WO2021007436A1 - Tricyclic peptide as protein binders and modulators and uses thereof - Google Patents

Abstract

The present disclosure relates to the development of screening tricyclic peptide library for the identification of tricyclic peptides as binders and modulators to therapeutic protein targets. As examples, tricyclic peptides that specifically bind and modulate the functional activities of PD-1, TNFα and BCL-2, and to the use of such tricyclic peptides for the therapeutic treatment of related diseases and disorders are disclosed.

Description

TRICYCLIC PEPTIDE AS PROTEIN BINDERS AND MODULATORS AND USES

THEREOF

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of priority to U.S. Provisional Application No.

62/871,991, filed on July 9, 2019, which is herein incorporated by reference in its entirety.

DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

The contents of the text file submitted electronically herewith are incorporated by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: TABI-005_01WO_SeqList_ST25.txt; date recorded July 9, 2020; file size 38 kilobytes).

BACKGROUND OF THE DISCLOSURE

Small molecule cyclic peptides have a number of favorable properties that make them attractive to be developed as drug molecules. They can bind to macromolecular targets with high affinities and specificities and can efficiently target protein-protein interactions. They can diffuse efficiently in tissues and/or cross biological barriers that cannot be easily passed by much larger proteins, such as antibodies. The small peptides allow for the full chemical synthesis with low cost, and with their amino acid makeup, peptide molecules inherently may have low toxicity and reduced immunogenicity.

This disclosure describes tricyclic peptide comprising three peptide loops cyclized on a molecular scaffold. The disclosure also describes the construction of a tricyclic peptide phage library and a method to screen this library for the identification of tricyclic peptide as the binder and modulator of therapeutic protein targets. As examples, this disclosure describes the screening for tricyclic peptide binders for Programmed Cell Death Protein 1(PD-1), Tumor Necrosis Factor alpha (TNFa) and B-cell lymphoma 2 (BCL-2). The identified tricyclic binders may modulate the functional activities of these targets and may be used therapeutically to treat related diseases and disorders.

SUMMARY OF THE DISCLOSURE

The tricyclic peptides of the disclosure comprise of three loops of peptide cyclized on a molecular scaffold, in which four reactive groups on the tricyclic peptide that separate the three loop sequences form covalent bonds with the molecular scaffold. Together with the molecular scaffold and the covalent bonds formed between the reactive groups of certain amino acids and the molecular scaffold, the tricyclic peptide of the disclosure comprises a three-fused-ring structure, as exemplified in FIG. 1, with optional additional N- and/or C-terminal amino acid residue(s).

The loops or individual rings of the tricyclic peptide can comprise three amino acids, four amino acids, five amino acids, six amino acids, seven amino acids, eight amino acids, nine amino acids, or ten amino acids. The tricyclic peptide can comprise one or more non-natural amino acid substituents. In certain embodiments, the non-natural amino acid substituents comprise reactive groups not found in the 20 standard amino acids (such as an azide group), for reacting with the molecular scaffold.

The cyclization of tricyclic peptide of the disclosure includes, but not by way of limitation, covalent bonds formed by, for example, benzyl bromide moiety of a tetravalent molecular scaffold reacting with the thiol group of reactive cysteine of the tricyclic peptide, and/or alkyne moiety of the tetravalent molecular scaffold reacting with the azide group of reactive Fmoc azido amino acids of the peptide (see FIG. 2).

The disclosure also provides for a method of peptide cyclization, also known as Chemical Linkage of Peptides onto Scaffolds (CLIPS technology) to catalyze benzyl bromide moiety of the tetravalent molecular scaffold reacting with the thiol group of reactive cysteine of the tricyclic peptide (see FIG. 3).

The disclosure also provides for a method of peptide cyclization known as copper- catalyzed azide-alkyne cyclization (CuAAC) to catalyze alkyne moiety of the tetravalent molecular scaffold reacting with the azide group of reactive Fmoc azido amino acids of the peptide (see FIG. 4).

The disclosure also provides for a method of producing tricyclic peptides by biological or chemical synthesis of linear peptides followed by peptide cyclization through chemical linkage of peptides onto scaffolds (CLIPS) and copper-catalyzed azide-alkyne cyclization (CuAAC).

The disclosure also provides for a method of construction of a phage library displaying tricyclic peptides and screening such phage library for tricyclic peptides that specifically bind to a target protein (see FIG. 5). The disclosure also provides for a method of construction and screening a library of chemically-synthesized tricyclic peptides for those that specifically bind to a target protein.

The disclosure also provides for a pharmaceutical composition comprising the tricyclic peptide target protein binder of the disclosure and a pharmaceutically acceptable carrier.

The disclosure also provides for methods of detecting the binding of tricyclic peptide binding to target protein.

In one embodiment, the disclosure provides for tricyclic peptides that specifically bind and modulate (e.g., inhibit or activate) at least one activity of Programmed Cell Death Protein 1 (PD-1). The PD-1 activities that can be modulated by the tricyclic peptides of the disclosure include, but are not limited to, PD-1 mediated inhibition or activation of T cell activation.

In one embodiment, the tricyclic peptide PD-1 binder of the present disclosure can neutralize, inhibit, block, abrogate, reduce or interfere with PD-1 activity by blocking or reducing PD-1 interaction with its ligand PD-L1.

The disclosure also provides for methods of stimulating T cell activation by blocking or reducing PD-L1 interaction with PD-1 by tricyclic peptide PD-1 binder of the disclosure.

In another embodiment, tricyclic peptide PD-1 binder of the disclosure can activate PD-1 activity by functioning as PD-1 agonists.

The disclosure also provides for methods of inhibiting T cell activation by activating PD- 1 with tricyclic peptide PD-1 binder of the disclosure as an agonist.

The disclosure also provides for a method of treating cancers and chronic viral infections in a subject, comprising administering a therapeutically effective amount of a tricyclic peptide PD-1 binder that blocks or reduces PD-L1 interaction with PD-1.

The disclosure also provides for a method of treating inflammation diseases, autoimmune diseases, allergies or transplant rejections in a subject, comprising administering a

therapeutically effective amount of a tricyclic peptide PD-1 binder that activates PD-1 as an agonist

In embodiments, the tricyclic peptide PD-1 binder comprises or an amino acid sequence selected from SEQ ID Nos: 10-56.

In one embodiment, the disclosure provides for tricyclic peptides that specifically bind Tumor Necrosis Factor alpha (TNFa). In one embodiment, the tricyclic peptide TNFa binder of the present disclosure can block or reduce TNFa binding to its receptors.

In one embodiment, the tricyclic peptide TNFa binder of the present disclosure can neutralize, inhibit, block, abrogate, reduce or interfere with TNFa activity.

In one embodiment, the tricyclic peptide TNFa binder of the present disclosure can neutralize TNFa activity in cell-based TNFa-dependent functional assays.

In one embodiment, the tricyclic peptide TNFa binder of the present disclosure can neutralize TNFa activity in TNFa-driven inflammation mouse models.

The disclosure also provides for a method of treating TNFa-mediated disease or disorders, including but not limiting to auto-immune/inflammatory diseases, diabetes related diseases, skin diseases, eye diseases, neurological disease or different types of cancer in a subject, comprising administering a therapeutically effective amount of a tricyclic peptide TNFa binder that neutralizes TNFa activity.

In embodiments, the tricyclic peptide TNFa binder comprises an amino acid sequence selected from SEQ ID Nos: 85-102.

In one embodiment, the disclosure provides for tricyclic peptides that specifically bind B- cell lymphoma 2 (BCL-2).

In one embodiment, the tricyclic peptide BCL-2 binder of the present disclosure can pass cell plasma membrane by itself or if facilitated by a second agent.

In one embodiment, the tricyclic peptide BCL-2 binder of the present disclosure can specifically block BCL-2 protein binding to its associated pro-apoptotic binding partner proteins.

In one embodiment, the tricyclic peptide BCL-2 binder of the present disclosure can specifically release BCL-2 in sequestering its associated pro-apoptotic binding partner proteins.

In one embodiment, the tricyclic peptide BCL-2 binder of the present disclosure can specifically inhibit BCL-2 signalling activity.

In one embodiment, the tricyclic peptide BCL-2 binder of the present disclosure can specifically inhibit BCL-2-mediated anti-apoptosis.

In one embodiment, the tricyclic peptide BCL-2 binder of the present disclosure can specifically promote cell death in a tumor cell apoptosis assay. In one embodiment, the tricyclic peptide BCL-2 binder of the present disclosure can specifically inhibit tumor growth in a tumor-bearing xenograft mouse model.

The disclosure also provides for a method of treating BCL-2-related cancer, including but not limiting to acute myeloid leukaemia (AML), chronic lymphocytic leukaemia (CLL), non- Hodgkin lymphoma (NHL), diffuse large B cell lymphoma (DLBCL) and multiple myeloma in a subject, comprising administering a therapeutically effective amount of a tricyclic peptide BCL-2 binder that inhibits BCL-2 signaling activity.

In embodiments, the tricyclic peptide BCL-2 binder comprises an amino acid sequence selected from SEQ ID Nos: 57-84.

Any one embodiment of the disclosure described herein, including those described only in one section of the specification describing a specific aspect of the disclosure, and those described only in the examples or drawings, can be combined with any other one or more embodiment(s), unless explicitly disclaimed or improper.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1: Schematic illustration of an exemplary tricyclic peptide format. Each circle represents an amino acid residue of the tricyclic peptide. The hexagon represents the molecular scaffold.

FIG. 2: Chemical structure of representative molecular scaffolds. The compound on the left is 1 ,2,4,5-tetrabromodurene with four bromomethyl groups capable of reacting with thiol groups on four cysteine residues of a linear peptide. The one on the right is a compound with two bromomethyl groups capable of reacting with two thiol groups on two cysteines by CLIPS to form two thioether linkages, and two alkynes capable of reacting with two azide groups of two Fmoc azido amino acids by CuAAC to form two triazole linkages.

FIG. 3: Reactions of linear peptides containing four cysteines (circle with letter C) with a molecular scaffold with four bromomethyl groups by CLIPS to give a representative tricyclic peptide.

FIG. 4: Reactions of linear peptides containing two cysteines (circle with letter C) and two Fmoc azido amino acids (circle with“Aha”) with a molecular scaffold with two

bromomethyl groups and two alkynes to give a tricyclic peptide in two chemical reactions. In the first reaction, two bromomethyl groups react with two thiol groups on two cysteines by CLIPS to form two thioether linkages. Subsequently, two alkynes react with the azide groups of two Fmoc azido amino acids by CuAAC to form two triazole linkages.

FIG. 5: Illustration of the phage coat protein pIII with tricyclic peptide fused at the N- terminus (left) and the panning process of screening tricyclic peptide phage library for target protein binder (right).

FIG. 6: Map of the phage vector M13KE with sequence encoding cysteine-free pIII protein. The cloning of degenerated nucleotide sequences encoding tricyclic peptide sequence onto the N-terminus of pIII protein and the positions of relevant restriction enzymes for cloning are illustrated.

FIG. 7: Illustration of the reduction and cyclization process for the cyclization of linear peptide on a molecular scaffold to form tricyclic peptide on phage coat protein pIII.

FIG. 8: Quantitation of free thiol levels during the reduction and cyclization process for the cyclization of linear peptide on a molecular scaffold to form tricyclic peptide on phage coat protein pIII.

FIG. 9: Sequence alignment of tricyclic peptide sequences of candidate TNFa hits.

FIG. 10: ELISA binding of eluted phage from round 3 panning with target proteins PD-1, TNFa or BCL-2.

DETAILED DESCRIPTION OF THE DISCLOSURE

Definitions

All publications, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference as though fully set forth.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.

Although any methods and materials similar or equivalent to those described herein may be used in the practice for testing of the present disclosure, exemplary materials and methods are described herein. In describing and claiming the present disclosure, the following terminology will be used.

As used in this specification and the appended claims, the singular forms“a, '' '' an,” and

“the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to“a cell” includes a combination of two or more cells, and the like.

“Peptide” or“polypeptide,” used interchangeably herein, refers to a polymeric form of amino acids, which can include coded (e.g., 20 naturally occurring L-amino acids encoded by polynucleotides, see Table 1 below) and non-coded amino acids (e.g., not one of 20 naturally occurring L-amino acids), chemically or biochemically modified or derivative amino acids. For example, the peptide or polypeptide may include selenocysteine. The length of peptide is usually 50 or fewer amino acids.

Conventional one and three-letter amino acid codes are used herein as shown in Table 1.

Table 1

“Valent” refers to the presence of a specified number of binding sites specific for a binding site in a molecule. As such, the terms“monovalent,”“bivalent,”“tetravalent,” and “hexavalent” refer to the presence of one, two, four and six binding sites, respectively, in a molecule.

“Specific binding” or“specifically binds” or“binds” refers to a tricyclic peptide binding to a specific binding site with greater affinity than for other (non-specific) binding sites.

Typically, the tricyclic peptide“specifically binds” when the equilibrium dissociation constant (KD) for binding site is about 1 x 10^-8 M or less, for example about 1 x 10^-9 M or less, about 1 x 10- ¹⁰ M or less, about 1 x 10^-11 M or less, or about 1 x 10^-12 M or less, typically with the KD that is at least one hundred-fold less than its KD for binding to a non-specific antigen (e.g, BSA, casein). The KD may be measured using standard procedures.

A target is a molecule or part thereof to which the tricyclic peptide binds or otherwise interacts with. Although binding is seen as a prerequisite to activity of most kinds, and may be an activity in itself, other activities are envisaged. Thus, the present disclosure does not require the measurement of binding directly or indirectly.

Screening for binding activity (or any other desired activity) is conducted according to methods well known in the art, for instance from phage display technology. For example, targets immobilized to a solid phase can be used to identify and isolate binding members of a repertoire library. Screening allows selection of members of a repertoire library according to desired characteristics.

The term“library” refers to a mixture of heterogeneous polypeptides or nucleic acids. The library is composed of members, at least some of which are not identical. To this extent, library is synonymous with repertoire. Sequence differences between library members are responsible for the diversity present in the library. The library may take the form of a simple mixture of polypeptides or nucleic acids, or may be in the form of organisms or cells, for example bacteria, viruses, animal or plant cells and the like, transformed with a library of nucleic acids. Under some conditions, each individual organism or cell contains only one or a limited number of library members.

The term“repertoire” refers to a genetically diverse collection of nucleotides derived wholly or partially from sequences that encode expressed peptide. The sequences are generated by molecular biology techniques, such as PCR and random mutagenesis.

As used herein, the terms“treatment,”“treating,” and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease.

“Treatment,” as used herein, covers any treatment of a disease in a mammal, e.g., in a human or a non-human mammal, and may include: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, e.g., arresting its development; and/or (c) relieving the disease, e.g., causing regression of the disease.

The terms“individual,”“subject,”“host,” and“patient,” used interchangeably herein, refer to a mammal, including, but not limited to, murines (e.g., rats, mice), lagomorphs (e.g., rabbits), non-human primates or non-human mammals, humans, canines, felines, ungulates (e.g., equines, bovines, ovines, porcines, caprines), etc.

In certain embodiments, the terms“treatment” and“therapeutic method” may refer to both therapeutic treatment and prophylactic / preventative measures. Those in need of treatment may include individuals already having a particular medical disorder as well as those who may ultimately acquire the disorder (i.e., those needing preventative measures).

In certain embodiments, the terms“treatment” and“therapeutic method” may narrowly refer to therapeutic treatment, but not prophylactic / preventative measures.

A“therapeutically effective amount” or“efficacious amount” refers to the amount of an agent, or combined amounts of two agents, that, when administered to a mammal or other subject for treating a disease, is sufficient to effect such treatment for the disease. The“therapeutically effective amount” will vary depending on the agent(s), the disease and its severity and the age, weight, etc., of the subject to be treated.

Before the present disclosure is further described, it is to be understood that this disclosure is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

Composition of tricyclic peptide

A“tricyclic peptide,” as used herein, may refer to a peptide or polypeptide covalently linked to a molecular scaffold and forms three loops or three fused rings. See a representative structure in FIG. 1. Alternatively, it may refer to the peptide or polypeptide itself (i.e., without being covalently linked to the molecular scaffold). Thus, depending on the context, the tricyclic peptide of the disclosure may include both the molecular scaffold and the polypeptide covalently linked to the molecular scaffold, or may refer to the polypeptide capable of forming covalent bonds with the molecular scaffold to form the three-fused-ring structure.

For clarity, the tricyclic peptide comprising the molecular scaffold may also be referred to as tricyclic peptide-scaffold fusion or tricyclic peptide complex, while the tricyclic peptide capable of forming the fusion or complex but has yet to do so with the molecular scaffold is simply referred to as the tricyclic peptide. Thus, the term tricyclic peptide as used herein may be generally construed to mean both the tricyclic peptide complex and the tricyclic peptide not yet linked to the molecular scaffold, unless the context requires one interpretation over the other.

One aspect of the disclosure provides a tricyclic peptide covalently linked to a molecular scaffold and comprising the amino acid sequence:

wherein:

each of Y1-Y4 independently represents an amino acid with a reactive group covalently linked to the molecular scaffold,

each of Xl-XS independently represents a random amino acid residue or a random polypeptide,

k, m, and n are independently integers between 3 and 10 (e.g., 3, 4, 5, 6, 7, 8, 9,

10),

1 and o are independently integers between 0 and 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 1-10, 1-5, 1-3, etc.), and,

wherein the tricyclic peptide can specifically bind to a target protein and modulate one activity of the target protein.

In a related aspect, the disclosure provides a tricyclic peptide capable of being covalently linked to a molecular scaffold, said tricyclic peptide comprising the amino acid sequence:

wherein:

each of Y1-Y4 independently represents an amino acid with a reactive group capable of being covalently linked to the molecular scaffold,

each of X1-X5 independently represents a random amino acid residue or a random polypeptide,

k, m, and n are independently integers between 3 and 10 (e.g, 3, 4, 5, 6, 7, 8, 9,

10),

1 and o are independently integers between 0 and 20 (e.g, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 1-10, 1-5, 1-3, etc.), and, wherein the tricyclic peptide, after being covalently linked to the molecular scaffold, is capable of specifically binding to a target protein and modulate one activity of the target protein.

Typically, such tricyclic peptides comprise four reactive groups which are capable of forming covalent bonds to the scaffold, and a sequence subtended between said reactive groups which is referred to as the“loop sequence,” since it forms a loop when the peptide is covalently bound to the scaffold. In the present case, the peptides comprise four reactive groups, and form three loops / fused rings with the molecular scaffold.

In certain embodiments, the first and/or the last residues with the reactive groups (such as Cys) can be, but do not need to be, the terminal amino acid residue of the tricyclic peptide.

In certain embodiments, the most N-terminal of the four residues with the reactive groups (such as Cys) is also the N-terminal amino acid residue of the tricyclic peptide. In certain embodiments, the most C-terminal of the four residues with the reactive groups (such as Cys) is also the C-terminal amino acid residue of the tricyclic peptide.

In certain embodiments, both the most N-terminal and the most C-terminal of the four residues with the reactive groups (such as Cys) are also the N- and C-terminal amino acid residues, respectively, of the tricyclic peptide.

In certain embodiments, there are one or more (e.g., 1, 2, 3, 4, 5 etc.) N-terminal amino acid residues than the most N-terminal of the four residues with the reactive groups (such as

Cys).

In certain embodiments, there are one or more (e.g., 1, 2, 3, 4, 5 etc.) C-terminal amino acid residues than the most C-terminal of the four residues with the reactive groups (such as

Cys).

In embodiments, the tricyclic peptides provided herein comprise or consist of an amino acid sequence selected from the group consisting of SEQ ID Nos: 10-102.

The amino acids comprising the loop sequence can be any natural or non-natural amino acids, excluding the ones harboring functional groups for cross-linking the peptides to a molecular scaffold. The inclusion of non-natural amino acids may help to improve the binding affinity and protect the peptide from proteolytic degradation or may provide a reactive group otherwise not found in standard amino acids. The loop sequences may have random sequences, known sequences, or sequences with random and known amino acids.

The reactive groups of the peptides can be selected from thiol groups, amino groups, carboxyl groups, guanidinium groups, phenolic groups or hydroxyl groups. The reactive groups of the peptides can be selected from azide, keto-carbonyl, alkyne, vinyl, or aryl halide groups. The reactive groups of the peptides for linking to a molecular scaffold can be on the side chains of amino acid residues or be the amino or carboxy terminus of the polypeptide.

In certain embodiments, the reactive groups of the tricyclic peptides are provided by side chains of natural or non-natural amino acids. Examples of reactive groups of natural amino acids are the thiol group of cysteine, the amino group of lysine, the carboxyl group of aspartate or glutamate, the guanidinium group of arginine, the phenolic group of tyrosine or the hydroxyl group of serine. Non-natural amino acids can provide a wide range of reactive groups including an azide, a keto-carbonyl, an alkyne, a vinyl, or an aryl halide group. The amino and carboxyl group of the termini of the polypeptide can also serve as reactive groups to form covalent bonds to a molecular scaffold/molecular core.

In certain embodiments, the reactive group(s) comprise the thiol group of cysteine, or an azide group from Fmoc azido amino acids.

In some embodiments, each of the reactive groups of the tricyclic peptide for linking to a molecular scaffold are of the same type. For example, each reactive group may be a cysteine residue.

In some embodiments, the reactive groups for linking to a molecular scaffold may comprise two or more different types or may comprise three or more different types. For example, the reactive groups may comprise two cysteine residues and one lysine residue, or may comprise one cysteine residue, one lysine residue, and one N-terminal amine, etc. The different reactive groups can be in any desired order. For example, if 2 of the 4 are Cys thio groups, the Cys can be the 1^st and the 4^th, the 1^st and the 3^rd, the 1^st and the 2^nd, the 2^nd and the 3^rd, the 2^nd and the 4^th, or the 3^rd and the 4^th (with the 1^st being the most N-terminal of the 4).

In certain embodiments, Cysteine is employed to provide the reactive group(s), partly due to its advantage that its reactivity is most different from all other amino acids. Scaffold reactive groups that could be used on the molecular scaffold to react with the thiol groups of cysteines include haloacetyls, maleimides, aziridines, acryloyls, arylating agents, vinylsulfones, pyridyl disulfides, TNB-thiols and disulfide reducing agents. Most of these groups conjugate to sulfhydryls by either alkylation (usually the formation of a thioether bond) or disulfide exchange (formation of a disulfide bond).

In certain embodiments, the thio- or sulfhydryl-reactive chemical groups include alkyl halides (or also named halogenoalkanes or haloalkanes). Examples are bromomethylbenzene or iodoacetamide.

In certain embodiments, scaffold reactive groups that are used to couple selectively compounds to cysteines in proteins are maleimides. Examples of maleimides which may be used as molecular scaffolds in the disclosure include: tris-(2-maleimidoethyl)amine, tris-(2- maleimidoethyl)benzene, tris-(maleimido)benzene.

Selenocysteine is also a natural amino acid which has a similar reactivity to cysteine and can be used for the same reactions.

Lysines (and primary amines of the N-terminus of peptides) are also suited as reactive groups to modify candidate tricyclic peptides, such as peptides on phage, by linking to a molecular scaffold. Scaffold reactive groups that react selectively with primary amines include isothiocyanates, isocyanates, acyl azides, NHS esters, sulfonyl chlorides,

aldehydes, glyoxals, epoxides, oxiranes, carbonates, aryl halides, imidoesters, carbodiimides, anhydrides, and fluorophenyl esters. Representative structures of some of these groups are depicted below. Most of these conjugate to amines by either acylation or alkylation. Among them, NHS esters and imidoesters are one of the most popular amine-specific functional groups that are incorporated into reagents for protein / amino acid crosslinking and labeling.

Representative primary amine reactive groups include: succinimides, aldehydes or alkyl halides. Examples of succinimides for use as molecular scaffold include tris-(succinimidyl aminotriacetate), 1,3,5-Benzenetriacetic acid. Examples of aldehydes for use as molecular scaffold include Triformylmethane. Examples of alkyl halides for use as molecular scaffold include l,3,5-Tris(bromomethyl)-2,4,6-trimethylbenzene, l,3,5-Tris(bromomethyl) benzene, l,3,5-Tris(bromomethyl)-2,4,6-triethylbenzene.

Lysines are more abundant in phage proteins than cysteines, but there is also a higher risk that phage particles might become cross-linked or that they might lose their infectivity.

The unnatural amino acids incorporated into peptides may include: 1) a ketone functional group (as found in para or meta acetyl-phenylalanine) that can be specifically reacted with hydrazines, hydroxylamines and their derivatives, azides (as found in p-azido-phenylalanine) that can be reacted with alkynes via copper catalyzed“click chemistry” to form the corresponding triazoles, or azides that can be reacted with aryl phosphines, via a Staudinger ligation, Alkynes that can be reacted with azides to form the corresponding triazole, Boronic acids (boronates) than can be specifically reacted with compounds containing more than one appropriately spaced hydroxyl group or undergo palladium-mediated coupling with halogenated compounds, Metal chelating amino acids, including those bearing bipyridyls, that can specifically co-ordinate a metal ion.

Unnatural amino acids may be incorporated into proteins and peptides displayed on phage by transforming E. coli with plasmids or combinations of plasmids bearing: 1) the orthogonal aminoacyl-tRNA synthetase and tRNA that direct the incorporation of the unnatural amino acid in response to a codon, 2) The phage DNA or phagemid plasmid altered to contain the selected codon at the site of unnatural amino acid incorporation.

The peptides of the disclosure contain at least four reactive groups. The reactive groups react with the molecular scaffold to form covalent bonds. These covalent bonds, together with the peptide sequence between the two reactive groups form a loop / a ring of the three fused rings structure. The more reactive groups are used, the more loops are formed with the molecular scaffold.

Tricyclic peptides with four reactive groups forming covalent bonds with a molecular scaffold have a tetrahedral symmetry and can generate two product isomers. Even though the two different product isomers are encoded by one and the same nucleic acid, the isomeric nature of the isolated isomer can be determined by chemically synthesizing both isomers, separating the two isomers, and testing both isomers for binding to a target ligand.

The tricyclic peptides provided herein include peptides In embodiments, the tricyclic peptide TNFct binder comprises an amino acid sequence selected from SEQ ID Nos: 85-102.

Molecular scaffold

The molecular scaffold can be any molecule which is able to connect the peptide at multiple points to impart one or more structural features to the tricyclic peptide. It is not a cross- linker, in that it does not merely replace a disulfide bond; instead, it provides two or more attachment points for the tricyclic peptide. Suitably, the molecular scaffold comprises at least three attachment points for the tricyclic peptide, referred to as“scaffold reactive groups.” These groups are capable of reacting to the reactive groups on the peptide to form covalent bonds.

The reactive groups on the amino acid residues are groups capable of forming covalent bonds with the scaffold reactive groups on the molecular scaffold. Typically, the reactive groups are present on amino acid side chains of the tricyclic peptide. Examples are amino- or thio- containing groups, such as cysteine, lysine and selenocysteine.

The molecular scaffold may be a small molecule, such as a small organic molecule (e.g, one with molecular weight of less than 5000, 3000, 2000, 1000, 500, or 250 Da). The molecular scaffold may be, or may be based on / derived from, natural monomers such as nucleosides, sugars, or steroids. The molecular scaffold may comprise a short polymer of such entities, such as a dimer or a trimer. In one embodiment, the molecular scaffold is a compound of known toxicity, for example, of low toxicity. Examples of suitable compounds include cholesterols, nucleotides, steroids, or existing drugs such as tamazepam. The molecular scaffold may be a macromolecule. In one embodiment the molecular scaffold is a macromolecule composed of amino acids, nucleotides, or carbohydrates.

The molecular scaffold comprises reactive groups that are capable of reacting with functional group(s) of the peptide to form covalent bonds. The molecular scaffold may comprise chemical groups as amines, thiols, alcohols, ketones, aldehydes, nitriles, carboxylic acids, esters, alkenes, alkynes, azides, anhydrides, succinimides, maleimides, alkyl halides and acyl halides.

In certain embodiments, the molecular scaffold of the disclosure contains chemical groups that allow functional groups of the tricyclic peptide to form covalent links with the molecular scaffold. Said chemical groups are selected from a wide range of functionalities including amines, thiols, alcohols, ketones, aldehydes, nitriles, carboxylic acids, esters, alkenes, alkynes, anhydrides, succinimides, maleimides, azides, alkyl halides and acyl halides.

In certain embodiments, the molecular scaffold is a tetravalent scaffold forming (or capable of forming) a covalent bond with a thiol group of the amino acid sequence through a benzyl bromide moiety, and/or forming (or capable of forming) a covalent bond with an azide group of the amino acid sequence through an alkyne moiety.

In certain embodiments, the molecular scaffold is a tetravalent scaffold forming (or capable of forming) four covalent bonds with said amino acid sequence through four benzyl bromide moieties.

In certain embodiments, the molecular scaffold is 1,2,4, 5-tetrabromodurene.

In certain embodiments, the molecular scaffold is a tetravalent scaffold forming (or capable of forming) two covalent bonds with the amino acid sequence through two benzyl bromide moieties, and two covalent bonds with the amino acid sequence through two alkyne moieties.

Synthesis of tricyclic peptide

The first step of making tricyclic peptide of the disclosure may be synthesizing a linear peptide by standard synthetic chemistry. Subsequently, the linear peptide is cyclized by chemical reactions to catalyze the formation of covalent bonds between reactive groups on the linear peptide and the molecular scaffold.

Peptide synthesis can be carried out by standard techniques known in the art. Automated peptide synthesizers are widely available. To extend the peptide, it may simply be extended chemically at its N-terminus or C-terminus or within the loops using orthogonally protected lysines (and analogues) using standard solid phase or solution phase chemistry. Standard protein chemistry may be used to introduce an activatable N- or C-terminus. Alternatively, additions may be made by fragment condensation or native chemical ligation, e.g., as described in Dawson P E, Muir T W, Clark-Lewis I, Kent, S B H. 1994. Synthesis of Proteins by Native Chemical Ligation. Science 266:776-779; or by enzymes, for example, using subtiligase as described in Subtiligase: a tool for semisynthesis of proteins Chang T K, Jackson D Y, Burnier J P, Wells J A Proc Natl Acad Sci USA. 1994 Dec. 20; 91(26): 12544-8, or in Bioorganic & Medicinal

Chemistry Letters Tags for labelling protein N-termini with subtiligase for proteomics Volume 18, Issue 22, 15 Nov. 2008, Pages 6000-6003 Tags for labeling protein N-termini with subtiligase for proteomics; Hikari A. I. Yoshihara, Sami Mahrus and James A. Wells (all incorporated by reference).

The tricyclic peptide can also be synthesized in any of the standard translation systems known in the art, or by transfecting polynucleotides (such as plasmids) encoding the tricyclic peptides into a host cell (such as E. coli) for producing the tricyclic peptides. The host may be modified so that it is capable of incorporating unnatural amino acids into the tricyclic peptides if desired.

The polynucleotides encoding the tricyclic peptides may encode a library of tricyclic peptides differing in the residues designed to react with the molecular scaffold, in the residues not designed to react with the molecular scaffold (e.g., the loop region sequences, or the N- or C- terminal sequences, if present), or a mixture of both.

The library may be a phage display library, such as one with each encoded tricyclic peptide tethered to a phage capsid protein for displaying on the surface of the phage.

Cyclization of tricyclic peptide

One way to cyclize linear peptide into tricyclic peptide conjugated with the molecular scaffold is to ligate tetrakis(cysteine)-containing peptides with 1,2,4,5-tetrabromodurene by chemical linkage of peptides onto scaffolds (CLIPS) (FIG. 3). The CLIPS technology can be applied to efficiently cyclize peptide displayed on phage while sparing phage coat proteins in order to conserve phage functionality. Although this is a straightforward route to manufacture tricycles, this reaction yields a mixture of six different regioisomers.

To get isomerically pure tricyclic peptide, another strategy is to design a linear peptide with different amino acid reactive groups at carefully chosen locations, such as having two Fmoc azido amino acids at the peptide termini and two cysteine residues in the center of the peptide (Richelle, Ori et al. 2018). Tetravalent scaffolds containing two benzyl bromide and two alkyne moieties are used to ligate azide group of Fmoc azido amino acids with the alkyne moiety, and to ligate the thiol group of cysteine with the benzyl bromide. The reaction of benzyl bromide with thiol group can be catalyzed by CLIPS technology. The reaction of alkyne with azide group can be realized by copper-catalyzed azide-alkyne cyclization (CuAAC), in which a mixture of CuSOVTHPTA/NaAsc (Asc=ascorbate, THPTA=tris(3-hydroxypropyltriazolylmethyl)amine) in HzO is added to trigger the CuAAC cyclizations and the reaction can be completed within minutes (FIG. 4). The CuAAC chemistry is fully compatible with both peptide and CLIPS chemistry, and does not require protection of any of the amino acid side chains. Besides, CuAAC reaction condition can be controlled to cyclize peptide displayed on phage while sparing phage coat proteins in order to conserve phage functionality.

In certain embodiments, the covalent bond between the thiol group and the benzyl bromide moiety is formed via chemical linkage of peptides onto scaffolds (CLIPS).

In certain embodiments, the covalent bond between the azide group and the alkyne moiety is formed via copper-catalyzed azide-alkyne cyclization (CuAAC).

Screening chemically synthesized tricyclic peptide library for target protein binder

A library of tricyclic peptide can be constructed by synthesizing each and discrete tricyclic peptide by conventional synthetic chemistry. The resulting tricyclic peptide library can be screened for target protein binder.

This strategy is simple, and are especially useful where, for instance, only a small number of peptides needs to be screened. Screening by such individual assays, however, may be time- consuming and the number of unique molecules that can be tested for binding to a specific target generally may be 10⁶ chemical entities or less.

Screening phage library displaying tricyclic peptide for target protein binder In contrast to screening chemical library with limited number of peptide compounds, screening peptide repertoires produced biologically generally allow the sampling of a much larger number of different molecules in the range of 10¹³ individual compounds. Examples for powerful affinity selection techniques are phage display, ribosome display, mENA display, yeast display, bacterial display or RNA/DNA aptamer methods. These biological in vitro selection methods have in common that peptide repertoires are encoded by DNA or RNA. They also allow the propagation and the identification of selected peptides by sequencing.

Phage display technology has, for example, been used for the isolation of antibodies with very high binding affinities to virtually any target. Phage display is a method in which the gene of a polypeptide is fused to the gene of a phage coat protein. When phage is produced in a bacterial cell, the peptide is expressed as a fusion of the coat protein. Upon assembly of a phage particle, the peptide is displayed on the surface of the phage. By contacting a phage repertoire with an immobilized antigen, some phage remains bound to the antigen while others are removed by washing. The phage can be eluted and propagated. The DNA encoding the polypeptide of selected phage can be sequenced. Phage display can be used to encode more than 10¹⁰ individual peptides. A favorable aspect of phage display is that the genetic code, a single stranded DNA is packed in a coat The coat may protect the DNA from reaction with the molecular scaffold.

Libraries of tricyclic peptide intended for screening may be constructed using different biological systems, including phage vector systems as described herein. Other vector systems are known in the art, and include other phage (for instance, phage lambda), bacterial plasmid expression vectors, eukaryotic cell-based expression vectors, including yeast vectors, and the like. Once a vector system is chosen, nucleic acid sequences encoding peptides repertoires are cloned into the library vector. The diversity of nucleic acid sequences determines the diversity of peptide repertoires coded by the DNA sequence. The nucleic acid sequence diversity can be generated by standard molecular methods. Of particular use is the polymerase chain reaction (PCR) to amplify the target sequence of interest, is well known in the art. The construction of various antibody libraries has been discussed in Winter et al. (1994) Ann. Rev. Immunology 12, 433-55, and references cited therein.

In phage display embodiments, the tricyclic peptides are displayed on phage by fusion of the target tricyclic peptide of interest to an engineered gene permitting external display of the tricyclic peptide of interest In certain embodiments, the engineered gene comprises an engineered gene 9 (p9 or gene IX), gene 8 (gene VIII), gene 7 (p7 or gene VII), gene 6 (p6 or gene VI) or gene 3 (p3 or gene ID) of the phage. These proteins offer the advantage that they contain fewer or no cysteines that can react with the molecular scaffold and produce side products. For p6, it is advantageous to mutate cysteine 84 to serine. The cysteines in p7 and p9 are most likely buried and therefore may not necessarily need to be mutated to remove them. p8 offers the advantage that it does not contain a cysteine residue. Thus, in certain embodiments, the engineered gene comprises an engineered gene 8 (gene VIII), gene 6 (gene VI) or gene 3 (gene IP) of the phage.

In certain embodiments, such display is accomplished by fusion of the target tricyclic peptide of interest to an engineered gene 3 protein lacking cysteine residues in domain 1 and 2. This fusion may be accomplished by any suitable technique known in the art such as by manipulation of the nucleic acid encoding the phage gene III protein to change the codons encoding cysteine to codon(s) encoding other amino acid(s), and by inserting a nucleic acid sequence encoding the target polypeptide into the gene IP coding sequence in frame so that it is displayed as a gene III fusion protein on the outside of the phage particle.

In certain embodiments, the amino acid sequence of the native phage gene 3 (gene III) protein (p III) comprise amino acid sequence as in SEQ ID NO: 1, while the amino acid sequence of the phage gene 3 (gene III) protein (pIII) with cysteines mutated to other amino acids and with additional mutations to stabilize the protein comprise amino acid sequence as in SEQ ID NO: 2.

The amino acid sequence of the native phage pIII protein (SEQ ID NO: 1)

The amino acid sequence of engineered phage pIII protein free of cysteine (SEQ ID NO: 2)

Specific chemistry conditions may be adopted to cyclize the linear peptide displayed on the surface of phage on molecular scaffold into tricyclic form (Zha, Lin et al. 2018). Reaction conditions as reaction temperature, molecular scaffold concentration, solvent and/or pH are chosen to allow efficient reaction of the functional groups of the target polypeptide with the scaffold compound, but leave the nucleic acid encoding the polypeptide in a condition that allows to decode (e.g. to sequence) and/or propagate the isolated molecules (e.g. by PCR or by phage propagation or any other suitable technique). Moreover, the reaction conditions should leave the phage coat protein in a condition that allows it to propagate the phage.

In one embodiment of the present disclosure, thiol groups of cysteine residues are used as functional groups to link polypeptides to a molecular scaffold. In some embodiments, the thiol groups of the polypeptides are first reduced. Thiol groups in phage displayed polypeptides can be efficiently reduced by adding a reducing agent such as tris(carboxyethyl)phosphine (TCEP). Since an excess of reducing agent can interfere with the attachment reaction, it is efficiently removed by filtration of the phage. Re-oxidation of the thiol groups after removal of TCEP can be prevented by degassing of the reaction buffer. Re-oxidation of the thiol groups can also be prevented by complex formation of metal ions by chelation, for example chelation with ethylenediaminetetraacetic acid (EDTA).

In one embodiment of the present disclosure, attachment of the polypeptide to the molecular scaffold is accomplished by reacting the reactive groups of the polypeptide such as thiol groups of a phage encoded polypeptide with the molecular scaffold compound for one hour. For example, they can be reacted at 30°C with molecular scaffold compound at a concentration of about 10 mM in aqueous buffer at pH 8. The reaction buffer may contain about 20% acetonitrile.

In certain embodiments, the method of the disclosure minimizes the concentration of molecular scaffold used in the reaction. In other words, the lower the concentration of the molecular scaffold used at the time of reaction with the polypeptide of the phage, the better, provided always that sufficient molecular scaffold becomes joined to the phage polypeptide. of phage infectivity following coupling of the molecular scaffold.

Any suitable means for purification of the phage may be used. Standard techniques may be applied in the present disclosure. For example, phage may be purified by filtration or by precipitation such as PEG precipitation; phage particles may be produced and purified by polyethylene-glycol (PEG) precipitation.

Screening for target protein binder may be performed by contacting a library of the disclosure with the target protein and isolating one or more library members) that bind to target protein (Heinis, Rutherford et al. 2009). Several rounds of screening with increased binding stringency may be performed to identify target protein binder with high affinity. Besides, affinity maturation with mutagenesis of targeted peptide sequence may be performed to obtain target protein binder with desired binding affinity.

Attachment of effector groups and functional groups

In certain embodiments, one or more effector and/or functional groups may be attached to the tricyclic peptide (for example, to the N- or C- terminus of the tricyclic peptide), and/or to the molecular scaffold. Coupling effector/functional groups at the N- or C-termini or via molecular scaffold can be achieved using appropriate synthetic chemistry approaches.

Appropriate effector groups may include antibodies and parts or fragments thereof (including antigen-binding or non-binding fragments thereof). In one embodiment, an effector group according to the present disclosure is an Fc region of an IgG molecule. Advantageously, a peptide ligand-effector group according to the present disclosure comprises or consists of a peptide ligand Fc fusion having an extended half-life of 12 hours or more, a day or more, two days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more, or 7 days or more.

Functional groups may include, in general, binding groups, drugs, reactive groups for the attachment of other entities, functional groups which aid uptake of the macrocyclic peptides into cells, and the like.

Functional groups which enable the penetration of cells include peptides or chemical groups which have been added either to the peptide or the molecular scaffold. Peptides such as those derived from VP22, HIV-Tat, a homeobox protein of Drosophila (Antennapedia), e.g., as described in Chen and Harrison, Biochemical Society Transactions (2007) Volume 35, part 4, p

821“Cell-penetrating peptides in drug development: enabling intracellular targets” and

“Intracellular delivery of large molecules and small peptides by cell penetrating peptides” by

Gupta et al. in Advanced Drug Discovery Reviews (2004) Volume 57 9637 (incorporated by reference).

Examples of short peptides which have been shown to be efficient at translocation through plasma membranes include the 16 amino acid penetrating peptide from Drosophila Antennapedia protein (Derossi et al (1994) J Biol. Chem. Volume 269 p 10444“The third helix of the Antennapedia homeodomain translocates through biological membranes,” incorporated by reference), the 18 amino acid‘model amphipathic peptide’ (Oehlke etal (1998) Biochim

Biophys Acts Volume 1414 p 127“Cellular uptake of an alpha-helical amphipathic model peptide with the potential to deliver polar compounds into the cell interior non-endocytically,” incorporated by reference) and arginine rich regions of the HIV TAT protein. Non peptide approaches include the use of small molecule mimics or SMOCs that can be easily attached to biomolecules (Okuyama et al (2007) Nature Methods Volume 4 p 153‘Small-molecule mimics of an a-helix for efficient transport of proteins into cells,’ incorporated by reference). Other chemical strategies to add guanidinium groups to molecules also enhance cell penetration (Elson- Scwab et al (2007) J Biol Chem Volume 282 p 13585“Guanidinylated Neomcyin Delivers Large Bioactive Cargo into cells through a heparin Sulphate Dependent Pathway,” incorporated by reference). Small molecular weight molecules such as steroids may be added to the molecular scaffold to enhance uptake into cells.

Functional groups may also include drugs, such as cytotoxic agents for cancer therapy. These include Alkylating agents such as Cisplatin and carboplatin, as well as oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, ifosfamide; Anti-metabolites including purine analogs azathioprine and mercaptopurine)) or pyrimidine analogs; plant alkaloids and terpenoids including vinca alkaloids such as Vincristine, Vinblastine, Vinorelbine and Vindesine; Podophyllotoxin and its derivatives etoposide and teniposide; Taxanes, including paclitaxel, originally known as Taxol; topoisomerase inhibitors including camptothecins: irinotecan and topotecan, and type P inhibitors including amsacrine, etoposide, etoposide phosphate, and teniposide. Further agents can include Antitumor antibiotics which include the

immunosuppressant dactinomycin (which is used in kidney transplantations), doxorubicin, epirubicin, bleomycin and others.

Possible effector groups may also include enzymes, for instance, carboxypeptidase G2 for use in enzyme/prodrug therapy, where the peptide ligand replaces antibodies in ADEPT. Pharmaceutical Compositions and methods of use

Pharmaceutical composition of the disclosure comprising the subject tricyclic peptides may be administered to human or any non-human mammal. In certain embodiments, the tricyclic peptides are substantially pure, e.g., at least 90 to 95% homogeneity, or 98 to 99% or more homogeneity, especially when the mammal is a human.

Once purified, partially or to homogeneity as desired, the selected peptides may be used diagnostically or therapeutically, or in developing and performing assay procedures,

immunofiuorescent staining, and the like.

Generally, the present tricyclic peptide can be used in purified form together with pharmacologically appropriate carriers. Typically, these carriers include aqueous or

alcoholic/aqueous solutions, emulsions or suspensions, and may include saline and/or buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer's. Suitable physiologically-acceptable adjuvants, if necessary to keep a tricyclic peptide complex in suspension, may be chosen from thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates. Intravenous vehicles include fluid and nutrient replenishes and electrolyte replenishes, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, may also be present.

The tricyclic peptide of this disclosure can be lyophilized for storage and reconstituted in a suitable carrier prior to use. This technique has been shown to be effective and art-known lyophilization and reconstitution techniques can be employed. In case that lyophilization and/or reconstitution leads to varying degrees of activity loss, use levels can be adjusted upward to compensate for any loss.

Pharmaceutically acceptable agents include carriers, excipients, diluents, antioxidants, preservatives, coloring, flavoring and diluting agents, emulsifying agents, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles, tonicity agents, cosolvents, wetting agents, complexing agents, buffering agents, antimicrobials, and surfactants.

The composition can be in liquid form, or in a lyophilized or freeze-dried form, and may include one or more lyoprotectants, excipients, surfactants, high molecular weight structural additives and/or bulking agents.

Compositions can be suitable for parenteral administration. Exemplary compositions are suitable for injection or infusion into an animal by any route available to the skilled worker, such as intraarticular, subcutaneous, intravenous, intramuscular, intraperitoneal, intracerebral (intraparenchymal), intracerebroventricular, intramuscular, intraocular, intraarterial,

intralesional, intrarectal, transdermal, oral, and inhaled routes.

Solutions or suspensions used for intradermal or subcutaneous application typically include one or more of the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Such preparations may be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injection include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, cremophor EL (BASF, Parsippany, N. J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars; polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and/or by the use of surfactants. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate, and gelatin. Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For oral administration, the peptides can be combined with excipients and used in the form of tablets, troches, or capsules.

Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches, and the like can contain any of the following ingredients, or compounds of a similar nature; a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent Such as alginic acid, primogel, or com starch; a lubricant Such as magnesium stearate or sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration may be accomplished, for example, through the use of lozenges, nasal sprays, inhalers, or

suppositories. For transdermal administration, the active compounds may be formulated into ointments, salves, gels, or creams as generally known in the art. For administration by inhalation, the peptides may be delivered in the form of an aerosol spray from pressured container or dispenser, which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

Toxicity and therapeutic efficacy of the composition of the disclosure can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LDs (the dose lethal to 50% of the population) and the EDs (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. Compositions that exhibit large therapeutic indices are preferred.

For any composition used in the present disclosure, the therapeutically effective dose can be estimated initially from cell culture assays. Examples of suitable bioassays include DNA replication assays, cytokine release assays, transcription-based assays, binding assays, creatine kinase assays, assays based on the differentiation of preadipocytes, assays based on glucose uptake in adipocytes, immunological assays other assays as, for example, described in the examples. The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the ICs (i.e., the concentration of the peptide which achieves a half-maximal inhibition of symptoms). Circulating levels in plasma may be measured, for example, by high performance liquid chromatography. The effects of any particular dosage can be monitored by a suitable bioassay. The dosage lies preferably within a range of circulating concentrations with little or no toxicity. The dosage may vary depending upon the dosage form employed and the route of administration utilized.

The tricyclic peptide of the present disclosure may be used as diagnostic agents. Where the peptides are intended for diagnostic purposes, it may be desirable to modify them, for example, with a ligand group (such as biotin) or a detectable marker group (such as a fluorescent group, a radioisotope or an enzyme). If desired, the peptides of the disclosure may be labeled using conventional techniques. Suitable detectable labels include, for example, fluorophores, chromophores, radioactive atoms, electron-dense reagents, enzymes, and ligands having specific binding partners. Enzymes are typically detected by their activity. For example, horseradish peroxidase can be detected by its ability to convert tetramethylbenzidine (TMB) to a blue pigment, quantifiable with a spectrophotometer. For detection, suitable binding partners include, but are not limited to, biotin and avidin or Streptavidin, IgG and protein A, and the numerous receptor-ligand couples known in the art. Other permutations and possibilities will be readily apparent to those of ordinary skill in the art, and are considered as equivalents within the scope of the instant disclosure.

The tricyclic peptide of the present disclosure may be used as separately administered compositions or in conjunction with other agents. These can include antibodies, antibody fragments and various immunotherapeutic drugs, such as cylcosporine, methotrexate, adriamycin or cisplatinum, and immunotoxins. Pharmaceutical compositions can include“cocktails” of various cytotoxic or other agents in conjunction with the selected antibodies, receptors or binding proteins thereof of the present disclosure, or even combinations of selected peptides according to the present disclosure having different specificities, such as peptides selected using different target ligands, whether or not they are pooled prior to administration. The tricyclic peptide of the present disclosure can be made as Fc fusion proteins or as fusions with PEGS, dendrimers, or other PK enhancing domain such as albumin, etc. The route of administration of pharmaceutical compositions according to the disclosure may be any of those commonly known to those of ordinary skill in the art For therapy, including without limitation immunotherapy, the selected antibodies, receptors or binding proteins thereof of the disclosure can be administered to any patient in accordance with standard techniques. The administration can be by any appropriate mode, including parenterally, intravenously, intramuscularly, intraperitoneally, transdermally, via the pulmonary route, or also, appropriately, by direct infusion with a catheter. The dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counter indications and other parameters to be taken into account by the clinician.

The compositions containing the present peptide ligands or a cocktail thereof can be administered for therapeutic treatments. In certain therapeutic applications, an adequate amount to accomplish at least partial inhibition, suppression, modulation, killing, or some other measurable parameter, of a population of selected cells is defined as a“therapeutically-effective dose.” Amounts needed to achieve this dosage will depend upon the severity of the disease and the general state of the patient’s own immune system, but generally range from 0.005 to 5.0 mg of selected peptide per kilogram of body weight, with doses of 0.05 to 2.0 mg/kg/dose being more commonly used. For prophylactic applications, compositions containing the present peptide ligands or cocktails thereof may also be administered in similar or slightly lower dosages.

Preliminary doses as, for example, determined according to animal tests, and the scaling of dosages for human administration is performed according to art-accepted practices. Toxicity and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The data obtained from the cell culture assays or animal studies can be used in formulating a range of dosage for use in humans. Therapeutically effective dosages achieved in one animal model can be converted for use in another animal, including humans, using conversion factors known in the art (see, e.g., Freireich et al. (1966) Cancer Chemother. Reports, 50(4): 219-244). Incorporated herein by reference.

Tricyclic peptide binder and modulator of PD-1

As an example, the disclosure described herein relates to the screening for tricyclic peptide that specifically binds to PD-1, such as human PD-1, and modulates PD-1 activity. The use of such tricyclic peptides as PD-l modulators to treat cancer and autoimmune diseases is also described.

Programmed Cell Death Protein 1 (PD-l) is expressed on activated T cells and transduces inhibitory signal which antagonizes the activating T-cell receptor (TCR) and CD28 axis (Butte, Keir et al. 2007). The inhibitory signal is provided by Programmed Death Ligand 1 (PD-Ll), the ligand of PD-l, which is naturally expressed on the antigen-presenting cells (APCs) and in a variety of tissues. In physiological conditions, the binding of PD-Ll to PD-l mitigates T-cell response (Freeman, Long et al. 2000). However, the immunosuppressive function of PD-Ll is utilized by cancer cells to avoid being killed by the T cells recognizing neoantigens at their surface (Dong, Strome et al. 2002, Ahmadzadeh, Johnson et al. 2009).

PD-Ll is often overexpressed on the surface of cancer cells. Prolonged exposure to PD- Ll leads to T cell exhaustion characterized by a sustained poor effector function. Thus, it is very common that tumor tissue is infiltrated by immune cells, which recognize but are unable to eradicate the cancer cells.

Antagonizing the PD-l /PD-Ll interaction can revert the exhausted phenotype of T cells and allows efficient killing of cancer cells. This is the basis of the development of checkpoint inhibitors of PD-1/PD-L1 interaction for tumor immunotherapy (Mellman, Coukos et al. 2011). The utility of this approach has been demonstrated in clinics, and has become a spectacular success in the recent years (Chen and Flies 2013). In just 3 years the U.S. Food and Drug Administration (FDA) has approved two anti-PD-1 antibodies: nivolumab (Opdivo, Bristol- Myers Squibb) and pembrolizumab (Keytruda, Merck), and three anti-PD-Ll antibodies, atezolizumab (Tecentriq, Genentech/Roche), durvalumab (Imfinzi, AstraZeneca), and avelumab (Bavencio, EMD Serono, Inc.). This raised hope in patients suffering from cancers, which were frequently deadly prior to the introduction of checkpoint inhibitors (Wilkinson 2015, Barone, Hazarika et al. 2017).

However, antibody drugs targeting PD-l /PD-Ll interaction still have poor efficacy in solid tumors, partly due to poor tumor penetration by large biologies molecules such as antibodies. In addition, the complex and expensive process in therapeutic antibody development and manufacturing leads to high cost of such biologies drugs.

In contrast, small molecule inhibitors of PD-l /PD-Ll interaction may offer several advantages over therapeutic antibodies, including lower production costs, higher stability, improved tumor penetration, amenability for oral administration, and elimination of immunogenicity issues.

In this regard, a few compounds have been identified that bind to human PD-L1 and block its interaction with human PD-1 (Li and Tian 2018). Such small-molecule compounds were reported to be able to restore the activity of T cells by disrupting the PD-1/ PD-L1 interaction (Skalniak, Zak et al. 2017). However, development of small-molecule antagonists is lagging behind that of antibodies, primarily due to the challenge of targeting a relatively flat and highly hydrophobic PD-1/PD-L1 interaction surface (Zarganes-Tzitzikas, Konstantinidou et al. 2016).

Small molecule cyclic peptides have a number of favorite properties that make them an attractive format to be developed as checkpoint inhibitors of PD-1/PD-L1 for tumor

immunotherapy.

First, cyclic peptides can bind to macromolecular targets with high affinities due to conformation constrain as cyclic forms. They can interact with flat, featureless surfaces of proteins, whereas small molecules generally need a pocket to bind. Therefore, the tricyclic peptides of the disclosure can efficiently target protein-protein interactions exemplified by PD- 1/PD-Ll interaction. With bigger size, the subject tricyclic peptides may establish more contacts with PD-1 surface relative to typical small molecule chemical compounds, resulting in increased affinity and/or specificity.

Second, due to their still relatively small molecular weight, tricyclic peptides of the disclosure can diffuse efficiently in tissues and/or cross biological barriers that cannot be easily passed by much larger proteins, such as antibodies. These properties hold promise for efficient tumor penetration and administration via various topical routes.

Third, the small molecular weight of the subject tricyclic peptides further allows for the full chemical synthesis of these peptides. This allows for the production of a uniform product with low cost, which is often an issue for biologies that are expressed and purified from cells.

Additionally, with their amino acids makeup, peptide molecules inherently may have low or lower toxicity relative to chemical compounds, and reduced immunogenicity due to their smaller sizes compared to antibodies.

Further, the subject tricyclic peptides are more stable and resistant to protease degradation relative to linear peptides. Besides blocking PD-1/PD-L1 interaction for tumor immunotherapy, cyclic peptide binding to PD-1 can also be developed as PD-1 agonist. PD-1 and its ligands, PD-L1 and PD- L2, are critical inhibitory signalling pathways that regulate T cell response and maintain peripheral tolerance (Keir, Butte et al. 2008). There are multiple potential mechanisms by which PD-1: PD-L1 interactions might participate in the induction of allograft tolerance. PD-L1 can limit effector T cell function and expansion, as well as induce regulatory T cells, providing several means by which this pathway can tip the balance away from immunity, toward tolerance. The up-regulation of PD-1 on T cells and PD-L1 on hematopoietic and non-hematopoietic cells might serve as an important negative feedback mechanism for controlling the alloimmune response and limiting allo-specific T cell activation and proliferation against the allograft. An agonist agent would have the potential to simultaneously inhibit function of effector T cells and promote de novo T_reg generation. Such a PD-1 agonist not only could be beneficial in the prevention of allograft rejection, but also has the potential to ameliorate autoimmune diseases, allergies and inflammatory disorders.

Thus, herein described is a novel class of tricyclic peptides that specifically bind human PD-1 and modulates (e.g., either inhibits or activates) the functional activities of PD-1 in T cell activation. The described tricyclic peptides can be therapeutically administered to a subject to treat diseases or conditions that can be regulated by PD-1 activity, such as cancers and virial chronic infections by activating T cells, and inflammatory diseases by inhibiting T cell activation through PD-1 agonism.

In certain embodiments, the tricyclic peptide that specifically binds to FD-1 and modulates PD-1 activity is identified by screening a phage library displaying tricyclic peptides.

In certain embodiments, the tricyclic peptide that specifically binds to PD-1 and modulates PD-1 activity is identified by screening a library of chemically synthesized tricyclic peptides.

In certain embodiments, the tricyclic peptide is capable of specifically blocking and reducing the interaction of PD-L1 with PD-1.

In certain embodiments, the tricyclic peptide is capable of specifically neutralizing, reducing, or interfering with a functional activity of PD-L1 interaction with PD-1.

In certain embodiments, the tricyclic peptide is capable of specifically activating PD-1 signaling as a PD-1 agonist.

In certain embodiments, the PD-1 is from human, a non-human mammal or non-human primate, a rodent (e.g., rat, mouse, hamster, Guinea Pig), a rabbit, a farm or livestock mammal (e.g, pig, horse, sheep, goat, cattle, camel), a pet mammal (e.g., cat, dog), etc.

Another aspect of the disclosure provides a method of selectively modulating the activity of a T cell, the method comprising contacting the T cell with any one of the subject tricyclic peptides.

In certain embodiments, the tricyclic peptide specifically activates the T cell by blocking PD-1 activation by PD-L1.

In certain embodiments, the tricyclic peptide specifically inhibits the T cell by activating PD-1 as a PD-1 agonist.

In certain embodiments, the contacting is in vitro.

In certain embodiments, the contacting is in vivo.

The tricyclic peptide PD-1 modulator can be tested in vitro as described in the examples or in an animal model (see, generally, Immunologic Defects in Laboratory Animals, eds.

Gershwin etal., Plenum Press, 1981), for example, such as the following: the SWRX NZB (SNF1) transgenic mouse model (Uner etal. (1998) J. Autoimmune. 11 (3): 233-240), the KRN transgenic mouse (K/BXN) model (Jiet al. (1999) Immunol. Rev. 169: 139): NZBXNZW (B/W) mice, a model for SLE (Riemekasten etal. (2001) Arthritis Rheum., 44(10): 2435-2445):

experimental autoimmune encephalitis (EAE) in mouse, a model for multiple sclerosis (Tuohy et al. (1988).J. Immunol. 141: 1126-1130, Sobel etal. (1984) J. Immunol. 132: 2393-2401, and Traugott, Cell Immunol. (1989) 119: 114-129); the NOD mouse model of diabetes (Baxter et al. (1991) Autoimmunity, 9(1): 61-67), etc.). All incorporated herein by reference.

In embodiments, the tricyclic peptide that specifically binds to PD-1 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 10-56.

Methods of Use of tricyclic peptide binder and modulator of PD-1

The subject tricyclic peptide PD-1 modulators are capable of modulating the PD-1- associated immune responses. In particular embodiments, the immune response is TcR/CD28- mediated. The subject tricyclic peptides can act as either agonists or antagonists of PD-1 , depending on the method of their use. The tricyclic peptides can be used to prevent, diagnose, or treat medical disorders in mammals, especially, in humans. Peptides of the disclosure can also be used for isolating PD-1 or PD- 1 -expressing cells. Furthermore, the peptides can be used to treat a subject at risk of, or susceptible to a disorder, or having a disorder associated with aberrant PD-1 expression or function.

Tricyclic peptide PD-1 modulator of the disclosure can be used to elicit or enhance a patient’s immune response in order to treat an immune disorder or cancer. The disorders being treated or prevented by the disclosed methods include but are not limited to infections with microbes (e.g, bacteria), viruses (e.g., systemic viral infections such as influenza, Viral skin diseases Such as herpes or shingles), or parasites.

Stimulation of T cell activation with tricyclic peptide PD-1 modulator enhances T cell responses. In such cases, tricyclic peptides act as antagonists of PD-1. Thus, in some embodiments, the tricyclic peptides can be used to inhibit or reduce the down-regulatory activity associated with PD-1, i.e., the activity associated with down-regulation of TcPR/CD28-mediated immune response. In these embodiments, the peptides are not coupled to a positive signal such as the TcR-mediated Stimulation, e.g., the peptides are in their soluble, support-unbound, form. As demonstrated in the examples, a blockade of PD-1/PD-L1 interaction with antagonizing tricyclic peptide PD-1 modulator leads to enhanced T cell proliferative responses, consistent with a down-regulatory role for the PD-1 pathway in T cell response. In various embodiments, the peptides inhibit binding of PD-L1 to PD-1 with an IC₅₀ of less than 10 nM, less than 5 nM, or less than 1 nM. Inhibition of PD-L1 binding can be measured as described in examples or using techniques known in the art.

Tricyclic peptides of the disclosure can be used in methods for induction of tolerance to a specific antigen (e.g., a therapeutic protein). In one embodiment, tolerance is induced against a specific antigen by co-administration of antigen and a tricyclic peptide PD-1 modulator of the disclosure. For example, patients that received Factor V III frequently generate antibodies to this protein; co-administration of a tricyclic peptide PD-1 modulator of the disclosure in combination with recombinant Factor VIII is expected to result in the downregulation of immune responses to this clotting factor.

Tricyclic peptide PD-1 modulator of the disclosure can be used in circumstances where a reduction in the level of immune response may be desirable, for example, in certain types of allergy or allergic reactions (e.g., by inhibition of IgE production), autoimmune diseases (e.g., rheumatoid arthritis, type I diabetes mellitus, multiple sclerosis, inflammatory bowel disease, Crohn's disease, and systemic lupus erythematosis), tissue, skin and organ transplant rejection, and graft- V ersus-host disease (GVHD).

Another aspect of the disclosure provides a method for treating a PD-1 -mediated disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of any one of the subject tricyclic peptides and/or any one of the subject pharmaceutical composition to selectively modulate the activity of T cells in the subject

In certain embodiments, the PD-1 -mediated disease or disorder is a cancer, and wherein the tricyclic peptide activates the T cells by blocking PD-1 activation by PD-L1.

In certain embodiments, the PD-1 -mediated disease or disorder is a virus chronic infection, and wherein the tricyclic peptide activates the T cells by blocking PD-1 activation by PD-L1.

In certain embodiments, the PD- 1 -mediated disease or disorder is an inflammatory disease, and wherein the tricyclic peptide inhibits T cell activation by activating PD-1 as a PD-1 agonist

In certain embodiments, the PD-1 -mediated disease or disorder is an autoimmune disease, and wherein the tricyclic peptide inhibits T cell activation by activating PD-1 as a PD-1 agonist

In certain embodiments, the PD-1 -mediated disease or disorder is an allergy, and wherein the tricyclic peptide inhibits T cell activation by activating PD-1 as a PD-1 agonist.

In certain embodiments, the PD-1 -mediated disease or disorder is transplant rejection, and wherein the tricyclic peptide inhibits T cell activation by activating PD-1 as a PD-1 agonist.

In certain embodiments, the administering is subcutaneous.

In certain embodiments, the administering is intravenous.

In certain embodiments, the administering is intramuscular.

In certain embodiments, the administering is systemic.

In certain embodiments, the administering is distal to a treatment site.

In certain embodiments, the administering is local.

In certain embodiments, the administering is at or near a treatment site. Immune cells (e.g., activated T cells, B cells, or monocytes) can also be isolated from a patient and incubated ex vivo with tricyclic peptide PD-1 modulators of the disclosure. In some embodiments, immune responses can be inhibited by removing immune cells from a subject, contacting the immune cells in vitro with a tricyclic peptide PD-1 modulator of the disclosure concomitantly with activation of the immune cells (e.g., by antibodies to the TcR). In such embodiments, the tricyclic peptide should be used in a multivalent form such that PD-1 molecules on the surface of an immune cell become“crosslinked upon binding to such peptides. For example, the tricyclic peptide PD-1 modulator can be bound to solid support, such as beads, by chemical crosslinking. The immune cells may be then isolated using methods known in the art and re-implanted into the patient. Besides, the tricyclic peptide PD-1 modulators of the present disclosure may be used in combination with therapeutic immune modulation antibodies, including anti -PD-1 antibodies, anti-PD-Ll antibodies, anti-CTLA-4 antibodies, for therapeutic purpose.

In another aspect, the tricyclic peptide PD-1 modulators of the disclosure can be used as a targeting agent for delivery of another therapeutic or a cytotoxic agent (e.g, a toxin) to a cell expressing PD-1. The method includes administering a tricyclic peptide PD-1 modulator coupled to a therapeutic or a cytotoxic agent or under conditions that allow binding of the peptide to PD-1.

The tricyclic peptide PD-1 modulator of the disclosure may also be used to detect the presence of PD-1 in biological samples. The amount of PD-1 detected may be correlated with the expression level of PD-1, which, in turn, is correlated with the activation status of immune cells (e.g., activated T cells, B cells, and monocytes) in the subject Detection methods that employ peptides are well known in the art and include, for example, ELISA, radioimmunoassay, immunoblot, Western blot immunofluorescence, immunoprecipitation. The peptides may be provided in a diagnostic kit that incorporates one or more of these techniques to detect PD-1. Such a kit may contain other components, packaging, instructions, or other material to aid the detection of the protein.

Tricyclic peptide TNFa inhibitor

As an example, the disclosure described herein relates to the screening for tricyclic peptide that specifically binds to TNFa and neutralizes TNFa activity. The use of such tricyclic peptides as TNFa inhibitors to treat TNFa-related diseases is also described.

Tumor necrosis factor alpha (TNFa), originally discovered due to its antitumor cell properties, has since been shown to mediate the inflammatory response and modulate immune function (Aggarwal 2003). TNFa is produced by macrophages, immune cells and granulocytes and expressed as a membrane protein on the cell surface that is rapidly released via proteolytic cleavage by ADAM- 17. The active form of soluble TNFa is a homotrimer which signals via two receptors, TNFRI and TNFRII. While the normal functions of TNFa are beneficial,

uncontrolled excessive production of TNFa can lead to chronic disease (Feldmann, Brennan et al. 2004).

Several antibody drugs targeting TNFa have been approved and shown efficacy in multiple TNFa-related diseases. Infliximab (Remicade^®, cA2) is a chimeric antibody comprised of human light and heavy chain constant domains and murine light and heavy variable domains developed by Centocor/Janssen. Adalimumab (Humira^®, D2E7), developed by Abbott/Abbvie, is an engineered human monoclonal antibody comprised of human heavy and light chains with variable domains optimized by phage display technology. Certolizumab pegol (Cimzia^®, CDP- 870) is an antibody fragment, developed by UCB, that targets TNFa. It is a humanized Fab fragment comprised of murine heavy and light variable sequences interspliced with human variable framework sequences attached to human heavy CHI and light chain constant domains, respectively. A fourth anti-TNFa, golimumab (Simponi^®) was developed by Janssen Biotech. It is a fully human antibody generated in human antibody transgenic mice (Shealy, Cai et al. 2010). All these therapeutic antibodies have been shown to bind TNFa with high specificity and affinity, thereby neutralizing the biologic functions of TNFa. They have been approved to treat Crohn’s disease, rheumatoid arthritis, ankylosing spondylitis, psoriatic arthritis, ulcerative colitis, plaque psoriasis, and many other types of autoimmune diseases.

However, small molecule tricyclic peptide TNFa inhibitors may offer several advantages over therapeutic antibodies. Similar to therapeutic antibodies, tricyclic peptides can bind to TNFa with high affinity and specificity due to the tricyclic peptide rings interaction with multiple sites on TNFa. Tricyclic peptide TNFa inhibitors can diffuse efficiently in tissues and/or cross biological barriers that cannot be easily passed by much larger proteins, such as antibodies, due to their relatively small molecular weight. What is more, with simple chemical modification these tricyclic peptide TNFa inhibitors may be amenable for oral and topical administration, a clear advantage over antibodies. Besides, with shorter PK and easy dosing control, these tricyclic peptide TNFa inhibitors may not have the toxicity liabilities, such as risk of infection, inherited with antibody drug with prolonged inhibition of TNFa. The tricyclic peptides further allow for the full chemical synthesis, which allows for the production of a uniform product with low cost, which is often an issue for biologies that are expressed and purified from cells.

Thus, herein described is a novel class of tricyclic peptides that specifically bind human TNFa and neutralize the functional activities of TNFa. The described tricyclic peptides can be therapeutically administered to a subject to treat diseases or conditions that can be regulated by TNFa activity, including many types of inflammation diseases.

In certain embodiments, the tricyclic peptide that specifically binds to TNFa and neutralizes TNFa activity is identified by screening a phage library displaying tricyclic peptides.

In certain embodiments, the tricyclic peptide that specifically binds to TNFa and neutralizes TNFa activity is identified by screening a library of chemically synthesized tricyclic peptides.

In certain embodiments, the tricyclic peptide that specifically binds to TNFa in this disclosure is capable of blocking the binding of TNFa to its receptors.

In certain embodiments, the tricyclic peptide that specifically binds to TNFa in this disclosure can neutralize, reduce, or interfere the functional activity of TNFa to its receptors.

In certain embodiments, the tricyclic peptide that specifically binds to TNFa in this disclosure can neutralize TNFa driven reporter gene activation in reporter gene assays.

In certain embodiments, the tricyclic peptide that specifically binds to TNFa in this disclosure can neutralize TNFa driven cytotoxicity to a murine fibrosarcoma WEHI cell line in a WEHI cell-based cytotoxicity assay.

In certain embodiments, the tricyclic peptide that specifically binds to TNFa in this disclosure can neutralize TNFa driven inflammation in a Collagen antibody induced arthritis (CAIA) mouse model.

In certain embodiments, the tricyclic peptide that specifically binds to TNFa in this disclosure can neutralize TNFa driven knee joint inflammation in a human TNFa induced knee joint inflammation mouse model. In embodiments, the tricyclic peptide that specifically binds to TNFa comprises an amino acid sequence of any one of SEQ ID NO: 85-102.

Methods of Use of Tricyclic peptide TNF a inhibitor

The tricyclic peptide TNFa inhibitor in this disclosure can be used for treating an TNFa mediated disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of the tricyclic peptide TNFa inhibitor.

In certain embodiments, the TNFa mediated disease or disorder is an autoimmune/inflammatory disease which includes rheumatoid arthritis, systemic lupus

erythematosus, osteoarthritis, ankylosing spondylitis, Behcet’s Disease, gout, psoriatic arthritis, multiple sclerosis, Crohn’s colitis, small intestine enteropathy and inflammatory bowel disease.

In certain embodiments, the TNFa mediated disease or disorder is a diabetes related disease which include Type II diabetes mellitus, proliferative diabetic retinopathy, diabetic neuropathy, fulminant Type 1 diabetes.

In certain embodiments, the TNFa mediated disease or disorder is a skin disease, including wound healing, leprosy, decubitus ulcer.

In certain embodiments, the TNFa mediated disease or disorder is an eye disease, including age-related macular degeneration, retinal vasculitis, non-infectious posterior uveitis.

In certain embodiments, the TNFa mediated disease or disorder is a neurological disease, including Parkinson’s disease, polyneuropathy, sensory peripheral neuropathy, alcoholic neuropathy and sciatic neuropathy.

In certain embodiments, the TNFa mediated disease or disorder is a cancer which includes: multiple myeloma, non-small cell lung cancer, acute myeloid leukemia, female breast cancer, pancreatic cancer, colorectal cancer and peritoneum cancer.

In certain embodiments, the TNFa mediated disease or disorder is chronic hepatitis B infection, atrophic thyroiditis.

In certain embodiments, the administering is subcutaneous.

In certain embodiments, the administering is intravenous. In certain embodiments, the administering is intramuscular.

In certain embodiments, the administering is oral.

In certain embodiments, the administering is rectal.

In certain embodiments, the administering is topical.

In certain embodiments, the administering is systemic.

In certain embodiments, the administering is local.

Tricyclic peptide BCL-2 inhibitor

As an example, the disclosure described herein relates to the screening for tricyclic peptide that specifically binds to BCL-2 and inhibits BCL-2 signaling activity. The use of such tricyclic peptides as BCL-2 inhibitors to treat different types of cancer is also described.

The B cell lymphoma 2 (BCL-2) gene family encodes more than 20 proteins that regulate the intrinsic apoptosis pathway and are fundamental to the balance between cell survival and death. Anti-apoptotic BCL-2 proteins promote malignant cell survival by sequestering pro- apoptotic proteins through binding to their BH3 motifs, thus attenuating apoptosis. Following activation of the intrinsic pathway by cellular stress, pro-apoptotic BCL-2 homology 3

(BH3)-only proteins inhibit the anti-apoptotic proteins BCL-2, BCL-XL, BCL-W and myeloid cell leukaemia 1 (MCL1). The subsequent activation and oligomerization of the pro-apoptotic proteins BCL-2 antagonist killer 1 (BAK) and BCL-2-associated X protein (BAX) results in mitochondrial outer membrane permeabilization. This results in the release of cytochrome c and second mitochondria-derived activator of caspase from the mitochondria. Cytochrome c forms a complex with procaspase 9 and apoptosis protease-activating factor 1 (APAFl), which leads to the activation of caspase 9. Caspase 9 then activates procaspase 3 and procaspase 7, resulting in cell death.

As BCL-2-mediated resistance to intrinsic apoptosis is a hallmark of malignancy, targeting the anti-apoptotic BCL-2 proteins is an attractive therapeutic strategy in cancer. A combination of nuclear magnetic resonance (NMR)-based screening and structure-based drug design has yielded the first bona fide BCL-2 homology 3 (BH3) mimetics, including the BCL-2 and BCL-XL dual antagonist navitoclax (also known as ABT-263), which is the first BCL-2 family inhibitor to show efficacy in patients with cancer (Tse, Shoemaker et al. 2008). Clinical experience with navitoclax prompted the generation of the highly selective BCL-2 inhibitor venetoclax (ABT-199), which is now approved in the United States for the treatment of patients with chronic lymphocytic leukaemia with 17p deletion who have received at least one prior therapy. Because it does not target BCL-XL, ABT-199 does not reduce platelet lifespan and is therefore better tolerated than ABT-263 (Souers, Leverson et al. 2013).

However, small molecule tricyclic peptide BCL-2 inhibitors may offer several advantages over chemical compound drugs including ABT-263 and ABT-199. Similar to chemical compound, tricyclic peptide BCL-2 inhibitors can diffuse efficiently in tissues and/or cross biological barriers due to their relatively small molecular weight. With bigger size and more contacts with BCL-2 surface relative to typical smaller chemical compounds, tricyclic peptide BCL-2 inhibitors instead have the advantages of increased binding affinity and/or specificity to BCL-2 among more than 20 proteins shared with similar domain structures and homology sequences. Due to the same reason, tricyclic peptide BCL-2 inhibitors may have better specificity and efficacy in blocking BCL-2 interaction to its associated pro-apoptotic proteins. Additionally, with their amino acid makeup, peptide molecules inherently may have lower toxicity relative to chemical compounds.

Thus, herein described is a novel class of tricyclic peptides that specifically bind human BCL-2 and inhibits BCL-2 signaling activity. The described tricyclic peptides can be therapeutically administered to a subject to treat different types of cancers.

In certain embodiments, the tricyclic peptide that specifically binds to BCL-2 and neutralizes BCL-2 activity is identified by screening a phage library displaying tricyclic peptides.

In certain embodiments, the tricyclic peptide that specifically binds to BCL-2 and neutralizes BCL-2 activity is identified by screening a library of chemically synthesized tricyclic peptides.

In certain embodiments, the tricyclic peptide that specifically binds to BCL-2 in this disclosure may pass cell plasma membrane by itself or facilitated by a second agent.

In certain embodiments, the tricyclic peptide that specifically binds to BCL-2 in this disclosure is capable of blocking BCL-2 proteins binding to its pro-apoptotic binding partner proteins, including BAK and BAX.

In certain embodiments, the tricyclic peptide that specifically binds to BCL-2 in this disclosure can release BCL-2 in sequestering its pro-apoptotic binding partner proteins, including BAK and BAX.

In certain embodiments, the tricyclic peptide that specifically binds to BCL-2 in this disclosure can inhibit BCL-2-mediated anti-apoptosis.

In certain embodiments, the tricyclic peptide that specifically binds to BCL-2 in this disclosure can promote cell death in a tumor cell apoptosis assay.

In certain embodiments, the tricyclic peptide that specifically binds to BCL-2 in this disclosure have efficacy in a tumor-bearing xenograft mouse model.

In embodiments, the tricyclic peptide that specifically binds to BCL-2 comprises an amino acid sequence of any one of SEQ ID NO: 57-84.

Methods of Use of tricyclic peptide BCL-2 inhibitor

The tricyclic peptide BCL-2 inhibitor in this disclosure can be used for treating various types of cancer in a subject in need thereof, comprising administering to the subject an effective amount of the tricyclic peptide BCL-2 inhibitor.

In certain embodiments, the BCL-2 related tumor types include but is not limited to acute myeloid leukaemia (AML), chronic lymphocytic leukaemia (CLL), non-Hodgkin lymphoma (NHL), diffuse large B cell lymphoma (DLBCL) and multiple myeloma.

In certain embodiments, the administering is intravenous.

In certain embodiments, the administering is Intratumoral injection.

In certain embodiments, the administering is oral.

In certain embodiments, the administering is systemic.

In certain embodiments, the administering is local.

EXAMPLES

The following examples are provided to describe the disclosure in greater detail. They are intended to illustrate, not to limit, the disclosure.

Example 1: Construction of phage library cloning vector expressing cysteine-free pin protein

To screen for tricyclic peptide binders to protein targets, phage display was adopted as a selection technique in which a library of tricyclic peptides is expressed on the outside of a phage viron. Specifically, the tricyclic peptides were intended to display pentavalently as N-terminal fusions to the Ml 3 phage minor coat protein rIII. However, pIII protein contains three disulfide bonds which are essential to its stability but tends to be disrupted during the reduction and cyclization processes for tricyclic peptide cyclization. Therefore, the pin protein was engineered with 15 mutations to eliminate all the cysteines and also introduce compensation mutations to keep pIII protein structurally and functionally intact (Kather, Bippes et al. 2005).

Specifically, the coding sequence for the pin protein on the phage display cloning vector M13KE (New England Biolab) was modified to introduce the following 15 mutations: C7S, T13I, N15G, R29W, C36I, N39K, C46I, C53V, G55A, T101I, Q129H, Cl 88V, F199L, C201A, D209Y, and the resulting cysteine-free pIII protein sequence is as SEQ ID NO: 2. To do this, a DNA fragment encoding the mutated pIII protein with the sequence as in SEQ ID NO: 3 was synthesized and cloned into M13KE vector via Eagl and Afel sites to replace the corresponding sequence encoding the native pin protein (FIG. 6). The resulting mutated phage vector, designated as Ml 3KE- pIII-cys-free, was transformed into ER2738 electrocompetent E.coli (Lucigen) by electrotransformation to make phage with mutated pIII coat protein. The phage were propagated and phage vector Ml 3KE- pIII-cys-free was isolated.

Nucleotide sequence encoding cysteine-free pin (SEQ ID NO: 3)

The infection ability of phage with native pIII protein and with cysteine-free pIII protein was compared. It was observed that cysteine-free pIII protein only caused a minor decrease in the ability of phage in infection of E. Coli. Besides, both types of phage particles were subjected to reduction and chemical cyclization processes as described below for peptide cyclization. While the majority of phage with native pIII protein could not survive after this process, significant numbers of phage with cysteine-free pIII could survive this process and remained infectious to E. Coli, indicating that the cysteine-free pIII can be used for the construction of cyclic peptide library.

Example 2: Construction of tricyclic peptide phage display library

A tricyclic peptide phage display library was constructed based on Ml 3KE-pIII-cys-free phage vector. PCR with degenerated primers were performed to generate a library of DNA fragments that encode a semi-random peptide with the sequence AC(X)5C(X)5C(X)5C and the linker GGGS. The forward primer for this PCR is Tricyclic-F with sequence as SEQ ID NO: 4 and the reverse primer is Tricyclic-R with degenerated sequence as SEQ ID NO: 5. The PCR reaction was performed against Ml 3KE-pIII-cys-free as template using Platinum PCR supermix high fidelity (ThermoFisher) to generate the insert fragment of about 2 kb. Nucleotide sequence of PCR primer Tricyclic-F (SEQ ID NO: 4)

GCAATGACCTGATAGCCTTTGTAGA

Nucleotide sequence of PCR primer Tricyclic-R (SEQ ID NO: 5)

Another PCR reaction was performed against Ml SKE- pIII-cys-free as template using Platinum PCR supermix high fidelity (ThermoFisher) to generate the vector fragment of about 5.2 kb. The forward primer for this PCR is M13KE-E with sequence as SEQ ID NO: 6 and the reverse primer is M13KE-F with sequence as SEQ ID NO: 7.

Nucleotide sequence of PCR primer M13KE-E (SEQ ID NO: 6)

ATTCGCAATTCCTTTAGTGGTACCT

Nucleotide sequence of PCR primer M13KE-F (SEQ ID NO: 7)

CGTTCTAGCTGATAAATTAATGCC

The insert fragment and the vector fragment were cut by Bglll and Eagl enzymes, gel purified and ligated together by T4 DNA ligase (ThermoFisher) to generate a library of linear, semirandom tricyclic peptide sequences fused to the N-terminus of pin protein free of cysteine (FIG. 6). The ligated products were used to transform ER2738 E. Coli by electroporation and the transformed phage were amplified. By performing over 100 rounds of ligation-transformation, a linear peptide phage library with about 24 million independent clones were constructed.

Sequencing analysis of randomly picked phage revealed the presence of sequences coding the semi-random peptide in almost all picked phage and the peptide sequences among these clones are different. More ligation and transformation will be performed to further increase the size of the tricyclic peptide phage library. Example 3: Cyclization of the library of linear peptides displayed on pIH protein to tricyclic peptides

The linear peptides displayed on phage are chemically transformed into tricyclic form by reacting the four cysteines in each peptide with 1,2,4,5-tetrabromodurene (FIG. 7). More specifically, the cysteines were reduced by incubating the phage particles with ImM reducing agent Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) in reaction buffer with 20 mM NH4HCO3 pH 8.0 at 42 °C for 1 hour. TCEP was then removed by washing the phage with ice- cold reaction buffer with 20 mM NH4HCO3, 5mM EDTA pH 8.0 followed by filtration over a filtration device with molecular weight cut-off of 10 kDa (Amicon). The phages were then incubated with 10 mM l,2,4,5-Tetrakis(bromomethyl)benzene (Sigma) in reaction buffer with 20 mM NH4HCO3, 5mM EDTA pH 8.0 at 30°C for 1 hour to drive the cyclization of peptide on this molecular scaffold. Then the molecular scaffold was removed by precipitating the phage particles by 20% PEG/2.5 M NaCl.

The cyclization of peptides was assessed using Protein Thiol Fluorescent Detection Kit (Jhvitrogen) according to manufacture’s instructions. It was observed that free thiol level went up about four folds from the initial state after the phage particles were subjected to reduction (FIG. 8). However, after cyclization step, the free thiol level dropped to the initial level, apparently due to the reaction of free thiol of the reduced cysteine to the molecular scaffold. This data demonstrated the cyclization of tricyclic peptide on the phage after the reduction and cyclization chemical reaction processes.

Example 4: Screening of tricyclic peptide phage display library for PD-1 binder

Recombinant human PD-1 with His tag (R&D Systems) was employed as the antigen for phage library screening. The overall panning process was illustrated in FIG. 5. 2x10⁹ tricyclic peptide phage library and 4 ug His-tagged PD-1 antigen were incubated in binding buffer (TBS,

0.1% Tween20, 30mM imidazole) at room temperature for 60 minutes. HisPur Ni-NTA

Magnetic Beads (ThermoFisher) were suspended in 1ml blocking buffer (TBS, 0.1% Tween20,

30mM imidazole, 5mg/ml BSA) for 60 minutes. Then the blocked beads were added to the phage library and antigen complex for 60 minutes. After washing the beads 10 times with washing buffer (TBS, 0.1% Tween20, 50mM imidazole), the phage bound on the beads were eluted in elution buffer (TBS, 0.1% Tween20, 250mM imidazole). The eluted phages were titered, amplified, then cyclized for next round of panning with increased stringency. Totally three rounds of panning were performed in order to identify tricyclic peptide binder for PD-1.

Example 5: Screening of tricyclic peptide phage display library for TNFa binder

Recombinant human TNFa as biotinylated protein (R&D Systems) was employed as the antigen for phage library screening. The overall panning process was illustrated in FIG. 5. 2x10⁹ tricyclic peptide phage library and 2.5 ug biotinylated TNFa antigen were incubated in binding buffer (TBS, 0.1% Tween20) at room temperature for 60 minutes. Streptavidin-coated magnetic beads (ThermoFisher) were suspended in 1ml blocking buffer (TBS, 0.1% Tween20, 5 mg/ml BSA) for 60 minutes. Then the blocked beads were added to the phage library and antigen complex for 60 minutes. After washing the beads 10 times with washing buffer (TBS, 0.1% Tween20), the phage bound on the beads were eluted in elution buffer (0.2 M Glycine-HCl, pH 2.2, 1 mg/ml BSA).

The eluted phages were titered, amplified, then cyclized for next round of panning with increased stringency. Totally three rounds of panning were performed in order to identify tricyclic peptide binder for TNFa.

Example 6: Screening of tricyclic peptide phage display library for BCL-2 binder

Recombinant human BCL-2 with His tag (R&D Systems) was employed as the antigen for phage library screening. The overall panning process was illustrated in FIG. 5. 2x10⁹ tricyclic peptide phage library and 4 ug His-tagged BCL-2 antigen were incubated in binding buffer (TBS, 0.1% Tween20, 3GmM imidazole) at room temperature for 60 minutes. HisPur Ni- NTA Magnetic Beads (ThermoFisher) were suspended in 1ml blocking buffer (TBS, 0.1% Tween20, 30mM imidazole, 5mg/ml BSA) for 60 minutes. Then the blocked beads were added to the phage library and antigen complex for 60 minutes. After washing the beads 10 times with washing buffer (TBS, 0.1% Tween20, 50mM imidazole), the phage bound on the beads were eluted in elution buffer (TBS, 0.1% Tween20, 250mM imidazole).

The eluted phages were titered, amplified, then cyclized for next round of panning with increased stringency. Totally three rounds of panning were performed in order to identify tricyclic peptide binder for BCL-2.

Example 7 Sequencing tricyclic peptide binder hits by Next Generation Sequencing

After 2 or 3 rounds panning and phage amplification, tricyclic peptides specifically binding to the target antigens should be enriched and become dominated in the hits population. For a comprehensive analysis of the sequences of identified hits, the tricyclic peptide sequences from eluted phage from Round 2 and Round 3 of panning for the three example targets were amplified by PCR and subjected to next generation sequencing (NGS). The forward primer Ml 3KE-Amplicon-F with sequence as SEQ ID NO: 8 and the reverse primer Ml 3KE- Amplicon- R with sequence as SEQ ID NO: 9 were used in PCR to amplify the region on phage vector encoding the tricyclic peptide (273bp). The heterogeneous PCR products were subjected to Amplicon sequencing to deduce tricyclic peptide hit sequences using Amplicon-EZ, a streamlined NGS sequencing service provided by GENEWIZ (NJ, USA).

Nucleotide sequence of PCR primer M13KE-Amplicon-F (SEQ ID NO: 8)

CACCTCGAAAGCAAGCTGATA

Nucleotide sequence of PCR primer M13KE-Amplicon-R (SEQ ID NO: 9)

TTGTCGTCTTTCCAGACGTTAG

After NGS, paired-end reads were analysed using NGS statistical analysis programming language R to obtain their quality scores. Only peptide hits with high quality reads were selected. The tricyclic peptide sequences of the sequenced hits were compared to each other for consensus sequences and ranked according to their frequencies in the population. The most frequent peptides were aligned, and specific consensus peptide residues or motifs were identified.

Table 2 summarized the peptide read count after the second and third round of panning of each target: total and quality sequencing reads; number of total peptides; number of unique peptide; and number of peptides having ³10, ³100, or ³1000 repeats in the population. For all these three target proteins, it was observed that target-specific peptides got enriched with a decrease in the number of unique peptides and an increase of high frequency peptides from round 2 to round 3 panning.

Table 2: read count matrix of sequenced peptide hits after round 2 and 3 panning

For both PD-1 and BCL-2, panning were conducted using nickle magnetic beads to capture His-tagged antigens. Peptide hits after round 3 panning with multiple histidines in the sequence were considered as non-specific binder and discarded. The remaining hits from both panning were rank ordered by repeats in the population and compared. Table 3 lists the candidate PD-1 binder hits with repeats from round 3 PD-1 panning at least 5-fold more than that from round 3 BCL-2 panning. Table 4 lists the candidate BCL-2 binder hits with repeats from round 3 BCL-2 panning at least 5-fold more than that from round 3 PD-1 panning.

Table 3: Candidate PD-1 binder hits and their repeats number in round 3 PD-1 panning vs. round 3 BCL-2 panning

Table 4: Candidate BCL-2 binder hits and their repeats number in round 3 BCL-2 panning vs. round 3 PD-1 panning

For TNFa, panning was conducted using streptavidin magnetic beads to capture biotinylated antigens. The motif His-Pro-Gln (HPQ) is a well-known streptavidin binding motif so peptide hits after round 3 panning with HPQ in the sequence were considered as non-specific binder and discarded. The remaining TNFa hits were rank ordered by repeats in the population and their sequences were aligned as shown in FIG. 9. It was observed that these candidate TNFa hits have multiple consensus amino acids within all three loops of tricyclic peptide sequences. The sequences of the TNFa hits are also provided in Table 5.

Table 5. TNFa binder hits

Example 8 Confirmation of binding to target proteins by identified tricyclic peptide hits

A phage ELISA binding assay was used to rapidly determine whether the eluted phages after round 3 panning could specifically bind to target proteins. In this assay, the target proteins PD-1, TNFa or BCL-2 were coated on 96- well plate overnight. Then the eluted phages after round 3 panning were applied to the plate and bound phage were detected with an anti-M13 antibody (anti-Ml 3-HRP conjugate, Sino Biological).

It was observed that phage panned with PD-1 showed greater binding affinity to PD-1 than the control phage panned with BCL-2, suggesting that the eluted phages after round 3 panning against PD-1 contains phage that specifically bind to PD-1 (FIG. 10). Similarly, the eluted phage after round 3 panning against TNFa or BCL-2 had greater binding affinity to TNFa or BCL-2, respectively, relative to phage from control panning.

Beside ELISA binding assay with pooled phage, the binding of phage with specific tricyclic peptide sequence will also be evaluated in a similar assay. Furthermore, the candidate tricyclic peptide will be chemically synthesized and cyclized, and its binding to the target protein will be assessed in ELISA binding assays.

Example 9: Evaluation tricyclic peptide PD-1 binder on blocking of PD-1/PD-L1

interaction

The ability of candidate tricyclic peptide PD-1 binders to inhibit PD-Ll/PD-1 interaction will be evaluated by ELISA-based binding assay. Briefly, recombinant human PD-1 protein is immobilized on 96- well plate. Recombinant human PD-L1 Fc chimera protein along with increasing amount of tricyclic peptide PD-1 binders will be applied and the blocking PD-L1 binding to immobilized PD-1 by tricyclic peptide PD-1 binders is evaluated.

The ability of candidate tricyclic peptide PD-1 binders to inhibit PD-Ll/PD-1 interaction will also be evaluated by flow cytometry-based binding assay. Recombinant human PD-L1 Fc chimera protein along with increasing amount of tricyclic peptide PD-1 binders will be applied to cells expressing human PD-1. The interference of PD-L1 binding to cell surface PD-1 by tricyclic peptide PD-1 binders is quantitated by flow cytometry analysis.

To evaluate the functional effects of tricyclic peptide PD-1 binder in the inhibition of the PD-1/PD-L1 interactions, a reporter cell-based T cell activation assay developed by Promega will be employed. Briefly, increasing amounts of tricyclic peptide PD-1 binder will be applied to artificial Antigen-Presenting Cells (APCs) overexpressing TCR ligand and PD-L1, and modified Jurkat reporter T cells overexpressing PD-1 and carrying a luciferase reporter under the control of TCR-inducible NFAT promoter. The functional effects of tricyclic peptide in the

antagonization of the inhibitory effect of PD-1/PD-L1 on reporter gene expression can be evaluated.

Alternatively, a mixed lymphocyte reaction (MLR) assay will be set up by co-culturing purified CD4+ T cells with allogeneic dendritic cells in the presence of tricyclic peptide PD-1 binder (Wang, Thudium et al. 2014). The increased release of IFNy in the supernatant due to blocking of PD-Ll/PD-1 interaction will be quantitated by ELISA.

The functional effects of tricyclic peptide PD-1 binder in the inhibition of the PD-l/PD- L1 interactions will also be evaluated by a suppression assay with regulatory T cells.

CD4+CD25+ regulatory T cells (Tregs) and CD4+CD25- responder T cells will be purified from PBMCs by Treg isolation kit from Miltenyi Biotec (Wang, Thudium et al. 2014). In an MLR assay, Tregs will be co-cultured with responder T cells and DC cells, along with increasing amount of tricyclic peptide PD-1 binder. After 5 days, the increased release of IFNy in the supernatant due to blockade of PD-Ll/PD-1 interaction will be quantitated by ELISA.

Example 10: Evaluation functional activity of tricyclic peptide TNFa inhibitor

A HEK-Blue reporter cell line (Invivogen) can respond to TNFa stimulation by triggering a signalling cascade leading to the activation of NF-kB, and the subsequent production of a secreted embryonic alkaline phosphatase (SEAT) by activating the SEAP reporter gene expression. A HEK-Blue reporter assay will be employed to evaluate tricyclic peptide TNFa inhibitor in blocking reporter gene expression driven by TNFa. Increasing amounts of tricyclic peptide TNFa inhibitor along with TNFa will be applied to HEK-Blue reporter cells. After overnight incubation, the SEAP reporter gene expression will be quantitated.

TNFa has cytotoxicity effect on a murine fibrosarcoma WEHI cell line. A WEHI cell- based cytotoxicity assay will be developed to assess the effects of tricyclic peptide TNFa inhibitor on the neutralization of TNFa-mediated cytotoxicity. In this assay, increasing amounts of tricyclic peptide TNFa inhibitor will be applied to WEHI cells along with 10 ng/mL TNFa. The cytotoxicity of WEHI cells will be quantitated by MTT assay.

The in vivo efficacy of tricyclic peptide TNFa inhibitor in inflammation will be evaluated in a collagen antibody induced arthritis (CAIA) model (Moore, Allden et al. 2014). CAIA model will be established through the administration of an anti-collagen monoclonal antibody cocktail and the subsequent administration of lipopolysaccharide (LPS). CAIA is characterized by inflammation, pannus formation and bone erosions similar to those observed in RA. The CAIA pathology has been reported to be TNFa dependent, while blockade with anti-TNFa antibody has been shown to ameliorate the pathology (Bendele, Chlipala et al. 2000).

A mouse model of knee joint inflammation will also be developed to evaluate the in vivo model will be induced upon continuous secretion of human TNFa from transfected mouse NIH3T3 cells injected into one of the knee joints, since human TNFa can activate cognate mouse TNFa receptors to induce inflammation. The tricyclic peptide TNFa inhibitor will be dosed to mice prior to the injection of NIH3T3 cells expressing human TNFa into the knee joint and the efficacy of tricyclic peptide on knee joint swollen will be observed.

Example 11: Evaluation of functional activity of tricyclic peptide BCL-2 inhibitor

The ability of candidate tricyclic peptide BCL-2 binders to inhibit BCL-2 binding to proapoptotic proteins will be evaluated by mammalian two hybrid system (Tse, Shoemaker et al. 2008). Briefly, BCL-2 can be used as the bait protein while pro-apoptotic proteins such as BIM can be used as the prey. The ability of tricyclic peptide BCL-2 binders in disrupting BCL-2 interaction with BIM will be evaluated by the two hybrid system.

Mouse FL5.12 cells engineered with BCL-2 (FL5.12-BCL-2 cells) depend on BCL-2 for survival in the absence of IL-3. This cell line will be used to evaluate the functional effects of tricyclic peptide BCL-2 inhibitor in promoting apoptosis. The tricyclic peptide BCL-2 inhibitor will be applied to FL5.12-BCL-2 cells and their effects on promoting cell death will be evaluated. Similar cell cytotoxicity assays can be performed using BCL-2-dependent acute lymphoblastic leukemia (ALL) cell line RS4;11 or SCLC cell line HI 46.

To study the in vivo activity of tricyclic peptide BCL-2 inhibitor, xenograft mouse tumor models will be established by implanting mouse with BCL-2-dependent acute lymphoblastic leukemia (ALL) cell line RS4;1 1 or SCLC cell line HI 46. Tricyclic peptide BCL-2 inhibitors will be dosed to the mice and the regression of implanted tumors will be observed.

REFERENCES

Aggarwal, B. B. (2003). "Signalling pathways of the TNF superfamily: a double-edged sword." Nat Rev Immunol 3(9): 745-756. Ahmadzadeh, M, L. A. Johnson, B. Heemskerk, J. R Wunderlich, M. E. Dudley, D. E. White and S. A. Rosenberg (2009). "Tumor antigen-specific CDS T cells infiltrating the tumor express high levels of PD-1 and are functionally impaired." Blood 114(8): 1537-1544.

Barone, A., M Hazarika, M R Theoret, P. Mishra-Kalyani, H. Chen, K. He, R Sridhara, S. Subramaniam, E. Pfuma, Y. Wang, H. Li, H. Zhao, J. F. Zirkelbach, P. Keegan and R Pazdur (2017). "FDA Approval Summary: Pembrolizumab for the Treatment of Patients with

Unresectable or Metastatic Melanoma." Clin Cancer Res 23(19): 5661-5665.

Bendele, A. M, E. S. Chlipala, J. Scherrer, J. Frazier, G. Sennello, W. J. Rich and C. K.

Edwards, 3rd (2000). "Combination benefit of treatment with the cytokine inhibitors interleukin- 1 receptor antagonist and PEGylated soluble tumor necrosis factor receptor type I in animal models of rheumatoid arthritis." Arthritis Rheum 43(12): 2648-2659.

Butte, M J., M. E. Keir, T. B. Phamduy, A. H. Sharpe and G. J. Freeman (2007). "Programmed death- 1 ligand 1 interacts specifically with the B7-1 costimulatory molecule to inhibit T cell responses." Immunity 27( 1): 111-122.

Chen, L. and D. B. Flies (2013). "Molecular mechanisms of T cell co-stimulation and coinhibition." Nat Rev Immunol 13(4): 227-242.

Dong, H., S. E. Strome, D. R Salomao, H. Tamura, F. Hirano, D. B. Flies, P. C. Roche, J. Lu, G. Zhu, K. Tamada, V. A. Lennon, E. Celis and L. Chen (2002). "Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion." Nat Med 8(8): 793-800. Feldmann, M, F. M Brennan, E. Paleolog, A. Cope, P. Taylor, R Williams, J. Woody and R. N. Maini (2004). " Anti-TNFalpha therapy of rheumatoid arthritis: what can we learn about chronic disease?" Novartis Found Svmp 256: 53-69; discussion 69-73, 106-1 11, 266-109.

Freeman, G. J., A. J. Long, Y. Iwai, K. Bourque, T. Chernova, H. Nishimura, L. J. Fitz, N.

Malenkovich, T. Okazaki, M C. Byme, H. F. Horton, L. Fouser, L. Carter, V. Ling, M. R Bowman, B. M Carreno, M Collins, C. R Wood and T. Honjo (2000). "Engagement of the PD- 1 immunoinhibitory receptor by a novel B7 family member leads to negative regulation of lymphocyte activation." J Exp Med 192(7): 1027-1034.

Heinis, C., T. Rutherford, S. Freund and G. Winter (2009). "Phage-encoded combinatorial chemical libraries based on bicyclic peptides." Nat Chem Biol 5(7): 502-507.

Kather, L, C. A. Bippes and F. X. Schmid (2005). "A stable disulfide-free gene-3-protein of phage fd generated by in vitro evolution." J Mol Biol 354(3): 666-678. Keir, M. E., M J. Butte, G. J. Freeman and A. H. Sharpe (2008). "PD-1 and its ligands in tolerance and immunity." Annu Rev Immunol 26: 677-704.

Li, K. and H. Tian (2018). "Development of small-molecule immune checkpoint inhibitors of PD-1ZPD-L1 as a new therapeutic strategy for tumour immunotherapy." J Drue Target: 1-13. Mellman, I., G. Coukos and G. Dranoff (2011). "Cancer immunotherapy comes of age." Nature 480(7378): 480-489.

Moore, A. R, S. Allden, T. Bourne, M. C. Denis, K. Kranidioti, R Okoye, Y. Sotsios, Z.

Stencel, A. Vugler, G. Watt and S. Shaw (2014). "Collagen P antibody-induced arthritis in Tgl278TNFko mice: optimization of a novel model to assess treatments targeting human TNFalpha in rheumatoid arthritis." J Transl Med 12: 285.

Richelle, G. J. J., S. Ori, H. Hiemstra, J. H. van Maarseveen and P. Timmerman (2018). "General and Facile Route to Isomerically Pure Tricyclic Peptides Based on Templated Tandem

CLIPS/CuAAC Cyclizations." Aneew Chem Int Ed Enel 57(2): 501-505.

Shealy, D. J., A. Cai, K. Staquet, A. Baker, E. R Lacy, L. Johns, O. Vafa, G. Gunn, 3rd, S. Tam, S. Sague, D. Wang, M Brigham-Burke, P. Dalmonte, E. Emmell, B. Pikounis, P. J. Bugelski, H. Zhou, B. J. Scallon and J. Giles-Komar (2010). " Characterization of golimumab, a human monoclonal antibody specific for human tumor necrosis factor alpha." MAbs 2(4): 428-439. Skalniak, L, K. M Zak, K. Guzik, K. Magiera, B. Musielak, M Pachota, B. Szelazek, J. Kocik, P. Grudnik, M Tomala, S. Krzanik, K. Pyre, A. Domling, G. Dubin and T. A. Holak (2017). "Small-molecule inhibitors of PD-1/PD-L1 immune checkpoint alleviate the PD-L1 -induced exhaustion of T-cells." Oncotareet 8(421: 72167-72181.

Souers, A. J., J. D. Leverson, E. R Boghaert, S. L. Ackler, N. D. Catron, J. Chen, B. D. Dayton, H. Ding, S. H. Enschede, W. J. Fairbrother, D. C. Huang, S. G. Hymowitz, S. Jin, S. L. Khaw, P. J. Kovar, L. T. Lam, J. Lee, H. L. Maecker, K. C. Marsh, K. D. Mason, M. J. Mitten, P. M Nimmer, A. Oleksijew, C. H. Park, C. M Park, D. C. Phillips, A. W. Roberts, D. Sampath, J. F. Seymour, M. L. Smith, G. M Sullivan, S. K. Tahir, C. Tse, M. D. Wendt, Y. Xiao, J. C. Xue, H. Zhang, R A. Humerickhouse, S. H. Rosenberg and S. W. Elmore (2013). "ABT-199, a potent and selective BCL-2 inhibitor, achieves antitumor activity while sparing platelets." Nat Med 19(2): 202-208.

Tse, C., A. R Shoemaker, J. Adickes, M G. Anderson, J. Chen, S. Jin, E. F. Johnson, K. C. Marsh, M J. Mitten, P. Nimmer, L. Roberts, S. K. Tahir, Y. Xiao, X. Yang, H. Zhang, S. Fesik, S. H. Rosenberg and S. W. Elmore (2008). "ABT-263: a potent and orally bioavailable Bcl-2 family inhibitor." Cancer Res 68(91: 3421-3428.

Wang, C., K. B. Thudium, M Han, X. T. Wang, H. Huang, D. Feingersh, C. Garcia, Y. Wu, M. Kuhne, M. Srinivasan, S. Singh, S. Wong, N. Gamer, H. Leblanc, R T. Bunch, D. Blanset, M. J. Selby and A. J. Korman (2014). "In vitro characterization of the anti-PD-1 antibody nivolumab, BMS-936558, and in vivo toxicology in non-human primates." Cancer Immunol Res 2(9): 846-

856.

Wilkinson, E. (2015). "Nivolumab success in untreated metastatic melanoma." Lancet Oncol 16(1): e9.

Zarganes-Tzitzikas, T., M. Konstantinidou, Y. Gao, D. Krzemien, K. Zak, G. Dubin, T. A. Holak and A. Domling (2016). "Inhibitors of programmed cell death 1 (PD-1): a patent review (2010- 2015)." Expert Opin Ther Pat 26(91: 973-977.

Zha, M, P. Lin, H. Yao, Y. Zhao and C. Wu (2018). "A phage display-based strategy for the de novo creation of disulfide-constrained and isomer-free bicyclic peptide affinity reagents." Chem Commun (Camb) 54(32): 4029-4032.

All references cited herein, including the entire disclosures of these references / publications, and all patents, patent application publications and books referred to herein, are hereby incorporated by reference in their entirety into the subject application.

Claims

WE CLAIM:

1. A tricyclic peptide covalently linked to a molecular scaffold and comprising the amino acid sequence:

a. wherein:

i. each of Y1 -Y4 independently represents an amino acid with a reactive group covalently linked to the molecular scaffold, ii. each of XI -X5 independently represents a random amino acid residue or a random polypeptide,

iii. k, m, and n are independently integers between 3 and 10, iv. 1 and o are independently integers between 0 and 20, and, b. wherein the tricyclic peptide is capable of specifically binding to a target protein.

2. A tricyclic peptide capable of being covalently linked to a molecular scaffold, said

tricyclic peptide comprising the amino acid sequence:

a. wherein:

i. each of Y1 -Y4 independently represents an amino acid with a reactive group capable of being covalently linked to the molecular scaffold, ii. each of XI -X5 independently represents a random amino acid residue or a random polypeptide,

iii. k, m, and n are independently integers between 3 and 10, iv. 1 and o are independently integers between 0 and 20, and, b. wherein the tricyclic peptide, after being covalently linked to the molecular

scaffold, is capable of specifically binding to a target protein.

3. The tricyclic peptide of claim 1 or 2, wherein said amino acid sequence comprises one or more non-natural amino acid substituents, and/or is resistant to protease degradation.

4. The tricyclic peptide of any one of claims 1-3, wherein said reactive group(s) comprise the thiol group of cysteine, or an azide group from Fmoc azido amino acids.

5. The tricyclic peptide of any one of claims 1-4, wherein the molecular scaffold is a

tetravalent scaffold forming (or capable of forming) a covalent bond with a thiol group of the amino acid sequence through a benzyl bromide moiety, and/or forming (or capable of forming) a covalent bond with an azide group of the amino acid sequence through an alkyne moiety.

6. The tricyclic peptide of any one of claims 1 -5, wherein the molecular scaffold is a

tetravalent scaffold forming (or capable of forming) four covalent bonds with said amino acid sequence through four benzyl bromide moieties.

7. The tricyclic peptide of claim 6, wherein said molecular scaffold is 1,2,4, 5- tetrabromodurene.

8. The tricyclic peptide of any one of claims 1-5, wherein the molecular scaffold is a

tetravalent scaffold forming (or capable of forming) two covalent bonds with the amino acid sequence through two benzyl bromide moieties, and two covalent bonds with the amino acid sequence through two alkyne moieties.

9. The tricyclic peptide of any one of claims 1-8, wherein the covalent bond between the thiol group and the benzyl bromide moiety is formed via chemical linkage of peptides onto scaffolds (CLIPS).

10. The tricyclic peptide of any one of claims 1-5 and 8, wherein the covalent bond between the azide group and the alkyne moiety is formed via copper-catalyzed azide-alkyne cyclization (CuAAC).

11. The tricyclic peptide of any one of claims 1-10, wherein said tricyclic peptide specifically binds to a target protein.

12. The tricyclic peptide of any one of claims 1-11, wherein said tricyclic peptide that

specifically binds to a target protein is identified by construction of a phage library displaying tricyclic peptides and screening said phage library for tricyclic peptides binding to the target protein.

13. The tricyclic peptide of any one of claims 1-11, wherein said tricyclic peptide that

specifically binds to a target protein is identified by construction and screening a library of chemically synthesized tricyclic peptides.

14. The tricyclic peptide of claims 11-13, wherein said target protein is Programmed Cell Death Protein 1 (PD-l) and said tricyclic peptide specifically binds to PD-1 is tricyclic peptide PD-1 binder.

15. The tricyclic peptide of claim 14, wherein said tricyclic peptide PD-1 binder is capable of specifically blocking and reducing the interaction of PD-L1 with PD-1.

16. The tricyclic peptide of claim 14, wherein said tricyclic peptide PD-1 binder is capable of specifically neutralizing, reducing, or interfering with a functional activity of PD-L 1 interaction with PD-1.

17. The tricyclic peptide of claim 14, wherein said tricyclic peptide PD-1 binder is capable of specifically activating PD-1 signaling as a PD-1 agonist

18. A method of selectively modulating the activity of a T cell, the method comprising

contacting the T cell with the tricyclic peptide PD-1 binder of any one of claims 14-17.

19. The method of claim 18, wherein the tricyclic peptide PD-1 binder specifically activates the T cell by blocking PD-1 activation by PD-L1.

20. The method of claim 18, wherein the tricyclic peptide PD-1 binder specifically inhibits the T cell by activating PD-1 as a PD-1 agonist.

21. A pharmaceutical composition comprising the tricyclic peptide PD-1 binder of any one of claims 14-20, and a pharmaceutical acceptable carrier.

22. A method for treating a PD-1 -mediated disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of the tricyclic peptide PD-1 binder of any one of claims 14-20 and/or the pharmaceutical composition of claim 21 to selectively modulate the activity of T cells in the subject

23. The method of claim 22, wherein the PD-1 -mediated disease or disorder is a cancer or a chronic viral infection, and wherein the tricyclic peptide PD-1 binder activates the T cells by blocking PD-1 activation by PD-L1.

24. The method of claim 22, wherein the PD-1 -mediated disease or disorder is an

inflammatory disease, autoimmune disease, allergy or transplant rejection, and wherein the tricyclic peptide PD-1 binder inhibits T cell activation by activating PD-1 as a PD-1 agonist.

25. The tricyclic peptide of any one of claims 11-13, wherein said target protein is Tumor Necrosis Factor alpha (TNFa) and said tricyclic peptide specifically binds to TNFa is tricyclic peptide TNFa binder.

26. The tricyclic peptide of claim 25, wherein said tricyclic peptide TNFa binder is capable of specifically blocking the binding of TNFa to its receptors.

27. The tricyclic peptide of claim 25, wherein said tricyclic peptide TNFa binder is capable of specifically neutralizing, reducing, or interfering with a functional activity of TNFa.

28. The tricyclic peptide of claim 25, wherein said tricyclic peptide TNFa binder is capable of specifically neutralizing the TNFa-driven reporter gene activation in reporter gene assays.

29. The tricyclic peptide of claim 25, wherein said tricyclic peptide TNFa binder is capable of specifically neutralizing the TNFa-driven cytotoxicity to a murine fibrosarcoma WEHI cell line in a WEHI cell-based cytotoxicity assay.

30. The tricyclic peptide of claim 25, wherein said tricyclic peptide TNFa binder is capable of specifically neutralizing the TNFa-driven inflammation in a Collagen antibody induced arthritis (CAIA) mouse model.

31. The tricyclic peptide of claim 25, wherein said tricyclic peptide TNFa binder is capable of specifically neutralizing the TNFa-driven knee joint inflammation in a human TNFa induced knee joint inflammation mouse model.

32. A pharmaceutical composition comprising the tricyclic peptide TNFa binder of any one of claims 25-31, and a pharmaceutical acceptable carrier.

33. A method for treating a TNFa-mediated disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of the tricyclic peptide TNFa binder of any one of claims 25-31 and/or the pharmaceutical composition of claim 32 to selectively neutralize TNFa activity in the subject.

34. The method of claim 33, wherein the TNFa-mediated disease or disorder is an auto- immune/inflammatory disease, diabetes related disease, skin disease, eye disease, neurological disease or a cancer, and wherein the tricyclic peptide TNFa binder neutralizes TNFa activity.

35. The tricyclic peptide of any one of claims 11-13, wherein said target protein is B-cell lymphoma 2 (BCL-2) and said tricyclic peptide specifically binds to BCL-2 is tricyclic peptide BCL-2 binder.

36. The tricyclic peptide of claim 35, wherein said tricyclic peptide BCL-2 binder is capable of passing cell plasma membrane by itself or facilitated by a second agent.

37. The tricyclic peptide of claim 35, wherein said tricyclic peptide BCL-2 binder is capable of specifically blocking BCL-2 proteins binding to its pro-apoptotic binding partner proteins.

38. The tricyclic peptide of claim 35, wherein said tricyclic peptide BCL-2 binder is capable of specifically releasing BCL-2 in sequestering its pro-apoptotic binding partner proteins.

39. The tricyclic peptide of claim 35, wherein said tricyclic peptide BCL-2 binder is capable of inhibiting BCL-2 signaling activity.

40. The tricyclic peptide of claim 35, wherein said tricyclic peptide BCL-2 binder is capable of specifically inhibiting BCL-2-mediated anti-apoptosis.

41. The tricyclic peptide of claim 35, wherein said tricyclic peptide BCL-2 binder is capable of specifically promoting cell death in a tumor cell apoptosis assay.

42. The tricyclic peptide of claim 35, wherein said tricyclic peptide BCL-2 binder is capable of specifically inhibiting tumor growth in a tumor-bearing xenograft mouse model.

43. A pharmaceutical composition comprising the tricyclic peptide BCL-2 binder of claim 35, and a pharmaceutical acceptable carrier.

44. A method for treating a BCL-2-mediated disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of the tricyclic peptide BCL- 2 binder of any one of claims 35-42 and/or the pharmaceutical composition of claim 43 to selectively neutralize BCL-2 activity in the subject.

45. The method of claim 44, wherein the BCL-2-mediated disease or disorder is a cancer.

46. The method of claim 45, wherein the cancer is selected from the group consisting of acute myeloid leukaemia (AML), chronic lymphocytic leukaemia (CLL), non-Hodgkin lymphoma (NHL), diffuse large B cell lymphoma (DLBCL) and multiple myeloma; and wherein the tricyclic peptide BCL-2 binder inhibits BCL-2 signaling activity.

47. The tricyclic peptide of any one of claims 1-10, wherein said tricyclic peptide forms a part of a Fc fusion protein or a fusion with PEGS, dendrimers, or other PK enhancing domain.