDH-OGG vector (5 '-GA ATTC AGCGAGAGCCTGAC-3 ' (SEQ ID NO. 11) and 5 "-ACATTGTTGGAGCCGAAATC-3 ' (SEQ ID NO. 12)) and the presence of the transgene (5 '-CCCGG A A ACTC ACT CTCCTT-3 ' (SEQ ID NO. 13) and

5'- GTCTTCCGCT AAAACACCCC-3 ' (SEQ ID NO. 14)) were verified for each putative transformant. Genomic DNA from wild type C. purpurea (strain PI) was used as a negative control, and the plasmid DNAs with individual genes were used as positive controls (Fig. 2-4).

Selected obtained transformants with the highest activities were stored in the Czech Collection of Microorganisms, CCM:

OE TrpE S76L 4 = CCM8984 (Cp TrpE SL)

OE ogfp-dmaW 8 = CCM8983 ( Cp dmaW)

4. Isolation of homocaryotic cultures of C. purpurea

Homokaryotic cultures of C. purpurea (strain PI) fungi were obtained by cutting the tips of hyphae. The fungi were grown for 1 week on Mantle agar (100 g sucrose, 10 g L-asparagine monohydrate, 1 g calcium nitrate tetrahydrate, 0.25 g potassium dihydrogen phosphate, 0.25 g magnesium sulphate heptahydrate, 0.033 g ferrous sulphate heptahydrate, 0.27 g ferrous sulphate heptahydrate, 0.01 g L- cysteine, 0.1 g yeast extract, 20 g agar, made up to 1 liter with distilled water, pH adjusted to 5.2, autoclaved for 20 min at 112 °C), and then hyphae tips were cut under a stereomicroscope behind dichotomous branching. The hyphae tips were transferred to new Mantle agar. This procedure was repeated three times.

Genomic DNA was isolated from all obtained C. purpurea homocaryotic cultures, and the presence of the transgene and hph gene was re -verified by PCR.

Example 2: Study of the transgenic DNA expression

RNA from transformants and wild type C. purpurea (strain PI) was isolated using an RN Aqueous kit (Thermo Fischer Scientific, Waltham, MA, USA). The obtained RNA was treated with DNAse (Thermo Fischer Scientific) and then precipitated with LiCl (Thermo Fischer Scientific). Subsequently, transcription into cDNA was performed using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Fischer Scientific). RT-PCR was performed using GoTaq G2 Flexi DNA polymerase (Promega corporation), two sets of primers were used. One set of primers was used to amplify the hph gene (5 '-G A ATTC AGCG AG AGCCTG AC-3 ' (SEQ ID NO. 11) and 5'- ACATTGTTGGAGCCGAAATC-3" (SEQ ID NO. 12)), the other to amplify the gene encoding g-actin, which served as an endogenous control (EnsemblFungi: CPUR_01270, 5'- CGCTCTCGTCATCGACAAT-3" (SEQ ID NO. 15) and 5'- ATTT C ACGCT CGGC ACT AGT-3 ' (SEQ ID NO. 16)) (Fig. 5).

Example 3: Determination of the content of ergot alkaloids in submerged cultures of C. purpurea PI

1. Sample preparation

C. purpurea (strain PI) transformants were cultivated in parallel with wild type C. purpurea (strain PI) for 3 weeks on Mantle agar. Then, each fungus was inoculated into six 250 ml Erlenmeyer flasks with 50 ml of liquid preinoculation InoCN medium (100 g sucrose, 10 g citric acid monohydrate, 0.12 g potassium chloride, 0.5 g potassium dihydrogen phosphate, 0.5 g magnesium sulphate heptahydrate, 1 g calcium nitrate tetrahydrate, 0.075 g nicotinic acid amide, 0.006 g zinc sulphate heptahydrate, 0.007 g ferrous sulphate heptahydrate, pFl adjusted to 5.2 with 10% NH₄OH, made up to 1 liter with distilled water, autoclaved for 15 min at 105 °C). After 5 days of incubation in the dark at 26 °C on a shaker (200 rpm), the cultures were centrifuged for 5 min (4700 rpm, room temperature). Sterile distilled water was added to each mycelium (40 ml per 6.97 g). Using a stick blender (BangCo, Brno, Czech Republic), the culture was homogenized and 2 ml of the obtained biomass were pipetted into a 250 ml Erlenmeyer flask containing 50 ml of T25N induction medium (300 g sucrose, 15 g citric acid monohydrate, 0.12 g potassium chloride, 0.5 g potassium dihydrogen phosphate, 0.5 g magnesium sulphate heptahydrate, 1 g calcium nitrate tetrahydrate, 0.075 g nicotinic acid amide, 0.006 g zinc sulphate heptahydrate, 0.007 g ferrous sulphate heptahydrate, pFl adjusted to 5.2 with 10% NH₄OH, made up to 1 liter with distilled water, autoclaved for 20 min at 115 °C). Cultures of C. purpurea expressing TrpE^S76L were cultivated along with the wild type for 10 days in the dark at 26 °C on a shaker (200 rpm), while the cultures expressing ogfp-dmaW and free ogfp were grown for 14 days under the same conditions.

In the end, the cultures were filtered through a Miracloth membrane (Merck, Darmstadt, Germany), and the media and mycelia were used for further analyzes. The volume of the media was measured, the mycelia were lyophilized in a SCANVAC lyophilizer (Trigon-plus, Ricany u Prahy, Czech Republic).

2. Detection of the transgene by PCR Genomic DNA was again isolated from all obtained lyophilized mycelia, and the presence of the transgene and the hph gene in all samples was verified by PCR (see Example 1, item 3, detection of the transgene by PCR analysis) (Fig. 6-9).

3. Extraction of the ergot alkaloids from the media

2 ml of T25N induction medium containing low level of phosphate from the culture of wild type or C. purpurea (strain PI) transformants were mixed with 2 ml of distilled water, the samples were pipetted onto SPE Catridges Octadecyl Cl 8/18% columns (Applied Separations, Allentown, PA, USA)activated by 5 ml of acetonitrile followed by 5 ml of distilled water. After washing the columns with 5 ml of distilled water, the ergot alkaloids were eluted with 3 ml of a 1:4 mixture of ammonium carbonate and acetonitrile. The eluate was evaporated under reduced pressure at 37 °C in an SPD SpeedVac instrument (Thermo electron, Waltham, MA, USA), the obtained residue was resuspended in 1 ml of 80% methanol. Subsequently, the sample was filtered through Costar SpinX 22 pm columns (Sigma-Aldrich, St. Louis, Missouri, USA) and 5 pi of this mixture were analyzed on UPLC.

4. Extraction of the ergot alkaloids from the mycelia

150 mg of lyophilized mycelium from the culture of wild type or C. purpurea (strain PI) transformants were extracted with 1 ml of a 1:1 mixture of acetone and 4% tartaric acid. After incubation on a shaker overnight at room temperature, the mixture was centrifuged for 10 min (14000 rpm, room temperature), the supernatant was evaporated under reduced pressure at 37 °C in an SPD SpeedVac instrument and the obtained residue was resuspended in 500 pi of 80% methanol. Subsequently, the sample was filtered through Costar SpinX 22 pm columns (Sigma-Aldrich) and 5 pi of this mixture were analyzed on UPLC.

5. Determination of the content of the ergopeptines

The prepared samples were analyzed by UPLC (ultra high performance liquid chromatography) using a Nexera system (Shimadzu, Prague, Czech Republic) equipped with a Cl 8 reversed phase column (Zorbax RRHD Eclipse Plus 1.8 pm, 2.1 mm ID x 150 mm, Agilent, Santa Clara, CA, USA). Mobile phase A contained 0.15% (w/w) acetic acid (pH = 4.4) and acetonitrile in a ratio of 4:1, mobile phase B contained acetonitrile and water in a ratio of 4:1. The contents of the following ergopeptines were determined in the samples: ergotamine, ergotaminine, a-ergocryptine and a-ergocryptinine (methodology based on: Cudejkova MM, Vojta P, Valfk J, Galuszka P. (2016), New Biotechnology, 33(5), 743-754, 2016). Ergopeptines were eluted with a mobile phase A (0.15% acetic acid pH 4.4 and acetonitrile, 4:1, v/v) and B (water and acetonitrile, 1:4, v/v) with the following gradient: 0-5 min, 7- 9% B; 5-7 min, 9-13% B; 7-9 min, 13-29% B; 9-11 min, 29-44% B; 11-13 min, 44% B; 13-15 min, 44-59% B; 15-18 min, 59% B; 18-19 min, 59-7% B; and 19-25 min, 7% B. The column temperature was set at 15 °C. The monitoring was performed at 317 nm. Alkaloid concentrations were read from the peak area using LabSolution software (Shimadzu). The concentrations of the individual alkaloids were calculated to 1 mg of lyophilized mycelium and 1 ml of T25N induction medium.

Outliers were excluded from the obtained data using the Grubbs test, the obtained data were subjected to non-parametric Kruskal-Wallis ANOVA test (Statistica 12 software).

Table 1 summarizes the average amounts of ergopeptines in 1 mg of lyofilized mycelium (WT, OE ogfp, OE ogfp_dmaW 8, OE ogfp_dmaW 13). The table clearly shows that the transformants expressing only ogfp did not show any difference in comparison to C. purpurea PI WT (wild type). On the other hand, the transformants expressing dmaW fused with ogfp show increased levels of ergotamine and ergotaminine. Transformant No. 13 has shown also a significant increase of a- ergocryptinine.

Table 2 summarizes the average amounts of ergopeptines in 1 ml of T25N induction medium (WT, OE gfp, OE gfp_dmaW 8, OE gfp_dmaW 13). The table shows that the transformants expressing only ogfp did not show any difference in comparison to wild type of C. purpurea PI. On the other hand, the transformants expressing dmaW fused with ogfp show increased levels of all examined ergopeptines, i.e., ergotamine, ergotaminine, a-ergocryptine and a-ergocryptinine.

Table 3 summarizes the average amounts of ergopeptines in 1 mg of lyofilized mycelium (WT, OE TrpE^S76L 4, OE TrpE^S76L 12). Significant increase of all examined ergopeptines (ergotamine, ergotaminine, a-ergocryptine and a-ergocryptinine) was observed only for transformant No. 4.

Table 4 summarizes the average amounts of ergopeptinesin 1 ml of T25N induction medium (WT, OE TrpE^S76L 4, OE TrpE^S76L 12). The table clearly shows that in both transformants, a significant increase of ergotamine and ergotaminine levels was observed. Transformant No. 4 showed also an increase in the levels of a-ergocryptine and a-ergocryptinine.

Table 1: Average content of ergopeptines ergotamine, ergotaminine, a-ergocryptine, a-ergocryptinine) in mycelia of wild type (WT) and transformants of C. purpurea (strain PI) expressing ogfp (OE ogfp) and dmaW fused with ogfp (OE ogfp-dmaW 8, OE ogfp-dmaW 13). The amount of alkaloids was calculated to 1 mg of lyofilized mycelium in the culture after 14 days of cultivation ± standard error. The values were obtained from 6 biological replicates. The data were analyzed by non-parametric Kruskal-Wallis ANOVA test: * p < 0.05, ** p < 0.01).

Table 2: Average content of ergopeptines ergotamine, ergotaminine, a-ergocryptine, a-ergocryptinine in media of wild type (WT) and transformants of C. purpurea (strain PI) expressing ogfp ( OE ogfp ) and dmaW fused with ogfp (OE ogfp-dmaW 8, OE ogfp-dmaW 13). The amount of alkaloids was calculated to 1 mg of medium in the culture after 14 days of cultivation ± standard error. The values were obtained from 6 biological replicates. The data were analyzed by non-parametric Kruskal -Wallis ANOVA test: * p < 0.05, ** p < 0.01).

Table 3: Average content of ergopeptines ergotamine, ergotaminine, a-ergocryptine, a-ergocryptinine in media of wild type (WT) and transformants of C. purpurea (strain PI) expressing the mutated version of TrpE (OE TrpE ^S76L 4, OE TrpE ^S76L 12). The amount of alkaloids was calculated to 1 mg of lyofilized mycelium in the culture after 10 days of cultivation ± standard error. The values were obtained from 6 biological replicates. The data were analyzed by non-parametric Kruskal -Wallis ANOVA test: * p < 0.05, ** p < 0.01, *** p < 0.01).

Table 4: Average content of ergopeptines ergotamine, ergotaminine, a-ergocryptine, a-ergocryptinine in media of wild type (WT) and transformants of C. purpurea (strain PI) expressing the mutated version of TrpE (OE TrpE ^S76L 4, OE TrpE ^S76L 12). The amount of alkaloids was calculated to 1 mg of medium in the culture after 10 days of cultivation ± standard error. The values were obtained from 6 biological replicates. The data were analyzed by non-parametric Kruskal-Wallis ANOVA test: * p < 0.05, ** p < 0.01, *** p < 0.01).

(Original in Electronic Form)

PCT

(Original in Electronic Form)

FOR RECEIVING OFFICE USE ONLY

FOR INTERNATIONAL BUREAU USE ONLY

Claims

1. Fungus Claviceps purpurea, characterized in that it comprises in its genome an inserted nucleotide sequence comprising at least one gene selected from gene TrpE^S76L which is a gene encoding a-subunit of anthranilate synthase having an S76L mutation, and gene dmaW which is a gene encoding dimethylallyltryptophan synthetase, wherein the inserted nucleotide sequence of the said at least one gene is under the control of a constitutive promoter.

2. The fungus of claim 1 , wherein the gene TrpE^S76L has a sequence with at least 90% identity to the sequence SEQ ID NO. 1, wherein the mutation of the serine -encoding codon at position 76 to the leucine-encoding codon (S76L) must be present; preferably the gene TrpE^S76L has the sequence SEQ ID NO. 1.

3. The fungus of claim 1, wherein the gene dmaW has a sequence with at least 90% identity to the sequence SEQ ID NO. 2, preferably the gene dmaW has the sequence SEQ ID NO. 2.

4. The fungus according to any one of the preceding claims, further comprising a codon-optimized ogfp gene encoding a green fluorescent protein for expression in Botrytis cinerea.

5. The fungus according to any one of the preceding claims, wherein the constitutive promoter is an OliC promoter of the nuclear gene encoding subunit 9 of the mitochondrial ATP synthetase from Aspergillus nidulans or an gpdA promoter of the gene encoding glyceraldehyde-3-phosphate dehydrogenase from Aspergillus nidulans.

6. A method for preparing the fungus Claviceps purpurea according to any one of claims 1 to 5, characterized in that it comprises the following steps:

- providing an expression cassette comprising a nucleotide sequence comprising at least one gene selected from gene TrpE^S76L encoding a-subunit of anthranilate synthase having the S76L mutation and gene dmaW encoding dimethylallyltryptophan synthetase, wherein the said at least one gene is under the control of a constitutive promoter, and further comprising a terminator; and optionally also comprising a codon-optimized ogfp gene encoding a green fluorescent protein for expression in Botrytis cinerea,

- and inserting the expression cassette into the genome of Claviceps purpurea.

7. The method according to claim 6, wherein the expression cassette is prepared by yeast recombinational cloning method, and/or the expression cassette is inserted into the genome of Claviceps purpurea by protoplast transformation method.

8. Expression cassette for use in the method according to claim 6 or 7, characterized in that it comprises a constitutive promoter, at least one gene selected from a gene TrpE^S76L encoding a-subunit of anthranilate synthase having the S76L mutation, and a gene dmaW encoding dimethylallyltryptophan synthetase, and a terminator; and optionally further comprising a codon- optimized ogfp gene encoding a green fluorescent protein for expression in Botrytis cinerea.

9. The expression cassette according to claim 8, having a sequence with at least 90% identity, more preferably with at least 95% identity, to a sequence selected from the group consisting of SEQ ID NO. 3 and SEQ ID NO. 4.

10. Use of the expression cassette according to claim 8 or 9 for preparing Claviceps purpurea for use as a production microorganism for the production of ergot alkaloids.

11. Use of the fungus Claviceps purpurea according to any one of claims 1 to 5 as a production microorganism for the production of ergot alkaloids.