WO2021008565A1 - Use of acetylcholine pathway modulators in treatment of cancer - Google Patents

Abstract

A method for treating a cancer in a subject (e.g., a human being) in need, comprising administering to a subject a therapeutically effective amount of an acetylcholine pathway modulator. The subject has previously received at least one anti-cancer treatment, or is resistant to at least one anti-cancer treatment, or has a cancer that has recurred or progressed after at least one anti-cancer treatment. Also provided is a combination for treatment of a cancer in a subject in need, comprising: a) an acetylcholine pathway modulator, and b) an antitumor agent.

Description

Use of acetylcholine pathway modulators in the treatment of cancer

This application claims priority for the Chinese patent application 201910638683.6 filed on July 16, 2019. Chinese patent application 201910638683.6 is incorporated herein by reference, which is a part of the disclosure of this application.

Technical field

The present invention relates to a method for the treatment of cancer in a subject in need thereof, and more specifically to the use of an acetylcholine pathway modulator in the treatment of cancer, the subject being resistant to at least one anti-cancer treatment, or suffering from Cancer that recurs or progresses after receiving at least one anti-cancer treatment.

Background technique

Cancer is the leading cause of death in developed countries. Among them, more than one million people are diagnosed in the United States each year, and the number of deaths exceeds 500,000 each year. In general, it is estimated that at least one-third of people will develop some form of cancer in their lifetime. There are more than 200 different histopathological types of cancer, of which four (breast cancer, lung cancer, colorectal cancer, and prostate cancer) account for more than half of all new cases in the United States. (Jemal et al., Cancer J. Clin., 53, 5-26 (2003)).

In addition to traditional surgery, radiotherapy and chemotherapy, targeted therapy and immunotherapy have also made great progress in specific treatment methods for cancer. However, primary and secondary drug resistance eventually make targeted therapy fall into a passive situation.

Previous studies believe that tumor resistance is caused by the genetic evolution of cancer: due to the heterogeneity of tumors, there is a small subset of cells in the tumor, called "survival cells" or "drug resistant cells," It will survive by entering a dormant state through non-genetic mechanisms, and later will evolve traditional genetic mutations that cause tumor resistance and recurrence.

Therefore, there is an urgent need for compounds suitable for the treatment or prevention of cancer, especially for the treatment of cancers that are resistant to known anti-cancer treatments.

Summary of the invention

In one aspect, the present invention relates to a method of treating cancer in a subject in need thereof, which comprises administering to the subject a therapeutically effective amount of an acetylcholine pathway modulator.

In some embodiments, the subject has previously received at least one anti-cancer treatment. In some embodiments, the subject is resistant to at least one anti-cancer treatment, or suffers from a cancer that recurs or progresses after receiving at least one anti-cancer treatment.

In another aspect, the present invention relates to a combination for the treatment of cancer in a subject in need thereof, comprising: a) an acetylcholine pathway modulator; and b) an antitumor agent, wherein the antitumor agent is selected from chemotherapeutics And targeted drugs.

In another aspect, the present invention relates to a pharmaceutical composition comprising: a) an acetylcholine pathway modulator; and b) an antitumor agent, wherein the antitumor agent is selected from chemotherapeutic drugs and targeted drugs.

In another aspect, the present invention relates to a kit comprising: a) a first composition comprising an acetylcholine pathway modulator; and b) a second composition comprising an antitumor agent, wherein the antitumor agent is selected from chemotherapeutics And targeted drugs.

In another aspect, the present invention relates to a method of treating cancer, comprising administering a combination of an acetylcholine pathway modulator and an antitumor agent.

In another aspect, the present invention relates to an acetylcholine pathway modulator for use in the treatment of cancer.

In another aspect, the present invention relates to the use of an acetylcholine pathway modulator in the preparation of a medicament for the treatment of cancer.

In some embodiments, the cancer is resistant to at least one anti-cancer treatment, or is a cancer that recurs or progresses after at least one anti-cancer treatment.

In another aspect, the present invention relates to a drug comprising an acetylcholine inhibitor, wherein the acetylcholine pathway modulator is for administration in combination with an anticancer drug.

In another aspect, the present invention relates to the use of acetylcholine as a biomarker, wherein the biomarker is used to identify subjects who have developed resistance to anti-cancer therapy, or to identify those who have developed cancer after undergoing anti-cancer therapy. Subjects who have relapsed or progressed.

In another aspect, the present invention relates to reagents for detecting acetylcholine in preparation for identifying subjects who are resistant to anticancer therapy, or for identifying subjects who have undergone anticancer therapy to relapse or progress. Use in the kit.

Brief description of the drawings

Figure 1 shows the sensitivity of parental cells and drug-resistant cells of non-small cell lung cancer cell lines to EGFR mutation targeting drugs. Figure 1A is a schematic diagram of a method for inducing parental cells of non-small cell lung cancer into drug-resistant cells. Figure 1B shows the results of cell viability experiments. In the non-small cell lung cancer cell line PC9 drug-resistant cell model, the sensitivity of drug-resistant cells to targeted drugs (gefitinib and osimertinib) is similar to that of parent cells The ratio is significantly lower. Figure 1C shows the results of cell viability experiments. In the drug-resistant cell model of the non-small cell lung cancer cell line HCC827, the sensitivity of drug-resistant cells to targeted drugs (gefitinib and osimertinib) is similar to that of parent cells The ratio is significantly lower.

Figure 2 shows the metabonomic analysis of the acetylcholine content in the parental cells and drug-resistant cells of non-small cell lung cancer cell lines. According to Figure 2, the content of acetylcholine in PC9 drug-resistant cells was significantly higher than that of parent cells.

Figures 3A and 3B respectively show the content of acetylcholine in the PC9 nude mouse model and the PDX-217645 model, indicating that the acetylcholine content in the drug-resistant tissues of the PC9 nude mouse model and the PDX model is significantly increased.

Figure 4 shows the content of acetylcholine in PC9 parent cells and drug-resistant cell culture media. Compared with PC9 parent cells, the amount of acetylcholine secreted to the outside of the cell by drug-resistant cells was significantly increased.

Figure 5 shows the plasma levels of acetylcholine in patients with non-small cell lung cancer with EGFR mutations before and after targeted therapy. Figure 5A shows the average value of acetylcholine levels in the plasma of patients before and after targeted therapy. Figure 5B shows the changes in plasma acetylcholine levels in 8 patients before and after targeted therapy. The results of Figures 5A and 5B show that the plasma acetylcholine content of patients with EGFR mutations in non-small cell lung cancer after targeted therapy is higher than the plasma level of acetylcholine before targeted therapy.

Figure 6 shows the protein level expression changes of key factors in the acetylcholine metabolic pathway. Figure 6A shows that choline acetyltransferase (ChAT) is up-regulated in the drug tolerance model of non-small cell lung cancer cell lines. Figure 6B shows that acetylcholinesterase (ACHE) is down-regulated at the protein level.

Figure 7 shows the activation of the Wnt signaling pathway in drug-resistant cells. Figure 7A shows the RNAseq results of PC9 parent cells and drug-resistant cells. It can be seen that Wnt ligands and Wnt pathway target genes in drug-resistant cells are higher than those in parent cells. Figure 7B shows the results of real-time fluorescent quantitative PCR. It can be seen that the expression of Wnt ligand and Wnt pathway target genes in PC9 drug-resistant cells is significantly higher than that of parent cells.

Figure 8 shows the effect of exogenous acetylcholine on the Wnt signaling pathway in the parental cells of the non-small cell lung cancer cell line HCC827. Among them, HCC827 parent cells were treated with different concentrations of acetylcholine for 7 days. Real-time fluorescent quantitative PCR results showed that the expression of Wnt ligand and Wnt pathway target genes were significantly up-regulated, including S100A4 and KLF4 related to metastasis, and BCL2L1 related to anti-apoptosis. It is suggested that exogenous acetylcholine can promote the activation of Wnt pathway in the parental cells of non-small cell lung cancer cell lines.

Figure 9 shows the effect of exogenous acetylcholine on the sensitivity of parental cells of the non-small cell lung cancer cell line PC9 to drugs. Figure 9A shows the results of cell viability experiments. It can be seen that exogenous addition of acetylcholine significantly reduces the sensitivity of PC9 parent cells to the targeted drug gefitinib. Figure 9B shows the results of cell viability experiments. It can be seen that exogenous addition of acetylcholine significantly reduces the sensitivity of PC9 parent cells to the targeted drug osimertinib.

Figure 10 shows that Wnt pathway inhibitors can inhibit the effect of exogenous acetylcholine on drug sensitivity of PC9 parent cells. The cell viability test results showed that the addition of Wnt pathway inhibitor LGK974 can significantly reduce the viability of PC9 cells, thereby reversing the effect of acetylcholine on the drug sensitivity of PC9 parent cells.

Figure 11 shows the results of cell viability experiments. Figure 11A shows that PC9 cells knocked down by shChAT have a significantly increased sensitivity to osimertinib. Figure 11B shows that the sensitivity of shChAT knockdown HCC827 cells to gefitinib was significantly increased.

Figure 12 shows the results of the clone formation experiment. Figure 12A shows that, compared with control cells, PC9 cells knocked down by shM3R and shVAChT have a reduced ability to form drug-resistant cells under 2 μM osimertinib treatment. Figure 12B shows that, compared with control cells, HCC827 cells knocked down by shM3R and shVAChT have a reduced ability to form drug-resistant cells under 2 μM osimertinib treatment.

Figure 13 shows the inhibitory effect of acetylcholine M receptor inhibitors on drug-resistant cells. Figure 13A shows the effect of acetylcholine M receptor inhibitors (including darfinacine, benztropine mesylate, isoladine and methylscopolamine) on osimertinib-induced PC9 drug-resistant cells Among them, it can be seen that the inhibitor of M-type receptor significantly reduces the cell viability in the presence of osimertinib, indicating that it can significantly inhibit the formation of drug-resistant cells induced by osimertinib, but has no effect on the parent cells. Figure 13B shows the PC9 drugs induced by acetylcholine M receptor inhibitors (including darfinacine and benztropine mesylate) on different targeted drugs (including gefitinib, erlotinib and CO1686) It can be seen that inhibitors of M-type receptors significantly reduce cell viability in the presence of gefitinib, erlotinib or CO1686, and it can be seen that inhibitors of M-type receptors can significantly inhibit different EGFR The formation of drug-resistant cells induced by targeted drugs, but has no effect on parent cells.

Figure 14 shows the inhibitory effect of acetylcholine N receptor inhibitors on drug-resistant cells. Specifically, Figure 14 shows the effect of inhibitors of acetylcholine N-type receptors (MG624, mecamylamine and pancuronium) on different targeted drugs (including osimertinib, gefitinib, erlotinib and CO1686) It can be seen that the inhibitors of the N-type receptor significantly reduce the cell viability in the presence of different targeted drugs, indicating that the inhibitors of the N-type receptor can significantly inhibit the drugs targeted by different EGFR The induced drug-resistant cell formation has no effect on the parental cells.

Figure 15 shows the inhibitory effects of different targets of the acetylcholine pathway on drug-resistant cells. Specifically, Figure 15 shows the PC9 drug-resistant cells induced by the acetylcholine transporter inhibitor Vesamicol and the choline transporter inhibitor hemicholine-3 against different targeted drugs (including osimertinib and gefitinib) It can be seen that Vesamicol and hemicholine-3 significantly reduce cell viability in the presence of different targeted drugs, indicating that acetylcholine transporter inhibitors and choline transporter inhibitors can significantly inhibit the induction of different EGFR-targeted drugs The drug is resistant to the formation of cells, but has no effect on the parental cells.

Figure 16 shows the effect of acetylcholine pathway modulators on PDX in vitro cell model. Specifically, Figure 16 shows that the acetylcholine M-type receptor inhibitor darfinacine significantly reduced the formation of drug-resistant cells induced by osimertinib in tumor cells isolated from PDX tissue.

Figure 17 shows the inhibitory effects of different target inhibitors of the acetylcholine pathway on ALK gene fusion non-small cell lung cancer cell line drug-resistant cells. Specifically, Figure 17 shows the acetylcholine M receptor inhibitor darfinacine, the acetylcholine transporter inhibitor Vesamicol, and the choline transporter inhibitor hemicholine-3 against different ALK mutation-targeted drugs (including ceritin). And Alectinib)-induced H2228 drug-resistant cells. It can be seen that different acetylcholine pathway modulators significantly reduce cell viability in the presence of different ALK targeted drugs, indicating that acetylcholine M receptor inhibitors, acetylcholine Transporter inhibitors and choline transporter inhibitors can significantly inhibit the formation of drug-resistant cells induced by different ALK targeted drugs, but have no effect on parent cells.

Figure 18 shows the inhibitory effect of acetylcholine M3 receptor inhibitor darfinacine on drug-resistant cells (including chemotherapeutics and targeted drugs) of other tumor (including breast cancer, colorectal cancer, and melanoma) cell lines. Specifically, Figure 18 shows that the acetylcholine M receptor inhibitor darfinacine can significantly inhibit other tumors (including breast cancer, colorectal cancer and melanoma) cells in the presence of different drugs (including chemotherapeutics and targeted drugs) The drug of the line is resistant to the formation of cells, but has no significant inhibitory effect on the parental cells.

Figure 19 shows the effect of acetylcholine pathway modulators on the maintenance phase of drug-resistant cells. Specifically, Figure 19A shows the cell viability of darfinacine to established drug-resistant cells in the presence of osimertinib. Figure 19B shows the effect of darfinacine on the viability of established drug-resistant cells. The results show that darfinacine can effectively inhibit the maintenance of drug-resistant cells.

Figures 20-22 show the inhibitory effect of acetylcholine M receptor inhibitor darfinacine on tumor recurrence in vivo. Among them, the non-small cell lung cancer cell line PC9 was selected to establish a subcutaneous xenograft tumor model in nude mice. After the tumor grew to a certain size, the nude mice were randomly divided into 4 groups: the first group was the control group; the second group was monogadafinacin Group; the third group is a single osimertinib group; the fourth group is a combined osimertinib and darfinacine group, in which osimertinib is stopped after the 9th day, and the subsequent single osimertinib group; In the 5 groups, osimertinib was administered alone for the first 9 days, and osimertinib was discontinued after the 9th day, followed by dalfenacin; in the 6th group, osimertinib and osimertinib were administered in the first 9 days. For darfinacine, osimertinib and darfinacine were stopped after the 9th day.

Figure 20 shows that after 9 days of drug treatment, the tumor volume in the 3rd and 4th groups quickly shrank to a stable level, forming tiny residual lesions. After 20 days of treatment, compared with the third group, the tumor recurrence rate of the nude mice in the darfinacine treatment group in the fourth group was significantly reduced. Figure 20A is a statistical graph of tumor volume. It can be seen that the continued administration of darfinacine after discontinuation of osimertinib in group 4 can significantly inhibit tumor recurrence. Figure 20B is a statistical graph of tumor weight. It can be seen that the weight of the tumors in the fourth group after the continued osimertinib treatment was given darfinacine treatment was significantly reduced. Figure 20C is a schematic diagram of tumor size.

Figure 21 shows that after 9 days of administration of osimertinib alone, the tumor volume decreased rapidly. Observed for about 20 days after the drug was removed, it can be seen that the tumor recurred rapidly in the third group after the drug was removed, but the tumor in the fifth group The recurrence was slower, and the tumor volume was significantly lower than that of group 3.

Figure 22 shows that in the 3rd and 6th groups, the tumor volume shrinks rapidly. Observed for about 20 days after the drug is removed, it can be seen that the tumor recurs rapidly in the 3rd group after the drug is removed, but the 6th group is being removed After osimertinib, tumor recurrence was slower, and the tumor volume was significantly lower than that of osimertinib alone.

Figure 23 shows the effect of acetylcholine M receptor inhibitor darfinacine combined with osimertinib on drug response and survival in mice. Specifically, Figure 23A shows that the tumor volume of the combination group of osimertinib and darfinacine was significantly smaller than that of the osimertinib alone group. At the same time, Figure 23B shows that the survival time of mice in the combination group of osimertinib and darfinacine was significantly higher than that of the osimertinib group alone.

definition

As used herein, when the term "about" is used in conjunction with a numerical range, it modifies the range by expanding the boundaries above and below the stated numerical value. Generally speaking, the term "about" is used in the present invention to modify a numerical value to a variation of 10% above and below the stated value.

As used herein, the term "treatment" and related expressions refer to therapeutic treatment. When it comes to a specific condition, treatment means: (1) ameliorate the condition or one or more of the biological manifestations of the condition, (2) interfere with (a) one of the biological cascades that cause or cause the condition or Multiple points, or (b) one or more biological manifestations of the disorder, (3) alleviate one or more symptoms, effects, or side effects related to the disorder, or one or more related to the disorder or its treatment Various symptoms, effects or side effects, or (4) slow down the progress of the disease, or slow down one or more biological manifestations of the disease.

As used herein, "prevention" refers to prophylactic administration to substantially reduce the likelihood or severity of a disorder or its biological manifestations, or to delay the onset of such a disorder or its biological manifestations. Those skilled in the art will understand that "prevention" is not an absolute term. For example, when the subject is considered to be at high risk of developing cancer, such as when the subject has a strong family history of cancer or when the subject has been exposed to carcinogens, prophylactic treatment is appropriate.

As used herein, the term "effective amount" means the amount of a drug or agent that elicits a biological or pharmaceutical response of a tissue, system, animal, or human, for example, which is sought by a researcher or clinician. In addition, the term "therapeutically effective amount" means an amount that causes an improved treatment, cure, prevention, or alleviation of a disease, disorder, or side effect, or reduces the rate of progression of the disease or disorder, compared to a corresponding subject who did not receive the amount The amount. The term also includes an amount effective to enhance normal physiological functions within its scope.

As used herein, "pharmaceutically acceptable" refers to a substance that is not biologically undesirable or otherwise undesirable. For example, the substance can be incorporated into a pharmaceutical composition administered to a patient without causing any significant adverse effects. The desired biological effect will not interact in a harmful way with any other ingredients contained in the composition. Pharmaceutically acceptable carriers (e.g., carriers, adjuvants, and/or other excipients) have preferably met the required standards for toxicology and finished product testing and/or have been included in the regulations established by the U.S. Food and Drug Administration Inactive ingredients guide.

"Pharmaceutically acceptable salts" include, for example, salts of inorganic acids and salts of organic acids. Examples of salts may include hydrochloride, phosphate, pyrophosphate, hydrobromide, sulfate, sulfinate, nitrate, malate, maleate, fumarate, tartrate, succinate Acid salt, citrate, acetate, lactate, methanesulfonate, p-toluenesulfonate, 2-isethionate, benzoate, salicylate, stearate and Alkanoate (for example, acetate, HOOC-(CH ₂ ) _n -COOH, where n is 0-4). Furthermore, if the compound herein is obtained as an acid addition salt, the free base can be obtained by alkalizing a solution of the acid salt. Conversely, if the compound herein is a free base, an addition salt (especially a pharmaceutically acceptable addition salt) can be prepared by dissolving the free base in a suitable organic solvent and treating the solution with an acid. According to the conventional operation of preparing acid addition salt from base compound. Those skilled in the art will understand various synthetic methods that can be used to prepare non-toxic pharmaceutically acceptable addition salts.

As used herein, "subject" refers to an animal, such as a mammal (including a human), which has been or will be the subject of treatment, observation, or experiment. The methods described herein can be used in human therapy and/or veterinary applications. In some embodiments, the subject is a mammal. In one embodiment, the subject is a human.

As used herein, the term "inhibition" means a decrease in the baseline activity of a biological activity or biological process.

Detailed description of the invention

The present inventors discovered for the first time that in drug-resistant cells resistant to anticancer drugs, the content of the neurotransmitter acetylcholine is significantly up-regulated, and exogenous acetylcholine can significantly reduce the sensitivity of cancer cells to anticancer drugs.

The present inventors further found that increased acetylcholine can activate the Wnt pathway in cancer cells, and the addition of Wnt pathway inhibitors can reverse the effect of acetylcholine on the drug sensitivity of cancer cells, thereby indicating that acetylcholine promotes drugs by activating the Wnt pathway in cancer cells. Tolerant cell formation and maintenance.

On this basis, the present inventors demonstrated for the first time that the related inhibitors of acetylcholine synthesis and secretion pathways, namely acetylcholine pathway modulators, can effectively inhibit the production of drug-resistant cells, reverse the resistance of cancer cells to anti-tumor agents, and effectively Inhibit the recurrence of tumors in the body.

I. Acetylcholine pathway modulator

As used herein, "acetylcholine" refers to a neurotransmitter represented by the formula CH ₃ COO(CH ₂ ) ₂ N ⁺ (CH ₃ ) ₃ , which is released from parasympathetic or motor nerve terminals. Acetylcholine is distributed throughout neurons, but the concentration is highest in nerve endings.

The formation of the neurotransmitter acetylcholine is catalyzed by choline acetyltransferase (ChAT), which transfers the acetyl group of acetyl-CoA to choline in the presynaptic nerve terminals of cholinergic neurons. Acetylcholine is packaged into synaptic vesicles by the vesicle acetylcholine transporter (VAChT), and then released in a calcium-dependent manner. Acetylcholine specifically binds to nicotinic or muscarinic receptors (AChR) to transmit information to postsynaptic neurons. The action of acetylcholine is terminated by the hydrolysis of acetylcholinesterase into acetic acid and choline. Most of the choline is then transported back to the presynaptic terminal and recycled as one of the precursors of acetylcholine biosynthesis. This step is mediated by the action of the high-affinity choline transporter (CHT1).

As used herein, "acetylcholine pathway modulator" refers to molecules that directly or indirectly interfere with the function of acetylcholine, including molecules that can interfere with the acetylcholine metabolism pathway, acetylcholine transport and secretion process, and the acetylcholine signaling pathway. In a preferred embodiment, the acetylcholine pathway modulator is an acetylcholine pathway inhibitor that inhibits the function of acetylcholine. Examples of acetylcholine pathway modulators include, but are not limited to, acetylcholine receptor inhibitors, acetylcholine transporter inhibitors, choline transporter inhibitors, acetylcholinesterase (or nucleic acid encoding it), acetylcholine receptor antibodies (or nucleic acid encoding it) ), agents that inhibit the gene expression of acetylcholine receptors (for example, ribozymes, antisense nucleic acids and siRNAs encoding acetylcholine receptor genes), and induce protein degradation agents for acetylcholine receptors (for example, based on proteolytic targeted chimera technology Protein degradation agent), inhibitors of choline acetyltransferase, reagents that inhibit choline acetyltransferase gene expression (for example, gene ribozymes, antisense nucleic acids and siRNA), protein degradation agents that induce choline acetyltransferase (For example, protein degradation agent based on proteolytic targeted chimera technology) and so on.

By measuring the anticholinergic effect, it can be determined whether a substance can be used as an acetylcholine pathway modulator in the composition of the present invention. For example, when preparing antibodies to acetylcholine receptors or substances that inhibit the transcription of genes encoding acetylcholine receptors (for example, ribozymes, antisense nucleic acids, or siRNAs of genes encoding acetylcholine receptors), it can be determined by measuring the anticholinergic effect whether The prepared substance can be used in the composition of the present invention. If a substance has an anticholinergic effect when its anticholinergic effect is measured, it can also be used in the composition of the present invention.

Preliminary screening of substances with anticholinergic effects can be performed by measuring the interaction with acetylcholine receptors using Biacore. For example, acetylcholine receptors can be immobilized on the flow cell, and the sample can be allowed to flow into the flow cell to screen substances that bind to the acetylcholine receptors, where the change in the sensor pattern is used as an indicator (Spurny et al., Proc Natl Acad Sci USA. 2015 May 12 ; 112(19):E2543-52). Candidate substances isolated through primary screening can be determined by measuring the decrease in acetylcholine activity after adding them to the suspension of guinea pig ileum to determine whether the substance has anticholinergic effects (Acred et al., Br J Pharmacol Chemother. 1957 December; 12(4) ):447-52).

As used herein, "acetylcholine receptor inhibitor" refers to a substance that partially or completely inhibits the action of the neurotransmitter acetylcholine by acting on the acetylcholine receptor. Examples of acetylcholine receptor inhibitors include antagonists of acetylcholine receptors. Acetylcholine receptor agonists (for example, partial agonists and inverse agonists) that ultimately act as inhibitors can also be used as acetylcholine receptor inhibitors.

As used herein, "protein degradation agent" includes protein degradation targeted chimera (PROTAC), that is, a hybrid bifunctional small molecule compound capable of removing specific proteins, and its structure contains two different ligands: one is pan The E3 ligand of ligase, the other is a ligand that binds to the target protein in the cell, and the two ligands are connected by a linker. PROTAC forms the target protein-PROTAC-E3 ternary polymer by drawing the target protein and E3 in the cell closer, and adds a ubiquitinated protein tag to the target protein through E3 ubiquitin ligase to initiate intracellular ubiquitin hydrolysis The process uses the ubiquitin-proteasome pathway to specifically degrade the target protein. The protein degrading agent that can be used as the acetylcholine pathway modulator in the present invention includes a protein degrading agent that induces degradation of acetylcholine receptor and/or a protein degrading agent that induces degradation of choline acetyltransferase.

As used herein, "acetylcholine receptor" refers to a protein that specifically recognizes and binds acetylcholine. It is abbreviated as AChR, also known as cholinergic receptor. Receptors that use nicotine as an agonist are called nicotinic acetylcholine receptors (N-type acetylcholine receptors), and receptors that use muscarinic as agonists are called muscarinic acetylcholine receptors (M-type acetylcholine receptors). body). "Nicotine acetylcholine receptor" is also called "nicotinic receptor", abbreviated as nAChR. Two types of nicotinic acetylcholine receptors are known, namely nicotinic acetylcholine receptors of skeletal muscle and nicotinic acetylcholine receptors of nerves. Skeletal muscle nicotinic acetylcholine receptors are present at the neuromuscular junctions of motor nerve endings, while nerve nicotinic acetylcholine receptors are present at the preganglionic fiber ends (ganglion part) of sympathetic and parasympathetic nerves. "Muscarinic acetylcholine receptor" is also called "muscarinic receptor", abbreviated as mAChR. Five subtypes of muscarinic acetylcholine receptors (M1 to M5) have been confirmed. The distribution of the five subtypes varies from organ to organ.

As used herein, "antagonist" refers to a substance that inhibits the action of a ligand (for example, a neurotransmitter such as acetylcholine, hormone, etc.) by acting on a receptor. Antagonists are also called blockers. Antagonists include competitive antagonists that bind to the receptor to prevent ligand binding and inhibit its action, and non-competitive antagonists that act on sites other than the receptor to induce an action opposite to a specific ligand to inhibit the action of the ligand. Agent.

As used herein, "agonist" refers to a substance that exhibits the same or different function from that of a ligand (for example, a neurotransmitter such as acetylcholine, hormone, etc.) by acting on a receptor. Agonists include agonists that exhibit a physiological action similar to the original action of the ligand and partial agonists that have a weaker action relative to the original ligand (even when administered at a high concentration). There are also inverse agonists, which, by binding to the receptor, exhibit an effect opposite to the physiological effect of the original ligand.

As used herein, examples of muscarinic receptor inhibitors include, but are not limited to, darfinacine, benzatropine, isoladine, methylscopolamine, trihexyphenidyl, scopolamine butylbromide, pirenzepine, iso Proptropium bromide, oxytropium bromide, tiotropium bromide, atropine, topecaramide, diphenhydramine, dicyclomine, oxybutynin, tolterodine, sophenacine, propaline bromide, Scopolamine, Scopolamine Bromide, Orphenadrine, Homatropine, Methixol, Episate Bromide, Midanasine, Fesoterodine, and its pharmaceutically acceptable salts, solvates, prodrugs , Metabolites and their combinations.

As used herein, examples of nicotinic receptor inhibitors include, but are not limited to, MG624, mecamylamine, pancuronium bromide, succinylcholine chloride, decahylammonium bromide, vecuronium bromide, pancuronium bromide, chlorine Toxicrine, camphormifene, hexamethylammonium bromide, atracurium, doxonium chloride, mcuronium chloride, dextromethorphan, methyl oxopyridine, α-causarium, α-taro Spirotoxin G1, benzquinone ammonium, bPiDDB, its pharmaceutically acceptable salts, solvates, prodrugs, metabolites, and combinations thereof.

As used herein, an "acetylcholine transporter inhibitor" is a substance that acts by inhibiting the uptake of acetylcholine into synaptic vesicles via the vesicular acetylcholine transporter and reducing its release. Examples of acetylcholine transporter inhibitors include, but are not limited to, 2-(4-phenylpiperidinyl) cyclohexanol (Vesamicol).

As used herein, a "choline transporter inhibitor" is a drug that blocks the reuptake of choline by a high-affinity choline transporter. Choline reuptake is the rate-limiting step in the synthesis of acetylcholine. Therefore, choline transporter inhibitors down-regulate the synthesis of acetylcholine. Examples of choline transporter inhibitors include, but are not limited to, hemicholine-3.

As used herein, "choline acetyltransferase" refers to an enzyme that catalyzes the reaction of producing acetylcholine and CoA from acetyl CoA and choline, and is abbreviated as ChAT. "Choline acetyltransferase inhibitor" refers to a substance that inhibits the production of acetylcholine catalyzed by choline acetyltransferase. Examples of choline acetyltransferase inhibitors include, but are not limited to, the compounds disclosed in J. Med. Chem., 1969, vol. 12, 134-38, antibodies that can specifically bind choline acetyltransferase, and the like.

As used herein, "acetylcholinesterase" refers to an enzyme that decomposes acetylcholine into choline and acetic acid to eliminate the effect of acetylcholine, where the acetylcholine is released as a neurotransmitter. Using this enzyme activity, acetylcholinesterase can act as an acetylcholine inhibitor.

As used herein, "an antibody that blocks the binding of acetylcholine to the acetylcholine receptor" refers to an antibody that blocks the binding of acetylcholine to the acetylcholine receptor by specifically binding to a specific part (or near) related to the acetylcholine receptor. This antibody can inhibit the effect of acetylcholine. Alternatively, the "antibody that blocks the binding of acetylcholine to acetylcholine receptors" may be an antibody that inhibits the binding of acetylcholine to acetylcholine receptors. Examples of the antibodies include human monoclonal antibodies and humanized monoclonal antibodies (and F(ab) ₂ fragments, Fv fragments, and single chain antibodies), which block the binding of acetylcholine to acetylcholine receptors. Antibodies can be chimeric or humanized. The chimeric antibody herein includes the constant region of a human antibody and the variable region of a non-human antibody, such as a mouse antibody. Humanized antibodies include the constant regions and framework variable regions (ie, variable regions other than the hypervariable regions) of human antibodies and the hypervariable regions of non-human antibodies such as mouse antibodies. In another embodiment, the antibody may be an antibody selected by a phage display system, or an antibody obtained by any other method, such as a human antibody produced by Xenomouse or its antibody derivative.

As used herein, examples of the "agent for inhibiting acetylcholine receptor gene expression" include ribozymes, antisense nucleic acids, and siRNAs of genes encoding acetylcholine receptors, but siRNA is preferred. The siRNA of the gene encoding the acetylcholine receptor can be used to knock down (inhibit) the expression of the gene.

In some embodiments, the agent that inhibits acetylcholine receptor gene expression is siRNA. siRNA is an RNA molecule having a double-stranded RNA portion composed of 15 to 40 bases, which has a function of cutting the mRNA of a target gene having a sequence complementary to the antisense strand of the siRNA that inhibits the expression of the target gene. More specifically, the siRNA in the present invention is an RNA that includes a double-stranded RNA portion consisting of a sense RNA strand and an antisense RNA strand, and the sense RNA strand is composed of an acetylcholine receptor and the like. The contiguous RNA sequence in the mRNA is composed of a sequence homologous, and the antisense RNA strand is composed of a sequence complementary to the sense RNA sequence.

The design and manufacture of such siRNAs and mutant siRNAs discussed below fall within the technical capabilities of those skilled in the art. Those skilled in the art can appropriately select any continuous RNA region of mRNA, which is a transcription product of the acetylcholine receptor sequence, to prepare double-stranded RNA corresponding to this region in a normal procedure. Those skilled in the art can also appropriately select an siRNA sequence with a more effective RNAi effect from the mRNA sequence by a known method, and the mRNA sequence is a transcription product of the sequence.

In order to prepare siRNA, the following conditions can be added: (1) lack of 4 or more consecutive G or C; (2) lack of 4 or more consecutive A or T; or (3) less than 9 G Or C. The length of the double-stranded RNA portion is 15 to 40 bases, preferably 15 to 30 bases, more preferably 15 to 25 bases, still more preferably 18 to 23 bases, and most preferably 19 to 21 bases. It should be understood that the upper and lower limits are not limited to these specific numbers, but can be any combination of the listed numbers. The end structure of the sense strand or antisense strand of the siRNA is not particularly limited, and can be appropriately selected according to the purpose. For example, the structure may have a blunt end or a sticky end (overhang), and preferably has a type of protruding 3'end. SiRNAs having an overhang composed of several bases (preferably 1 to 3 bases, more preferably 2 bases) at the 3'end of the sense RNA strand and the antisense RNA strand are preferred because they usually have inhibitory effects. Significant effect on the expression of target genes.

The type of base at the overhang is not particularly limited, and it may be a base constituting RNA or a base constituting DNA. Examples of preferred overhanging sequences include dTdT (2-base deoxy T) at the 3'end and the like. Examples of preferred siRNAs include, but are not limited to, siRNAs having dTdT (2-base deoxy T) at the 3'end of the sense/antisense strands of all siRNAs.

In addition, siRNA in which there is a deletion, substitution, insertion, and/or addition of one to several nucleotides in the sense strand and/or antisense strand of the aforementioned siRNA can also be used. The one or more bases used herein are not particularly limited, but preferably 1 to 4 bases, more preferably 1 to 3 bases, and most preferably 1 to 2 bases. Specific examples of such mutations include, but are not limited to: mutations of 0 to 3 bases in the 3'overhang; mutations in which the base sequence of the 3'overhang is changed to another base sequence; due to base insertion , Additions or deletions lead to mutations in which the lengths of the sense RNA strand and antisense RNA strand differ by 1 to 3 bases; mutations in which a base in the sense strand and/or antisense strand is replaced with another base, etc. However, the sense strand and the antisense strand must be hybridized in this mutant siRNA, and these mutant siRNAs have the ability to inhibit gene expression equivalent to that of siRNA without any mutation.

The siRNA may also be a molecule having a structure with one end closed, such as siRNA (short hairpin RNA; shRNA) having a hairpin structure. shRNA is RNA that contains the following: a sense strand RNA of a specific sequence of a target gene, an antisense strand RNA composed of a sequence complementary to the sense strand sequence, and a linker sequence for connecting two strands, in which the sense strand part Hybridize with the antisense strand to form a double-stranded RNA portion.

In order to prepare the siRNA according to the present invention, a known method such as a method using chemical synthesis or a method using gene recombination technology can be appropriately used. When a synthetic method is used, a double-stranded RNA can be synthesized based on sequence information by using a conventional method. When using gene recombination technology, it is possible to construct an expression vector encoding the sense strand sequence or the antisense strand sequence and introduce the vector into the host cell, and then obtain each of the sense strand RNA and the antisense strand RNA by transcription. Prepare siRNA. The desired double-stranded RNA can also be prepared by expressing shRNA that forms a hairpin structure, which contains the sense strand of a specific sequence of the target gene, an antisense strand composed of a sequence complementary to the sense strand sequence, And the linker sequence used to connect the two chains.

For siRNA, all or part of the nucleic acid constituting the siRNA may be a naturally-occurring or modified nucleic acid, as long as the nucleic acid has the activity of suppressing the expression of the target gene. A modified nucleic acid refers to a nucleic acid that has a modification in the nucleoside (base portion, sugar portion) and/or the binding site between nucleosides and has a structure different from a naturally-occurring nucleic acid.

It is also possible to introduce the nucleic acid or reagent of the present invention into the phospholipid endoplasmic reticulum such as liposome (carrier) and administer the endoplasmic reticulum. Lipofection can be used to introduce the endoplasmic reticulum in which siRNA or shRNA is retained into a given cell. The resulting cells are then administered systemically, for example, intravenously or intraarterially. It can also be applied topically to the desired area on the skin, etc. Although siRNA exhibits very good specific post-transcriptional inhibition in vitro, due to the nuclease activity in serum, siRNA is rapidly degraded in vivo, so its duration is limited. Therefore, there is a need to develop better and more effective delivery systems. For example, Ochiya, T et al., Nature Med., 5:707-710, 1999, Curr. Gene Ther., 1:31-52, 2001 reported that when mixed with nucleic acid to form a complex, the biocompatibility decreases Telopeptide collagen is a carrier that protects nucleic acids from degrading enzymes in vivo, and is very suitable as a carrier for siRNA. Although this form can be used, the method for introducing the nucleic acid or drug of the present invention is not limited to this. In this way, despite the rapid degradation of the nuclease in the serum of the organism, a sustained effect can be achieved for an extended period of time. For example, Takeshita F.PNAS, (2003) 102(34) 12177-82, Minakuchi Y Nucleic Acids Research (2004) 32(13) e109 reported that atelocollagen derived from cowhide forms a complex with nucleic acid, which has protection Nucleic acids are protected from the effects of degrading enzymes in living organisms and are very suitable as carriers for siRNA.

The effect of acetylcholine receptor gene expression by an agent that inhibits acetylcholine receptor gene expression can be verified by a known method.

In some embodiments, the agent that inhibits acetylcholine receptor gene expression is an antisense nucleic acid. Antisense nucleic acids can be utilized using techniques well known to those skilled in the art. Antisense nucleic acids can inhibit the expression of target genes by inhibiting various processes such as transcription, splicing, or translation (Hirashima and Inoue, New Biochemical Experiment 2, Replication and Expression of Gene of Nucleic Acid IV, edited by the Japanese Society of Biochemistry, Tokyo Kagaku Dojin, 1993, 319-347).

In some embodiments, designing an antisense sequence complementary to the untranslated region near the 5'end of the mRNA of the gene encoding the acetylcholine receptor is considered to be able to effectively inhibit the translation of the gene. A sequence complementary to the 3'untranslated region or coding region can also be used. In this way, the antisense nucleic acid used in the present invention also includes nucleic acid, which includes not only the antisense sequence of the translation region sequence of the gene encoding the acetylcholine receptor, but also the antisense sequence of the untranslated region sequence. The antisense nucleic acid to be used is linked downstream of a suitable promoter, and preferably, a sequence containing a transcription termination signal is linked to the 3'side. The nucleic acid prepared in this way can be transformed into cells by using known methods. The sequence of the antisense nucleic acid is preferably a sequence complementary to the gene encoding the acetylcholine receptor of the cell to be transformed or a part thereof. However, as long as gene expression can be effectively suppressed, the sequence does not need to be completely complementary. Relative to the transcript of the target gene, the transcribed RNA preferably has a complementarity of 90% or higher, and most preferably 95% or higher. In order to use an antisense nucleic acid to effectively inhibit the expression of a target gene, the length of the antisense nucleic acid is preferably at least 12 bases and less than 25 bases, but the antisense nucleic acid of the present invention is not necessarily limited to this length. For example, the length may be 11 bases or less, 100 bases or more, or 500 bases or more. The antisense nucleic acid may consist of only DNA, or may include nucleic acid other than DNA, such as locked nucleic acid (LNA). As an embodiment, the antisense nucleic acid used in the present invention may be an antisense nucleic acid containing LNA, the antisense nucleic acid comprising LNA at the 5'end or LNA at the 3'end. In the embodiment using the antisense nucleic acid of the present invention, the antisense sequence can be used, for example, Hirashima and Inoue, New Biochemical Experiment Course 2, Replication and Expression of Gene of Nucleic Acid IV, edited by the Japanese Biochemical Society, Tokyo Kagaku Dojin, 1993 , The method design described in 319-347.

In some embodiments, the agent that inhibits acetylcholine receptor gene expression is a ribozyme or DNA encoding a ribozyme. Ribozymes are RNA molecules with catalytic activity, which are biocatalysts that can degrade specific mRNA sequences. Specifically, the ribozyme can specifically cleave the substrate RNA molecule by catalyzing the cleavage of the phosphodiester bond in the RNA strand at the target site, thereby blocking the expression of the target gene. Although ribozymes with various activities exist, research on ribozymes as enzymes that cleave RNA has allowed the design of ribozymes that cleave RNA site-specifically. There are ribozymes of 400 nucleotides or more in size in M1RNA contained in RNase P and group I intron ribozymes, but ribozymes with an active domain of about 40 nucleotides also exist, It is called hammerhead or hairpin ribozyme (Makoto Koizumi and Eiko Otsuka, Protein, Nucleic Acid and Enzyme, 1990, 35, 2191).

Hairpin ribozymes can also be used for the purposes of the present invention. For example, this ribozyme was found in the negative strand of the satellite RNA of tobacco ringspot virus (Buzayan J M, Nature, 1986, 323, 349). It has been proved that targeting specific RNA-cleaving ribozymes can also be produced by hairpin ribozymes (Kikuchi, Y. & Sasaki, N., Nucl. Acids Res, 1991, 19, 6751., Chemistry and Biology, 1992, 30, 112). In this way, by specifically cutting gene transcripts using ribozymes, the expression of genes encoding acetylcholine receptors can be suppressed.

As used herein, "agents for inhibiting choline acetyltransferase gene expression" include ribozymes, antisense nucleic acids and siRNAs of genes encoding choline acetyltransferase, wherein ribozymes, antisense nucleic acids and siRN are as defined above.

In some embodiments, the acetylcholine pathway modulator is an acetylcholine receptor inhibitor.

In some embodiments, the acetylcholine receptor inhibitor is selected from muscarinic receptor inhibitors and nicotinic receptor inhibitors.

In some embodiments, the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benzatropine, isoladine, methylscopolamine, trihexyphenidyl, scopolamine butylbromide, pirenzepine, iso Proptropium bromide, oxytropium bromide, tiotropium bromide, atropine, topecaramide, diphenhydramine, dicyclomine, oxybutynin, tolterodine, sophenacine, propaline bromide, Scopolamine, Scopolamine Bromide, Orphenadrine, Homatropine, Methixol, Episate Bromide, Midanasine, Fesoterodine, and its pharmaceutically acceptable salts, solvates, prodrugs , Metabolites and their combinations.

In some embodiments, the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium bromide, succinylcholine chloride, decahylammonium bromide, vecuronium bromide, pancuronium bromide, chloride Toxicrine, camphormifene, hexamethylammonium bromide, atracurium, doxonium chloride, mcuronium chloride, dextromethorphan, methyl oxopyridine, α-causarium, α-taro Spirotoxin G1, benzquinone ammonium, bPiDDB, its pharmaceutically acceptable salts, solvates, prodrugs, metabolites, and combinations thereof.

In some embodiments, the acetylcholine pathway modulator is an acetylcholine transporter inhibitor, such as 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

In some embodiments, the acetylcholine pathway modulator is a choline transporter inhibitor, such as hemicholine-3.

In some embodiments, the acetylcholine pathway modulator is preferably selected from darfinacine, benztropine mesylate, isoladine, methylscopolamine, MG624, mecamylamine, pancuronium, 2- (4-Phenylpiperidinyl) cyclohexanol (Vesamicol), hemicholine-3 and their combinations.

II. Treatment methods

The present invention provides a method for treating cancer in a subject in need, comprising administering to the subject a therapeutically effective amount of an acetylcholine pathway modulator. In some embodiments, the subject has previously received at least one anti-cancer treatment. In some embodiments, the subject is resistant to at least one anti-cancer treatment, or suffers from a cancer that recurs or progresses after receiving at least one anti-cancer treatment. As used in the present invention, the term "resistance" or "tolerance" means that the subject's condition has not significantly improved after anti-cancer treatment.

The present invention also provides a method for improving the sensitivity of cancer cells to anti-cancer therapy, which comprises administering a therapeutically effective amount of an acetylcholine pathway modulator to a subject undergoing anti-cancer therapy.

The present invention also provides a method for preventing cancer recurrence, comprising administering a therapeutically effective amount of an acetylcholine pathway modulator to a subject, wherein the subject has previously received at least one anti-cancer treatment.

In some embodiments, the anti-cancer treatment is surgery and/or radiation therapy. In some embodiments, the anti-cancer treatment is at least one anti-tumor agent, wherein "anti-tumor agent" refers to a substance that produces an anti-tumor effect in a tissue, system, animal, mammal, human or other subject .

In some embodiments, the anti-tumor agent may be an epidermal growth factor receptor (EGFR) inhibitor, which can inhibit the signaling pathway in which EGFR participates, thereby reducing the activity of tumor cells. Examples of EGFR inhibitors include, for example, necitumumab (necitumumab), nimotuzumab (nimotuzumab), Imgatuzumab (RO5083945), cetuximab, gefitinib, erlotinib, panitumumab Anti (panitumumab), icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib (CO1686) and their combinations.

In some embodiments, the anti-tumor agent may be a progressive lymphoma kinase (ALK) inhibitor, which can inhibit the signaling pathway in which ALK participates, thereby reducing the activity of tumor cells. Examples of ALK inhibitors include, for example, crizotinib, alectinib, ceritinib, alectinib, brigatinib, lorlatinib, lopatinib (TPX-0005) and their combinations.

In some embodiments, the anti-tumor agent may be lapatinib or vermurafinib.

In some embodiments, the anti-tumor agent may also be selected from: anti-microtubule agents such as diterpenoids and vinca alkaloids; platinum complexes; alkylating agents such as nitrogen mustard, oxazaphosphorine , Alkyl sulfonates, nitrosoureas, and triazenes; antibiotic reagents such as anthracycline antibiotics, actinomycin and bleomycin; topoisomerase II inhibitors such as epipodophyllotoxin; antimetabolites Such as purine and pyrimidine analogs and antifolate compounds; topoisomerase I inhibitors such as camptothecin; hormones and hormone analogs; signal transduction pathway inhibitors; non-receptor tyrosine angiogenesis inhibitors; immunotherapeutics ; Pro-apoptotic agents; and cell cycle signaling inhibitors.

Anti-microtubule or antimitotic drugs are phase-specific drugs that have activity against tumor cell microtubules in the M phase or mitosis phase of the cell cycle. Examples of anti-microtubule drugs include, but are not limited to, diterpenoids and vinca alkaloids.

Diterpenoids derived from natural sources are phase specific antineoplastic agent which acts G ₂ / M phase of the cell cycle. It is believed that diterpenoids stabilize the microtubules by binding to β-tubulin subunits. Then the breakdown of the protein appears to be inhibited, and at the same time mitosis stops, and the cells die. Examples of diterpenoids include, but are not limited to, paclitaxel and its analog docetaxel.

Paclitaxel, 5β,20-epoxy-1,2α,4,7β,10β,13α-hexahydroxypaclitaxel-11-en-9-one 4,10-diacetate 2-benzoate 13-( 2R,3S)-N-benzoyl-3-phenylisoserine ester, a natural diterpene product, isolated from Taxus brevifolia and used as an injectable solution

Commercially available. It is a member of the taxane family of terpenes. Paclitaxel has been approved in the United States for the treatment of refractory ovarian cancer (Markman et al., Yale Journal of Biology and Medicine, 64:583, 1991; McGuire et al., Ann.lntem, Med., 111:273, (989)) and The clinical application of breast cancer treatment (Holmes et al., J. Nat. Cancer Inst., 83:1797 (1991)). Paclitaxel is used for the treatment of skin tumors (Einzig et al., Proc. Am. Soc. Clin. Oncol., 20:46 (2001)) and head and neck cancer (Forastire et al., Sem. Oncol., 20:56, (1990)) Potential drug candidates. The compounds also show therapeutic potential for polycystic kidney disease (Woo et al., Nature, 368:750. (1994)), lung cancer and malaria. Treatment of patients with paclitaxel resulted in bone marrow suppression (Multiple cell lineages, Ignoff et al., Cancer Chemotherapy Pocket Guide, 1998), which was related to the duration of administration above the threshold concentration (50 nM) (Kearns et al., Seminars in Oncology, 3 (6) p.16-23, (1995)).

Docetaxel, 5β-20-epoxy-1,2α,4,7β,10β,13α-hexahydroxypaclitaxel-11-en-9-one-4-acetate 2-benzoate-N- Tert-Butyl 13-(2R,3S)-N-carboxy-3-phenylisoserine ester trihydrate; as an injectable solution

Commercially available. Docetaxel is used to treat breast cancer. Docetaxel is a semi-synthetic derivative of paclitaxel, which is prepared using the natural precursor 10-deacetyl-baccatin III (extracted from the needles of European yew).

Catharanthus roseus alkaloids are phase-specific anti-tumor drugs, derived from the Catharanthus roseus plant. Vinca alkaloids act on the M phase (mitosis) of the cell cycle by specifically binding to tubulin. Therefore, the bound tubulin molecules cannot aggregate into microtubules. Mitosis is thought to end in mid-division and then the cell dies. Examples of vinca alkaloids include, but are not limited to, vinblastine, vincristine, and vinorelbine.

Vinblastine, vinblastine sulfate, as an injectable solution

Commercially available. Although it can be used as a second-line treatment for various solid tumors, it is mainly used to treat testicular cancer and various lymphomas including Hodgkin's disease; and lymphocyte and histiocytic lymphoma. Myelosuppression is a dose limiting side effect of vinblastine.

Vincristine, 22-oxovinblastine sulfate, as an injectable solution

Commercially available. Vincristine is used to treat acute leukemia and is also used in treatment regimens for Hodgkin and non-Hodgkin's malignant lymphomas. Hair loss and nerve effects are the most common side effects of vincristine, and a lower degree of bone marrow suppression and gastrointestinal mucositis will occur.

Vinorelbine, 3',4'-didehydro-4'-deoxy-C'-norvinblastine [R-(R*,R*)-2,3-dihydroxysuccinate (1 :2) (salt)], as vinorelbine tartrate injectable solution

Commercially available, it is a semi-synthetic vinca alkaloid. Vinorelbine is used as a single drug or in combination with other chemotherapeutic drugs, such as cisplatin, to treat a variety of solid tumors, such as non-small cell lung cancer, advanced breast cancer, and hormonal refractory prostate cancer. Myelosuppression is the most common dose-limiting side effect of vinorelbine.

Platinum complexes are non-phase specific anti-tumor agents that interact with DNA. The platinum complex enters tumor cells, hydrates and forms intra-chain and inter-chain cross-links with DNA, causing unfavorable biological effects on tumors. Examples of platinum complexes include, but are not limited to, oxaliplatin, cisplatin, and carboplatin.

Cisplatin, cis-diammine dichloroplatinum, as an injectable solution

Commercially available. Cisplatin is mainly used to treat metastatic testicular cancer, ovarian cancer and advanced bladder cancer.

Carboplatin, diamino[1,1-cyclobutane-dicarboxylic acid (2-)-O,O']platinum, as an injectable solution

Commercially available. Carboplatin is mainly used for first-line and second-line treatment of advanced ovarian cancer.

Alkylating agents are non-phase specific antitumor agents and strong electrophiles. Generally, the alkylating agent forms a covalent bond with DNA via the nucleophilic moiety of the DNA molecule, such as phosphate, amino, sulfhydryl, hydroxyl, carboxyl, and imidazolyl through alkylation. The alkylation disrupts the function of the nucleic acid, leading to cell death. Examples of alkylating agents include, but are not limited to, nitrogen mustards such as cyclophosphamide, melphalan, and chlorambucil; alkyl sulfonates such as busulfan; nitrosoureas such as carmustine; and triazide For example, dacarbazine.

Cyclophosphamide, 2-[bis(2-chloroethyl)amino]tetrahydro-2H-1,3,2-oxazepine 2-oxide monohydrate, as an injectable solution or tablet

Commercially available. Cyclophosphamide is used as a single drug or in combination with other chemotherapy drugs to treat malignant lymphoma, multiple myeloma, and leukemia.

Melphalan, 4-[bis(2-chloroethyl)amino]-L-phenylalanine, as an injectable solution or tablet

Commercially available. Melphalan is used in the palliative treatment of multiple myeloma and unresectable ovarian epithelioma. Myelosuppression is the most common dose limiting side effect of melphalan.

Chlorambucil, 4-[bis(2-chloroethyl)amino]phenylbutyric acid, as

Tablets are commercially available. Chlorambucil is used in the palliative treatment of chronic lymphocytic leukemia and malignant lymphomas, such as lymphosarcoma, giant follicular lymphoma, and Hodgkin's disease.

Busulfan, 1,4-butanediol dimethanesulfonate, as

Tablets are commercially available. Busulfan is used in the palliative treatment of chronic myelogenous leukemia.

Carmustine, 1,3-[bis(2-chloroethyl)-1-nitrosourea, as

Single vials of lyophilized products are commercially available. Carmustine is used as a single drug or in combination with other drugs for the palliative treatment of brain tumors, multiple myeloma, Hodgkin's disease and non-Hodgkin's lymphoma.

Dacarbazine, 5-(3,3-dimethyl-1-triazenyl)-imidazole-4-carboxamide, as

A single medicine bottle of the product is commercially available. Dacarbazine is used to treat metastatic malignant melanoma and is used in combination with other drugs for the second-line treatment of Hodgkin's disease.

Antibiotic antitumor drugs are non-phase specific drugs that bind or intercalate with DNA. Usually, this action forms a stable DNA complex or causes DNA strand breaks, which disrupt the normal function of nucleic acids and cause cell death. Examples of antibiotic antitumor drugs include, but are not limited to, actinomycins such as actinomycin D, anthrocyclins such as daunorubicin and doxorubicin; and bleomycin.

Actinomycin D (Actinomycin D), as an injectable form

Commercially available. Actinomycin D is used to treat Wilms tumor and rhabdomyosarcoma.

Daunorubicin, (8S-cis)-8-acetyl-10-[(3-amino-2,3,6-tideoxy-α-L-lyso-hexylpyranosyl)oxy] -7,8,9,10-tetrahydro-6,8,11-trihydroxy-1-methoxy-5,12-naphthonaphthoquinone hydrochloride, as an injectable form of liposome

Or injectable form

Commercially available. Daunorubicin is used to relieve and induce the treatment of acute non-lymphocytic leukemia and Kaposi's sarcoma associated with advanced HIV.

Doxorubicin, (8S, 10S)-10-[(3-amino-2,3,6-tideoxy-α-L-lyxo-hexopyranosyl)oxy]-8-glycolyl, 7,8,9,10-Tetrahydro-6,8,11-trihydroxy-1-methoxy-5,12 naphthonaphthoquinone hydrochloride, as an injectable form

or

Commercially available. Doxorubicin is mainly used for the treatment of acute lymphoblastic leukemia and acute myeloblastic leukemia, but it is also a useful component for the treatment of some solid tumors and lymphomas.

Bleomycin, a mixture of cytotoxic glycopeptide antibiotics isolated from a strain of Streptomyces verticillium, as

Commercially available. Bleomycin is used as a single drug or in combination with other drugs for the palliative treatment of squamous cell carcinoma, lymphoma and testicular cancer.

Topoisomerase II inhibitors include but are not limited to epipodophyllotoxins.

Epipodophyllotoxins are phase-specific anti-tumor drugs, derived from the mandrake plant. Epipodophyllotoxin usually affects cells by forming a ternary complex with topoisomerase II and DNA during the S and G ₂ phases of the cell cycle, causing DNA strand breaks. DNA strand breaks accumulate, and the cells die. Examples of epipodophyllotoxins include, but are not limited to, etoposide and teniposide.

Etoposide, 4'-desmethyl-epipdophyllotoxin 9-[4,6-0-(R)-ethylene-β-D-glucopyranoside], as an injectable solution or capsule

It is commercially available and commonly referred to as VP-16. Etoposide is used as a single drug or in combination with other chemotherapy drugs to treat testicular cancer and non-small cell lung cancer.

Teniposide, 4'-desmethyl-epipodophyllotoxin 9-[4,6-0-(R)-thienmethylene-β-D-glucopyranoside], as an injectable solution

Commercially available and commonly referred to as VM-26. Teniposide is used as a single drug or in combination with other chemotherapeutic drugs to treat acute leukemia in children.

Antimetabolites antitumor drugs are phase-specific antitumor drugs that act on the S phase (DNA synthesis phase) of the cell cycle by inhibiting DNA synthesis or by inhibiting the synthesis of purine or pyrimidine bases and thus restricting DNA synthesis. Therefore, the S phase stops and the cells die. Examples of antimetabolites and antitumor drugs include, but are not limited to, fluorouracil, methotrexate, cytarabine, mercaptopurine, thioguanine, and gemcitabine.

5-Fluorouracil, 5-fluoro-2,4-(1H,3H)pyrimidinedione, is commercially available as fluorouracil. The administration of 5-fluorouracil inhibits the synthesis of thymidylic acid and can incorporate both RNA and DNA. The result is usually cell death. 5-Fluorouracil is used as a single drug or in combination with other chemotherapy drugs for the treatment of breast, colon, rectal, gastric, and pancreatic cancers. Other fluoropyrimidine analogs include 5-fluorodeoxyuridine (fluorouridine) and 5-fluorodeoxyuridine monophosphate.

Cytarabine, 4-amino-1-β-D-arabinosyl-2(1H)-pyrimidinone, commercially available

And is usually called Ara-C. It is believed that cytarabine exhibits cell phase specificity in S phase by inhibiting DNA chain elongation, and this effect is produced by binding cytarabine to the end of the growing DNA chain. Cytarabine is used as a single drug or combined with other chemotherapy drugs to treat acute leukemia. Other cytidine analogs include 5-azacytidine and 2',2'-difluorodeoxycytidine (gemcitabine).

Mercaptopurine, 1,7-dihydro-6H-purine-6-thione monohydrate, as

Commercially available. Mercaptopurine shows cell phase specificity in S phase by inhibiting DNA synthesis, and its mechanism is not clear. Mercaptopurine is used as a single drug or in combination with other chemotherapy drugs to treat acute leukemia. One useful mercaptopurine analog is azathioprine.

Thioguanine, 2-amino-1,7-dihydro-6H-purine-6-thione, as

Commercially available. Thioguanine exhibits cell phase specificity in S phase by inhibiting DNA synthesis, and its mechanism is not clear. Thioguanine is used as a single drug or in combination with other chemotherapy drugs to treat acute leukemia. Other purine analogs include pentostatin, erythroxynonyladenine, fludarabine phosphate, and cladribine.

Gemcitabine, 2'-deoxy-2',2'-difluorocytidine monohydrochloride (β-isomer), as

Commercially available. Gemcitabine shows cell phase specificity in S phase by blocking cells from G1 phase to S phase. The combination of gemcitabine and cisplatin is used to treat locally advanced non-small cell lung cancer, as well as to treat locally advanced pancreatic cancer alone.

Methotrexate, N-[4[[(2,4-Diamino-6-pteridinyl)methyl]methylamino]benzoyl]-L-glutamic acid, as the market for methotrexate sodium Sale. Methotrexate exhibits cell phase specificity in S phase by inhibiting DNA synthesis, repair and/or replication. This effect is achieved by inhibiting dihydrofolate reductase, which is the synthesis of purine nucleotides and thymidylic acid The required substance. Methotrexate is used as a single drug or in combination with other chemotherapy drugs to treat choriocarcinoma, meningeal leukemia, non-Hodgkin's lymphoma and breast cancer, head cancer, neck cancer, ovarian cancer and bladder cancer.

Topoisomerase I inhibitors: Camptothecins, including camptothecin and camptothecin derivatives, can be used as topoisomerase I inhibitors, or research and development in this regard. The cytotoxicity of camptothecin is believed to be related to its topoisomerase I inhibitory activity. Examples of camptothecin include, but are not limited to, irinotecan, topotecan, and the following 7-(4-methylpiperazinyl-methylene)-10,11-ethylenedioxy-20-xi The various optical forms of tree alkali.

Irinotecan hydrochloride, (4S)-4,11-diethyl-4-hydroxy-9-[(4-piperidinylpiperidinyl)carbonyloxy]-1H-pyrano[3',4' ,6,7]Indazino[1,2-b]quinoline-3,14(4H,12H)-dione hydrochloride, as an injectable solution

Commercially available. Irinotecan is a camptothecin derivative that binds to the topoisomerase I-DNA complex together with its active metabolite SN-38. It is believed that the occurrence of cytotoxicity is the result of irreparable double-strand breaks caused by the interaction of topoisomerase I:DNA:irinotecan or SN-38 ternary complex with replicase. Irinotecan is used to treat metastatic cancer of the colon or rectum.

Topotecan hydrochloride, (S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy-1H-pyrano[3',4',6,7 ]Inzino[1,2-b]quinoline-3,14-(4H,12H)-dione monohydrochloride, as an injectable solution

Commercially available. Topotecan is a camptothecin derivative that binds to the topoisomerase I-DNA complex and prevents the reconnection of single-strand breaks caused by topoisomerase I due to strand twist of DNA molecules . Topotecan is used for the second-line treatment of metastatic ovarian cancer and small cell lung cancer.

Hormones and hormone analogs are compounds that are effective in the treatment of cancer whose development and/or lack of development are related to hormones. Examples of hormones and hormone analogs used in cancer treatment include, but are not limited to, adrenal corticosteroids, such as prednisone and prednisolone, which are used in the treatment of malignant lymphoma and childhood acute leukemia; ammonite and other aromas Enzyme inhibitors such as anastrozole, letrozole, vorazole and exemestane, which are used for the treatment of adrenocortical tumors and hormone-dependent breast cancer containing estrogen receptors; progestins, such as methyl acetate Gestosterone for the treatment of hormone-dependent breast cancer and endometrial cancer; estrogen, androgens and antiandrogens such as flutamide, nilutamide, bicalutamide, cyproterone acetate and 5α- Reductases such as finasteride and dutasteride are used to treat prostate cancer and benign prostatic hypertrophy; anti-estrogens such as tamoxifen, toremifene, raloxifene, droxifene, iodooxyfene, and U.S. Patent Nos. 5,681,835, 5,877,219 and 6,207,716 disclose selective estrogen receptor modulators (SERMS) for the treatment of hormone-dependent breast cancer and other susceptible cancers; and gonadotropin releasing hormone (GnRH) and its analogs ( It stimulates the release of luteinizing hormone (LH) and/or follicle-stimulating hormone (FSH)) for the treatment of prostate cancer, such as LHRH agonists and antagonists, such as goserelin acetate and luprolide.

Signal transduction pathway inhibitors are those inhibitors that block or inhibit the chemical processes that trigger changes in the cell. The change used in the present invention is cell proliferation or differentiation. Signal transduction inhibitors used in the present invention include, but are not limited to, receptor tyrosine kinases, non-receptor tyrosine kinases, SH2/SH3 domain blockers, serine/threonine kinases, phosphatidylinositol- 3 Kinase, inositol signal transduction and Ras oncogene inhibitor.

Several protein tyrosine kinases catalyze the phosphorylation of specific tyrosyl residues in a variety of proteins involved in cell growth regulation. The protein tyrosine kinases can be broadly classified as receptor or non-receptor kinases.

Receptor tyrosine kinases are transmembrane proteins with extracellular ligand binding domain, transmembrane domain and tyrosine kinase domain. Receptor tyrosine kinases are involved in the regulation of cell growth and are commonly referred to as growth factor receptors. Inappropriate or uncontrolled activation of many of these kinases, that is, abnormal kinase growth factor receptor activity, such as activity caused by overexpression or mutation, has been shown to lead to uncontrolled cell growth. Therefore, the abnormal activity of the kinase is associated with the growth of malignant tissues. Therefore, the inhibition of the kinase will provide cancer treatment methods. Growth factor receptors include, for example, epidermal growth factor receptor (EGFr), platelet-derived growth factor receptor (PDGFr), erbB2, erbB4, ret, vascular endothelial growth factor receptor (VEGFr), with immunoglobulin-like and Epidermal growth factor identification domain tyrosine kinase (TIE-2), insulin growth factor-I (IGFI) receptor, macrophage colony stimulating factor (cfms), BTK, ckit, cmet, fibroblast growth factor (FGF) ) Receptor, Trk receptor (TrkA, TrkB and TrkC), ephrin (eph) receptor and RET proto-oncogene. Several inhibitors of growth receptors are under development, and include ligand antagonists, antibodies, tyrosine kinase inhibitors, and antisense oligonucleotides. Growth factor receptors and drugs that inhibit the function of growth factor receptors are disclosed in, for example, the following documents: Kath, John C., Exp. Opin. Ther. Patents (2000) 10(6): 803-818; Shawver et al., DDT Vol. 2, No. 2 February 1997; and Lofts, FJ, etc., "Growth factor receptors as targets", New Molecular Targets for Cancer Chemotherapy (Workman, Paul and Kerr, David, CRC press 1994, London).

Tyrosine kinases that are not growth factor receptor kinases are called non-receptor tyrosine kinases. Non-receptor tyrosine kinases (which are targets or potential targets of antitumor agents) used in the present invention include cSrc, Lck, Fyn, Yes, Jak, cAbl, FAK (Focal Adhesion Kinase), Bruton Tyrosine kinase and Bcr-Abl. Non-receptor kinases and drugs that inhibit the function of non-receptor tyrosine kinases are disclosed in the following documents: Sinh et al., Journal of Hematotherapy and Stem Cell Research, 8(5): 465-80 (1999); and Bolen et al. ,Annual review of Immunology,15:371-404(1997).

SH2/SH3 domain blockers are used to disrupt SH2 or SH3 domains in a variety of enzymes or adaptor proteins (including PI3-K p85 subunit, Src family kinases, adaptor molecules (Shc, Crk, Nck, Grb2) and Ras-GAP) Combined drugs. The SH2/SH3 domain as a target of anti-tumor agents is discussed in the following documents: Smithgall, T.E., Journal of Pharmacological and Toxicological Methods. 34(3) 125-32 (1995).

Serine/threonine kinase inhibitors include MAP kinase cascade blockers, which include blockers of Raf kinase (rafk), mitogen or extracellular regulated kinase (MEK) and extracellular signal regulated kinase (ERK); And protein kinase C family member blockers, including PKC (α, β, γ, ε, μ, λ, ι, ζ), IkB kinase family (IKKa, IKKb), PKB family kinases, akt kinase family members and TGFβ receptor Blocker of body kinase. The serine/threonine kinase and its inhibitors are disclosed in the following documents: Yamamoto et al., Journal of Biochemistry, 126(5)799-803 (1999); Brodt et al., Biochemical Pharmacology, 60.1101-1107 (2000) ; Massague et al., Cancer Surveys, 27:41-64 (1996); Philip et al., Cancer Treatment and Research, 78: 3-27 (1995), Lackey et al., Bioorganic and Medicinal Chemistry Letters, (10) 223- 226 (2000); US Patent No. 6,268,391; and Martinez-Iacaci et al., Int. J. Cancer, 88(1), 44-52 (2000).

Inhibitors of phosphatidylinositol-3 kinase family members including PI3-kinase, ATM, DNA-PK and Ku blockers can also be used in the present invention. The kinase is disclosed in the following documents: Abraham, RT (1996), Current Opinion in Immunology. 8(3) 412-8; Canman, CE, Lim, DS (1998), Oncogene 17(25) 3301-3308; Jackson , SP(1997), International Journal of Biochemistry and Cell Biology. 29(7):935-8; and Zhong, H. et al., Cancer Res, (2000) 60(6), 1541-1545.

Also useful in the present invention are inositol signal transduction inhibitors, such as phospholipase C blockers and inositol analogs. This signal inhibitor is disclosed in the following documents: Powis, G. and Kozikowski A., (1994) New Molecular Targets for Cancer Chemotherapy ed., Paul Workman and David Kerr, CRC press 1994, London.

Another type of signal transduction pathway inhibitor is the inhibitor of the Ras oncogene. The inhibitors include farnesyl transferase, geranyl-geranyl transferase and CAAX protease inhibitors, as well as antisense oligonucleotides, ribozymes and immunotherapy. The inhibitor has been shown to block the activation of ras in cells containing wild-type mutant ras, and thus acts as an anti-proliferative drug. Ras oncogene suppression is discussed in the following documents: Scharovsky, et al. (2000), Journal of Biomedical Science. 7(4)292-8; Ashby, MN(1998), Current Opinion in Lipidology.9(2)99–102 ; And BioChim. Biophys. Acta, (19899) 1423(3): 19-30.

As mentioned above, antibody antagonists that bind to receptor kinase ligands can also be used as signal transduction inhibitors. Such signal transduction pathway inhibitors include the use of humanized antibodies for the extracellular ligand binding domain of receptor tyrosine kinases. For example, Imclone C225 EGFR specific antibody (see Green et al., Monoclonal Antibody Therapy for Solid Tumors, Cancer Treat. Rev., (2000), 26(4), 269-286);

erbB2 antibody (see "Tyrosine Kinase Signalling in Breast cancer: erbB Family Receptor Tyrosine Kinases", Breast Cancer Res., 2000, 2(3), 176-183); and 2CB VEGFR2 specific antibody (see Brekken et al., Selective Inhibition of VEGFR2 Activity by a monoclonal Anti-VEGF antibody blocks tumor growth in mice, Cancer Res. (2000) 60, 5117-5124).

Anti-angiogenic drugs, including non-receptor MEK angiogenesis inhibitors, are also useful. Anti-angiogenic drugs such as those that inhibit the effect of vascular endothelial growth factor (such as anti-vascular endothelial cell growth factor antibody bevacizumab [Avastin ^TM ] and compounds that act through other mechanisms (such as linolamide, integrin αvβ3) Agents, endostatin and angiostatin);

Drugs used in immunotherapy regimens can also be used in the present invention. Immunotherapy approaches, including, for example, methods to increase the immunogenicity of patient cancer cells in vitro and in vivo (for example, transfection with cytokines such as interleukin 2, interleukin 4 or granulocyte macrophage colony stimulating factor), and reduce T cell anergy Sexual methods, methods using transfected immune cells (such as cytokine-transfected dendritic cells), methods using cytokine-transfected tumor cell lines, and methods using anti-idiotypic antibodies.

Drugs used in proapoptotic treatment regimens (pro-apoptotic drugs, for example, bcl-2 antisense oligonucleotides) can also be used in the present invention.

Cell cycle signaling inhibitors inhibit molecules involved in cell cycle control. The protein kinase family called cyclin-dependent kinases (CDK) and its interaction with the protein family called cyclins control the entire eukaryotic cell cycle. The coordination activation and inactivation of different cyclin/CDK complexes are necessary for the normal progression of the entire cell cycle. Several cell cycle signaling inhibitors are under development. For example, examples of cell cycle regulatory protein-dependent kinases include CDK2, CDK4, and CDK6 and their inhibitors, as disclosed in the following documents: Rosania et al., Exp. Opin. Ther. Patents (2000) 10(2): 215-230 .

Examples of cancers suitable for treatment with the acetylcholine pathway modulator of the present invention include, but are not limited to, primary and metastatic forms of head and neck cancer, breast cancer, lung cancer, colon cancer, colorectal cancer, skin cancer, ovarian cancer, and prostate cancer. Suitably, the cancer is selected from: brain cancer (glioma), malignant glioma, astrocytoma, multiform malignant glioma, Bannayan-Zonana syndrome, Cowden disease, Lhermitte-Duclos disease , Breast cancer, inflammatory breast cancer, Wilms tumor, Ewing sarcoma, rhabdomyosarcoma, ependymoma, medulloblastoma, colon cancer, head and neck cancer, kidney cancer, lung cancer, liver cancer, melanoma, ovarian Cancer, pancreatic cancer, prostate cancer, sarcoma, osteosarcoma, giant cell tumor of bone, thyroid cancer, colorectal cancer, lymphoblastic T cell leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, hairy cell leukemia, acute lymphoblast Cellular leukemia, acute myelogenous leukemia, AML, chronic neutrophilic leukemia, acute lymphoblastic T-cell leukemia, plasmacytoma, immunoblast large cell leukemia, mantle cell leukemia, multiple myeloma megakaryocyte Leukemia, multiple myeloma, acute megakaryocytic leukemia, promyelocytic leukemia, erythroleukemia, malignant lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, lymphoblastic T-cell lymphoma, Burkitt Lymphoma, follicular lymphoma, neuroblastoma, bladder cancer, bladder epithelial cancer, lung cancer, vulvar cancer, cervical cancer, endometrial cancer, kidney cancer, mesothelioma, esophageal cancer, salivary gland cancer, liver cell Cancer, stomach cancer, nasopharyngeal cancer, buccal cancer, oral cancer, GIST (gastrointestinal stromal tumor) and testicular cancer.

In addition, examples of cancers to be treated include Barret's adenocarcinoma; biliary tract cancer; breast cancer; cervical cancer; cholangiocarcinoma; central nervous system tumors, including primary CNS tumors such as glioblastoma, astrocytoma (eg , Glioblastoma multiforme) and ependymoma, and secondary CNS tumors (ie, tumors that originate outside the central nervous system and metastasize to the central nervous system); colorectal cancer, including colorectal cancer; gastric cancer ; Head and neck cancer, including squamous cell carcinoma of the head and neck; blood cancer, including leukemia and lymphoma such as acute lymphoblastic leukemia, acute myelogenous leukemia (AML), myelodysplastic syndrome, chronic myelogenous leukemia, Hodgkin’s lymphoma, non-Hodgkin’s lymphoma, megakaryoblastic leukemia, multiple myeloma and erythroleukemia; hepatocellular carcinoma; lung cancer, including small cell lung cancer and non-small cell lung cancer; ovarian cancer; endometrial cancer; Pancreatic cancer; pituitary adenoma; prostate cancer; kidney cancer; sarcoma; skin cancer, including melanoma; and thyroid cancer.

Suitably, the present invention relates to a method of treating a cancer selected from the group consisting of brain cancer (glioma), malignant glioma, astrocytoma, multiform malignant glioma, Bannayan-Zonana syndrome, Cowden Disease, Lhermitte-Duclos disease, breast cancer, colorectal cancer, head and neck cancer, kidney cancer, lung cancer, liver cancer, melanoma, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma and thyroid cancer.

In some embodiments, the present invention relates to a method of treating cancer selected from: sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head and neck cancer, nasopharyngeal cancer Cancer, esophageal cancer, stomach cancer, liver cancer, cholangiocarcinoma, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, buccal cancer, oropharynx Cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

In some embodiments, the present invention relates to a method of treating cancer selected from the group consisting of lung cancer, breast cancer, colorectal cancer, and melanoma.

In some embodiments, the present invention relates to methods of treating non-small cell lung cancer. In some embodiments, the present invention relates to a method of treating non-small cell lung cancer with EGFR mutation and/or overexpression, or ALK mutation and/or overexpression.

III. Drug combination

The present invention provides a combination of an acetylcholine pathway modulator and an antitumor agent for use in the treatment of cancer in a subject in need. The administration of a therapeutically effective amount of the combination of the present invention (or a therapeutically effective amount of each component of the combination) is advantageous over the administration of only a single component, because compared to the administration of a therapeutically effective amount of a single component alone, The combination will provide one or more of the following improved properties: i) have a higher anti-cancer effect compared to the administration of a single component, ii) synergistic or highly synergistic anti-cancer activity, iii) provide A dosing regimen with enhanced anti-cancer activity and reduced side effects, or iv) effectively suppresses cancer recurrence.

In some embodiments, the acetylcholine pathway modulator is an acetylcholine receptor inhibitor.

In some embodiments, the acetylcholine receptor inhibitor is selected from muscarinic receptor inhibitors and nicotinic receptor inhibitors.

In some embodiments, the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benzatropine, isoladine, methylscopolamine, trihexyphenidyl, scopolamine butylbromide, pirenzepine, iso Proptropium bromide, oxytropium bromide, tiotropium bromide, atropine, topecaramide, diphenhydramine, dicyclomine, oxybutynin, tolterodine, sophenacine, propaline bromide, Scopolamine, Scopolamine Bromide, Orphenadrine, Homatropine, Methixol, Episate Bromide, Midanasine, Fesoterodine, and its pharmaceutically acceptable salts, solvates, prodrugs , Metabolites and their combinations.

In some embodiments, the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium bromide, succinylcholine chloride, decahylammonium bromide, vecuronium bromide, pancuronium bromide, chloride Toxicrine, camphormifene, hexamethylammonium bromide, atracurium, doxonium chloride, mcuronium chloride, dextromethorphan, methyl oxopyridine, α-causarium, α-taro Spirotoxin G1, benzquinone ammonium, bPiDDB, its pharmaceutically acceptable salts, solvates, prodrugs, metabolites, and combinations thereof.

In some embodiments, the acetylcholine pathway modulator is an acetylcholine transporter inhibitor, such as 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

In some embodiments, the acetylcholine pathway modulator is a choline transporter inhibitor, such as hemicholine-3.

Preferably, the acetylcholine pathway modulator is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, MG624, mecamylamine, pancuronium bromide, 2-(4-benzene Piperidinyl) cyclohexanol (Vesamicol), hemicholine-3 and combinations thereof.

In some embodiments, the anti-tumor agent is an epidermal growth factor receptor (EGFR) inhibitor, including, for example, necitumumab, nimotuzumab, Imgatuzumab (RO5083945), Western Tuximab, Gefitinib, Erlotinib, Panitumumab, Icotinib, Afatinib, Dacomitinib (PF-00299804), Osimertinib, Rociletinib and Their combination.

In some embodiments, the anti-tumor agent is a progressive lymphoma kinase (ALK) inhibitor and their combination, including, for example, crizotinib, alectinib, ceritinib, alectinib (Alectinib) ), Brigatinib, Lorlatinib, Lopatinib (TPX-0005), and combinations thereof.

In some embodiments, the anti-tumor agent is lapatinib or vermurafinib.

In some embodiments, the anti-tumor agent is 5-fluorouracil.

In one aspect, the present invention provides a combination of an acetylcholine pathway modulator and an epidermal growth factor receptor (EGFR) inhibitor for the treatment of cancer, preferably lung cancer, more preferably non-small cell lung cancer in a subject in need, Most preferred is non-small cell lung cancer with EGFR mutation and/or overexpression.

In some embodiments, the combination is a combination of an acetylcholine receptor inhibitor and an EGFR inhibitor. Preferably, the acetylcholine receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, MG624, mecamylamine, pancuronium bromide, 2-(4- (Phenylpiperidinyl) cyclohexanol (Vesamicol), hemicholine-3 and their combination, the EGFR inhibitor is selected from osimertinib, gefitinib, erlotinib, Rociletinib (CO1686) And their combination.

In one aspect, the present invention provides a combination of an acetylcholine pathway modulator and a progressive lymphoma kinase (ALK) inhibitor for the treatment of cancer, preferably lung cancer, more preferably non-small cell lung cancer in a subject in need, Most preferred is non-small cell lung cancer with ALK mutation and/or overexpression.

In some embodiments, the combination is a combination of an acetylcholine receptor inhibitor and an ALK inhibitor. Preferably, the acetylcholine receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, MG624, mecamylamine, pancuronium bromide, 2-(4- Phenylpiperidinyl) cyclohexanol (Vesamicol), hemicholine-3 and combinations thereof, and the ALK inhibitor is selected from ceritinib, alectinib and combinations thereof.

In some embodiments, the combination of the present invention can be administered simultaneously or independently in any order. In some embodiments, the acetylcholine pathway modulator and antitumor agent may be administered first, and then only the acetylcholine pathway modulator may be administered. In some embodiments, only the antitumor agent may be administered first, and then only the acetylcholine pathway modulator may be administered. In some embodiments, the acetylcholine pathway modulator and antitumor agent are administered simultaneously.

In some embodiments, the combination of the invention is administered "within a prescribed period."

The term "specified period" as used herein means the time between the administration of one of the acetylcholine pathway modulator and the antitumor agent and the administration of the other of the acetylcholine pathway modulator and the antitumor agent interval. Unless otherwise stated, the prescribed period may include simultaneous administration. Unless otherwise specified, the prescribed period refers to the administration of acetylcholine pathway modulators and antitumor agents within one day.

Suitably, if the compound is administered within a "prescribed period" but not at the same time, they can all be administered within about 24 hours of each other-in this case, the prescribed period will be about 24 hours Appropriately, they can all be administered within about 12 hours apart from each other-in this case, the prescribed period will be about 12 hours; suitably, they can all be administered within about 11 hours apart from each other-in In this case, the prescribed period will be about 11 hours; suitably, they can all be administered within about 10 hours of each other-in this case, the prescribed period will be about 10 hours; suitably, They can all be administered within about 9 hours of each other-in this case, the prescribed period will be about 9 hours; suitably, they can all be administered within about 8 hours of each other-in this case, The prescribed period will be about 8 hours; suitably, they can all be administered within about 7 hours of each other-in this case, the prescribed period will be about 7 hours; suitably, they can all be administered within about 7 hours Administer within about 6 hours apart from each other-in this case, the prescribed period will be about 6 hours; suitably, they can all be administered within about 5 hours apart from each other-in this case, the prescribed period The period will be about 5 hours; suitably, they can all be administered within about 4 hours of each other-in this case, the prescribed period will be about 4 hours; suitably, they can all be about 3 hours apart from each other. Administer within hours-in this case, the prescribed period will be about 3 hours; suitably, they can be administered within about 2 hours of each other-in this case, the prescribed period will be about 2 Hours; suitably, they can all be administered within about 1 hour of each other-in this case, the prescribed period will be about 1 hour. As used in the present invention, the administration of the acetylcholine pathway modulator and the antitumor agent less than about 45 minutes apart is considered to be simultaneous administration.

Suitably, when the combination of the present invention is administered for a "prescribed period", the compounds are co-administered for a "duration".

The term "duration" as used herein means the continuous administration of the two compounds of the present invention for a specified number of days. Unless otherwise specified, the number of consecutive days does not have to be the beginning of the treatment start or the end of the treatment end, it only needs to occur consecutive days at a certain point in the treatment process.

Regarding the "prescribed period" administration: suitably, the two compounds are administered for at least one day within the prescribed period-in this case, the duration is at least one day; suitably, during the treatment, the two compounds are Administer for at least 3 consecutive days within the prescribed period-in this case, the duration is at least 3 days; suitably, during the course of treatment, the two compounds are administered within the prescribed period for at least 5 consecutive days-in this case In this case, the duration is at least 5 days; suitably, during the treatment, the two compounds are administered within a prescribed period for at least 7 consecutive days-in this case, the duration is at least 7 days; appropriate Specifically, during the course of treatment, the two compounds are administered within a prescribed period for at least 9 consecutive days-in this case, the duration is at least 9 days; suitably, during the course of treatment, the two compounds Dosing during the period for at least 14 consecutive days-in this case, the duration is at least 14 days; suitably, during the course of treatment, the two compounds are administered within a prescribed period for at least 30 consecutive days-in this case , The duration is at least 30 days.

Suitably, if the compounds are not administered "within the prescribed period," they are administered sequentially. The term "sequential administration" as used herein means to administer one of the acetylcholine pathway modulator and antitumor agent once a day for two or more consecutive days, followed by administration of the acetylcholine pathway modulator and antitumor agent once a day The other of the agents lasts for two or more consecutive days. Likewise, the present invention also includes a drug withdrawal period used between the sequential administration of one of the acetylcholine pathway modulator and the antitumor agent and the administration of the other of the acetylcholine pathway modulator and the antitumor agent. As used in the present invention, the drug holiday is that acetylcholine is not administered after the sequential administration of one of the acetylcholine pathway modulator and the antitumor agent and before the other one of the acetylcholine pathway modulator and the antitumor agent is administered. The number of days between the pathway modifiers and the administration of antitumor agents. The drug withdrawal period is a period of days selected from the following: 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days and 14 days.

Regarding sequential administration: Appropriately, one of the acetylcholine pathway modulator and antitumor agent is administered for 1 to 30 consecutive days, followed by an optional drug holiday, followed by administration of the acetylcholine pathway modulator and antitumor agent. The other of the tumor agents is continuous for 1 to 30 days. Suitably, one of the acetylcholine pathway modulator and antitumor agent is administered for 1 to 21 consecutive days, followed by an optional drug holiday, followed by the administration of the other one of the acetylcholine pathway modulator and antitumor agent. To 21 days. Suitably, one of the acetylcholine pathway modulator and antitumor agent is administered for 1 to 14 consecutive days, followed by a drug holiday of 1 to 14 days, followed by the administration of the other of the acetylcholine pathway modulator and antitumor agent 1 to 14 consecutive days. Suitably, one of the acetylcholine pathway modulator and antitumor agent is administered for 1 to 7 consecutive days, followed by a drug holiday of 1 to 10 days, followed by the administration of the other of the acetylcholine pathway modulator and antitumor agent For 1 to 7 consecutive days.

Suitably, the antitumor agent is administered first in this sequence, followed by an optional drug holiday, followed by administration of the acetylcholine pathway modulator. Suitably, the anti-tumor agent is administered for 3 to 21 consecutive days, followed by an optional drug holiday, followed by administration of the acetylcholine pathway modulator for 3 to 21 consecutive days. Suitably, the antitumor agent is administered for 3 to 21 consecutive days, followed by a drug holiday of 1 to 14 days, followed by administration of the acetylcholine pathway modulator for 3 to 21 consecutive days. Suitably, the antitumor agent is administered for 3 to 21 consecutive days, followed by a drug holiday of 3 to 14 days, followed by the administration of the acetylcholine pathway modulator for 3 to 21 consecutive days. Suitably, the anti-tumor agent is administered for 21 consecutive days, followed by an optional drug holiday, followed by administration of the acetylcholine pathway modulator for 14 consecutive days. Suitably, the antitumor agent is administered for 14 consecutive days, followed by a drug holiday of 1 to 14 days, followed by administration of the acetylcholine pathway modulator for 14 consecutive days. Suitably, the antitumor agent is administered for 7 consecutive days, followed by a drug holiday of 3 to 10 days, followed by administration of the acetylcholine pathway modulator for 7 consecutive days. Suitably, the antitumor agent is administered for 3 consecutive days, followed by a drug holiday of 3 to 14 days, followed by the administration of the acetylcholine pathway modulator for 7 consecutive days. Suitably, the antitumor agent is administered for 3 consecutive days, followed by a drug holiday of 3 to 10 days, followed by administration of the acetylcholine pathway modulator for 3 consecutive days.

It should be understood that the "prescribed period" administration and the "sequential" administration may be followed by repeated administration or may be followed by an alternate dosing schedule, and the drug holiday may precede the repeated dosing or the alternate dosing schedule.

The combination of the present invention can also be used together with other anti-cancer treatments as defined above.

The acetylcholine pathway modulator and antitumor agent of the present invention can be administered by any suitable route. Suitable routes include oral, rectal, nasal, topical (including buccal and sublingual), intratumoral, intraperitoneal, transvaginal, and parenteral (including subcutaneous, intramuscular, intravenous, intradermal, and sheath Internal and epidural). It is understood that the preferred route may vary with, for example, the condition of the subject of the combination and the cancer being treated. It is also understood that each drug administered can be administered via the same or different routes.

IV. Pharmaceutical composition

The acetylcholine pathway modulator and the antitumor agent can be formulated into a pharmaceutical composition together. The pharmaceutical composition includes the acetylcholine pathway modulator and at least one pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include pharmaceutically acceptable carriers, adjuvants and/or other excipients, and may be regarded as other pharmaceutically acceptable ingredients, as long as they are compatible with the other ingredients of the formulation and Harmless to its recipients.

The pharmaceutical composition of the acetylcholine pathway modulator and antitumor agent described herein can be prepared using any conventional method, for example, mixing, dissolving, granulating, tableting, grinding, emulsifying, encapsulating, embedding, melt spinning, spray drying Or freeze-drying process. The optimal pharmaceutical formulation can be determined by those skilled in the art according to the route of administration and the required dosage. This formulation can affect the physical state, stability, in vivo release rate and in vivo clearance rate of the administered drug. Depending on the condition being treated, these pharmaceutical compositions can be formulated and administered systemically or locally.

The term "carrier" refers to diluents, disintegrants, precipitation inhibitors, surfactants, glidants, binders, lubricants, and other excipients and carriers to be administered with the compound. The carrier is generally described in this article and in E.W. Martin's "Remington's Pharmaceutical Sciences". Examples of carriers include, but are not limited to, aluminum monostearate, aluminum stearate, carboxymethyl cellulose, sodium carboxymethyl cellulose, crospovidone, glyceryl isostearate, glyceryl monostearate Ester, hydroxyethyl cellulose, hydroxyethyl cellulose, hydroxymethyl cellulose, hydroxy octacosanol hydroxystearate, hydroxypropyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose Vegetarian, lactose, lactose monohydrate, magnesium stearate, mannitol, microcrystalline cellulose, poloxamer 124, poloxamer 181, poloxamer 182, poloxamer 188, poloxamer 237, Poloxamer 407, povidone, silica, colloidal silica, silicone, silicone adhesive 4102 and silicone emulsion. However, it should be understood that the selected carrier in the pharmaceutical composition and the amount of such carrier in the composition may vary according to the preparation method (for example, dry granulation preparation, solid dispersion preparation).

The term "diluent" generally refers to a substance used to dilute the compound of interest before delivery. Diluents can also be used to stabilize the compound. Examples of diluents may include starch, sugar, disaccharide, sucrose, lactose, polysaccharide, cellulose, cellulose ether, hydroxypropyl cellulose, sugar alcohol, xylitol, sorbitol, maltitol, microcrystalline cellulose , Calcium carbonate or sodium carbonate, lactose, lactose monohydrate, dicalcium phosphate, cellulose, compressible sugar, anhydrous calcium hydrogen phosphate, mannitol, microcrystalline cellulose and calcium phosphate.

The term "disintegrant" generally refers to a substance that, once added to a solid formulation, promotes the disintegration or disintegration of the solid formulation after administration and allows the active ingredient to be released as efficiently as possible to allow rapid dissolution. Examples of disintegrants may include corn starch, sodium carboxymethyl starch, croscarmellose sodium, crospovidone, microcrystalline cellulose, modified corn starch, sodium carboxymethyl starch, povidone, Pregelatinized starch and alginic acid.

The term "precipitation inhibitor" generally refers to a substance that prevents or inhibits the precipitation of the active agent from a supersaturated solution. An example of a precipitation inhibitor includes hydroxypropyl methylcellulose (HPMC).

The term "surfactant" generally refers to a substance that reduces the surface tension between a liquid and a solid, which can increase the humidity of the active agent or increase the solubility of the active agent. Examples of surfactants include poloxamers and sodium lauryl sulfate.

The term "glidant" generally refers to substances used in tablet and capsule formulations to improve fluidity during tablet compression and produce anti-caking effects. Examples of glidants may include colloidal silicon dioxide, talc, fumed silica gel, starch, starch derivatives, and bentonite.

The term "binder" generally refers to any pharmaceutically acceptable substance that can be used to bind the active ingredient and the inert ingredient of the carrier together to maintain the adhesion and separation of the part, which can be used to bind the active ingredient It is bonded with the inert components of the carrier to maintain the bonding and separation. Examples of the binder may include hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone, copovidone, and ethyl cellulose.

The term "lubricant" generally refers to a substance added to a powder blend to prevent the compacted powder from sticking to the equipment during the tableting or encapsulation process. The lubricant can help the tablet to be removed from the mold and can improve powder flow. Examples of lubricants may include magnesium stearate, stearic acid, silicon dioxide, fat, calcium stearate, polyethylene glycol, sodium stearyl fumarate, or talc; and solubilizers, such as fatty acids, including laurel Acid, oleic acid and C ₈ /C ₁₀ fatty acid.

V. Kit

The present invention provides a kit comprising a first composition containing an acetylcholine pathway modulator and a second composition containing an antitumor agent. The first and second compositions are provided in a form suitable for sequential, separate and/or simultaneous administration.

The kit of the present invention may include: a first container containing an acetylcholine pathway modulator and a pharmaceutically acceptable carrier; a second container containing an antitumor agent and a pharmaceutically acceptable carrier; and a second container for containing the first container and the first container Container device for two containers.

The kit described in the present invention may include two or more single-dose or multiple-dose medicaments each packaged or formulated separately; or two or more single-dose or multiple-dose packaged or formulated in combination. Medicament. Thus, one or more medicaments may be present in the first container, and the kit may optionally include one or more medicaments in the second container. One or more containers are placed in the package, and the package may optionally include instructions for administration or dosage. The kit may include additional components such as a syringe or other components for administering medicaments and diluents or other components for formulation. Therefore, the kit may comprise: a) a pharmaceutical composition comprising the acetylcholine pathway modulator described in the present invention and a pharmaceutically acceptable carrier, vehicle or diluent; b) comprising the antitumor agent described in the present invention And a pharmaceutical composition comprising a pharmaceutically acceptable carrier, vehicle or diluent; and c) a container or package. The kit may optionally include instructions describing the method of using the pharmaceutical composition in one or more of the methods described in the present invention (for example, to prevent or treat one or more diseases and disorders described in the present invention). ). The kit may optionally include an additional pharmaceutical composition, which includes one or more additional agents, pharmaceutically acceptable carriers, vehicles, or diluents for adjuvant therapy described in the present invention. The pharmaceutical composition containing the compound described in the present invention and the second pharmaceutical composition contained in the kit may optionally be combined in the same pharmaceutical composition.

The kit includes a container or package for holding the pharmaceutical composition, and may also include a separate container, such as a separate bottle or a separate foil pack. The container can be, for example, a paper or cardboard box, a glass or plastic bottle or can, a resealable bag (for example, to keep the tablets "refilled" into a different container), or a blister pack with individual doses It can be pressed out from the package according to the treatment schedule. It is feasible that more than one container can be used together in a single package to sell a single dosage form. For example, the tablets can be contained in a bottle, which in turn is contained in a box.

An example of a kit is the so-called blister pack. Blister packaging is well known in the packaging industry and is being widely used for packaging pharmaceutical unit dosage forms (tablets, capsules, and the like). Blister packs usually consist of a relatively hard material sheet and a foil of preferably transparent plastic material covering it. During the packaging process, recesses are formed in the plastic foil. The recess has the size and shape of a single tablet or capsule to be packaged, or may have a size and shape suitable for multiple tablets and/or capsules to be packaged. Next, the tablets or capsules are placed in the recesses accordingly and the relatively hard material sheet is sealed on the foil surface of the plastic foil opposite to the direction in which the recesses are formed. Therefore, the tablets or capsules are sealed separately or jointly in the recesses between the plastic foil and the sheet as required. Preferably, the strength of the sheet material is such that the tablets or capsules can be removed from the blister pack by manually pressing on the recesses, thereby forming an opening at the location of the recesses in the sheet material. The tablet or capsule can then be removed through the opening.

It may be desirable to provide physicians, pharmacists, or subjects with written memory aids containing information and/or instructions about when to take the medication. A "daily dose" can be a single tablet or capsule or several tablets or capsules taken on a given day. When the kit contains separate compositions, the daily dose of one or more compositions of the kit may consist of one tablet or capsule, and the daily dose of another or more compositions of the kit may consist of several tablets Or capsule composition. The kit may take the form of a dispenser designed to dispense the daily doses one at a time in the order in which they are intended for use. The dispenser can be equipped with a memory aid to further promote compliance with the protocol. An example of such a memory aid is a mechanical counter, which indicates the number of daily doses that have been dispensed. Another example of such a memory aid is a battery-powered microchip memory coupled to a liquid crystal reader or an audible reminder signal, such as reading the date and/or the last daily dose has been taken Remind when to take the next dose.

Example

The following examples are used to illustrate the embodiments of the present invention, and the examples are not intended to limit the scope of the present invention. Those skilled in the art should understand that the technology disclosed herein represents a technology for implementing the present invention. Those skilled in the art will understand that according to the present invention, the embodiments of the present invention can be modified without departing from the spirit and scope of the present invention.

Example 1: Construction of a drug resistant cell model for EGFR mutation targeted drugs

Select non-small cell lung cancer cell lines PC9 and HCC827, use high-dose (2μM) EGFR mutation targeting drugs osimertinib and gefitinib (purchased from Selleck) to treat PC9 and HCC827 cells, change the culture every 3 days Base, a total of 9 days of treatment. During drug treatment, a large number of drug-sensitive cells die, and only a small part of drug-resistant cells survive, and this cell population is drug-resistant cells.

Figure 1A is a schematic diagram of inducing non-small cell lung cancer drug resistant cells.

Example 2: Testing the sensitivity of parental cells and drug-resistant cells to targeted drugs

The parent cells and drug-resistant cells of PC9 and HCC827 were seeded in 96-well plates at 3×10 ⁴ cells/ml, and 24 hours later, different concentrations of gefitinib and osimertinib were added at the concentrations of 0 μM and 0.05 μM, respectively , 0.1μM, 0.5μM, 1μM, 5μM, 5 replicate wells for each concentration. After 72h, add CellTiter-Glo cell viability detection reagent (Promega), add 30μL per well. Shake the 96-well plate for 5 minutes, and then let it stand at room temperature for 5 minutes for a total of 10 minutes of incubation. Use a microplate reader to detect the luminescence value.

Figure 1B shows the results of the cell viability experiment, which shows that in the non-small cell lung cancer cell line PC9 drug-resistant cell model, compared with the parental cells, the drug-resistant cells pair targeted drugs (gefitinib and osimertin) The sensitivity of Ni) was significantly reduced. Under 1 μM osimertinib treatment, the survival rate of PC9 drug-resistant cells was 100%, but the survival rate of PC9 parental cells was only 40.9%. Under 1 μM gefitinib treatment, the survival rate of PC9 drug-resistant cells was 78%, but the survival rate of PC9 parental cells was only 48%.

Figure 1C is the result of the cell viability experiment, which shows that in the drug-resistant cell model of the non-small cell lung cancer cell line HCC827, compared with the parental cells, the drug-resistant cells pair targeted drugs (gefitinib and osimerti The sensitivity of Nepal is also significantly reduced. Under 1 μM osimertinib treatment, the survival rate of HCC827 drug-resistant cells was 87%, but the survival rate of HCC827 parental cells was only 33%. Under 1μM Gefitinib treatment, the survival rate of HCC827 drug-resistant cells was 82.2%, but the survival rate of HCC827 parental cells was only 42.6%. The above results suggest that the sensitivity of drug-resistant cells to targeted drugs is significantly lower than that of parent cells.

Example 3: LC/MS analysis of parental cells and drug-resistant cells

Select non-small cell lung cancer cell lines PC9 and HCC827, use high-dose (2μM) EGFR mutation targeting drugs gefitinib and osimertinib to treat the cells, change the medium every 3 days for a total of 9 days to obtain the drug Tolerant cells.

To determine the difference metabolites between drug-resistant cells and parent cells, extract the metabolites of parent cells and drug-resistant cells: 1mL -80℃ methanol-water (80:20, V/V) solution containing internal standard was added Put it in a cell culture dish (about 1.5 million cells), place it at -80℃ for 20 minutes, place the culture dish on dry ice, collect the cell suspension system sample with a cell scraper, centrifuge at 15000rpm, 4℃ for 15min, and take 800μL of the supernatant , Concentrate in vacuum to dryness, store at -80°C. Sample pretreatment: Dissolve each sample with 56 μL of mobile phase A, vortex for 1 min, centrifuge at 15000 rpm and 4°C for 15 min, take 50 μL of supernatant and place it in the liquid phase vial sleeve. Quantitative analysis of metabolites: Liquid chromatography-mass spectrometry (LC-MS) method is used for analysis, and the liquid phase method uses Waters ACQUITY UPLC HSS T3 (1.8μm, 2.1x 5mm) guard column, Waters ACQUITY UPLC HSS T3 (1.8 μm, 2.1x 150mm) chromatographic column; using 0.03% formic acid-containing aqueous phase (A) and 0.03% formic acid-containing acetonitrile (B) as mobile phases, elution is carried out according to the following gradient: 0-3min, 1% B; 3 -15min, 1%-99%B; 15-17min, 99%B; 17-17.1min, 99%-1%B; 17.1-20min, 1%B; column temperature: 35℃; sample chamber temperature: 4 ℃; flow rate: 0.25mL/min, injection volume: 20μL. The mass spectrometry method uses a triple quadrupole mass spectrometer (AB SCIEX QTRAP 6500PLUS) combined with multi-reaction monitoring (MRM) mode, and the target compound acetylcholine and internal standard (deuterated choline) parent ion, daughter ion and Mass spectrometry parameters such as collision energy, and then use internal standard method to quantitatively analyze the target compound. Data processing: Use the data processing software MultiQuant 3.0.2 to perform the integration of chromatographic peaks, the preparation of standard music and the calculation of concentration.

Figure 2 shows that the content of acetylcholine in PC9 parent cells is 0.387 picomoles/10 ⁵ cells, and the content of acetylcholine in PC9 drug-resistant cells is 13.03 picomoles/10 ⁵ cells. It can be seen that the content of acetylcholine in drug-resistant cells is significantly higher than that in parent cells.

Example 4: Detecting the content of acetylcholine in the drug tolerance model in vivo

To further determine the changes in acetylcholine content in the drug tolerance model in vivo, PC9 cells were used to construct a nude mouse xenograft model. Use trypsin to digest PC9 cells, stop the digestion, centrifuge and resuspend in 5ml cold 1xPBS. Each mouse needs to be injected with 5x10 ⁶ cells. Mix the pre-cooled PBS and Matrigel at a ratio of 1:1 on ice, and resuspend the cells to a final concentration of 5x10 ⁷ cells/ml. 100 μL of tumor cell suspension was injected subcutaneously into mice. The dosage regimen is: 1% sodium carboxymethyl cellulose nitrocellulose is used to prepare osimertinib, and mice are treated with 5 mg/kg/day osimertinib by gavage, and 1% carboxymethyl cellulose is used for the control group. Mice were treated with sodium methylcellulose. The tumor tissues of the drug-resistant group and the control group were collected after continuous administration for 9 days. In addition, we used the patient-derived xenografts (PDX) model of human-derived lung cancer constructed by Shanghai Lidi Biotechnology Company. The model number is LD1-0006-217645. The patient is a female, aged 62 years old, and the pathological diagnosis is lung cancer. -Low to moderately differentiated adenocarcinoma, EGFR mutation type is Exon 19 deletion (T790M). Osimitinib was prepared with 1% sodium carboxymethyl cellulose nitrate solution, and mice were treated with 5 mg/kg/day osimertinib by gavage, and 1% sodium carboxymethyl cellulose was used in the control group. Handling mice. Tumor tissues from the drug-resistant group and the control group were collected after 28 days of continuous administration.

In order to determine the acetylcholine content between the tissues of the drug tolerance group and the control group, extract the metabolites of the tissues: collect fresh tissue samples into the cryotube and quickly put them into liquid nitrogen for freezing. In order to extract the tissue metabolites, Weigh 20～30mg of tissue into EP tube, record the weight of tissue, configure -80℃ methanol-water (80:20, V/V) solution with a certain concentration of internal standard (deuterated choline), add 50μL to 1mg tissue Add the methanol solution containing the internal standard to the methanol solution, add grinding beads, then use a homogenizer to homogenize the tissue, collect the homogenate into a new EP tube, vortex vigorously for 1 min with a vortexer at 15000rpm, 4℃ Centrifuge for 15 min, take 800 μL of the supernatant, concentrate in vacuo to dryness, and store at -80°C. Sample pretreatment: Dissolve each sample in water, vortex for 1 min, centrifuge at 15000 rpm and 4°C for 15 min, take 50 μL of the supernatant, and place it in the liquid phase vial sleeve. Quantitative analysis of metabolites: Liquid chromatography-mass spectrometry (LC-MS) method is used for analysis, and the liquid phase method uses Waters ACQUITY UPLC BEH HILIC (2.1mm×5mm, 1.7μm) guard column, Waters ACQUITY UPLC BEH HILIC( 2.1mm×100mm, 1.7μm) ACQUITY UPLC Chromatography Column; using 5mM ammonium formate-containing water-acetonitrile (5:95)(A) and 5mM ammonium formate-containing water-acetonitrile (50:50)(B) as mobile phases , Eluting according to the following gradient: 0-3min, 1%B; 3-15min, 1%-99%B; 15-17min, 99%B; 17-17.1min, 99%-1%B; 17.1-20min , 1% B; column temperature: 35°C; sample chamber temperature: 4°C; flow rate: 0.5 mL/min, sample volume: 10 μL. The mass spectrometry method uses a triple quadrupole mass spectrometer (AB SCIEX QTRAP 6500PLUS) combined with multiple reaction monitoring (MRM) mode. The target compound acetylcholine and the internal standard are pre-injected to optimize the mass spectrometry parameters such as the parent ion, product ion and collision energy of the target compound acetylcholine and the internal standard. The internal standard method was used to quantitatively analyze the target compound. Data processing: Use the data processing software MultiQuant 3.0.2 to perform the integration of chromatographic peaks, the preparation of standard music and the calculation of concentration.

Figure 3A shows that the content of acetylcholine in the drug resistance group of PC9 nude mice was 261.24pg/mg, and the content of acetylcholine in the control group was 15.35pg/mg. It can be seen that the content of acetylcholine in the tumor tissue of the PC9 drug resistance group was significantly higher than that in the control group Tumor tissue, indicating that the acetylcholine content in the drug-resistant tumor tissue formed by the PC9 nude mouse model after targeted drug treatment was significantly increased.

Figure 3B shows that the content of acetylcholine in the drug resistance group of the PDX-217645 model was 54.69pg/mg, and the content of acetylcholine in the control group was 9.73pg/mg. It can be seen that the content of acetylcholine in the tumor tissue of the PDX-217645 model drug resistance group was significant It is higher than the control group tumor tissue, indicating that the acetylcholine content in the drug-resistant tumor tissue formed by the PDX model after targeted drug treatment is significantly increased.

Example 5: Detection of the content of acetylcholine secreted out of the cell by parental cells and drug-resistant cells

In order to confirm the content of acetylcholine secreted to the outside of the parent cells and drug-resistant cells, we cultured the parent cells and drug-resistant cells, and added 50μM acetylcholinesterase (ACHE) inhibitor Neostigmine Bromide . After 9 days of cultivation, the upper medium was collected and the metabolites of the medium were extracted. First, prepare a methanol solution of a certain concentration of internal standard (deuterated choline), add the methanol solution containing the internal standard according to the ratio of 400μL methanol solution to 100μL medium, vortex vigorously for 1min with a vortexer, and centrifuge at 15000rpm and 4℃ 15min, take 400μL of supernatant, vacuum concentrate to dryness, store at -80℃. Sample pretreatment: Dissolve each sample in water, vortex for 1 min, centrifuge at 15000 rpm and 4°C for 15 min, take 50 μL of the supernatant, and place it in the liquid phase vial sleeve. Quantitative analysis of metabolites: Liquid chromatography-mass spectrometry (LC-MS) method is used for analysis, and the liquid phase method uses Waters ACQUITY UPLC BEH HILIC (2.1mm×5mm, 1.7μm) guard column, Waters ACQUITY UPLC BEH HILIC( 2.1mm×100mm, 1.7μm) ACQUITY UPLC Chromatography Column; using 5mM ammonium formate-containing water-acetonitrile (5:95)(A) and 5mM ammonium formate-containing water-acetonitrile (50:50)(B) as mobile phases , Eluting according to the following gradient: 0-3min, 1%B; 3-15min, 1%-99%B; 15-17min, 99%B; 17-17.1min, 99%-1%B; 17.1-20min , 1% B; column temperature: 35°C; sample chamber temperature: 4°C; flow rate: 0.5 mL/min, sample volume: 10 μL. The mass spectrometry method uses a triple quadrupole mass spectrometer (AB SCIEX QTRAP 6500PLUS) combined with multiple reaction monitoring (MRM) mode. The target compound acetylcholine and the internal standard are pre-injected to optimize the mass spectrometry parameters such as the parent ion, product ion and collision energy of the target compound acetylcholine and the internal standard. The internal standard method was used to quantitatively analyze the target compound. Data processing: Use the data processing software MultiQuant 3.0.2 to perform the integration of chromatographic peaks, the preparation of standard music and the calculation of concentration.

Figure 4 shows the content of acetylcholine in the culture medium of PC9 parent cells and drug-resistant cells. It shows that compared with PC9 parent cells, the content of acetylcholine secreted to the outside of the cell by drug-resistant cells is significantly increased. The above results indicate that the content of acetylcholine synthesized by the drug-resistant cells induced by the targeted drug and secreted to the outside of the cell are significantly increased.

Example 6: Detection of acetylcholine levels in plasma of patients with non-small cell lung cancer with EGFR mutations before and after targeted therapy

We enrolled 22 patients with non-small cell lung cancer with EGFR mutations from the Tumor Hospital of Guangxi Medical University and Shanghai Pulmonary Hospital. We collected plasma samples of the patients before and after targeted drug treatment, and extracted plasma metabolites. First, prepare a methanol solution of a certain concentration of internal standard (deuterated choline), add the methanol solution containing the internal standard according to the ratio of 400μL methanol solution to 100μL of plasma, vortex vigorously for 1min using a vortexer, and centrifuge at 15000rpm and 4℃ for 15min , Take 400μL of supernatant, vacuum concentrate to dryness, store at -80℃. Sample pretreatment: Dissolve each sample in water, vortex for 1 min, centrifuge at 15000 rpm and 4°C for 15 min, take 50 μL of the supernatant, and place it in the liquid phase vial sleeve. Quantitative analysis of metabolites: Liquid chromatography-mass spectrometry (LC-MS) method is used for analysis, and the liquid phase method uses Waters ACQUITY UPLC BEH HILIC (2.1mm×5mm, 1.7μm) guard column, Waters ACQUITY UPLC BEH HILIC( 2.1mm×100mm, 1.7μm) ACQUITY UPLC Chromatography Column; using 5mM ammonium formate-containing water-acetonitrile (5:95)(A) and 5mM ammonium formate-containing water-acetonitrile (50:50)(B) as mobile phases , Eluting according to the following gradient: 0-3min, 1%B; 3-15min, 1%-99%B; 15-17min, 99%B; 17-17.1min, 99%-1%B; 17.1-20min , 1% B; column temperature: 35°C; sample chamber temperature: 4°C; flow rate: 0.5 mL/min, sample volume: 10 μL. The mass spectrometry method uses a triple quadrupole mass spectrometer (AB SCIEX QTRAP 6500PLUS) combined with multiple reaction monitoring (MRM) mode. The target compound acetylcholine and the internal standard are pre-injected to optimize the mass spectrometry parameters such as the parent ion, product ion and collision energy of the target compound acetylcholine and the internal standard. The internal standard method was used to quantitatively analyze the target compound. Data processing: Use the data processing software MultiQuant 3.0.2 to perform the integration of chromatographic peaks, the preparation of standard music and the calculation of concentration.

Figure 5A shows that the average plasma acetylcholine content of 8 patients before targeted therapy was 1.11 nM, while the average plasma acetylcholine content of 6 patients after targeted therapy was 2.63 nM. Figure 5B shows that the plasma acetylcholine content of 8 patients after targeted therapy is higher than the plasma acetylcholine content of this patient before targeted therapy. The above results show that plasma acetylcholine levels in patients with EGFR mutations after targeted therapy are higher than those in plasma before targeted therapy, indicating that plasma levels of acetylcholine in patients with non-small cell lung cancer have predictive targets Potential biomarker function of the formation of therapeutic drug tolerance.

Example 7: Detection of the expression of key enzymes of the acetylcholine pathway in drug-resistant cells

As described in the present invention, acetylcholine is synthesized by choline and acetyl-CoA under the action of choline acetyltransferase (ChAT), and acetylcholine is decomposed by acetylcholinesterase (ACHE) into choline and acetic acid. Acetylcholine can be secreted out of the cell by acetylcholine transporter (VAChT). Acetylcholine can bind to acetylcholine receptors on the cell surface, activate intracellular signaling pathways, and regulate cell functions.

In order to determine the reason for the up-regulation of acetylcholine content in drug-resistant cells, Western Western blotting was used to detect the expression of choline acetyltransferase (ChAT) and acetylcholinesterase (ACHE) in parental cells and drug-resistant cells. The non-small cell lung cancer cell line PC9 was selected, and the cells were treated with a high-dose (2μM) EGFR mutation targeting drug. The medium was changed every 3 days for a total of 9 days to obtain drug-resistant cells. Resuspend the cells in protein lysis buffer, place them on ice for 30 minutes, centrifuge at 4°C and 14000 rpm for 15 minutes, and obtain protein lysis buffer after centrifugation. The lysate was separated by SDS-PAGE, and the expression of acetyltransferase (ChAT) and acetylcholinesterase (ACHE) was detected by immunoblotting. ACHE antibody was purchased from Abcam, and ChAT antibody was purchased from Proteintech.

Figure 6A shows the results of the immunoblotting experiment of ChAT in PC9 cells. The lanes from left to right correspond to the PC9 parent cells, induced by gefitinib, erlotinib, osimertinib and Rociletinib (CO1686) Of drug resistant cells. The results showed that choline acetyltransferase (ChAT) expression was significantly up-regulated in drug-resistant cells.

Figure 6B shows the results of immunoblotting experiments of AChE in PC9 and HCC827 cells. From left to right, the lanes correspond to parent cells, drug-resistant cells induced by gefitinib and osimertinib, each group Make two copies. The results showed that there was no significant change in acetylcholinesterase (AChE) in drug-resistant cells.

The results of Figures 6A and 6B show that the rate of acetylcholine synthesis in drug-resistant cells increases, leading to its accumulation in the cells.

Example 8: Detecting the expression of Wnt pathway related genes in drug-resistant cells

The non-small cell lung cancer cell line PC9 was selected, and the cells were treated with a high-dose (2μM) EGFR mutation targeting drug osimertinib. The medium was changed every 3 days for a total of 9 days to obtain drug-resistant cells. Use the Trizol method to extract RNA: Transfer the Trizol lysate into an EP tube and leave it at room temperature for 5 minutes; in the EP tube, add the corresponding volume of chloroform (ie 1/5 volume) at the ratio of 0.2 mL of chloroform per 1 mL of Trizol. Cover the EP tube lid, shake vigorously in your hand for 15 seconds, leave it at room temperature for 2 minutes, and centrifuge at 14000 rpm, 4°C for 15 minutes. Take the upper aqueous phase and mix thoroughly with 0.5 mL of isopropanol, let stand still to precipitate RNA, and centrifuge at 14000 rpm (4° C.) for 15 minutes to obtain RNA. The extracted RNA of parental cells and drug-resistant cells was sequenced by Novo Zhiyuan.

Figure 7A shows the results of RNAseq analysis, which shows that the expression of Wnt ligand genes Wnt3a, Wnt10a, Wnt8b, and Wnt6 in drug-resistant cells is more than 4 times that of parent cells.

Use real-time fluorescent quantitative PCR technology to verify the expression of Wnt pathway related genes in drug-resistant cells at the mRNA level, including Wnt ligands: Wnt3a, Wnt10a, Wnt4, Wnt6, Wnt5b, Wnt8b, Wnt7b, Wnt9a, and Wnt pathway target genes: s100a4, sox2, KLF4, BCL2L1, CD133. The real-time fluorescent quantitative PCR detection kit was purchased from Biorad. The primers were synthesized by Ruibo Xingke Company, and the primer sequence is:

Wnt4-F, TCAGAGGCCCTCATGAACCT

Wnt4-R, CACCCGCATHTHTHTCAG

Wnt6-F, AGAGTGCCAGTTCCAGTTCC

Wnt6-R, AGAGTGCCAGTTCCAGTTCC

Wnt10a-F, CCCAATGACATTCTGGACCT

Wnt10a-R, TAAGCGGTGCAGCTTCCTAC

Wnt3a-F, TCAGCTGCCAGGAGTGCACG

Wnt3a-R, CGCCCTCAGGGAGCAGCCTAC

Wnt5b-F, GCTTCTGACAGACGCCAACT

Wnt5b-R, CACCGATGATAAACATCTCGGG

Wnt8b-F, CCGACACCTTTCGCTCCATC

Wnt8b-R, CAGCCCTAGCGTTTTGTTCTC

Wnt7b-F, GAAGCAGGGCTACTACAACCA

Wnt7b-R, CGGCCTCATTGTTATGCAGGT

Wnt9a-F, AGCAGCAAGTTCGTCAAGGAA

Wnt9a-R, CCTTCACACCCACGAGGTTG

S100a4-F, AACTAAAGGAGCTGCTGACCC

S100a4-R, TGTTGCTGTCCAAGTTGCTC

Sox2-F, CAAGATGCACAACTCGGAGA

Sox2-R, GCTTAGCCTCGTCGATGAAC

KLF4-F, CGAACCACACAGGTGAGAA

KLF4-R, TACGGTAGTGCCTGGTCAGTTC

BCL2L1-F, TTGCCAGCCGGAACCTATG

BCL2L1-R, CGAAGGCGACCAGCAATGATA

CD133-F, TTACGGCACTCTTCACCT

CD133-R, TATTCCACAAGCAGCAAA

GAPDH-F, CCTGTTCGACAGTCAGCCG

GAPDH-R, CCTGTTCGACAGTCAGCCG

The real-time fluorescent quantitative PCR reaction system is:

Use StepOnePlus real-time fluorescent quantitative PCR instrument (Applied Biosystems) to detect the level of corresponding mRNA. The reaction conditions are as follows: 94°C for 5 minutes; 94°C for 10s, 60°C for 30s, and 40 cycles. According to the Ct value in the experimental results, according to the 2-ΔΔCt method, and using GAPDH as the internal reference gene, the mRNA level of the tested gene in the sample was relatively quantitatively analyzed.

Figure 7B shows the results of real-time fluorescent quantitative PCR. The expression of Wnt ligands Wnt3a, Wnt10a, Wnt4, Wnt6, Wnt5b, Wnt8b, Wnt7b, Wnt9a and Wnt signaling pathway target genes s100a4, sox2, KLF4, BCL2L1, CD133 in drug-resistant cells was significant Higher than the parent cell. This result indicates that the Wnt pathway is activated in drug-resistant cells.

Example 9: Detection of the effect of exogenous acetylcholine on the expression of Wnt pathway related genes in non-small cell lung cancer parent cells

First, HCC827 cells were treated with 10 μM and 100 μM acetylcholine for 7 days. Using Trizol method to extract cell RNA, real-time fluorescent quantitative PCR experiment was performed to detect the expression of Wnt pathway related genes before and after treatment at the mRNA level, including Wnt ligands: Wnt3a, Wnt10a, Wnt4, Wnt6, Wnt9a and Wnt pathway target genes: s100a4, KLF4 , BCL2L1. The real-time fluorescent quantitative PCR detection kit was purchased from Biorad. The primers are synthesized by Ruibo Xingke Company, and the primer sequence is the same as above.

The real-time fluorescent quantitative PCR reaction system is:

Use StepOnePlus real-time fluorescent quantitative PCR instrument (Applied Biosystems) to detect the level of corresponding mRNA. The reaction conditions are as follows: 94°C for 5 minutes; 94°C for 10s, 60°C for 30s, and 40 cycles. According to the Ct value in the experimental results, according to the 2-ΔΔCt method, and using GAPDH as the internal reference gene, the mRNA level of the tested gene in the sample was relatively quantitatively analyzed.

Figure 8 shows the real-time fluorescent quantitative PCR results, which showed that the expression of Wnt ligands Wnt3a, Wnt10a, Wnt4, Wnt6, and Wnt9a were significantly up-regulated after HCC827 cells were treated with 10μM and 100μM acetylcholine for 7 days; HCC827 cells were treated with 10μM and 100μM After 7 days of acetylcholine treatment, the expression of Wnt pathway target genes s100a4, KLF4, and BCL2L1 were significantly up-regulated. This result indicates that the increase in the content of exogenous acetylcholine promotes the activation of the Wnt pathway in the parental cells of non-small cell lung cancer.

Example 10: The effect of acetylcholine on the sensitivity of non-small cell lung cancer parent cells to targeted drugs

First, the PC9 parent cells were pretreated with 10 μM acetylcholine (purchased from sigma), and the treatment time was 3 days. Then the pretreated cells (acetylcholine group) and the unpretreated cells (control group) were seeded in 96-well plates at 2×10 ⁴ cells/ml. After 24 hours, the cells adhered to the wall and added different concentrations of gefitin. Ni (Figure 9A) and osimertinib (Figure 9B), the concentrations are 0μM, 0.001μM, 0.005μM, 0.01μM, 0.05μM, 0.1μM, 0.5μM, 1μM, 5μM, 10μM, each concentration set 5 Multiple holes. After 5 days, add CellTiter-Glo cell viability detection reagent and add 30μL per well. Shake the 96-well plate for 5 minutes, and then let it stand at room temperature for 5 minutes for a total of 10 minutes of incubation. Use a microplate reader to detect the luminescence value.

Figures 9A and 9B are the results of cell viability experiments, which show that exogenous addition of acetylcholine can reduce the sensitivity of PC9 parent cells to drugs. For example, according to Figure 9A, under 1 μM gefitinib treatment, the survival rate of cells not treated with acetylcholine was 39.4%, and the survival rate of cells treated with acetylcholine was 72.2%. According to Fig. 9B, under the treatment of 1 μM osimertinib, the survival rate of cells without acetylcholine treatment was 37.6%, and the survival rate of cells treated with acetylcholine was 89.8%. It indicates that the sensitivity of PC9 cells to osimertinib and gefitinib is significantly reduced after acetylcholine treatment.

LGK974 is an inhibitor of the Wnt signaling pathway. Cells are treated simultaneously with exogenous acetylcholine and LGK974 for cell viability testing. First, the PC9 parent cells were pretreated with 10 μM acetylcholine (purchased from sigma), and the treatment time was 3 days. Then the pretreated cells (acetylcholine group) and unpretreated cells (control group) were seeded on a 96-well plate at 2×10 ⁴ cells/ml. After 24 hours, the cells adhered to the wall, and different concentrations of osimer were added. Ni, the concentrations are 0μM, 0.0005μM, 0.001μM, 0.005μM, 0.5μM, among which, the acetylcholine group and the control group each have a group of different concentrations of osimertinib combined with 5μM LGK974 to co-process cells. Figure 10 shows that under the treatment of 0.001 μM osimertinib, the survival rate of parental cells was 85.5%, the survival rate of cells treated with acetylcholine was 103.8%, and the survival rate of cells treated with acetylcholine and LGK974 was 77.2%. This result indicates that inhibition of the Wnt pathway can reverse the effect of acetylcholine on the drug sensitivity of PC9 parent cells.

Example 11: The effect of knocking down key genes in the acetylcholine pathway on drug sensitivity and drug-resistant cell formation

We use genetic methods to further verify the role of choline acetyltransferase (ChAT), acetylcholine receptor (M3R) and acetylcholine transporter (VAChT) in regulating the drug sensitivity and drug tolerance of EGFR inhibitors. First, we constructed lentivirus-mediated shChAT, shM3R, shVAChT knockdown PC9 and HCC827 cell lines. The control group PC9 cells and shChAT knockdown PC9 cells were seeded on a 96-well plate at 2×10 ⁴ cells/ml. After 24 hours, the cells adhered to the wall, and different concentrations of osimertinib were added: the concentrations were 0 μM, 0.0005 μM, 0.001μM, 0.0025μM, 0.005μM, 0.01μM, 0.05μM, 0.5μM, 1μM, 5μM, 6 replicate wells for each concentration. In addition, the control group HCC827 cells and shChAT knockdown HCC827 cells were seeded in 96-well plates at 2×10 ⁴ cells/ml. After 24 hours, the cells adhered to the wall, and different concentrations of gefitinib were added: the concentrations were 0 μM and 0.0005. μM, 0.005μM, 0.05μM, 0.25μM, 0.75μM, 1.5μM, 5μM, 10μM, 6 replicate wells for each concentration. After 5 days, add CellTiter-Glo cell viability detection reagent and add 30μL per well. Shake the 96-well plate for 5 minutes, and then let it stand at room temperature for 5 minutes for a total of 10 minutes of incubation. Use a microplate reader to detect the luminescence value.

In addition, we use clone formation experiments to detect the ability of drug-resistant cells to form. The control cells, shM3R and shVAChT knockdown cells were seeded in a 6-well plate at 1.5×10 ⁴ cells/ml. After the cells adhered to the wall, dimethyl sulfoxide and 2 μM osimertinib were added to culture for 9 days, every 3 Change the liquid once a day. After 9 days of culture, the cells were fixed with 4% paraformaldehyde, stained with 0.5% crystal violet, and observed and photographed with a microscope.

Figure 11A shows the results of cell viability experiments, which show that PC9 cells knocked down by shChAT have a significantly increased sensitivity to osimertinib. For example, shChAT knockdown PC9 cells have IC50 values of 7.26 nM and 8.06 nM for osimertinib, while parent PC9 cells have IC50 values of 15.53 nM for osimertinib. Figure 11B shows the results of cell viability experiments, which show that the sensitivity of shChAT knockdown HCC827 cells to gefitinib was significantly increased. For example, shChAT knockdown HCC827 cells have IC50 values of 7.55 nM and 4.87 nM for osimertinib, while the IC50 value of parent cells for osimertinib is 20.53 nM. The above results indicate that ChAT, a key enzyme that catalyzes the synthesis of acetylcholine, plays an important role in regulating the sensitivity of tumor cells to targeted drugs.

Figure 12A shows the results of the clone formation experiment, which shows that compared with control cells, PC9 cells knocked down by shM3R and shVAChT have a reduced ability to form drug-resistant cells under 2 μM osimertinib treatment. Figure 12B shows the results of the clone formation experiment, which shows that compared with the control cells, shM3R and shVAChT knockdown HCC827 cells have reduced drug-resistant cell formation ability under 2 μM osimertinib treatment. The above results indicate that the acetylcholine receptor M3R and the acetylcholine transporter VAChT play an important role in regulating the formation of drug-resistant cells induced by targeted drugs.

Example 12: Effect of acetylcholine pathway modulators on drug-resistant cells of EGFR mutant non-small cell lung cancer cell line

In order to test the importance of acetylcholine pathway activation in the formation of drug-resistant cells, we tested acetylcholine M-type receptor inhibitors (including darfinacine, Benztropine mesylate, and Irsogladine). ) And methyl scopolamine (Methscopolamine), acetylcholine N-type receptor inhibitors (including MG624, Mecamylamine and Pancuromium dibromide), VAChT inhibitor (Vesamicol) and choline Transporter CHT1 inhibitor (Hemicholinium-3) inhibits parental cells and drug-resistant cells.

Among them, the source of inhibitors is the small molecule compound library of selleck and sigma provided by the drug screening platform of Tsinghua University. Darfinazin was purchased from selleck, and Vesamicol and hemicholine-3 were purchased from sigma. The EGFR mutation-targeted drugs osimertinib and gefitinib, erlotinib and CO1686 were all purchased from Selleck.

The experimental process is as follows: PC9 cells were seeded in a 96-well plate at 2×10 ⁴ cells/ml, and the following dosing treatment was performed after 24 hours.

1) The effect of M-type acetylcholine receptor inhibitors on the formation of drug-resistant cells

For the parental cells, different concentrations of darfinacine (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM) and benztropine mesylate (0μM, 1.25μM, 2.5μM) were added to PC9 cells. , 5μM, 10μM, 20μM, 50μM), isoladine (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM) and methyl scopolamine (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM) to treat the cells, and use the CellTiter-Glo chemiluminescence cell viability detection kit to detect the cell viability after 6 days.

For the detection of the formation process of drug-resistant cells, first add 2μM of EGFR targeting drugs osimertinib, gefitinib, CO1686 and erlotinib to the culture medium, and then add separately for each targeted drug Different concentrations of darfinacine (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM), benztropine mesylate (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM), Isogladine (0 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM, 20 μM, 50 μM) and methyl scopolamine (0 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM, 20 μM, 50 μM) were used to treat the cells. CellTiter-Glo chemiluminescence cell viability detection kit was used to detect cell viability after 6 days.

Figure 13A shows the effect of acetylcholine M receptor inhibitors darfinacine, benztropine mesylate, isoladine and methylscopolamine on PC9 cells in the presence and absence of osimertinib . The results show that the addition of an acetylcholine M receptor inhibitor can significantly inhibit the formation of drug-resistant cells against osimertinib.

For example, according to Figure 13A, in the presence of 2 μM osimertinib, the survival rate of PC9 cells treated with 50 μM darfinacine was 11.8% compared to the case where no acetylcholine M receptor inhibitor was added (0 μM) ; The survival rate of PC9 cells treated with 50μM benztropine mesylate was 4%; the survival rate of PC9 cells treated with 20μM isoladine was 7.4%; the survival rate of PC9 cells treated with 5μM methylscopolamine Is 8.1%.

In addition, Fig. 13A also shows that in the absence of osimertinib, only the addition of an M-type receptor inhibitor has little effect on the viability of PC9 parental cells. For example, according to Figure 13A, the survival rate of PC9 parent cells treated with only 50 μM darfinacine was 84.3%; the survival rate of parent cells treated with only 50 μM benztropine mesylate was 95%; The survival rate of the parental cells treated with solamidine was 108%; the survival rate of the parental cells treated with only 5μM methylscopolamine was 90%, which was significantly higher than in the presence of both osimertinib and M receptor inhibitors PC9 cell survival rate under.

It can be seen that M-type receptor inhibitors can significantly inhibit the survival of drug resistant cells induced by osimertinib, but have no effect on the parental cells.

Figure 13B shows that in the presence and absence of EGFR-targeting drugs (gefitinib, CO1686, and erlotinib), the acetylcholine M receptor inhibitor darfinacine and benztropine mesylate pair The influence of PC9 cells. The results show that the addition of acetylcholine M receptor inhibitors can significantly inhibit the formation of drug-resistant cells against gefitinib, CO1686 and erlotinib.

For example, according to the left column of Figure 13B, compared to the case where darfinacine was not added (0 μM), the survival rate of drug-resistant cells induced by 2 μM gefitinib under the action of 50 μM darfinacine was 59.7 %, the survival rate of drug-resistant cells induced by 2μM CO1686 was 31.4%, and the survival rate of drug-resistant cells induced by 2μM erlotinib was 58.3%. In contrast, the survival rate of parental cells in the absence of targeted drugs was 107%.

In addition, according to the right column of Figure 13B, compared to the case of no benztropine mesylate (0μM), under the action of 50μM benztropine mesylate, the drug tolerance induced by 2μM gefitinib The cell survival rate was 31.7%, the survival rate of drug-resistant cells induced by 2μM CO1686 was 24.4%, and the survival rate of drug-resistant cells induced by 2μM erlotinib was 42.2%. In contrast, in the absence of targeted drugs, the survival rate of parental cells was 85.4%.

It can be seen that M receptor inhibitors can significantly inhibit the survival of drug-resistant cells induced by gefitinib, CO1686 and erlotinib, but have no effect on the parental cells.

2) The effect of N-type acetylcholine receptor inhibitors on the formation of drug-resistant cells

For the parent cells, different concentrations of MG624 (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM), mecamylamine (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM) and pancuronium bromide (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM) were used to treat the cells, and the CellTiter-Glo chemiluminescence cell viability detection kit was used to detect cell viability after 6 days.

For the detection of the formation process of drug-resistant cells, first add 2μM of EGFR targeting drugs osimertinib, gefitinib, CO1686 and erlotinib to the culture medium, and then add separately for each targeted drug Different concentrations of MG624 (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM), mecamylamine (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM) and pancuronium (0μM, 1.25μM, 2.5μM, 5μM, 10μM, 20μM, 50μM) to treat the cells. CellTiter-Glo chemiluminescence cell viability detection kit was used to detect cell viability after 6 days.

Figure 14 shows the effects of acetylcholine N-type receptor inhibitors MG624, mecamylamine and pancuronium on PC9 cells in the presence and absence of EGFR-targeting drugs. The results show that the addition of an acetylcholine N-type receptor inhibitor can significantly inhibit the formation of drug-resistant cells against osimertinib, gefitinib, CO1686 and erlotinib.

For example, according to the left column of Figure 14, the survival rate of drug-resistant cells induced by 2μM osimertinib under the action of 10μM MG624 was 37.9% compared with the case without MG624 (0μM), and after 2μM gemfibrin The survival rate of drug-resistant cells induced by tinib was 37.6%, the survival rate of drug-resistant cells induced by 2μM CO1686 was 40%, and the survival rate of drug-resistant cells induced by 2μM erlotinib 37.6%. In contrast, the survival rate of parental cells in the absence of targeted drugs is about 100%.

According to the column in Figure 14, the survival rate of drug-resistant cells induced by 2μM osimertinib under the action of 50μM mecamylamine (0μM) was 32.6%, compared with the case without mecamylamine (0μM). The survival rate of drug-resistant cells induced by gefitinib was 32.4%, the survival rate of drug-resistant cells induced by 2μM CO1686 was 16.2%, and the survival rate of drug-resistant cells induced by 2μM erlotinib It is 38.7%. In contrast, the survival rate of parental cells in the absence of targeted drugs is about 100%.

According to the right column of Figure 14, the survival rate of drug-resistant cells induced by 2μM osimertinib under the action of 5μM pancuronium bromide was 33.9% compared to the case where pancuronium was not added (0μM). The survival rate of drug-resistant cells induced by 2μM gefitinib was 20%, the survival rate of drug-resistant cells induced by 2μM CO1686 was 12.4%, and drug-resistant cells induced by 2μM erlotinib The survival rate was 20.8%. In contrast, the survival rate of parental cells in the absence of targeted drugs is 88%.

It can be seen that inhibitors of N-type receptors can significantly inhibit the survival of drug-resistant cells induced by osimertinib, gefitinib, CO1686 and erlotinib, but have no effect on the parent cells.

3) The influence of acetylcholine transporter inhibitor and choline transporter inhibitor on the formation of drug-resistant cells

For the parental cells, different concentrations of acetylcholine transporter VAChT inhibitor Vesamicol (0μM, 10μM, 25μM, 50μM, 100μM) and choline transporter CHT1 inhibitor hemicholine-3 (0μM, 10μM, 100μM) were added to PC9 cells. 25μM, 50μM, 100μM) were used to treat the cells, and the CellTiter-Glo chemiluminescence cell viability detection kit was used to detect the cell viability after 6 days.

For the detection of the formation process of drug-resistant cells, first add 2μM EGFR targeting drugs osimertinib and gefitinib to the culture medium, and then add different concentrations of acetylcholine transporter VAChT for each targeted drug. The inhibitor Vesamicol (0 μM, 10 μM, 25 μM, 50 μM, 100 μM) and the choline transporter CHT1 inhibitor hemicholine-3 (0 μM, 10 μM, 25 μM, 50 μM, 100 μM) were used to treat the cells. CellTiter-Glo chemiluminescence cell viability detection kit was used to detect cell viability after 6 days.

Figure 15 shows the effects of acetylcholine transporter VAChT inhibitor Vesamicol and choline transporter CHT1 inhibitor hemicholine-3 on PC9 cells in the presence and absence of EGFR-targeting drugs. The results showed that after Vesamicol and hemicholine-3 treatment, the survival of drug-resistant cells induced by osimertinib and gefitinib was significantly lower than that of parent cells. It can be seen that the addition of acetylcholine transporter VAChT inhibitor and choline transporter can significantly inhibit the formation of drug-resistant cells against osimertinib and gefitinib.

Example 13: Effects of acetylcholine pathway modulators on PDX in vitro cell model

We used the patient-derived xenografts (PDX) model of human-derived lung cancer constructed by Shanghai Lidi Biotechnology Company. The model number is LD1-0006-217645. The patient is female, aged 62 years old, and the pathological diagnosis is lung cancer-low Moderately differentiated adenocarcinoma, the EGFR mutation type is Exon 19deletion (T790M). The PDX tumor tissue was digested in vitro to obtain a single cell suspension, and the cell count was performed to prepare a 1.1× ^{10 5} /mL cell suspension. Drop the cell suspension into the 96-well plate, adding 135μL to each well. The drugs of different treatment groups were added sequentially, namely: control group; 1μM osimertinib; 10μM dalfinacine; 20μM dalfinacine; 1μM osimertinib+10μM dalfinacine; 1μM osimertinib+ 20 μM Darfinacine. After 6 days of incubation, the CellTiter-Glo chemiluminescence cell viability detection kit was used to detect cell viability.

Figure 16 shows that after 6 days of drug incubation, the relative cell viability of the 1μM osimertinib group was 42.8% lower than that of the control group, while the relative cell viability of the 1μM osimertinib+10μM darfinacine group Compared with the control group, the relative cell viability decreased by 60.2%, and the relative cell viability of the 1μM osimertinib+20μM darfinacine group decreased by 79.5% compared to the control group. It can be seen that darfinacine can significantly reduce the formation of drug-resistant cells induced by osimertinib in tumor cells isolated from PDX tissue.

Example 14: Effect of acetylcholine pathway modulator on the formation of drug-resistant cells of ALK gene fusion non-small cell lung cancer cell line

We tested the formation of acetylcholine M-type receptor inhibitor darfinacine, acetylcholine transporter VAChT inhibitor (Vesamicol), and choline transporter CHT1 inhibitor (hemicholine-3) on parent cells and drug-resistant cells The inhibitory effect. Darfinazin was purchased from selleck, and Vesamicol and hemicholine-3 were purchased from sigma. ALK mutation targeting drugs Ceritinib and Alectinib were both purchased from Selleck.

The experimental process is as follows: H2228 cells were seeded in a 96-well plate at 2×10 ⁴ cells/ml, and treated with drugs after 24 hours.

For parent cells, different concentrations of darfinacine (0μM, 2μM, 5μM, 10μM, 20μM), Vesamicol (0μM, 5μM, 10μM, 25μM, 50μM) and hemicholine-3 (0μM, 5μM, 10μM) , 50μM, 100μM) treated the cells, 6 days later, the CellTiter-Glo chemiluminescence cell viability detection kit was used to detect the cell viability.

For the detection of the formation process of drug-resistant cells, first add 2μM of the targeted drug (ceritinib or alectinib) to the medium, and then add different concentrations of darfinacine (0μM, 2μM, 5μM, Cells were treated with 10μM, 20μM), Vesamicol (0μM, 5μM, 10μM, 25μM, 50μM) and hemicholine-3 (0μM, 5μM, 10μM, 50μM, 100μM). CellTiter-Glo chemiluminescent cell viability detection reagent was used 6 days later Box to detect cell viability.

Figure 17 shows the effect of acetylcholine M receptor inhibitor darfinacine, acetylcholine transporter VAChT inhibitor Vesamicol, and choline transporter CHT1 inhibitor hemicholine-3 on the ALK induced by ceritinib and alectinib The effect of gene fusion on non-small cell lung cancer cell line H2228 drug-resistant cells. According to Figure 17, the drug-resistant cells induced by ceritinib or alectinib, compared to the case where darfinacine, Vesamicol and hemicholine-3 were not added (0μM), have undergone darfinacine The survival rate was significantly reduced after treatment with, Vesamicol or hemicholine-3. In contrast, the survival rate of parental cells in the absence of targeted drugs is close to 100%.

It can be seen that the acetylcholine receptor inhibitors, acetylcholine transporter inhibitors and choline transporter inhibitors of the present invention can significantly inhibit the survival of drug-resistant cells induced by ceritinib or alectinib, but have a great impact on parent cells. small.

Example 15: The influence of acetylcholine pathway modulators on the formation process of resistant cells of other tumors (including colorectal cancer, breast cancer and melanoma) cell lines (including targeted drugs and chemotherapeutics)

In order to verify the role of acetylcholine pathway modulators in other tumors, we selected colorectal cancer cell HCT116, which was induced with 36μM of the chemotherapy drug 5-fluorouracil (5-FU) to obtain drug-resistant cells after 9 days. We selected the breast cancer cell BT474, which was induced with 1 μM of the targeted drug lapatinib to obtain drug-resistant cells after 9 days. We chose the melanoma cell A375, which can obtain drug-resistant cells after 9 days of induction with 20μM of the targeted drug vemurafenib.

We tested the inhibitory effect of acetylcholine M-type receptor inhibitor darfinacine on the formation of parental cells and drug-resistant cells of colorectal cancer, breast cancer and melanoma cell lines. Acetylcholine M-type receptor inhibitor darfinacine, breast cancer targeted drug Lapatinib (Lapatinib) and melanoma targeted drug Vemurafenib (Vemurafenib) were all purchased from Selleck, and the chemotherapy drug 5FU was purchased from sigma .

1) The effect of acetylcholine pathway modulators on the formation of drug-resistant cells in colorectal cancer cell lines

The experimental process is as follows: HCT116 cells were seeded on a 96-well plate at 2×10 ⁴ cells/ml, and after 24 hours, the following dosing treatment was performed:

For the parent cells, different concentrations of darfinacine (0μM, 5μM, 10μM, 20μM) were added to treat the cells, and the CellTiter-Glo chemiluminescence cell viability detection kit was used to detect cell viability after 6 days.

For the detection of the formation process of drug-resistant cells, first add 30μM of chemotherapeutic drug 5-FU to the culture medium, then add different concentrations of darfinacine (0μM, 5μM, 10μM, 20μM) to treat the cells, and use CellTiter 6 days later -Glo chemiluminescence cell viability detection kit to detect cell viability.

Figure 18A shows the effect of acetylcholine M receptor inhibitor darfinacine on the drug-resistant cells of the colorectal cancer cell line HCT116 induced by the chemotherapy drug 5-FU. According to Figure 18A, compared to the case where darfinacine was not added (0 μM), the survival rate of drug-resistant cells induced by 5-FU under the action of 20 μM darfinacine was 48%. In contrast, the survival rate of the parental cells in the absence of 5-FU was 81%.

It can be seen that the acetylcholine pathway modulator of the present invention can significantly inhibit the survival of colorectal cancer cell line drug-resistant cells induced by chemotherapeutics, but has little effect on parent cells.

2) The effect of acetylcholine pathway modulators on the formation of drug-resistant cells in breast cancer cell lines

BT474 cells were seeded in 96-well plates at 2×10 ⁴ cells/ml, and after 24 hours, the following dosing treatments were performed:

For the detection of parental cells, we added different concentrations of darfinacine (0μM, 5μM, 10μM, 20μM) to treat the cells, and 6 days later, the CellTiter-Glo chemiluminescence cell viability detection kit was used to detect cell viability.

For the detection of the formation process of drug-resistant cells, we first add 1μM lapatinib to the medium, and then add different concentrations of darfinacine (0μM, 5μM, 10μM, 20μM) to treat the cells, and use CellTiter 6 days later. -Glo chemiluminescence cell viability detection kit to detect cell viability.

Figure 18B shows the effect of acetylcholine M receptor inhibitor darfinacine on drug-resistant cells of the breast cancer cell line BT474 induced by lapatinib. According to Fig. 18B, the survival rate of drug-resistant cells induced by lapatinib under the action of 10 μM darfinacine was 48% compared to the case where darfinacine was not added (0 μM). In contrast, the survival rate of the parental cells in the absence of lapatinib was 73%.

It can be seen that compared with parent cells, the acetylcholine pathway modulator of the present invention can significantly inhibit the survival of breast cancer cell line drug-resistant cells induced by targeted drugs.

3) The influence of acetylcholine pathway modulators on the formation of drug-resistant cells in melanoma cell lines

A375 cells were seeded on a 96-well plate at 2×10 ⁴ cells/ml, and after 24 hours, the following dosing treatment was performed:

For the detection of parent cells, different concentrations of darfinacine (0 μM, 5 μM, 10 μM, 20 μM) were added to treat the cells, and the CellTiter-Glo chemiluminescence cell viability detection kit was used to detect cell viability after 6 days.

For the detection of the formation process of drug-resistant cells, first add 20μM vemurafinil to the culture medium, and then add different concentrations of darfinacine (0μM, 5μM, 10μM, 20μM) to treat the cells, and use CellTiter-Glo 6 days later Chemiluminescence cell viability detection kit detects cell viability.

Figure 18C shows the effect of acetylcholine M receptor inhibitor darfinacine on the drug-resistant cells of the melanoma cell line A375 induced by vemurafenib. According to Fig. 18C, the survival rate of drug-resistant cells induced by vemurafenib under the action of 20 μM darfinacine was 7% compared to the case where darfinacine was not added (0 μM). In contrast, the survival rate of parental cells in the absence of vilmurafenib is close to 100%.

It can be seen that the acetylcholine pathway modulator of the present invention can significantly inhibit the survival of melanoma cell line drug-resistant cells induced by targeted drugs, but has little effect on parent cells.

Example 16: Effects of acetylcholine pathway modulators on the maintenance phase of drug-resistant cells

The non-small cell lung cancer cell line PC9 was selected, and the PC9 cells were treated with 2 μM EGFR mutation targeting drug osimertinib. The medium was changed every 3 days for a total of 9 days to obtain drug-resistant cells. PC9 parent cells were seeded on a 384-well plate at 200 cells/well. After 24 hours, the cells adhered to the wall. The drug screening platform ECHO550 of Tsinghua University was used for dosing treatment, including different concentrations of darfinacine (0μM, 2.5μM, 5μM, 10μM, 15μM, 20μM, 25μM, 30μM, 40μM, 50μM), 6 days later, use CellTiter-Glo chemiluminescence cell viability detection kit to detect cell viability; drug resistant cells after 9 days of induction are seeded at 500 cells/well 384-well plate (with 2μM osimertinib in the medium), the cells adhered to the wall after 24h, and the drug screening platform ECHO550 of Tsinghua University was used for dosing treatment, including different concentrations of darfinacine (0μM, 2.5μM, 5μM, 10μM, 15μM, 20μM), use the CellTiter-Glo chemiluminescence cell viability detection kit to detect cell viability after 6 days; the drug-resistant cells after 9 days of induction are seeded in a 384-well plate at 500 cells/well (without medium Containing osimertinib), the cells adhere to the wall after 24h, use Tsinghua University drug screening platform ECHO550 for dosing, including darfinacine of different concentrations (0μM, 1μM, 5μM, 10μM, 20μM, 50μM), use after 3 days CellTiter-Glo Chemiluminescence Cell Viability Detection Kit detects cell viability.

Figure 19A shows that darfinacine can significantly inhibit the viability of formed drug-resistant cells cultured in a medium containing osimertinib. For example, under the action of 20μM darfinacine, the survival rate of the parental cells is close to 100%. In contrast, the cells formed after 9 days of induction with 2μM osimertinib and cultured in the medium containing osimertinib The survival rate of drug-resistant cells was 26%. This result indicates that darfinacine can inhibit the maintenance of drug-resistant cells.

Figure 19B shows that darfinacine can significantly inhibit the viability of established drug-resistant cells. For example, in the medium without osimertinib, the survival rate of the parental cells was 74% under the action of 50μM dalfinacine, compared with the formation of comorbidity after 9 days of induction with 2μM osimertinib. The survival rate of drug-resistant cells cultured in a medium without osimertinib was 8%. This result indicates that darfinacine can also inhibit the maintenance of drug-resistant cells without osimertinib.

Example 17: Effect of acetylcholine pathway modulator on tumor recurrence

1) Establishment of transplanted tumor in nude mice: PC9 was resuscitated in advance, and it was in good condition without mycoplasma contamination. On the day of cell inoculation, PC9 cells were trypsinized, the digestion was terminated and centrifuged, and then resuspended in 5ml of cold 1xPBS. Each mouse needs to be injected with 5x10 ⁶ cells. A small amount of cells were counted using the Matrigel cold PBS and a 1: 1 ratio mix on ice, and the cells were resuspended to a final concentration of 5x10 ⁷ cells / ml. Inject 100 μL of tumor cell suspension into the mouse subcutaneously with a distal needle, and mung bean-sized tumors will form after about 5 to 7 days. A total of 48 nude mice were inoculated.

2) Dosing regimen for tumor recurrence in nude mice:

A 1% sodium carboxymethyl cellulose nitrate solution was used to prepare osimertinib and administered by gavage. Dimethyl sulfoxide (DMSO) was used to dissolve darfinacine, and then PEG400, darfinacine and sterile water were mixed and prepared at a ratio of (30:5:65) for intraperitoneal injection.

When the tumor grows to 200-300mm ³ , the nude mice are randomly divided into 6 groups with 8 mice in each group. The specific administration groups are as follows:

Group 1: Use the same volume of solvent as the experimental group, that is, 1% sodium carboxymethylcellulose to treat mice by gavage, and use the same volume of solvent as the experimental group (5% DMSO + 35% PEG400 + 65 %H ₂ O) mice were treated by intraperitoneal injection.

Group 2: The mice were treated with darfinacine at 5 mg/kg/day by intraperitoneal injection.

Group 3: The mice were treated with osimertinib at 5 mg/kg/day by gavage for 9 consecutive days until the tumor volume was rapidly reduced to a stable level, then the drug treatment was stopped, tumor volume was measured regularly, and tumor recurrence was observed Happening.

Group 4: The mice were treated with 5mg/kg/day osimertinib combined with intraperitoneal injection with 5mg/kg/d darfinacine by intragastric administration for 9 consecutive days until the tumor volume decreased rapidly After it was stable, the osimertinib treatment was stopped, and the mice were treated with darfinacine at 5 mg/kg/day by intraperitoneal injection until the end of the experiment. The tumor volume was measured regularly and the tumor recurrence was observed.

Group 5: The mice were treated with osimertinib at 5 mg/kg/day by gavage for 9 consecutive days until the tumor volume quickly shrank to a stable level, then the osimertinib treatment was stopped and the intraperitoneal injection was continued Method 5 mg/kg/day darfinacine was used to treat mice until the end of the experiment, and tumor volume was measured regularly to observe tumor recurrence.

Group 6: The mice were treated with 5 mg/kg/day osimertinib combined with intraperitoneal injection with 5 mg/kg/day darfinacine by intragastric administration for 9 consecutive days until the tumor volume decreased rapidly After stable, the treatment of osimertinib and darfinacine was stopped, the tumor volume was measured regularly, and the tumor recurrence was observed.

Tumor volume calculation formula: (L×W×W)/2, according to the formula to calculate the growth curve of transplanted tumor.

Figure 20 shows that the osimertinib group alone (group 3) and the osimertinib and darfinacine combination group (group 4) after 9 days of administration, the tumor volume decreased rapidly. Observation continued for about 20 days after the drug was removed. It can be seen that the tumor recurred rapidly in the osimertinib group alone after the drug was removed, but the osimertinib and darfinacine combination group continued to be administered after the osimertinib was removed. With darfinacine treatment, tumor recurrence was slower, and the volume and tumor weight were significantly lower than those in the osimertinib group.

Figure 21 shows that 9 days after osimertinib was administered alone, the tumor volume decreased rapidly. Observed for about 20 days after withdrawal of the drug, it can be seen that the tumor recurred rapidly in the third group after the drug was removed, but in the fifth group (Osimertinib was given only on days 1 to 9, and then Osi was stopped after the 9th day. The tumor recurrence was slower, and the volume and tumor weight were significantly lower than those in the osimertinib group.

Figure 22 shows that the osimertinib group alone (group 3) and the osimertinib and darfinacine combination group (group 6) after 9 days of administration, the tumor volume decreased rapidly. Continue to observe for about 20 days after the drug was removed. It can be seen that the tumor recurred rapidly in the third group after the drug was removed, but the sixth group (combined administration of osimertinib and darfinacine on days 1 to 9 followed by After the administration of osimertinib and darfinacine was stopped 9 days later, tumor recurrence was slower, and the volume and tumor weight were significantly lower than those in the osimertinib group.

The results in Figures 20 to 22 show that, compared to the acetylcholine pathway modulator or EGFR inhibitor of the present invention alone, the combined administration of these two components can significantly enhance the therapeutic effect on cancer, inhibit cancer recurrence, and bring about Synergy effect.

Example 18: The effect of acetylcholine pathway modulator combined with osimertinib on drug response and survival time in mice

First, use PC9 cells to inoculate nude mice, each mouse needs to be injected with 5x10 ⁶ cells. 100 μL of tumor cell suspension was injected into the mouse subcutaneously with a distal needle.

A 1% sodium carboxymethyl cellulose nitrate solution was used to prepare osimertinib and administered by gavage. Dimethyl sulfoxide (DMSO) was used to dissolve darfinacine, and then PEG400, darfinacine and sterile water were mixed and prepared in a ratio of (30:5:65) for intraperitoneal injection. The specific administration groups are as follows: The mice were treated with 1 mg/kg/day osimertinib by gavage for 9 consecutive days, and then the mice were randomly divided into two groups: group 1, continued use The mice were treated with osimertinib at 1 mg/kg/day by gavage until the end of the experiment. In the second group, the mice were treated with 1 mg/kg/day osimertinib combined with intraperitoneal injection with 5 mg/kg/day darfinacine by gavage until the end of the experiment. Regularly measure the tumor volume, the tumor volume calculation formula: (L×W×W)/2, according to the formula to calculate the growth curve of transplanted tumor. At the same time, the survival time of the mice was counted and the survival curve was drawn.

Figure 23A shows that the tumor volume of the combined osimertinib and darfinacine group was significantly smaller than that of the osimertinib alone group. At the same time, Figure 23B shows that the survival time of mice in the combination group of osimertinib and darfinacine was significantly higher than that of the osimertinib group alone. It can be seen that the combined treatment of osimertinib and darfinacine can significantly enhance the response of mice to drugs and effectively extend the survival time of mice.

The present invention includes the following embodiments:

1. Use of an acetylcholine pathway modulator in the preparation of a medicament for treating cancer in a subject.

2. The use according to embodiment 1, wherein the cancer is resistant to at least one anti-cancer treatment, or is at least one cancer that has recurred or progressed after anti-cancer treatment.

3. The use according to embodiment 1 or 2, wherein the level of acetylcholine in the tumor tissue after the anticancer treatment is increased compared to the tumor tissue of the subject before the anticancer treatment.

4. The use according to embodiment 2 or 3, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiation therapy, and combinations thereof.

5. The use according to embodiment 4, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors and combinations thereof.

6. The use according to embodiment 5, wherein the EGFR inhibitor is selected from necitumumab (necitumumab), nimotuzumab (nimotuzumab), Imgatuzumab (RO5083945), cetuximab, gem Fetinib, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.

7. The use according to embodiment 5, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, alectinib (Alectinib), brigatinib (Brigatinib), Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.

8. The use according to embodiment 4, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vimurafenib, 5-fluorouracil, or a combination thereof.

9. The use according to any one of embodiments 1 to 8, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

10. The use according to any one of embodiments 1 to 8, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

11. The use according to any one of embodiments 1 to 10, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, Head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, Cheek cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

12. The use according to embodiment 11, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

13. The use according to embodiment 11, wherein the cancer is non-small cell lung cancer.

14. The use according to any one of embodiments 1 to 13, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, bile Alkaline transporter inhibitors and their combinations.

15. The use according to embodiment 14, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.

16. The use according to embodiment 14, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium and combinations thereof.

17. The use according to embodiment 14, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

18. The use according to embodiment 14, wherein the choline transporter inhibitor is hemicholine-3.

19. Use of an acetylcholine pathway modulator in the preparation of a medicament for the treatment of cancer in a subject in combination with an antitumor agent.

20. The use according to embodiment 19, wherein the level of acetylcholine in the tumor tissue after the anticancer treatment is increased compared to the tumor tissue of the subject before the anticancer treatment.

21. The use according to embodiment 19 or 20, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof.

22. The use according to embodiment 21, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, and Fetinib, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.

23. The use according to embodiment 21, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, alectinib (Alectinib), brigatinib (Brigatinib), Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.

24. The use according to embodiment 19 or 20, wherein the anti-tumor agent is selected from lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

25. The use according to any one of embodiments 19 to 24, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

26. The use according to any one of embodiments 19 to 24, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

27. The use according to any one of embodiments 19 to 26, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, Head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, Cheek cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

28. The use according to embodiment 27, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

29. The use according to embodiment 27, wherein the cancer is non-small cell lung cancer.

30. The use according to any one of embodiments 19 to 29, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, bile Alkaline transporter inhibitors and their combinations.

31. The use according to embodiment 30, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.

32. The use according to embodiment 30, wherein the nicotinic receptor inhibitor is selected from MG624, mecamamine, pancuronium and combinations thereof.

33. The use according to embodiment 30, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

34. The use according to embodiment 30, wherein the choline transporter inhibitor is hemicholine-3.

35. Use of an antitumor agent in the preparation of a medicament for the treatment of cancer in a subject in combination with an acetylcholine inhibitor.

36. The use according to embodiment 35, wherein the level of acetylcholine in the tumor tissue after the anticancer treatment is increased compared to the tumor tissue of the subject before the anticancer treatment.

37. The use according to embodiment 35 or 36, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors and combinations thereof.

38. The use according to embodiment 37, wherein the EGFR inhibitor is selected from necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, and Fetinib, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.

39. The use according to embodiment 37, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, alectinib (Alectinib), brigatinib (Brigatinib), Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.

40. The use according to embodiment 35 or 36, wherein the anti-tumor agent is selected from lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

41. The use according to any one of embodiments 35 to 40, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

42. The use according to any one of embodiments 35 to 40, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

43. The use according to any one of embodiments 35 to 42, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, Head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, Cheek cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

44. The use according to embodiment 43, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

45. The use according to embodiment 43, wherein the cancer is non-small cell lung cancer.

46. The use according to any one of embodiments 35 to 45, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, bile Alkaline transporter inhibitors and their combinations.

47. The use according to embodiment 46, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.

48. The use according to embodiment 46, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium and combinations thereof.

49. The use according to embodiment 46, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

50. The use according to embodiment 46, wherein the choline transporter inhibitor is hemicholine-3.

51. A method of treating cancer in a subject, comprising administering an acetylcholine pathway modulator to the subject.

52. The method of embodiment 51, wherein the subject has previously received or is receiving at least one anti-cancer treatment.

53. The method of embodiment 51 or 52, wherein the level of acetylcholine in the tumor tissue after the anti-cancer treatment is increased compared to the tumor tissue of the subject before the anti-cancer treatment.

54. The method of embodiment 52 or 53, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiation therapy, and combinations thereof.

55. The method of embodiment 54, wherein the anti-tumor agent is selected from the group consisting of EGFR inhibitors, ALK inhibitors, and combinations thereof.

56. The method according to embodiment 55, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, and Fetinib, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, rociletinib and Their combination.

57. The method according to embodiment 55, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, brigatinib, Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.

58. The method of embodiment 54, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

59. The method according to any one of embodiments 51 to 58, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

60. The method according to any one of embodiments 51 to 58, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

61. The method according to any one of embodiments 51 to 60, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, Head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, Cheek cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

62. The method of embodiment 61, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

63. The method of embodiment 61, wherein the cancer is non-small cell lung cancer (NSCLC).

64. The method according to any one of embodiments 51 to 63, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, bile Alkaline transporter inhibitors and their combinations.

65. The method of embodiment 64, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.

66. The method of embodiment 64, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium, and combinations thereof.

67. The method of embodiment 64, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

68. The method of embodiment 64, wherein the choline transporter inhibitor is hemicholine-3.

69. Acetylcholine pathway modulator for use in the treatment of cancer in a subject.

70. An acetylcholine pathway modulator for use according to embodiment 69, wherein the cancer is resistant to at least one anti-cancer treatment, or is at least one cancer that has recurred or progressed after anti-cancer treatment.

71. The acetylcholine pathway modulator for use according to embodiment 69 or 70, wherein the tumor after the anticancer treatment is compared with the tumor tissue of the subject before the anticancer treatment The level of acetylcholine in the tissues is elevated.

72. The acetylcholine pathway modulator for use according to embodiment 70 or 71, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiation therapy, and a combination thereof.

73. The acetylcholine pathway modulator for use according to embodiment 72, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors and their The combination.

74. The acetylcholine pathway modulator for use according to embodiment 73, wherein the EGFR inhibitor is selected from necitumumab, nimotuzumab, Imgatuzumab (RO5083945) , Cetuximab, Gefitinib, Erlotinib, Panitumumab, Icotinib, Afatinib, Dacomitinib (PF-00299804), Osimertinib, Rociletinib and their combinations.

75. The acetylcholine pathway modulator for use according to embodiment 73, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, alectinib, Brigatinib, Lorlatinib, Lopatinib (TPX-0005), and combinations thereof.

76. The acetylcholine pathway modulator for use according to embodiment 72, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

77. An acetylcholine pathway modulator for use according to any one of embodiments 69 to 76, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

78. An acetylcholine pathway modulator for use according to any one of embodiments 69 to 76, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

79. An acetylcholine pathway modulator for use according to any one of embodiments 69 to 78, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, Lung cancer, breast cancer, oral cancer, head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer Cancer, ovarian cancer, testicular cancer, buccal cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

80. An acetylcholine pathway modulator for use according to embodiment 79, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

81. An acetylcholine pathway modulator for use according to embodiment 79, wherein the cancer is non-small cell lung cancer.

82. The acetylcholine pathway modulator for use according to any one of embodiments 69 to 81, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors , Acetylcholine transporter inhibitors, choline transporter inhibitors and their combinations.

83. The acetylcholine pathway modulator for use according to embodiment 82, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, Methyl scopolamine and their combinations.

84. An acetylcholine pathway modulator for use in the use according to embodiment 82, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium and a combination thereof.

85. The acetylcholine pathway modulator for use according to embodiment 82, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

86. The acetylcholine pathway modulator for use in the use according to embodiment 82, wherein the choline transporter inhibitor is hemicholine-3.

87. Acetylcholine pathway modulator for use in the treatment of cancer in a subject in combination with an antitumor agent.

88. The acetylcholine pathway modulator for use according to embodiment 87, wherein in the tumor tissue after the anti-cancer treatment compared to the subject's tumor tissue before the anti-cancer treatment Elevated levels of acetylcholine.

89. The acetylcholine pathway modulator for use according to embodiment 87 or 88, wherein the antitumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors And their combination.

90. The acetylcholine pathway modulator for use according to embodiment 89, wherein the EGFR inhibitor is selected from necitumumab, nimotuzumab, Imgatuzumab (RO5083945) , Cetuximab, Gefitinib, Erlotinib, Panitumumab, Icotinib, Afatinib, Dacomitinib (PF-00299804), Osimertinib, Rociletinib and their combinations.

91. The acetylcholine pathway modulator for use according to embodiment 89, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, Brigatinib, Lorlatinib, Lopatinib (TPX-0005), and combinations thereof.

92. The acetylcholine pathway modulator for use according to embodiment 87 or 88, wherein the antitumor agent is selected from lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

93. An acetylcholine pathway modulator for use according to any one of embodiments 87 to 92, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

94. An acetylcholine pathway modulator for use according to any one of embodiments 87 to 92, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

95. An acetylcholine pathway modulator for use according to any one of embodiments 87 to 94, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, Lung cancer, breast cancer, oral cancer, head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer Cancer, ovarian cancer, testicular cancer, buccal cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

96. An acetylcholine pathway modulator for use according to embodiment 95, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

97. An acetylcholine pathway modulator for use according to embodiment 95, wherein the cancer is non-small cell lung cancer.

98. The acetylcholine pathway modulator for use according to any one of embodiments 87 to 97, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors , Acetylcholine transporter inhibitors, choline transporter inhibitors and their combinations.

99. The acetylcholine pathway modulator for use according to embodiment 98, wherein the muscarinic receptor inhibitor is selected from darfinacine, benztropine mesylate, isoladine, Methyl scopolamine and their combinations.

100. The acetylcholine pathway modulator for use according to embodiment 98, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium and a combination thereof.

101. The acetylcholine pathway modulator for use according to embodiment 98, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

102. The acetylcholine pathway modulator for use according to embodiment 98, wherein the choline transporter inhibitor is hemicholine-3.

103. An antitumor agent for the treatment of cancer in a subject in combination with an acetylcholine pathway modulator.

104. The anti-tumor agent for use according to embodiment 103, wherein acetylcholine is in the tumor tissue after the anti-cancer treatment compared to the tumor tissue of the subject before the anti-cancer treatment The level rises.

105. The anti-tumor agent for use according to embodiment 103 or 104, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors and Their combination.

106. An antitumor agent for use according to embodiment 105, wherein the EGFR inhibitor is selected from necitumumab, nimotuzumab, Imgatuzumab (RO5083945), Cetuximab, Gefitinib, Erlotinib, Panitumumab, Icotinib, Afatinib, Dacomitinib (PF-00299804), Osimertinib, Rociletinib And their combination.

107. The antitumor agent for use according to embodiment 105, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, and Brigatinib (Brigatinib), Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.

108. The anti-tumor agent for use according to embodiment 103 or 104, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

109. An antitumor agent for use according to any one of embodiments 103 to 108, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

110. An anti-tumor agent for use according to any one of embodiments 103 to 108, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

111. An antitumor agent for use according to any one of embodiments 103 to 110, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer , Breast cancer, oral cancer, head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, cholangiocarcinoma, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer , Ovarian cancer, testicular cancer, buccal cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

112. The antitumor agent for use according to embodiment 111, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

113. An antitumor agent for use in the use according to embodiment 112, wherein the cancer is non-small cell lung cancer.

114. The antitumor agent for use according to any one of embodiments 103 to 113, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, Acetylcholine transporter inhibitors, choline transporter inhibitors, and combinations thereof.

115. The antitumor agent for use according to embodiment 114, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, Scopolamine and their combinations.

116. The antitumor agent for use according to embodiment 114, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium, and combinations thereof.

117. An antitumor agent for use according to embodiment 114, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

118. An anti-tumor agent for use in the use according to embodiment 114, wherein the choline transporter inhibitor is hemicholine-3.

119. A combination comprising: a) an acetylcholine pathway modulator; and b) an antitumor agent.

120. The combination according to embodiment 119, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transporter inhibitors, and Their combination.

121. The combination according to embodiment 120, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.

122. The combination according to embodiment 120, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium, and combinations thereof.

123. The combination according to embodiment 120, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

124. The combination according to embodiment 120, wherein the choline transporter inhibitor is hemicholine-3.

125. The combination according to any one of embodiments 119 to 124, wherein the anti-tumor agent is selected from EGFR inhibitors and ALK inhibitors.

126. The combination according to embodiment 125, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gem Fetinib, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.

127. The combination according to embodiment 125, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, alectinib, brigatinib, Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.

128. The combination according to any one of embodiments 119 to 124, wherein the anti-tumor agent is selected from lapatinib, vermuracil, 5-fluorouracil or a combination thereof.

129. The combination according to any one of embodiments 119 to 128, wherein the acetylcholine pathway modulator is administered simultaneously with the antitumor agent.

130. The combination according to any one of embodiments 119 to 128, wherein the acetylcholine pathway modulator is administered after the antitumor agent.

131. A pharmaceutical composition comprising: a) an acetylcholine pathway modulator; b) an antitumor agent; and c) at least one pharmaceutically acceptable carrier.

132. The pharmaceutical composition according to embodiment 131, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transporter inhibitors Agents and their combinations.

133. The pharmaceutical composition according to embodiment 131, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine and their combination.

134. The pharmaceutical composition according to embodiment 131, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium, and combinations thereof.

135. The pharmaceutical composition of embodiment 131, wherein the acetylcholine transporter inhibitor is Vesamicol.

136. The pharmaceutical composition according to embodiment 131, wherein the choline transporter inhibitor is hemicholine-3.

137. The pharmaceutical composition according to any one of embodiments 131 to 136, wherein the anti-tumor agent is selected from EGFR inhibitors and ALK inhibitors.

138. The pharmaceutical composition according to embodiment 137, wherein the EGFR inhibitor is selected from the group consisting of cetuzumab, gefitinib, erlotinib, icotinib, afatinib, dacomitin Ni, osimertinib, Rociletinib and their combinations.

139. The pharmaceutical composition according to embodiment 137, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, aletinib, brigatinib, loratinib , Lopatinib and their combinations.

140. The pharmaceutical composition according to any one of embodiments 131 to 136, wherein the anti-tumor agent is selected from lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

141. A kit, which contains:

a) a first composition comprising an acetylcholine pathway modulator; and

b) A second composition comprising an anti-tumor agent.

142. The kit according to embodiment 141, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transporter inhibitors And their combination.

143. The kit according to embodiment 142, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof .

144. The kit of embodiment 142, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium, and combinations thereof.

145. The kit according to embodiment 142, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

146. The kit of embodiment 142, wherein the choline transporter inhibitor is hemicholine-3.

147. The kit according to any one of embodiments 141 to 146, wherein the anti-tumor agent is selected from EGFR inhibitors and ALK inhibitors.

148. The kit according to embodiment 147, wherein the EGFR inhibitor is selected from the group consisting of resistance to siltuzumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gefitinib, and Lotinib, panitumumab, icotinib, afatinib, dacomitinib, osimertinib, Rociletinib, and combinations thereof.

149. The kit according to embodiment 147, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, aletinib, brigatinib, loratinib, Lopatinib and their combinations.

150. The kit of any one of embodiments 141 to 149, wherein the anti-tumor agent is selected from lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

151. The kit of any one of embodiments 141 to 150, further comprising instructions that include instructions for using the kit to treat cancer in a subject in need thereof.

152. The combination according to any one of embodiments 119 to 130, the pharmaceutical composition according to any one of embodiments 131 to 140, or the kit according to any one of embodiments 141 to 151 Use in preparing medicines for treating cancer.

153. The use according to embodiment 152, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

154. The use according to embodiment 152, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

155. The use according to any one of embodiments 152 to 154, wherein the cancer is refractory and/or recurrent cancer.

156. The use according to any one of embodiments 152 to 155, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, Head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, Cheek cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

157. The use according to embodiment 156, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

158. The use according to embodiment 156, wherein the cancer is non-small cell lung cancer.

159. A method for diagnosing a cancer resistant to at least one anti-cancer treatment, comprising the following steps:

a) Measure the acetylcholine level of a sample from the subject;

b) The increase in the above-mentioned acetylcholine level compared to the subject before the anti-cancer treatment indicates that the subject has a cancer that is resistant to at least one anti-cancer treatment.

160. The method according to embodiment 159, wherein the sample from the subject is tumor tissue.

161. The method according to embodiment 159 or 160, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiation therapy, and combinations thereof.

162. The method according to embodiment 161, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof.

163. The method according to embodiment 162, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gem Fetinib, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.

164. The method according to embodiment 162, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, brigatinib, Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.

165. The method of embodiment 161, wherein the anti-tumor agent is selected from lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

166. The method according to any one of embodiments 159 to 165, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

167. The method according to any one of embodiments 159 to 165, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

168. The method according to any one of embodiments 159 to 167, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, Head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, Cheek cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

169. The method according to embodiment 168, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

170. The method of embodiment 168, wherein the cancer is non-small cell lung cancer.

171. A method for treating cancer in a subject, comprising the following steps:

a) Measure the acetylcholine level of a sample from the subject;

b) The acetylcholine level is compared with the acetylcholine level of the subject before the anti-cancer treatment, and if the acetylcholine level increases, the subject is administered an acetylcholine pathway modulator.

172. The method according to embodiment 171, wherein the sample from the subject is tumor tissue.

173. The method according to embodiment 171 or 172, wherein the subject is resistant to at least one anti-cancer treatment, or has previously received or is receiving at least one anti-cancer treatment.

174. The method according to any one of embodiments 171-173, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiation therapy, and combinations thereof.

175. The method of embodiment 174, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof.

176. The method according to embodiment 175, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, Gem Fetinib, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.

177. The method according to embodiment 175, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, alectinib, brigatinib, Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.

178. The method according to embodiment 174, wherein the anti-tumor agent is selected from lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.

179. The method according to any one of embodiments 171 to 178, wherein the cancer is characterized by the presence of EGFR mutations and/or overexpression.

180. The method of any one of embodiments 171 to 178, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.

181. The method according to any one of embodiments 171 to 180, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, Head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, Cheek cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.

182. The method of embodiment 181, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.

183. The method of embodiment 181, wherein the cancer is non-small cell lung cancer.

184. The method according to any one of embodiments 171 to 183, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, bile Alkaline transporter inhibitors and their combinations.

185. The method according to embodiment 184, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.

186. The method according to embodiment 184, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium and combinations thereof.

187. The method of embodiment 184, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).

188. The method according to embodiment 184, wherein the choline transporter inhibitor is hemicholine-3.

Claims (188)

1. Use of an acetylcholine pathway modulator in the preparation of a medicament for treating cancer in a subject.
2. The use according to claim 1, wherein the cancer is resistant to at least one anti-cancer treatment, or is at least one cancer that has recurred or progressed after anti-cancer treatment.
3. The use according to claim 1 or 2, wherein the acetylcholine level in the tumor tissue after the anti-cancer treatment is increased compared to the acetylcholine level in the tumor tissue of the subject before the anti-cancer treatment.
4. The use according to claim 2 or 3, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiotherapy and a combination thereof.
5. The use according to claim 4, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof.
6. The use according to claim 5, wherein the EGFR inhibitor is selected from necitumumab (necitumumab), nimotuzumab (nimotuzumab), Imgatuzumab (RO5083945), cetuximab, gefitin Ni, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.
7. The use according to claim 5, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib (Alectinib), brigatinib (Brigatinib), lora Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.
8. The use according to claim 4, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vemurfinib, 5-fluorouracil, or a combination thereof.
9. The use according to any one of claims 1 to 8, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
10. The use according to any one of claims 1 to 8, wherein the cancer is characterized by the presence of ALK mutation and/or overexpression.
11. The use according to any one of claims 1 to 10, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head and neck cancer , Nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, cheek cancer , Oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
12. The use according to claim 11, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
13. The use according to claim 11, wherein the cancer is non-small cell lung cancer.
14. The use according to any one of claims 1 to 13, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transport Body inhibitors and their combinations.
15. The use according to claim 14, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.
16. The use according to claim 14, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium and a combination thereof.
17. The use according to claim 14, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl) cyclohexanol (Vesamicol).
18. The use according to claim 14, wherein the choline transporter inhibitor is hemicholine-3.
19. Use of an acetylcholine pathway modulator in the preparation of a medicament for treating cancer in a subject in combination with an antitumor agent.
20. The use according to claim 19, wherein the level of acetylcholine in the tumor tissue after the anti-cancer treatment is increased compared to the level of acetylcholine in the tumor tissue of the subject before the anti-cancer treatment.
21. The use according to claim 19 or 20, wherein the anti-tumor agent is selected from the group consisting of epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof.
22. The use according to claim 21, wherein the EGFR inhibitor is selected from necitumumab (necitumumab), nimotuzumab (nimotuzumab), Imgatuzumab (RO5083945), cetuximab, gefitin Ni, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.
23. The use according to claim 21, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, brigatinib, lora Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.
24. The use according to claim 19 or 20, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil or a combination thereof.
25. The use according to any one of claims 19 to 24, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
26. The use according to any one of claims 19 to 24, wherein the cancer is characterized by the presence of ALK mutation and/or overexpression.
27. The use according to any one of claims 19 to 26, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head and neck cancer , Nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, cheek cancer , Oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
28. The use according to claim 27, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
29. The use according to claim 27, wherein the cancer is non-small cell lung cancer.
30. The use according to any one of claims 19 to 29, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transport Body inhibitors and their combinations.
31. The use according to claim 30, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.
32. The use according to claim 30, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium and a combination thereof.
33. The use according to claim 30, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl) cyclohexanol (Vesamicol).
34. The use according to claim 30, wherein the choline transporter inhibitor is hemicholine-3.
35. Use of an antitumor agent in the preparation of a medicament for treating cancer in a subject in combination with an acetylcholine inhibitor.
36. The use according to claim 35, wherein the level of acetylcholine in the tumor tissue after the anti-cancer treatment is increased compared to the level of acetylcholine in the tumor tissue of the subject before the anti-cancer treatment.
37. The use according to claim 35 or 36, wherein the anti-tumor agent is selected from the group consisting of epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof.
38. The use according to claim 37, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gefitin Ni, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.
39. The use according to claim 37, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib (Alectinib), brigatinib (Brigatinib), lora Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.
40. The use according to claim 35 or 36, wherein the antitumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil or a combination thereof.
41. The use according to any one of claims 35 to 40, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
42. The use according to any one of claims 35 to 40, wherein the cancer is characterized by the presence of ALK mutation and/or overexpression.
43. The use according to any one of claims 35 to 42, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head and neck cancer , Nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, cheek cancer , Oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
44. The use according to claim 43, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
45. The use according to claim 43, wherein the cancer is non-small cell lung cancer.
46. The use according to any one of claims 35 to 45, wherein the acetylcholine pathway modulator is selected from muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transport Body inhibitors and their combinations.
47. The use according to claim 46, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.
48. The use according to claim 46, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium and a combination thereof.
49. The use according to claim 46, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl) cyclohexanol (Vesamicol).
50. The use according to claim 46, wherein the choline transporter inhibitor is hemicholine-3.
51. A method of treating cancer in a subject includes administering an acetylcholine pathway modulator to the subject.
52. The method of claim 51, wherein the subject has previously received or is currently receiving at least one anti-cancer treatment.
53. The method of claim 51 or 52, wherein the level of acetylcholine in the tumor tissue after the anti-cancer treatment is increased compared to the level of acetylcholine in the tumor tissue of the subject before the anti-cancer treatment.
54. The method of claim 52 or 53, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiation therapy, and combinations thereof.
55. The method of claim 54, wherein the anti-tumor agent is selected from the group consisting of EGFR inhibitors, ALK inhibitors, and combinations thereof.
56. The method of claim 55, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gefitin Ni, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, rociletinib and their combination.
57. The method according to claim 55, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, brigatinib, lora Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.
58. The method of claim 54, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.
59. The method according to any one of claims 51 to 58, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
60. The method according to any one of claims 51 to 58, wherein the cancer is characterized by the presence of ALK mutation and/or overexpression.
61. The method according to any one of claims 51 to 60, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head and neck cancer , Nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, cheek cancer , Oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
62. The method according to claim 61, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
63. The method of claim 61, wherein the cancer is non-small cell lung cancer (NSCLC).
64. The method according to any one of claims 51 to 63, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transport Body inhibitors and their combinations.
65. The method of claim 64, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.
66. The method of claim 64, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium, and combinations thereof.
67. The method of claim 64, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).
68. The method of claim 64, wherein the choline transporter inhibitor is hemicholine-3.
69. Acetylcholine pathway modulator, which is used to treat cancer in a subject.
70. The acetylcholine pathway modulator for use according to claim 69, wherein the cancer is resistant to at least one anti-cancer treatment, or is at least one cancer that has recurred or progressed after anti-cancer treatment.
71. The acetylcholine pathway modulator for use according to claim 69 or 70, wherein the acetylcholine level after the anticancer treatment is compared with the acetylcholine level in the tumor tissue of the subject before the anticancer treatment The level of acetylcholine in tumor tissue is elevated.
72. The acetylcholine pathway modulator for use according to claim 70 or 71, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiotherapy and a combination thereof.
73. The acetylcholine pathway modulator for use according to claim 72, wherein the anti-tumor agent is selected from the group consisting of epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof .
74. The acetylcholine pathway modulator for use according to claim 73, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), Western Tuximab, Gefitinib, Erlotinib, Panitumumab, Icotinib, Afatinib, Dacomitinib (PF-00299804), Osimertinib, Rociletinib and Their combination.
75. The acetylcholine pathway modulator for use according to claim 73, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, burgher Brigatinib, Lorlatinib, Lopatinib (TPX-0005) and combinations thereof.
76. The acetylcholine pathway modulator for use according to claim 72, wherein the antitumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.
77. An acetylcholine pathway modulator for use according to any one of claims 69 to 76, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
78. An acetylcholine pathway modulator for use according to any one of claims 69 to 76, wherein the cancer is characterized by the presence of ALK mutation and/or overexpression.
79. The acetylcholine pathway modulator for use according to any one of claims 69 to 78, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, Breast cancer, oral cancer, head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, Ovarian cancer, testicular cancer, buccal cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
80. The acetylcholine pathway modulator for use according to claim 79, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
81. The acetylcholine pathway modulator for use according to claim 79, wherein the cancer is non-small cell lung cancer.
82. The acetylcholine pathway modulator for use according to any one of claims 69 to 81, wherein the acetylcholine pathway modulator is selected from muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine Transporter inhibitors, choline transporter inhibitors and their combinations.
83. The acetylcholine pathway modulator for use according to claim 82, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methyl Scopolamine and their combinations.
84. The acetylcholine pathway modulator for use according to claim 82, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium and a combination thereof.
85. The acetylcholine pathway modulator for use according to claim 82, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).
86. The acetylcholine pathway modulator for use according to claim 82, wherein the choline transporter inhibitor is hemicholine-3.
87. Acetylcholine pathway modulator, which is used in combination with an antitumor agent to treat cancer in a subject.
88. The acetylcholine pathway modulator for use according to claim 87, wherein the tumor tissue after the anticancer treatment is compared with the acetylcholine level in the tumor tissue of the subject before the anticancer treatment The level of acetylcholine is elevated.
89. The acetylcholine pathway modulator for use according to claim 87 or 88, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors and their The combination.
90. The acetylcholine pathway modulator for use according to claim 89, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), Western Tuximab, Gefitinib, Erlotinib, Panitumumab, Icotinib, Afatinib, Dacomitinib (PF-00299804), Osimertinib, Rociletinib and Their combination.
91. The acetylcholine pathway modulator for use according to claim 89, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, burgher Brigatinib, Lorlatinib, Lopatinib (TPX-0005) and combinations thereof.
92. The acetylcholine pathway modulator for use according to claim 87 or 88, wherein the antitumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.
93. An acetylcholine pathway modulator for use according to any one of claims 87 to 92, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
94. An acetylcholine pathway modulator for use according to any one of claims 87 to 92, wherein the cancer is characterized by the presence of ALK mutation and/or overexpression.
95. The acetylcholine pathway modulator for use according to any one of claims 87 to 94, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, Breast cancer, oral cancer, head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, Ovarian cancer, testicular cancer, buccal cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
96. The acetylcholine pathway modulator for use according to claim 95, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
97. The acetylcholine pathway modulator for use according to claim 95, wherein the cancer is non-small cell lung cancer.
98. The acetylcholine pathway modulator for use according to any one of claims 87 to 97, wherein the acetylcholine pathway modulator is selected from muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine Transporter inhibitors, choline transporter inhibitors and their combinations.
99. The acetylcholine pathway modulator for use according to claim 98, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methyl Scopolamine and their combinations.
100. The acetylcholine pathway modulator for use according to claim 98, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium and a combination thereof.
101. The acetylcholine pathway modulator for use according to claim 98, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).
102. The acetylcholine pathway modulator for use according to claim 98, wherein the choline transporter inhibitor is hemicholine-3.
103. An anti-tumor agent for treating cancer in a subject in combination with an acetylcholine pathway modulator.
104. The anti-tumor agent for use according to claim 103, wherein compared with the acetylcholine level of the subject's tumor tissue before the anti-cancer treatment, in the tumor tissue after the anti-cancer treatment Elevated levels of acetylcholine.
105. The anti-tumor agent for use according to claim 103 or 104, wherein the anti-tumor agent is selected from epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors and their combination.
106. The anti-tumor agent for use according to claim 105, wherein the EGFR inhibitor is selected from necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cital Coximab, Gefitinib, Erlotinib, Panitumumab, Icotinib, Afatinib, Dacomitinib (PF-00299804), Osimertinib, Rociletinib and the like The combination.
107. The antitumor agent for use according to claim 105, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, brigatinib Ni (Brigatinib), Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.
108. The anti-tumor agent for use according to claim 103 or 104, wherein the anti-tumor agent is selected from lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.
109. The antitumor agent for use according to any one of claims 103 to 108, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
110. An anti-tumor agent for use according to any one of claims 103 to 108, wherein the cancer is characterized by the presence of ALK mutation and/or overexpression.
111. The antitumor agent for use according to any one of claims 103 to 110, wherein the cancer is selected from sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast Cancer, oral cancer, head and neck cancer, nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, cholangiocarcinoma, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer Cancer, testicular cancer, buccal cancer, oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
112. The antitumor agent for use according to claim 111, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
113. The anti-tumor agent for use according to claim 112, wherein the cancer is non-small cell lung cancer.
114. The antitumor agent for use according to any one of claims 103 to 113, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transport Body inhibitors, choline transporter inhibitors and their combinations.
115. The anti-tumor agent for use according to claim 114, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine And their combination.
116. The antitumor agent for use according to claim 114, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium bromide, and a combination thereof.
117. The antitumor agent for use according to claim 114, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).
118. The anti-tumor agent for use according to claim 114, wherein the choline transporter inhibitor is hemicholine-3.
119. A combination comprising: a) an acetylcholine pathway modulator; and b) an antitumor agent.
120. The combination according to claim 119, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transporter inhibitors and their combination.
121. The combination of claim 120, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.
122. The combination according to claim 120, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium, and combinations thereof.
123. The combination of claim 120, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl)cyclohexanol (Vesamicol).
124. The combination of claim 120, wherein the choline transporter inhibitor is hemicholine-3.
125. The combination according to any one of claims 119 to 124, wherein the anti-tumor agent is selected from EGFR inhibitors and ALK inhibitors.
126. The combination of claim 125, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gefitin Ni, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.
127. The combination of claim 125, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, alectinib, brigatinib, lora Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.
128. The combination according to any one of claims 119 to 124, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.
129. The combination according to any one of claims 119 to 128, wherein the acetylcholine pathway modulator is administered simultaneously with the antitumor agent.
130. The combination according to any one of claims 119 to 128, wherein the acetylcholine pathway modulator is administered after the antitumor agent.
131. A pharmaceutical composition comprising: a) an acetylcholine pathway modulator; b) an antitumor agent; and c) at least one pharmaceutically acceptable carrier.
132. The pharmaceutical composition according to claim 131, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transporter inhibitors, and Their combination.
133. The pharmaceutical composition according to claim 131, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.
134. The pharmaceutical composition according to claim 131, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamylamine, pancuronium and a combination thereof.
135. The pharmaceutical composition according to claim 131, wherein the acetylcholine transporter inhibitor is Vesamicol.
136. The pharmaceutical composition according to claim 131, wherein the choline transporter inhibitor is hemicholine-3.
137. The pharmaceutical composition according to any one of claims 131 to 136, wherein the anti-tumor agent is selected from EGFR inhibitors and ALK inhibitors.
138. The pharmaceutical composition according to claim 137, wherein the EGFR inhibitor is selected from the group consisting of cetuximab, gefitinib, erlotinib, icotinib, afatinib, dacomitinib, Osimertinib, Rociletinib and their combinations.
139. The pharmaceutical composition according to claim 137, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, brigatinib, loratinib, and Putinib and their combinations.
140. The pharmaceutical composition according to any one of claims 131 to 136, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.
141. A kit, which contains:

     a) a first composition comprising an acetylcholine pathway modulator; and

     b) A second composition comprising an anti-tumor agent.
142. The kit according to claim 141, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transporter inhibitors, and their The combination.
143. The kit of claim 142, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.
144. The kit according to claim 142, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium and a combination thereof.
145. The kit according to claim 142, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl) cyclohexanol (Vesamicol).
146. The kit according to claim 142, wherein the choline transporter inhibitor is hemicholine-3.
147. The kit according to any one of claims 141 to 146, wherein the anti-tumor agent is selected from EGFR inhibitors and ALK inhibitors.
148. The kit according to claim 147, wherein the EGFR inhibitor is selected from the group consisting of resistance to siltuzumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gefitinib, erlotin Ni, panitumumab, icotinib, afatinib, dacomitinib, osimertinib, Rociletinib, and combinations thereof.
149. The kit according to claim 147, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, aletinib, brigatinib, loratinib, lop Tinib and their combinations.
150. The kit according to any one of claims 141 to 149, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.
151. The kit according to any one of claims 141 to 150, further comprising instructions, the instructions including instructions for using the kit to treat cancer in a subject in need thereof.
152. The combination according to any one of claims 119 to 130, the pharmaceutical composition according to any one of claims 131 to 140 or the kit according to any one of claims 141 to 151 is used in preparation Used in drugs for the treatment of cancer.
153. The use according to claim 152, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
154. The use according to claim 152, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.
155. The use according to any one of claims 152 to 154, wherein the cancer is refractory and/or recurrent cancer.
156. The use according to any one of claims 152 to 155, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head and neck cancer , Nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, cheek cancer , Oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
157. The use according to claim 156, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
158. The use according to claim 156, wherein the cancer is non-small cell lung cancer.
159. A method for diagnosing a cancer resistant to at least one anti-cancer treatment, which comprises the following steps:

     a) Measure the acetylcholine level of a sample from the subject;

     b) The increase in the above-mentioned acetylcholine level compared to the subject before the anti-cancer treatment indicates that the subject has a cancer that is resistant to at least one anti-cancer treatment.
160. The method according to claim 159, wherein the sample from the subject is tumor tissue.
161. The method of claim 159 or 160, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiation therapy, and combinations thereof.
162. The method of claim 161, wherein the anti-tumor agent is selected from the group consisting of epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof.
163. The method of claim 162, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gefitin Ni, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.
164. The method of claim 162, wherein the ALK inhibitor is selected from crizotinib, alectinib, ceritinib, alectinib, brigatinib, lora Lorlatinib (Lorlatinib), Lopatinib (TPX-0005) and their combinations.
165. The method of claim 161, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vermuracil, 5-fluorouracil, or a combination thereof.
166. The method according to any one of claims 159 to 165, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
167. The method of any one of claims 159 to 165, wherein the cancer is characterized by the presence of ALK mutations and/or overexpression.
168. The method according to any one of claims 159 to 167, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head and neck cancer , Nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, cheek cancer , Oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
169. The method according to claim 168, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
170. The method of claim 168, wherein the cancer is non-small cell lung cancer.
171. A method for treating cancer in a subject, which includes the following steps:

     a) Measure the acetylcholine level of a sample from the subject;

     b) The acetylcholine level is compared with the acetylcholine level of the subject before the anti-cancer treatment, and if the acetylcholine level increases, the subject is administered an acetylcholine pathway modulator.
172. The method according to claim 171, wherein the sample from the subject is tumor tissue.
173. The method according to claim 171 or 172, wherein the subject is resistant to at least one anti-cancer treatment, or has previously received or is currently receiving at least one anti-cancer treatment.
174. The method of any one of claims 171-173, wherein the anti-cancer treatment is selected from the group consisting of anti-tumor agent treatment, surgery, radiation therapy, and a combination thereof.
175. The method of claim 174, wherein the anti-tumor agent is selected from the group consisting of epidermal growth factor receptor (EGFR) inhibitors, progressive lymphoma kinase (ALK) inhibitors, and combinations thereof.
176. The method of claim 175, wherein the EGFR inhibitor is selected from the group consisting of necitumumab, nimotuzumab, Imgatuzumab (RO5083945), cetuximab, gefitin Ni, erlotinib, panitumumab, icotinib, afatinib, dacomitinib (PF-00299804), osimertinib, Rociletinib, and combinations thereof.
177. The method of claim 175, wherein the ALK inhibitor is selected from the group consisting of crizotinib, alectinib, ceritinib, alectinib, brigatinib, lora Lorlatinib, TPX-0005 and their combinations.
178. The method according to claim 174, wherein the anti-tumor agent is selected from the group consisting of lapatinib, vimuracil, 5-fluorouracil, or a combination thereof.
179. The method according to any one of claims 171 to 178, wherein the cancer is characterized by the presence of EGFR mutation and/or overexpression.
180. The method according to any one of claims 171 to 178, wherein the cancer is characterized by the presence of ALK mutation and/or overexpression.
181. The method according to any one of claims 171 to 180, wherein the cancer is selected from the group consisting of sarcoma, skin cancer, leukemia, lymphoma, brain cancer, glioblastoma, lung cancer, breast cancer, oral cancer, head and neck cancer , Nasopharyngeal cancer, esophageal cancer, stomach cancer, liver cancer, bile duct cancer, gallbladder cancer, bladder cancer, pancreatic cancer, bowel cancer, colorectal cancer, kidney cancer, cervical cancer, endometrial cancer, ovarian cancer, testicular cancer, cheek cancer , Oropharyngeal cancer, laryngeal cancer, prostate cancer, melanoma, renal cell carcinoma (RCC), colon cancer, hepatocellular carcinoma (HCC), blood cancer and/or adenocarcinoma.
182. The method of claim 181, wherein the cancer is selected from lung cancer, breast cancer, melanoma, colorectal cancer.
183. The method of claim 181, wherein the cancer is non-small cell lung cancer.
184. The method according to any one of claims 171 to 183, wherein the acetylcholine pathway modulator is selected from the group consisting of muscarinic receptor inhibitors, nicotinic receptor inhibitors, acetylcholine transporter inhibitors, choline transport Body inhibitors and their combinations.
185. The method of claim 184, wherein the muscarinic receptor inhibitor is selected from the group consisting of darfinacine, benztropine mesylate, isoladine, methylscopolamine, and combinations thereof.
186. The method of claim 184, wherein the nicotinic receptor inhibitor is selected from the group consisting of MG624, mecamamine, pancuronium, and combinations thereof.
187. The method of claim 184, wherein the acetylcholine transporter inhibitor is 2-(4-phenylpiperidinyl) cyclohexanol (Vesamicol).
188. The method of claim 184, wherein the choline transporter inhibitor is hemicholine-3.

Images