WO2020260870A1 - Inhibiteur d'exd2 pour le traitement du cancer - Google Patents

Inhibiteur d'exd2 pour le traitement du cancer Download PDF

Info

Publication number
WO2020260870A1
WO2020260870A1 PCT/GB2020/051522 GB2020051522W WO2020260870A1 WO 2020260870 A1 WO2020260870 A1 WO 2020260870A1 GB 2020051522 W GB2020051522 W GB 2020051522W WO 2020260870 A1 WO2020260870 A1 WO 2020260870A1
Authority
WO
WIPO (PCT)
Prior art keywords
exd2
cancer
inhibitor
cells
deficient
Prior art date
Application number
PCT/GB2020/051522
Other languages
English (en)
Inventor
Wojciech NIEDZWIEDZ
Original Assignee
The Institute Of Cancer Research: Royal Cancer Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Institute Of Cancer Research: Royal Cancer Hospital filed Critical The Institute Of Cancer Research: Royal Cancer Hospital
Publication of WO2020260870A1 publication Critical patent/WO2020260870A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/194—Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57449—Specifically defined cancers of ovaries
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57496—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving intracellular compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention relates to the field of cancer.
  • patient selection methods and methods of treating cancers that employ a synthetic lethality approach whereby cancers which are deficient in homologous recombination (HR) are preferentially killed when treated with an agent capable of inhibiting EXD2.
  • the invention also provides methods for screening for EXD2 inhibitors for use in the methods of treatment of the invention.
  • Synthetic lethality refers to a situation when a combined deficiency in two or more genes leads to cell death, whereas a deficiency in only one of these does not.
  • synthetic lethality provides an approach that can allow the precise killing of a specific subgroup of cells, such as cancer cells, based on their genetic make-up.
  • tumour development This is often associated with an inactivation of one or more DNA repair pathways, making cancer cells highly reliant on the so-called“back up” DNA repair pathways to survive.
  • This tumour vulnerability can be exploited therapeutically, through identification of synthetic lethal (essential) interactions within the DNA repair mechanisms, to selectively kill tumour cells and spare non-malignant cells.
  • BRCA1 or 2 mutations components of the homologous recombination DNA repair pathway (HR)) and poly(ADP-ribose) polymerase (PARP), whereby a PARP inhibitor (such as olaparib) can be used to target and kill tumour cells that have a deficiency in HR (such as BRCA1 or 2 mutation) (e.g. breast or ovarian cancers positive for BRCA1 or BRCA2 mutation).
  • HR homologous recombination DNA repair pathway
  • PARP poly(ADP-ribose) polymerase
  • EXD2 exonuclease
  • HR homology directed repair
  • Alt-EJ alternative-end joining pathway
  • EXD2 is synthetic lethal with RIF1 protein.
  • Rif1 is a member of 53BP1/RIF1/REV7/Shieldin 1 , 2 and 3 protein complex (BRRES complex) that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini (thus antagonising HR) and promoting non- homologous end joining pathway of DSB repair (NHEJ).
  • BRRES complex 53BP1/RIF1/REV7/Shieldin 1 , 2 and 3 protein complex
  • This function requires interactions of 53BP1 with RIF1 (also known as MAD2L2), and subsequent recruitment of other components of this protein complex, e.g. REV7/Shieldin 1/2/3.
  • depletion/deletion is in various BRCA-mutant cancers (e.g. breast, ovarian, prostate, etc), as well as BRCA tumours that developed resistance to treatment with PARP inhibitors either via restoration of BRCA1/2 expression or inactivation of one of the components of the 53BP1 protein complex (a protein complex consisting of
  • targeting EXD2 might be either superior to the use of PARP inhibitors (single agent), or could be used in combination with existing PARP inhibitors to increase the killing effect as well as limit the occurrence of resistance developing via crosstalk within the DSB repair pathways (i.e. Alt-EJ) or, via inactivation of the
  • 53BP1/RIF1/REV7/Shieldin protein complex could be employed following the development of PARP inhibitor-resistance via re-sensitizing these cells to chemotherapy and/or limiting repair of DSB by impacting on the tumour cell’s ability to engage the alternative mechanism of DSB repair i.e. the Alt-EJ pathway or finally, through the synthetic lethal interaction with the deficiency in RIF1 (or other components of the 53BP1 protein complex).
  • the present invention is based on hypothesis-driven work carried out to identify new synthetic lethal interactions to offer up new cancer therapeutic opportunities. From this work the inventor has discovered that EXD2 display synthetic lethality with members of homologous recombination DNA repair pathway (HR) such as BRCA1 and BRCA2. This mechanism can be employed by treating patients whose cancers are deficient in homologous recombination DNA repair by administering an agent that inhibits, (including depletes or inactivates) EXD2.
  • HR homologous recombination DNA repair pathway
  • an EXD2 inhibitor or a pharmaceutical composition thereof for use in a method of treatment of cancer in an individual, wherein the cancer comprises cells deficient in homologous
  • HR recombination
  • DSB double strand break
  • HRD homologous recombination repair
  • the pharmaceutical composition may further comprise one or more pharmaceutically acceptable carriers in addition to the EXD2 inhibitor.
  • the method of treatment comprises determining whether the individual (i.e. cancer patient) has a cancer comprising HRD cells.
  • the cancer (and/or patient) in addition to being deficient in homologous recombination repair (HR), is resistant to treatment with a PARP inhibitor selected from the group consisting of: olaparib, rucaparib, niraparib and talazoparib.
  • a PARP inhibitor selected from the group consisting of: olaparib, rucaparib, niraparib and talazoparib.
  • the cancer (and/or patient) is resistant to treatment with olaparib.
  • the resistance to PARP inhibition is the result of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the
  • the EXD2 inhibitor or pharmaceutical composition thereof for use according to the first aspect of the invention is specific for EXD2.
  • the EXD2 inhibitor or pharmaceutical composition thereof for use according to the first aspect of the invention causes a reduction in functional activity of EXD2 or expression levels of EXD2.
  • the cells are deficient in the 53BP1/RIF1/REV7/Shieldin protein complex due to one or more mutations in a gene, or the absence of or defective expression of a gene encoding a protein from
  • the 53BP1/RIF1/REV7/Shieldin protein complex selected from the group consisting of: 53BP1 , RIF1 , REV7, Shieldin 1 , Shieldin 2 and Shieldin 3.
  • a method of selecting an individual having a cancer condition for treatment comprising:
  • determining whether the individual’s cancer comprises cancer cells which are deficient in HR, wherein if the individual’s cancer comprises cancer cells which are deficient in HR the individual is selected for treatment with an EXD2 inhibitor.
  • the patient’s cancer cells are also tested to see if the 53BP1/RIF1/REV7/Shieldin protein complex is inactive, wherein if the individual’s cancer comprises cancer cells which are deficient in HR and
  • the individual is selected for treatment with an EXD2 inhibitor.
  • the cancer cells comprise mutations in BRCA1 or BRCA2 and RIF1.
  • a method of screening for a compound potentially suitable for use in the treatment of cancer deficient in HR comprising determining the ability of the compound to inhibit EXD2 protein, wherein if the compound inhibits EXD2 protein it is identified as one that is potentially suitable for use in the treatment of cancer deficient in HR.
  • a method of screening for a compound suitable for use in the treatment of cancer comprising HRD cells comprising the steps of:
  • step (b) contacting the EXD2 in step (a) with one or more test compounds;
  • a method of determining the responsiveness of a subject having a cancer to an EXD2 inhibitor comprising determining whether the cancer comprises cells deficient in HR, wherein the presence of said deficiency indicates that the subject is likely to be responsive to an EXD2 inhibitor.
  • the cells are also tested to see if the 53BP1/RIF1/REV7/Shieldin protein complex is inactive, wherein if the individual’s cancer comprises cancer cells which are deficient in HR and 53BP1/RIF1/REV7/Shieldin protein complex the subject is likely to be responsive to an EXD2 inhibitor.
  • a cell which is deficient in 53BP1/RIF1/REV7/Shieldin protein complex is one with a deficiency in any one (or more) member(s) selected from the group consisting of: 53BP1 , RIF1 , REV7, Shieldin 1 , Shieldin 2 and Shieldin 3.
  • a deficiency in a member of the BRRES complex could be caused by a mutation in /or silencing of the gene encoding the complex member.
  • the deficiency includes a completely defunct protein or a protein that has reduced activity or other deficiency relative to the normal protein.
  • a cell which is deficient in HR will be deficient in at least one member of the HR pathway.
  • a deficiency in a member of the HR pathway could be caused by a mutation in /or silencing of the gene encoding the pathway member.
  • the deficiency includes a completely defunct protein or a protein that has reduced activity or other deficiency relative to the normal protein.
  • the member of the HR pathway is selected from the group consisting of: BRCA1 , BRCA2, RAD51 , RAD51A, RAD51 B, RAD51 C, RAD51 D, RAD52, PALB2, BARD1 , MRE11 , ATM, ATR, WRN and BLM.
  • the EXD2 inhibitor can be any molecule that inhibits EXD2.
  • it can be a small molecule compound, a peptide/polypeptide (such as an aptamer), a nucleic acid (such as an aptamer, an RNA inhibitory molecule (RNAi), a guide RNA (gRNA) or an antisense oligonucleotide (ASO)), an antibody (such as an intrabody), or any other chemical moiety suitable for use as a therapeutic agent.
  • the terms“about” or“approximately” when used in conjunction with a stated numerical value or range denotes somewhat more or somewhat less than the stated value or range, to within a range of ⁇ 15% of that stated, ⁇ 10% of that stated, ⁇ 5% of that stated in different embodiments.
  • homologous recombination DNA repair As used herein, the terms homologous recombination DNA repair, homologous recombination repair, homologous recombination DNA repair pathway or
  • homologous recombination dependent double strand break repair refers to the DNA double strand break repair pathway in the cell, which is also referred to herein as HR or HR pathway.
  • a cancer with a deficiency in HR pathway may comprise or consist of one or more cancer cells which have a reduced or abrogated ability to repair DNA DSBs through that pathway, relative to normal cells i.e. the activity of the HR dependent DNA DSB repair pathway may be reduced or abolished in the one or more cancer cells.
  • it refers to a cancer with cells that have a deficiency in one or more members of the HR pathway, such as one selected from the group consisting of: BRCA1 , BRCA2, RAD51 , RAD51A, RAD51 B, RAD51 C, RAD51 D,
  • the deficiency can be caused by a mutation that results in incorrect processing or production of the protein of the pathway.
  • a cell with a deficiency in HR may be referred to as a cell with HRD or an HRD cell.
  • the cancer cells may have a BRCA1 and/or a BRCA2 deficient phenotype, i.e. compared to a normal cell they may be deficient in BRCA1 and/or BRCA2 expression and/or the activity of BRCA1 and/or BRCA2 may be reduced or abolished in the cancer cells, for example by means of mutation or polymorphism in the encoding nucleic acid, or by means of mutation or
  • EMSY gene which encodes a BRCA2 regulatory factor
  • Amplification of the EMSY gene, which encodes a BRCA2 binding factor is known to be associated with breast and ovarian cancer.
  • the association of BRCA1 and/or BRCA2 mutations with breast cancer is well- characterised in the art (Radice P. J Exp Clin Cancer Res. 21 (3 Suppl):9-12, 2002). Carriers of mutations in BRCA1 and/or BRCA2 are also at elevated risk of cancer of the ovary, prostate and pancreas.
  • a cancer with a deficiency in BRRES protein complex may comprise or consist of one or more cancer cells which have a reduced or abrogated ability to repair DNA DSBs through inactivation of that BRRES complex, relative to normal cells, i.e. the activity of DNA DSB repair pathway may be reduced or abolished in the one or more cancer cells.
  • it refers to a cancer with cells that have a deficiency in one or more members of the BRRES complex, such as one selected from the group consisting of: 53BP1 , RIF1 , REV7, Shielding Shieldin 2 and Shieldin 3.
  • the deficiency can be caused by a mutation that results in incorrect processing or production of the protein of the pathway.
  • inhibitor refers to an entity/agent whose presence in a system in which an activity of interest is observed correlates with a decrease in level and/or nature of that activity as compared with that observed under otherwise comparable conditions when the inhibitor is absent.
  • an inhibitor interacts directly with a target whose activity is of interest.
  • an inhibitor affects the amount/level of a target of interest;
  • an inhibitor affects the activity of a target of interest without affecting the level of the target.
  • an inhibitor affects both level and activity of a target entity of interest, so that an observed difference in activity is not entirely explained by or commensurate with an observed difference in level.
  • the inhibitor can be any agent, e.g. small molecule compound, nucleic acid, antibody, and the like.
  • the target can be a protein or a precursor thereof, or nucleic acid encoding said protein/precursor, e.g. genomic DNA or mRNA.
  • an individual who is“suffering from” a disease, disorder, and/or condition has been diagnosed with and/or displays one or more symptoms of the disease, disorder, and/or condition.
  • an individual who is suffering from a disease e.g. cancer
  • an individual who is suffering from a disease is also one who has the disease (e.g. cancer) or one who is in need of treatment for the disease (e.g. cancer).
  • the term“effective amount” refers to an amount of an agent which confers a therapeutic effect on a treated subject, at a reasonable benefit/risk ratio applicable to any medical treatment.
  • a therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect).
  • an“effective amount” refers to an amount of a therapeutic agent effective to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect, such as by ameliorating symptoms associated with a disease, preventing or delaying onset of a disease, and/or also lessening severity or frequency of symptoms of a disease.
  • an effective amount is commonly administered in a dosing regimen that may comprise multiple unit doses.
  • an effective amount and/or an appropriate unit dose within an effective dosing regimen
  • a specific effective amount (and/or unit dose) for any particular patient may depend upon a variety of factors including what disorder is being treated;
  • the therapeutically effective amount is typically the dosage of the agent as approved by a national health authority (such as the US Food and Drug Administration [FDA] or European Medicines Agency [EMA]) which will have been identified from controlled human clinical trials.
  • a national health authority such as the US Food and Drug Administration [FDA] or European Medicines Agency [EMA]
  • treatment refers to any administration of a substance (e.g. inhibitor) that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and/or reduces frequency, incidence or severity of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition.
  • a substance e.g. inhibitor
  • Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition.
  • such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition.
  • treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition.
  • treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of
  • the treatment can be part of“a method of treatment” which may include the diagnosis or selection of the patient/individual as well as the therapeutic intervention.
  • the selection of the patient may involve testing the patient for their suitability to be treated by the therapeutic intervention, which may involve testing to determine whether the patient’s cancer has a relevant deficiency in a protein or encoding nucleic acid. In the context of the present invention this could either be testing to see if the cancer is deficient in one or more members of HR pathway.
  • an EXD2 inhibitor or a pharmaceutical composition thereof for use in a method of treatment of cancer in an individual, wherein the cancer comprises cells deficient in homologous
  • the individual is a person in need of treatment.
  • the individual is a human.
  • a method of treating a subject having a cancer comprising cells deficient in homologous recombination dependent double strand break repair (HR), the method comprising administering to the subject a therapeutically effective amount of an EXD2 inhibitor or a pharmaceutical composition thereof.
  • the subject is a person in need of treatment.
  • the subject is a human.
  • the subject e.g. individual, patient
  • the method of treatment includes the step of identifying that the subject (e.g. individual, patient) has a cancer that comprises cells deficient in HR pathway (i.e. the method of treatment comprises the step of identifying a cancer condition in an individual as deficient in HR).
  • the cancer is identified as having cells with HRD by:
  • the component of the HR pathway is selected from the group consisting of: BRCA1 , BRCA2, RAD51 , RAD51A, RAD51 B, RAD51 C,
  • RAD51 D RAD51 D
  • RAD52 PALB2
  • BARD1 MRE11
  • ATM ATM
  • ATR WRN
  • BLM BLM
  • the cancer cells have an HR pathway member (e.g.
  • the cancer comprises one or more cancer cells having a reduced or abrogated ability to repair DNA double stranded breaks by homologous
  • an EXD2 inhibitor for use in the manufacture of a medicament for use in therapy.
  • the therapy is the treatment of cancer which comprises cells deficient in HR pathway.
  • a cell deficient in HR pathway can be caused by a deficiency in one or more components (members) of the HR pathway.
  • the cancer cells are deficient in a component of the HR pathway selected from the group consisting of: BRCA1 , BRCA2, RAD51 , RAD51A, RAD51 B, RAD51 C, RAD51 D, RAD52, PALB2, BARD1 , MRE11 , ATM, ATR, WRN and BLM.
  • the deficiency in the HR pathway member is due to one or more mutations in a gene, or the absence of or defective expression of a gene encoding a protein selected from the group consisting of: BRCA1 , BRCA2, RAD51 , RAD 51 A, RAD51 B, RAD51 C, RAD51 D, RAD52, PALB2, BARD1 , MRE11 , ATM,
  • the HRD cells are dependent on EXD2 for survival.
  • the cancer cells have a deficiency in BRCA1 or BRCA2 genes and/or are resistant to PARP inhibitors treatment via inactivation of one or more of the 53BP1/RIF1/REV7/Shieldin genes.
  • the cancer cells may have a
  • the diagnosis of the subject/individual/patient as having a cancer or a cancer with a particular genotype is not part of the method of treatment but precedes the method of treatment.
  • the method of treatment of cancer comprises the step of diagnosis of the subject/individual/patient.
  • the method of treatment of cancer comprises the step of identifying a cancer condition in an individual as deficient in HR pathway.
  • the cancer in addition to being deficient in homologous recombination repair (HR), the cancer (and/or patient) is resistant to treatment a PARP inhibitor selected from the group consisting of: olaparib, rucaparib, niraparib and talazoparib.
  • a PARP inhibitor selected from the group consisting of: olaparib, rucaparib, niraparib and talazoparib.
  • the resistance to PARP inhibition is the result of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the
  • the cells are deficient in the 53BP1/RIF1/REV7/Shieldin protein complex due to one or more mutations in a gene, or the absence of or defective expression of a gene encoding a protein from the 53BP1/RIF1/REV7/Shieldin protein complex selected from the group consisting of: 53BP1 , RIF1 , REV7, Shieldin 1 , Shieldin 2 and Shieldin 3.
  • DNA double strand breaks are amongst the most toxic lesions that cells can suffer. Their mis repair can trigger genome rearrangements that cause a plethora of inherited human syndromes with life-threatening symptoms including cancer.
  • the two major pathways involved in the repair of DSBs in eukaryotic cells are an error prone non-homologous end-joining (NHE J) process that involves the ligation of broken DNA ends (but often with loss of genetic information), and an error free process called homologous recombination (FIR) that utilises an intact DNA template to faithfully restore broken DNA. FIR is particularly important for repairing
  • the FIR dependent DNA DSB repair pathway repairs double-strand breaks (DSBs) in DNA via homologous recombination mechanisms to reform a continuous DNA helix (K.K. Khanna and S.P. Jackson, Nat. Genet. 27(3): 247-254, 2001 ).
  • 53BP1/RIF1/REV7/Shieldin 1/2/3 is a protein complex that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini, thus antagonising HR and promoting NHEJ (non-homologous end joining).
  • This function requires interactions of 53BP1 with RIF1 (also known as MAD2L2), and subsequent recruitment of other components of this protein complex REV7/Shieldin 1/2/3 (Sylvie M Noordermeer et al. Nature, 560(7716): 117-121 , 2018; Mirman Z., et al. Nature, 560(7716): 112-116, 2018; Ghezraoui H., Nature, 560(7716): 122-127, 2018).
  • BRRES proteins Inactivating mutations in one or more BRRES proteins (listed below) results in partial restoration of DNA resection-dependent DSB repair, and BRCA-deficient tumours becoming resistant to PARP inhibitors (Sylvie M Noordermeer et al. Nature,
  • cancers that are known to have a deficiency in a member of the HR pathway, including: breast cancer, prostate cancer, pancreatic cancer, liver cancer, ovarian cancer, testicular cancer, endometrium cancer, cervical cancer, thyroid cancer, parathyroid cancer liver cancer, stomach cancer, adrenal cancer, multiple endocrine neoplasia 1 , and multiple endocrine neoplasia 2.
  • the present invention can be employed for use in a patient with a sub-set of a cancer selected from breast cancer, ovarian cancer, prostate cancer, lung cancer, kidney cancer, gastric cancer, colorectal cancer, testicular cancer, head and neck cancer, pancreatic cancer, brain cancer, melanoma, bone cancer, oesophageal cancer, bladder cancer, cervical cancer, endometrial cancer or other cancers of tissue organs and cancers of the blood cells such as lymphomas and leukaemia.
  • a cancer selected from breast cancer, ovarian cancer, prostate cancer, lung cancer, kidney cancer, gastric cancer, colorectal cancer, testicular cancer, head and neck cancer, pancreatic cancer, brain cancer, melanoma, bone cancer, oesophageal cancer, bladder cancer, cervical cancer, endometrial cancer or other cancers of tissue organs and cancers of the blood cells such as lymphomas and leukaemia.
  • subset we mean that not all cancers within this group (e.g. breast cancer) will be treatable or suitable, rather as will be appreciated from the disclosure herein, it will be those cancers that possess cells which either have a deficiency in one or more members of HR pathway.
  • a cancer may be identified as a HR dependent DNA DSB repair deficient cancer, for example, by determining the activity of the HR dependent DNA DSB repair pathway in one or more cancer cells from a sample obtained from the individual or by determining the activity of one or more components of the pathway. Activity may be determined relative to normal (i.e. non-cancer) cells, preferably from the same tissue.
  • a cancer may be identified as deficient in an HR dependent DNA DSB repair pathway by determining the presence in cancer cells from the individual of one or more variations, for example, polymorphisms or mutations, in a nucleic acid encoding a polypeptide which is a component of the HR dependent DNA DSB repair pathway.
  • the cancer is selected from a BRCA 1 or BCRCA2 mutant cancer.
  • the cancer is a BRCA1 or BRCA2 mutant cancer selected from the group consisting of: breast cancer, prostate cancer, pancreatic cancer, liver cancer, ovarian cancer, testicular cancer, endometrium cancer, cervical cancer, thyroid cancer, parathyroid cancer liver cancer, stomach cancer, adrenal cancer, multiple endocrine neoplasia 1 , and multiple endocrine neoplasia 2.
  • the cancer is selected from the group consisting of:
  • breast, ovarian, prostate and pancreatic cancer are breast, ovarian, prostate and pancreatic cancer.
  • the cancer has been identified as possessing a BRCA1 mutation that causes the BRCA1 deficiency or as being BRCA1 -deficient.
  • the cancer has been identified as possessing a BRCA2 mutation that causes the BRCA2 deficiency or as being BRCA2-deficient.
  • the cancer has been identified as also being EXD2 wild type.
  • the cancer has been identified as being resistant to a PARP inhibitor, such as one selected from the group consisting of: selected from the group consisting of: olaparib, rucaparib, niraparib and talazoparib.
  • a PARP inhibitor such as one selected from the group consisting of: selected from the group consisting of: olaparib, rucaparib, niraparib and talazoparib.
  • the resistance to PARP inhibition is the result of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the cancer (cancer cells) acquiring mutation in one or more member of the
  • the patient has not received a prior therapy for the cancer, i.e. the EXD2 inhibitor is to be administered as first line treatment.
  • the patient has received one or more prior treatments for the cancer, i.e. the EXD2 inhibitor is to be administered as second-line, third-line etc. treatment.
  • the method of treatment further comprises administering a DNA damaging chemotherapeutic agent such as PARP inhibitors, ATR inhibitor, ATM inhibitors, X and gamma radiation, crosslinking agents (e.g. cisplatin, oxiplatin and their derivatives) or a replication inhibitor (e.g.
  • a DNA damaging chemotherapeutic agent such as PARP inhibitors, ATR inhibitor, ATM inhibitors, X and gamma radiation
  • crosslinking agents e.g. cisplatin, oxiplatin and their derivatives
  • a replication inhibitor e.g.
  • the EXD2 inhibitor is administered in combination with another anti-cancer agent, such as a PARP inhibitor.
  • the PARP inhibitor is selected from: olaparib, niraparib and rucaparib.
  • the cancer cells are typically tested to see if they are deficient in one or more members of HR pathway.
  • This testing can be part of a standard panel of tests for key mutations (such as in KRas, P53, MEK etc.) using gene sequencing or other mutation detection test or may be carried out using immunohistochemistry on a biopsy sample from the patient’s cancer to look for protein deficiencies (Stover et al. , Clinical Cancer Research, September 27, 2016, doi: 10.1158/1078-0432. CCR-16-0247; Hoppe et al., J Natl Cancer Inst. 110(7):704- 713, 2018. doi: 10.1093/jnci/djy085).
  • Testing for the presence of inactivating mutations in one or more member of the 53BP1/RIF1/REV7/Shieldin protein complex, such as RIF1 may be carried out separately or at the same time.
  • tumour/cancer biopsy samples or blood samples will be taken, and these will be sent off to a testing laboratory (e.g. hospital or other clinical pathology laboratory) for testing.
  • a testing laboratory e.g. hospital or other clinical pathology laboratory
  • sample typically refers to a biological sample obtained or derived from a source of interest, as described herein.
  • a source of interest comprises an organism, such as an animal or human.
  • a biological sample is or comprises biological tissue or fluid.
  • a biological sample may be or comprise bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; cell free circulating tumour DNA; sputum; saliva; urine;
  • a biological sample is or comprises cells obtained from an individual.
  • obtained cells are or include cells from an individual from whom the sample is obtained.
  • a sample is a“primary sample” obtained directly from a source of interest by any appropriate means.
  • a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, ascites, faeces etc.), etc.
  • sample refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane.
  • a“processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification (e.g. polymerase chain reaction) or reverse transcription of mRNA, isolation and/or purification of certain components, etc.
  • the sample may be a liquid, solid, or mixed biological sample obtained from a subject having, or suspected of having, a cancer with a particular deficiency.
  • Suitable tissue samples include cancer tissue samples including those that may be obtained by a biopsy or following surgical resection of the cancer, surrounding tissues, and/or distant tissues in which metastasis are known or are suspected.
  • the inventor has demonstrated that inhibition of EXD2 using siRNA causes a reduction in survival and/or proliferation of cells which have a deficiency in FIR.
  • EXD2 is a druggable target
  • any agent that could inhibit EXD2 for example at the nucleic acid (e.g. mRNA) or protein level, would have utility in the present invention.
  • EXD2 is an exonuclease required for double-strand breaks resection and efficient homologous recombination. It plays a key role in controlling the initial steps of chromosomal break repair. It is recruited to chromatin in a damage-dependent manner and functionally interacts with the MRN complex to accelerate resection through its 3'-5' exonuclease activity, which efficiently processes double-stranded DNA substrates containing nicks.
  • EXD2 is also referred to in the art as EXDL2 or C14orf114.
  • the 3-5’ exonuclease domain of EXD2 is located from amino acids 62-262 of the native protein.
  • SEQ ID NO: 1 provides the amino acid sequence of the isoform that has been chosen as the 'canonical' EXD2 protein sequence (see NM_001193360.1 or Q9NVH0-1 ).
  • the EXD2 gene sequence (as in NM_001193360.1 ) is disclosed in SEQ ID NO: 2.
  • the EXD2 inhibitor is selected from a polypeptide, polynucleotide, antibody, peptide, nucleic acid, small molecule, an RNA inhibitory molecule (RNAi), an antisense oligonucleotide (ASO) or any other suitable chemical.
  • RNAi RNA inhibitory molecule
  • ASO antisense oligonucleotide
  • the EXD2 inhibitor is a small molecule compound or a large molecule biologic.
  • the EXD2 inhibitor is selected from the group consisting of: an antibody, a peptide, a nucleic acid, a small molecule compound, an RNA inhibitory molecule (RNAi) and an antisense oligonucleotide (ASO).
  • RNAi RNA inhibitory molecule
  • ASO antisense oligonucleotide
  • RNAi and ASO molecules are particularly suitable for inhibiting the expression of EXD2.
  • the use of these approaches to down-regulate gene expression is now well- established in the art.
  • the EXD2 inhibitor is an RNAi.
  • the EXD2 inhibitor is a small molecule compound.
  • the EXD2 inhibitor is an ASO.
  • a "small molecule” as used herein, is an organic molecule that is less than about 5 kilodaltons (KDa) in mass. In some embodiments, the small molecule is less than about 3 KDa, or less than about 2 KDa, or less than about 1.5 KDa, or less than about 1 KDa. Most small molecule compounds are less than around 800 daltons (Da). In some embodiments, the small molecule is less than about 800 Da, less than about 600 Da, less than about 500 Da, less than about 400 Da, less than about 300 Da, less than about 200 Da, or less than about 100 Da. Often, a small molecule has a mass of at least 50 Da. In some embodiments, a small molecule is non-polymeric.
  • a small molecule contains multiple carbon-carbon bonds and can comprise one or more heteroatoms and/ or one or more functional groups important for structural interaction with proteins (e.g., hydrogen bonding), e.g., an amine, carbonyl, hydroxyl, or carboxyl group, and in some embodiments at least two functional groups.
  • proteins e.g., hydrogen bonding
  • Small molecules often comprise one or more cyclic carbon or heterocyclic structures and/or aromatic or polyaromatic structures, optionally substituted with one or more of the above functional groups.
  • the EXD2 inhibitor or pharmaceutical composition thereof for use according to the first aspect of the invention is specific for EXD2.
  • the inhibitor does not significantly inhibit the other DnaQ family exonucleases with the conserved DEDD motif selected from TREX1 and TREX2; in other words is 10- fold , 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 200-fold or more specific for inhibiting EXD2 than any TREX1 or TREX2.
  • the EXD2 inhibitor is specific for EXD2.
  • the EXD2 inhibitor or pharmaceutical composition thereof for use according to the first aspect of the invention causes a reduction in functional activity of EXD2 or expression levels of EXD2.
  • the EXD2 inhibitor is specific for EXD2 and blocks its exonuclease activity, such as by targeting the 3-5’ exonuclease domain from amino acids 62-262), by disrupting the metal ion binding site (located within the sequence from amino acids 108 - 242) [numbering according to SEQ ID NO: 1 ], by binding to the DNA substrate and/or steric effect/hindrance
  • the protein is impeded in its ability to process (degrade) DNA or RNA substrate.
  • the EXD2 inhibitor could be an antibody or an antibody fragment.
  • the EXD2 inhibitor is a monoclonal antibody.
  • the EXD2 inhibitor is a monoclonal antibody.
  • the EXD2 inhibitor is a monoclonal antibody fragment. In a particular embodiment, the EXD2 inhibitor is a polyclonal antibody. In a particular embodiment, the EXD2 inhibitor is an intrabody.
  • the EXD2 inhibitor is an oligonucleotide aptamer or peptide aptamer.
  • Nucleic acid aptamers (or oligonucleotide aptamers) can be generated from nucleic acid random-sequence using a systematic evolution of ligands by exponential enrichment (SELEX) technology ( Tuerk and Go/d. Science.
  • SELEX exponential enrichment
  • SELEX is a process of effectively selecting aptamers from different targets. To date, using SELEX technology has successfully- generated thousands of aptamers, which bind to specific targets including small molecules, metal ions, proteins, peptides, bacteria, virus, and live cells (e.g. see Ciesiolka et al. RNA 1 , 538-550, 1995; Stoltenburg et al., J. Ana!. Meth.
  • Peptide aptamers are short, 5-20 amino acid residues long sequences, typically embedded as a loop within a stable protein scaffold (e.g. see Colas et
  • Peptide aptamers can be produced and selected in vivo through yeast two hybrid and similar techniques.
  • proteolysis targeting chimeras involving the use of small bi-functional molecules that can inhibit a protein via the induction of its degradation (see Crew et al., J. Medicinal Chemistry.
  • the EXD2 inhibitor for use in the invention is a PROTAC molecule that inhibits EXD2 via the induction of its degradation.
  • Nucleic acid-based therapeutic agents such as RNAi or antisense oligonucleotides are well-known.
  • the EXD2 inhibitor for use in the invention is a nucleic- acid based therapeutic that comprise nucleic acid or nucleotides.
  • said nucleic acid therapeutic could be or comprises a dsRNA molecule, a RNAi molecule, a miRNA molecule, a ribozyme, a shRNA molecule, an antisense oligonucleotide (ASO), a guide RNA (gRNA) or a siRNA molecule.
  • the EXD2 inhibitor for use in the invention could also be a nucleic acid-based molecule, such as one capable of inhibiting generation of mRNA of EXD2.
  • the EXD2 inhibitor is or comprises a nucleic acid molecule capable of inhibiting mRNA of EXD2.
  • nucleic acid molecule comprises a sequence disclosed in SEQ ID Nos: 3 or 4.
  • RNA inhibitor is preferably an RNAi molecule specific for EXD2 mRNA; shRNA molecule specific for EXD2 mRNA; or an antisense oligonucleotide (AON) specific for EXD2 mRNA.
  • the agent that inhibits EXD2 is a nucleic acid or peptide- based aptamer.
  • the invention also provides an isolated oligonucleotide having 12-40 bases, wherein the oligonucleotide comprises a continuous stretch of at least 7 bases that is complementary to and capable of hybridizing to a continuous stretch of at least 7 bases that is complementary to and capable of hybridizing to EXD2 mRNA.
  • the isolated oligonucleotide comprises a sequence disclosed in any of SEQ ID Nos: 3 or 4,
  • the EXD2 inhibitor is selected from the group consisting of small interfering RNAs (siRNAs), nucleic acid aptamers, small molecules, inorganic compounds, PROTAC molecules, peptide aptamers, antibodies, such as Fab, scFv, VH H, natural single domain antibodies, nanobodies, affibodies, affibody-antibody chimeras, heavy-chain only antibodies (FICAbs), and non-immunoglobulins. Certain of these agents are discussed in Muyldermans (Ann Rev Biochem. 82:775- 797, 2013). Functional inhibitor agents can be identified based on their ability to induce a down-regulation or inhibition of gene expression and/or down- regulation or inhibition of the activity of a transcriptional or translational product thereof (i.e.
  • EXD2/ EXD2 The expression is, for example, reduced or down-regulated to less than 90%, such as less than 80% such as less than 70% for example less than 60%, for example less than 50%, such as less than 40%, such as less than 30% such as less than 20% for example less than 10%, for example less than 5%, for example less than 1 %, such as completely inhibited (0%) relative to the expression or activity in the absence of the agent that inhibits EXD2.
  • the EXD2 inhibitor could also be a large molecule biologic, such as an antibody.
  • An antibody is an immunoglobulin molecule capable of specific binding to a target, such as a carbohydrate, polynucleotide, lipid, polypeptide, etc., through at least one antigen recognition site, located in the variable domain of the immunoglobulin molecule.
  • an “intact antibody” typically refers to a Y-shaped tetrameric protein comprising two heavy (H) and two light (L) polypeptide chains held together by covalent disulfide bonds and non-covalent interactions.
  • Each light chain is composed of one variable domain (VL) and one constant domain (CL).
  • Each heavy chain comprises one variable domain (VH) and a constant region, which in the case of IgG, IgA, and IgD antibodies, comprises three domains termed CH1 , CH2, and CH3 (IgM and IgE have a fourth domain, CH4).
  • the CH1 and CH2 domains are separated by a flexible hinge region, which is a proline and cysteine rich segment of variable length (from about 10 to about 60 amino acids in various IgG subclasses).
  • the variable domains in both the light and heavy chains are joined to the constant domains by a "J" region of about 12 or more amino acids and the heavy chain also has a "D" region of about 10 additional amino acids.
  • Each class of antibody further comprises inter-chain and intra-chain disulfide bonds formed by paired cysteine residues.
  • the heavy chain variable region (YH) and light chain variable region (YL) can each be further subdivided into regions of hypervariability,
  • CDRs complementarity determining regions
  • FR framework regions
  • Each YH and YL comprises three CDRs and four FRs, arranged from amino-terminus to carboxy -terminus in the following order: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the
  • immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical
  • the term“antibody” includes, by way of example, both naturally occurring and non-naturally occurring intact antibodies, such as polyclonal, multiclonal or monoclonal antibodies, as well as chimeric antibodies, humanized and primatized antibodies, CDR grafted antibodies, human antibodies, intrabodies, multi specific antibodies, bispecific antibodies, monovalent antibodies, multivalent antibodies, anti-idiotypic antibodies and synthetic antibodies, but also, unless otherwise specified, any antigen-binding portion thereof that competes with the intact antibody for specific binding, fusion proteins comprising an antigen-binding portion, and any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site.
  • Antigen-binding portions of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., EXD2) bound by the whole antibody.
  • Antigen-binding portions include, for example, Fab, Fab', F(ab')2, F(ab') fragments, Fd, Fv, domain antibodies (dAbs, e.g., shark and camelid antibodies), portions including complementarity determining regions (CDRs), single chain variable fragment antibodies (e.g. scFv, scFvFc and bis-scFv), minibodies, maxibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and polypeptides that contain at least a portion of an immunoglobulin that is sufficient to confer specific antigen binding to the polypeptide.
  • CDRs complementarity determining regions
  • single chain variable fragment antibodies e.g. scFv, scFvFc and bis-scFv
  • minibodies maxibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and polypeptides that contain at
  • immunoglobulins can be assigned to different classes. There are five major classes (i.e. , isotypes) of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (subtypes), e.g., lgG1 , lgG2, lgG3, lgG4, lgA1 and lgA2.
  • subclasses e.g., lgG1 , lgG2, lgG3, lgG4, lgA1 and lgA2.
  • the heavy-chain constant regions that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively.
  • the subunit structures and three- dimensional configurations of different classes of immunoglobulins are well known. Unless dictated otherwise by contextual constraints the term further comprises all classes and subclasses of antibodies.
  • Heavy-chain constant domains that correspond to the different classes of antibodies are typically denoted by the corresponding lower-case Greek letter a, d, e, g, and m, respectively.
  • Light chains of the antibodies from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda (l), based on the amino acid sequences of their constant domains.
  • the two domains of the Fv portion, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv)); see e.g., Bird et al. Science 242:423-426 (1988) and Huston et al. Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988)).
  • scFv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term "antigen-binding portion" of an antibody.
  • Other forms of single chain antibodies, such as diabodies are also encompassed.
  • Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see e.g., Holliger et al. Proc. Natl. Acad. Sci. USA 90:6444-6448, 1993; Poljak et al., Structure. 2:1121 -1123, 1994).
  • the antibodies may be murine, rat, human, or any other origin (including chimeric or humanized antibodies).
  • the antibody is a monoclonal antibody.
  • the antibody is a human or humanized antibody.
  • a non-human antibody may be humanized by recombinant methods to reduce its immunogenicity in man.
  • mAb monoclonal antibody
  • a Mab is highly specific, being directed against a single antigenic site/epitope.
  • a mAb is an example of an isolated antibody.
  • MAbs may be produced by hybridoma, recombinant, transgenic or other techniques known to those skilled in the art. The modifier
  • monoclonal indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present disclosure may be made by the hybridoma method first described by Kohler and Milstein (Nature 256:495, 1975) or may be made by recombinant DNA methods such as described in U.S. Pat. No. 4,816,567.
  • the monoclonal antibodies may also be isolated from phage libraries generated using the techniques described in McCafferty et al. ,
  • Human antibody refers to an antibody having variable regions in which both the framework and CDR regions are derived from human germ line
  • human antibodies may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site- specific mutagenesis in vitro or by somatic mutation in vivo).
  • human antibody as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
  • human antibodies and “fully human” antibodies are used synonymously. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen binding residues.
  • humanized antibody refers to an antibody in which some, most or all of the amino acids outside the CDR domains of a non-human antibody are replaced with corresponding amino acids derived from human immunoglobulins.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a CDR of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity.
  • donor antibody such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity.
  • the humanized antibody may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences but are included to further refine and optimize antibody performance.
  • a humanized form of an Ab some, most or all the amino acids outside the CDR domains have been replaced with amino acids from human immunoglobulins, whereas some, most or all amino acids within one or more CDR regions are unchanged. Small additions, deletions, insertions, substitutions or modifications of amino acids are permissible provided they do not abrogate the ability of the antibody to bind to a particular antigen.
  • a "humanized" antibody retains an antigenic specificity similar to that of the original antibody.
  • a “chimeric antibody” refers to an antibody in which the variable regions are derived from one species and the constant regions are derived from another species, such as an antibody in which the variable regions are derived from a mouse antibody and the constant regions are derived from a human antibody or vice versa.
  • the term also encompasses an antibody comprising a V region from one individual from one species (e.g., a first mouse) and a constant region from another individual from the same species (e.g., a second mouse).
  • an“intrabody” refers to an antibody that has been designed to be expressed intracellularly and can be directed to a specific target antigen present in various subcellular locations including the cytoplasm, nucleus and endoplasmic reticulum through in frame fusion with intracellular localization peptide sequences. It has been identified as a new class of therapeutic molecule (Chen et al. , Human Gene
  • intrabodies can be expressed in different forms, the most commonly used format is a scFv due to their mall size.
  • Antibody fragments typically in scFv format, are cloned into a specific targeting vector allowing expression of the intrabody in the nucleus, cytoplasm or ER.
  • the intrabody gene is expressed inside the target cell after transfection with an expression plasmid or viral transduction with a recombinant virus. It has been found that the usual vector-, promoter- and transfection systems for heterologous expression can be employed to express the intrabody in the cell of interest.
  • antigen (Ag) refers to the molecular entity used for immunization of an immunocompetent vertebrate to produce the antibody (Ab) that recognizes the Ag or to screen an expression library (e.g., phage, yeast or ribosome display library, among others).
  • an expression library e.g., phage, yeast or ribosome display library, among others.
  • Ag is termed more broadly and is generally intended to include target molecules that are specifically recognized by the Ab, thus including portions or mimics of the molecule used in an immunization process for raising the Ab or in library screening for selecting the Ab.
  • EXD2 full-length EXD2 from mammalian species (e.g., human, monkey, mouse and rat EXD2), as well as truncated and other variants of EXD2, can represent the antigen.
  • mammalian species e.g., human, monkey, mouse and rat EXD2
  • truncated and other variants of EXD2 can represent the antigen.
  • epitope refers to the area or region of an antigen to which an antibody specifically binds, i.e., an area or region in physical contact with the antibody.
  • epitope refers to that portion of a molecule capable of being recognized by and bound by an antibody at one or more of the antibody's antigen-binding regions.
  • an epitope is defined in the context of a molecular interaction between an "antibody, or antigen-binding portion thereof (Ab), and its corresponding antigen.
  • Epitopes often consist of a surface grouping of molecules such as amino acids or sugar side chains and have specific three-dimensional structural characteristics as well as specific charge characteristics.
  • the epitope can be a protein epitope.
  • Protein epitopes can be linear or conformational. In a linear epitope, all of the points of interaction between the protein and the interacting molecule (such as an antibody) occur linearly along the primary amino acid sequence of the protein.
  • a “nonlinear epitope” or “conformational epitope” comprises non-contiguous polypeptides (or amino acids) within the antigenic protein to which an antibody specific to the epitope binds.
  • antigenic epitope as used herein, is defined as a portion of an antigen to which an antibody can specifically bind as determined by any method well known in the art, for example, by conventional immunoassays.
  • an antibody that "specifically binds" to an epitope is a term well understood in the art, and methods to determine such specific binding are also well known in the art.
  • a molecule is said to exhibit "specific binding” if it reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a particular cell or substance than it does with alternative cells or substances.
  • an antibody that specifically binds to an EXD2 epitope is an antibody that binds this epitope with greater affinity, avidity, more readily, and/or with greater duration than it binds to other EXD2 epitopes or non-EXD2 epitopes. It is also understood by reading this definition, for example, that an antibody which specifically binds to a first target may or may not specifically or preferentially bind to a second target. As such, "specific binding" does not necessarily require (although it can include) exclusive binding.
  • the antibody specifically binds to the 3-5’ exonuclease domain of EXD2 which is located from amino acids 62-262 (according to the sequence in SEQ ID NO: 1 ).
  • a variety of assay formats may be used to select an antibody or peptide that specifically binds a molecule of interest.
  • assay formats may be used to select an antibody or peptide that specifically binds a molecule of interest.
  • solid-phase ELISA enzyme-activated immunosorbent assay
  • an antibody is said to "specifically bind" an antigen when the equilibrium dissociation constant (KD) is ⁇ 7nM.
  • binding affinity is herein used as a measure of the strength of a non- covalent interaction between two molecules, e.g., an antibody or antigen-binding portion thereof and an antigen.
  • binding affinity is used to describe monovalent interactions (intrinsic activity). Binding affinity between two molecules may be quantified by determination of the dissociation constant (KD). In turn, KD can be determined by measurement of the kinetics of complex formation and dissociation using, e.g., the surface plasmon resonance (SPR) method (Biacore).
  • SPR surface plasmon resonance
  • SPR Surface Plasmon Resonance
  • the antibody may bind to EXD2 with a KD of about 1 x 10 10 M or greater.
  • the antibody may bind to hEXD2 with a KD of about 9 x 10 11 M or greater.
  • the antibody may bind to hEXD2 with a KD of about 8 x 10 11 M or greater.
  • the antibody may bind to hEXD2 with a KD of about 7 x 10 11 M or greater.
  • the antibody may bind to hEXD2 with a KD of about 6 x 10 11 M or greater.
  • the antibody may bind to hEXD2 with a KD of about 5.00 x 10 11 M or greater.
  • An antibody that specifically binds its target may bind its target with a high affinity, that is, exhibiting a low KD, and may bind to other, non- target molecules with a lower affinity.
  • the antibody may bind to non- target molecules with a KD of 1 x 10 6 M or more, in some embodiments, 1 x 10 5 M or more, in some
  • An antibody specific for hEXD2 is in some embodiments capable of binding to hEXD2 molecule (e.g. protein/polypeptide) with an affinity that is at least two-fold, 10-fold, 50-fold, 100-fold 200-fold, 500-fold, 1 ,000- fold or 10,000-fold or greater than its affinity for binding to another non-hEXD2 molecule. These amounts are not meant to be limiting and increments between the recited values are specifically envisioned as part of the disclosure.
  • An antibody to EXD2 may be made by any method known in the art. General techniques for production of human and mouse antibodies are known in the art and/or are described herein. For example, see Flarlow and Lane (1988) “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NJ.
  • antibodies may be made recombinantly and expressed using any method known in the art.
  • antibodies may be prepared and selected by phage display technology. See, for example, U.S. Patent Nos.
  • phage display technology (McCafferty et al. , Nature 348:552-553, 1990) can be used to produce human antibodies and antibody portions in vitro, from immunoglobulin variable (V) domain gene repertoires from unimmunized donors.
  • V immunoglobulin variable
  • antibodies may be made using hybridoma technology.
  • Hybridomas can be prepared from the lymphocytes and immortalized myeloma cells using the general somatic cell hybridization technique of Kohler and Milstein (Nature 256:495-497, 1975) or as modified by Buck et al., (In Vitro, 18:377-381 , 1982). Available myeloma lines, including but not limited to X63- Ag8.653 and those from the Salk Institute, Cell Distribution Center, San Diego, Calif., USA, may be used in the hybridization. Generally, the technique involves fusing myeloma cells and lymphoid cells using a fusogen such as polyethylene glycol, or by electrical means well known to those skilled in the art.
  • a fusogen such as polyethylene glycol
  • the cells are separated from the fusion medium and grown in a selective growth medium, such as hypoxanthine- aminopterin-thymidine (HAT) medium, to eliminate unhybridized parent cells.
  • a selective growth medium such as hypoxanthine- aminopterin-thymidine (HAT) medium.
  • HAT hypoxanthine- aminopterin-thymidine
  • the hybridomas or other immortalized B-cells are expanded and sub-cloned, if desired, and supernatants are assayed for anti-immunogen activity by conventional immunoassay procedures (e.g., radioimmunoassay, enzyme immunoassay, or fluorescence immunoassay).
  • Hybridomas that produce the desired antibody may be grown in vitro or in vivo using known procedures.
  • the monoclonal antibodies may be isolated from the culture media or body fluids, by conventional immunoglobulin purification procedures such as ammonium sulphate precipitation, gel electrophoresis, dialysis, chromatography, and ultrafiltration, if desired.
  • fully human antibodies may be obtained by using
  • mice that have been engineered to express specific human immunoglobulin proteins.
  • Transgenic animals that are designed to produce a more desirable (e.g., fully human antibodies) or more robust immune response may also be used for generation of humanized or human antibodies. Examples of such technology are HuMAb- MouseTM and TC MouseTM from Medarex, Inc. (Princeton, NJ) and XenomouseTM from Abgenix, Inc. (Fremont, CA).
  • Antibodies may be made recombinantly by first isolating the antibodies and antibody producing cells from host animals, obtaining the gene sequence, and using the gene sequence to express the antibody recombinantly in host cells (e.g., CHO cells). Methods for recombinantly expressing antigen-binding portions of antibodies, e.g., domain, single chain, etc. are also well known in the art.
  • the antibody for use in the invention is selected from: a monoclonal, human, humanised, Fab, Fab', F(ab')2, F(ab'), Fd, Fv, dAb, intrabody, scFV and VHH antibody.
  • Antibody and nucleic-acid technology molecules are suitably advanced that the person skilled in the art would be able to make an antibody or antibody-derived molecule or a nucleic-acid technology molecule that could inhibit EXD2.
  • EXD2 is an exonuclease involved in DNA repair. Many nuclease inhibitors have been identified, particularly towards other enzymes involved in DNA repair.
  • EXD2 will be druggable and that suitable inhibitors against EXD2 can be generated.
  • the inventor has conducted a preliminary screen for EXD2 inhibitors and a number of compounds of diverse chemical type were identified as putative inhibitor molecules (see example 2)
  • nuclease detection and control assay available from IDT
  • a method of screening for a compound potentially suitable for use in the treatment of cancer deficient in HR comprising determining the ability of the compound to inhibit EXD2 protein, wherein if the compound inhibits EXD2 protein it is identified as one that is potentially suitable for use in the treatment of cancer deficient in HR.
  • a method of screening for a compound suitable for use in the treatment of cancer comprising cells deficient in HR comprising the steps of:
  • step (b) contacting the EXD2 in step (a) with one or more test compounds;
  • a reduction in activity of EXD2 is measured in vitro by a reduction in the ability of the EXD2 nuclease to cleave a suitable substrate.
  • a suitable substrate is any DNA or RNA substrate that can be degraded or cleaved by EXD2.
  • EXD2- dependent degradation of DNA fork like structures (Example 2, Figure 1 ), which is carried out in a buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCI, 0.5 mM DTT, 10 mM MnCI2, 0.05% Triton-X, 0.1 mg ml-1 BSA, 5% glycerol, and EXD2 protein. The reaction is initiated by adding substrate and incubated at 37 °C for the indicated amounts of time. Reactions are stopped by addition of EDTA to a final concentration of 20 mM and 1/5 volume of formamide.
  • composition suitable for administration.
  • Such composition typically comprises the
  • “pharmaceutically-acceptable excipient” as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances that are suitable for administration into a human.
  • excipient denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • suitable excipient are salts, buffering agents, wetting agents, emulsifiers, preservatives, compatible carriers, diluents, carriers, vehicles, supplementary immune potentiating agents such as adjuvants and cytokines that are well known in the art and are available from commercial sources for use in pharmaceutical preparations (see, e.g.
  • the pharmaceutical compositions contain one or more other therapeutic agents or compounds.
  • Suitable pharmaceutically acceptable excipients are relatively inert and can facilitate, for example, stabilisation, administration, processing or delivery of the active compound/agent into preparations that are optimised for delivery to the body, and preferably directly to the site of action.
  • compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use.
  • compositions of the present invention are administered in pharmaceutically acceptable preparations/compositions.
  • Administration may be topical, i.e. , substance is applied directly where its action is desired, enteral or oral, i.e., substance is given via the digestive tract, parenteral, i.e., substance is given by other routes than the digestive tract such as by injection.
  • compositions for parenteral administration include aqueous or non-aqueous, isotonic, pyrogen-free, sterile liquids (e.g. solutions, suspensions), in which the active ingredient is dissolved, suspended, or otherwise provided (e.g. in a liposome or other microparticulate).
  • Such liquids may additionally contain one or more pharmaceutically acceptable carriers, such as anti-oxidants, buffers, stabilisers, preservatives, suspending agents, and solutes that render the formulation isotonic with the blood (or other relevant bodily fluid) of the intended patient.
  • the composition may be lyophilised to provide a powdered form that is ready for reconstitution as and when needed.
  • the aqueous liquid may be further diluted prior to administration.
  • such administration can be via intravenous infusion using an intravenous (IV) apparatus.
  • IV intravenous
  • the active agent and optionally another therapeutic or prophylactic agent are formulated in accordance with routine procedures as pharmaceutical
  • compositions adapted for intravenous administration to human beings are adapted for intravenous administration to human beings.
  • the active agents for IV administration are solutions in sterile isotonic aqueous buffer.
  • the compositions can also include a solubilizing agent.
  • compositions for IV administration can optionally include a local anaesthetic such as lignocaine to ease pain at the site of the injection.
  • a local anaesthetic such as lignocaine
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule.
  • the active compound is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.
  • compositions for oral delivery can be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example.
  • Orally administered compositions can contain one or more optional agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavouring agents such as peppermint, oil of wintergreen, or cherry; colouring agents; and preserving agents, to provide a pharmaceutically palatable preparation.
  • sweetening agents such as fructose, aspartame or saccharin
  • flavouring agents such as peppermint, oil of wintergreen, or cherry
  • colouring agents such as peppermint, oil of wintergreen, or cherry
  • preserving agents to provide a pharmaceutically palatable preparation.
  • a time delay material such as glycerol monostearate or glycerol stearate can also be used.
  • compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like.
  • Compositions for use in accordance with the present invention can be formulated in conventional manner using one or more physiologically acceptable excipients.
  • the active agent and optionally another therapeutic or prophylactic agent and their physiologically acceptable salts and solvates can be formulated into pharmaceutical compositions for administration by inhalation or insufflation (either through the mouth or the nose) or oral, parenteral or mucosal (such as buccal, vaginal, rectal, sublingual) administration.
  • parenteral or mucosal such as buccal, vaginal, rectal, sublingual
  • local or systemic parenteral administration is used.
  • compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pre-gelatinised maize starch,
  • Liquid preparations for oral administration can take the form of, for example, solutions, syrups or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with
  • suspending agents e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats
  • emulsifying agents e.g., lecithin or acacia
  • non-aqueous vehicles e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils
  • preservatives e.g., methyl or propyl-p- hydroxybenzoates or sorbic acid.
  • the preparations can also contain buffer salts, flavouring, colouring and sweetening agents as appropriate.
  • compositions of the invention are for administration in an effective amount.
  • An“effective amount” is the amount of a composition that alone, or together with further doses, produces the desired response.
  • the compound/agent that inhibits EXD2 can be administered as a pharmaceutical composition in which the pharmaceutical composition
  • the EXD2 inhibitor comprises between 0.1 -1 mg, 1 -10 mg, 10-50mg, 50-1 OOmg, 100-500mg, or 500mg to 5g of the active agent.
  • the EXD2 inhibitor will be administered at approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mg/Kg body weight per dose.
  • Other embodiments comprise the administration of the EXD2 inhibitor at about 200, 300, 400, 500, 600, 700, 8000, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900 or 2000 mg/Kg body weight dose.
  • one of skill in the art can determine the effective dose and dosing schedule/regime of the specific EXD2 inhibitor based on preclinical and clinical studies and standard medical and biochemical measurements and techniques.
  • the therapeutic treatments described herein are applicable to patients who possess cancer comprising cells with a deficiency in one or more members of HR pathway. Accordingly, the invention also provides for methods for identifying such patients and/or selecting such patients for therapeutic treatment.
  • a method of selecting an individual having a cancer condition for treatment comprising:
  • a method of determining the responsiveness of a subject having a cancer to an EXD2 inhibitor comprising determining whether the cancer comprises cells deficient in HR, wherein the presence of said deficiency indicates that the subject is likely to be responsive to an EXD2 inhibitor.
  • determining whether the cancer comprises cells deficient in HR is determined by the presence of one or more amino acid or nucleic acid mutations in the sequence of a member of the HR pathway. The presence of particular mutations will dictate whether the cell will be deficient in HR.
  • the determining of the cancer cells is carried out on a biological sample from the patient.
  • the biological sample is a tissue sample or a biological fluid sample, such as a sample comprising: blood, plasma, serum, sputum, needle aspirate, urine or ascites
  • the patient’s cancer cells are obtained from the individual.
  • the patient’s cancer cells have been previously obtained from the individual.
  • cancer cell nucleic acid is obtained from the individual.
  • Cancer cell nucleic acid can be obtained from the cancer cells of from circulating free DNA in blood.
  • the patient’s cancer cell nucleic acid is obtained from the individual.
  • the patient’s cancer cells nucleic acid has been previously obtained from the individual.
  • determining whether the cells possess a deficiency in HR can be done by directly detecting for the particular HR pathway member (protein detection) or by detecting surrogates of such proteins, e.g. mRNA or other encoding nucleic acid etc.
  • the patient’s cancer cells are also evaluated to determine whether the cells are deficient in the 53BP1/RIF1/REV7/Shieldin protein
  • 53BP1/RIF1/REV7/Shieldin protein complex due to one or more mutations in a gene, or the absence of or defective expression of a gene encoding a protein from the 53BP1/RIF1/REV7/Shieldin protein complex selected from the group consisting of: 53BP1 , RIF1 , REV7, Shieldin 1 , Shieldin 2 and Shieldin 3.
  • the identification of a cancer as being deficient in HR can be done using various means.
  • de-activating mutation we mean a mutation (such as one or more base substitutions, insertions or deletions) which alters the activity or function of the protein.
  • the mutation could cause a frameshift resulting in expression of an altered protein, which cannot function properly (e.g. cannot bind in the complex, cannot trigger signalling etc.), or a stop codon resulting in a premature protein which also cannot function properly.
  • the mutation could result in the production of a protein with one or more amino acid substitutions relative to the wild-type protein and the presence of such substitutions could change the three-dimensional configuration of the protein and/or interfere with complex binding or some other activity of the protein.
  • the mutation(s) may be in a coding or non-coding region of the nucleic acid sequence and, may reduce or abolish the expression or function of the HR dependent DNA DSB repair pathway.
  • the variant nucleic acid may encode a variant polypeptide which has reduced or abolished activity or may encode a wild-type polypeptide which has little or no expression within the cell, for example through the altered activity of a regulatory element.
  • a variant nucleic acid may have one, two, three, four or more mutations or polymorphisms relative to the wild-type sequence.
  • De-activating includes but is not limited to completely defunct or missing protein. It includes proteins that function but at a significantly reduced amount, such as by at least 50%, at least 60%, at least 70%, at least 80%, and least 90%, at least 95%, and least 98% and at least 99%, as compared to wild-type protein.
  • the presence of such a mutation can be detected using conventional techniques such as gene sequencing or using polymerase chain reaction applications to detect the presence of a particular mutation, such as allele-specific amplification on a suitable nucleic acid containing sample.
  • the nucleic acid which may be genomic DNA, RNA or cDNA, or an amplified region thereof, may be sequenced to identify or determine the presence of polymorphism or mutation therein.
  • a polymorphism or mutation may be identified by comparing the sequence obtained with the database sequence of the component, as set out above. In particular, the presence of one or more polymorphisms or mutations that cause abrogation or loss of function of the polypeptide component, and thus the HR dependent DNA DSB repair pathway as a whole, may be determined.
  • Sequencing and specific mutation detection may be performed using any one of a range of standard techniques.
  • the individual is heterozygous for one or more variations, such as mutations and polymorphisms, in BRCA1 and/or BRCA2 or a regulator thereof.
  • sequence information can be retained and subsequently searched without recourse to the original nucleic acid itself.
  • scanning a database of sequence information using sequence analysis software may identify a sequence alteration or mutation.
  • various forms of cancer possess mutations in one or more genes encoding proteins of the HR pathway.
  • Mutations and polymorphisms associated with cancer may also be detected at the protein level by detecting the presence of a variant (i.e. a mutant or allelic variant) polypeptide.
  • the presence of an HR pathway protein can be detected in the cells, including the cell nuclei, using any of a variety of techniques.
  • an HR pathway protein can be detected in the cells, including the cell nuclei, using any of a variety of techniques.
  • the presence of an HR pathway protein is detected using
  • electrophoresis or ELISA.
  • these methods can be employed using an antibody or digital barcoded antibody to the HR pathway protein.
  • a digital barcoded antibody is an antibody whereby DNA barcodes are attached to the antibody.
  • the level of an HR pathway protein can be assessed using any of a variety of methods.
  • the level of expression of an HR pathway protein is assessed by determining the level of the HR pathway gene product in a sample obtained from a tumour.
  • the HR pathway protein level can also be
  • a surrogate of the HR pathway protein such as for example mRNA encoding the HR pathway protein.
  • the mRNA is detected directly or measured after conversion to cDNA which may optionally be amplified (e.g. by reverse transcriptase PCR).
  • the skilled person will readily be able to determine suitable reference values with respect to which the amount of the appropriate target molecule (e.g. an HR pathway protein) may be compared.
  • expression of target molecule in cancerous tissue can be compared to expression of that same molecule in non- cancerous tissue, such as adjacent non-cancerous tissue. Expression can be assessed on a protein level for example by immunohistochemistry or on a DNA level for example by fluorescence in situ hybridization, or on an RNA level, for example by quantitative real-time PCR.
  • any suitable method for measuring proteins can be used to measure the level of an HR pathway protein/polypeptide in a sample.
  • an immunological method or other affinity-based method is used.
  • immunological detection methods involve detecting specific antibody-antigen interactions in a sample such as a tissue section or cell sample.
  • the sample is contacted with an antibody that binds to the target antigen of interest.
  • the antibody is then detected using any of a variety of techniques.
  • the antibody that binds to the antigen (primary antibody) or a secondary antibody that binds to the primary antibody has been tagged or conjugated with a detectable label.
  • a detectable label may be, for example, a fluorescent dye (e.g., a fluorescent small molecule) or quencher, colloidal metal, quantum dot, hapten, radioactive atom or isotope, or enzyme (e.g., peroxidase). It will be appreciated that a detectable label may be directly detectable or indirectly detectable.
  • a fluorescent dye would be directly detectable, whereas an enzyme may be indirectly detectable, e.g., the enzyme reacts with a substrate to generate a directly detectable signal.
  • an enzyme may be indirectly detectable, e.g., the enzyme reacts with a substrate to generate a directly detectable signal.
  • detectable labels and strategies that may be used for detection, e.g., immunological detection, are known in the art.
  • immunological detection methods include, e.g., immunohistochemistry (IHC); enzyme-linked immunosorbent assay (ELISA), flow cytometry, protein microarrays, surface plasmon resonance assays, immunoprecipitation, immunoblot (Western blot), etc.
  • IHC generally refers to immunological detection of an antigen of interest (e.g., a cellular constituent) in a tissue sample such as a tissue section.
  • IHC is considered to encompass immunocytochemistry (ICC), which term generally refers to the immunological detection of a cellular constituent in isolated cells that essentially lack extracellular matrix components and tissue microarchitecture that would typically be present in a tissue sample.
  • ICC immunocytochemistry
  • ELISA assays typically involve use of primary or secondary antibodies that are linked to an enzyme, which acts on a substrate to produce a detectable signal (e.g., production of a coloured product) to indicate the presence of antigen or another analyte.
  • an enzyme which acts on a substrate to produce a detectable signal (e.g., production of a coloured product) to indicate the presence of antigen or another analyte.
  • IHC generally refers to the immunological detection of a tissue or cellular constituent in a tissue or cell sample comprising substantially intact (optionally permeabilized) cells.
  • the term“ELISA” also encompasses use of non-enzymatic reporters such as fluorogenic, electrochemiluminescent, or real-time PCR reporters that generate quantifiable signals. It will be appreciated that the term“ELISA” encompasses a number of variations such as“indirect”,“sandwich”,“competitive”, and“reverse” ELISA.
  • a sample is in the form of a tissue section, which may be a fixed or a fresh (e.g., fresh frozen) tissue section or cell smear in various embodiments.
  • a sample e.g., a tissue section
  • a sample may be embedded, e.g., in paraffin or a synthetic resin or combination thereof.
  • a sample, e.g., a tissue section may be fixed using a suitable fixative such as a formalin-based fixative.
  • the section may be a paraffin-embedded, formalin-fixed tissue section.
  • a section may be deparaffinized (a process in which paraffin (or other substance in which the tissue section has been embedded) is removed (at least sufficiently to allow staining of a portion of the tissue section).
  • paraffin or other substance in which the tissue section has been embedded
  • a variety of antigen retrieval procedures can be used in IHC.
  • Such methods can include, for example, applying heat (optionally with pressure) and/or treating with various proteolytic enzymes.
  • Methods can include microwave oven irradiation, combined microwave oven irradiation and proteolytic enzyme digestion, pressure cooker heating, autoclave heating, water bath heating, steamer heating, high temperature incubator, etc.
  • the sample may be incubated with a buffer that blocks the reactive sites to which the primary or secondary antibodies may otherwise bind.
  • Common blocking buffers include, e.g., normal serum, non-fat dry milk, bovine serum albumin (BSA), or gelatin, and various commercial blocking buffers.
  • BSA bovine serum albumin
  • the sample is then contacted with an antibody that specifically binds to the antigen whose detection is desired (e.g., an HR pathway protein). After an appropriate period of time, unbound antibody is then removed (e.g., by washing) and antibody that remains bound to the sample is detected.
  • a second stain may be applied, e.g., to provide contrast that helps the primary stain stand out.
  • Such a stain may be referred to as a“counterstain”.
  • Such stains may show specificity for discrete cellular compartments or antigens or stain the whole cell.
  • Examples of commonly used counterstains include, e.g., hematoxylin, Hoechst stain, or DAPI.
  • the tissue section can be visualized using appropriate microscopy, e.g., light microscopy, fluorescence microscopy, etc.
  • automated imaging system with appropriate software to perform automated image analysis is used.
  • a suitable IHC test for detecting an HR pathway protein is used in Ross-lnnes et al, (Nature 481 (7381 ):389-393, 2012); here IHC staining was performed on metastatic tumour samples.
  • flow cytometry (optionally including cell sorting) is used to detect expression of an HR pathway protein.
  • the use of flow cytometry would typically require the use of isolated cells substantially removed from the surrounding tissue microarchitecture, e.g., as a single cell suspension polypeptide level could be assessed by contacting cells with a labelled probe or antibody that binds to the protein of interest (e.g. the HR pathway protein) wherein said probe or antibody is appropriately labelled (e.g., with a fluorophore, quantum dot, or isotope) so as to be detectable by flow cytometry.
  • cell imaging can be used to detect the target subunit protein of the HR pathway protein.
  • an antibody for use in an immunological detection method is monoclonal.
  • an antibody is polyclonal.
  • an antibody is an antigen-binding portion of an intact antibody.
  • a ligand that specifically binds to an HR pathway protein but is not an antibody is used as an affinity reagent for detection of the HR pathway protein.
  • nucleic acid aptamers or certain non-naturally occurring polypeptides structurally unrelated to antibodies based on various protein scaffolds may be used as affinity reagents.
  • Examples include, e.g., agents referred to in the art as affibodies, anticalins, adnectins, synbodies, etc. See, e.g., Gebauer, M. and Skerra, A., Current Opinion in Chemical Biology, (2009), 13(3): 245-255 or
  • a non-affinity based method is used to assess the level of an HR pathway protein.
  • mass spectrometry could be used to detect and quantitate the amount of an HR pathway protein.
  • measured values can be normalized based on the expression of one or more RNAs or polypeptides whose expression is not correlated with a phenotypic characteristic of interest.
  • a measured value can be normalized to account for the fact that different samples may contain different proportions of a cell type of interest, e.g., cancer cells, versus non-cancer cells.
  • the percentage of stromal cells, e.g., fibroblasts may be assessed by measuring expression of a stromal cell-specific marker, and the overall results adjusted to accurately reflect target mRNA or polypeptide level specifically in the tumour cells.
  • a sample such a tissue section contains distinguishable (e.g., based on standard histopathological criteria), areas of neoplastic and non-neoplastic tissue, such as at the margin of a tumour, the level of target protein expression could be assessed specifically in the area of neoplastic tissue, e.g., for purposes of comparison with a control level, which may optionally be the level measured in the non-neoplastic tissue.
  • members/components of the 53BP1/RIF1/REV7/Shieldin 1 ,2 and 3 protein complex can be performed using any of the methods described above for HR, but adapted for the 53BP1/RIF1/REV7/Shieldin 1 ,2 and 3 protein complex member.
  • the DNA substrate is labelled with two dyes: a fluorophore (6-FAM) at the 3' end of the“template strand”, and a dark quencher (Iowa Black FQ) at the 5' end of the“nascent strand”.
  • the reaction efficiency is determined by measuring an increase in fluorescence emission at a wavelength of
  • First bar no EXD2; second bar - EXD2 (200 nM).
  • EXD2 is synthetic lethal with BRCA1 and BRCA2 deficiency
  • Germline mutations in the BRCA1/BRCA2 genes account for up to 80% of familial breast and ovarian cancer cases (King et al. , Science 302, 643-646, 2003; Prakash et al., Cold Spring Harbor Perspectives in Biology 7, a016600, 2015). In their absence, cells are unable to repaie DNA double strand breaks by homology directed repair and in addition, nascent DNA at the stalled replication forks is extensively degraded, likely contributing to BRCA1/2 associated genome instability and sensitivity to replication stress-inducing therapies (Chaudhuri et al., Nature 539, 456, 2016; Ceccaldi, R. et al. Nature 518, 258-262, 2015).
  • EXD2 a novel factor called EXD2 and showed that EXD2 is required for efficient repair of damaged DNA.
  • EXD2 cells show hypersensitivity to agents inducing collapse of DNA replication forks (Broderick et al., Nat Cell Biol 18, 271 -280, 2016).
  • EXD2 functionally interacts with the MRE11 nuclease (Broderick et al., Nat Cell Biol 18, 271 -280, 2016), a protein required for alternative end-joining we considered the possibility that the synthetic growth defect may reflect the loss of Alt- EJ to rescue unprotected forks.
  • This pathway relies on limited resection of DSBs by the MRE11 nuclease to generate short stretches of homology used to bridge the break Floward et al., PLoS genetics 11 , e1004943, 2015) and recent work has implicated Alt-EJ in survival of BRCA1 /2-deficient tumours (Ceccaldi, R. et al.
  • Alt-EJ was also significantly impaired in the absence of EXD2 (Fig. 1 1 and Fig. 3A).
  • Fig. 1 1 and Fig. 3A We confirmed this discovery using another approach based on the analysis of the frequency of chromosomal fusions.
  • EXD2r' ⁇ cells In support for a role of EXD2 in promoting Alt-EJ mechanism, we also noticed a dramatic deficiency of EXD2r' ⁇ cells to generate chromosome fusions (Fig. 3B), which are dependent on the alternative end-joining pathway (Alt-EJ) (Mateos-Gomez et al., Nature 518, 254-257, 2015).
  • EXD2 inhibition will contribute to BRCA-tumours killing by at least two mechanism (i) synthetic lethal interaction with BRCA1 /2-deficiency as well as (ii) an inhibition of development of resistance to PARPi treatment in these tumours via inactivation of the Alt-EJ pathway and synthetic lethal interaction with RIF1 (or other members of BRRES protein complex), which are frequently inactivated in BRCA- deficient tumours leading to PARPi resistance (Model, Fig. 8).
  • EXD2 is essential for survival of BRCA1 and BRCA2 mutant cells as well as cells deficient for RIF1 , a protein that is part of the 53BP1/RIF1/REV7/Shieldin complex, which frequent inactivation in BRCA-tumours is associated with resistance to PARPi treatment (Noordermeer et al. Nature, 560(7716): 1 17-121 , 2018; Mirman Z., et al. Nature, 560(7716): 1 12-1 16, 2018; Ghezraoui H., Nature, 560(7716): 122-127, 2018). .
  • HeLa, U20S and RPE1 EXD2 _/_ cells were generated as previously described (Broderick et al. , Nat Cell Biol 18, 271 -280, 2016) using CRISPR/CAS9 approach.
  • RPE1 EXD2 ND/ND were generated using following DNA oligos:
  • GTCTAATTCACTTCTAAGCAA (SEQ ID NO: 5)
  • Cell lysis was carried out in urea buffer (9 M urea, 50 mM Tris HCL, pH 7.3, 150 mM b-mercaptoethanol) followed by sonication using a soniprep 150 (MSE) probe sonicator.
  • MSE soniprep 150
  • cells were lysed in SDS loading buffer (2% SDS, 10% (v/v) glycerol, 2% 2-Mercaptoethanol and 62.5 mM Tris-HCI, pH 6.8) followed by boiling for 10 min. Samples were resolved by SDS-PAGE and transferred to PVDF or nitrocellulose. Protein concentrations were determined by Bradford assay by spectrophotometry using a NanoDrop 2000 device (Thermo Scientific).
  • Immunoblots were carried out using the indicated antibodies: a-Tubulin (Sigma, B-5-1 -2; T5168, 1 : 100,000), BRCA1 (Millipore, OP-92, 1 : 1000), BRCA2 (Millipore, OP-95, 1 : 1000), EXD2 (Sigma, HPA005848, 1 :1000), MCM2 (Abeam, ab4461 , 1 :10,000), MRE11 (Abeam, ab214, 1 :1000), PCNA (Santa-Cruz, PC-10, 1 :500).
  • a-Tubulin Sigma, B-5-1 -2; T5168, 1 : 100,000
  • BRCA1 Micropore, OP-92, 1 : 1000
  • BRCA2 Millipore, OP-95, 1 : 1000
  • EXD2 Sigma, HPA005848, 1 :1000
  • MCM2 Abeam, ab4461 , 1 :10,000
  • MRE11 Abe
  • Alamar Blue survival assays were performed in accordance with the manufacturer’s recommendations (Life Technologies). Briefly, 500 cells per well in 96-well plates were untreated or treated with indicated doses of camptothecin or ionising radiation and incubated for 7 days. Alamar blue reagent (Life Technologies) was added to each well and fluorometric measurements taken after 2h incubation at 37°C. For proliferation assays cells were seeded at 500 cells per well and Alamar blue reagent added and measurements taken each day as indicated.
  • RNAi treatment siRNAs employed were as follows, siBRCAI - ACCAUACAGCUUCAUAAAUAA, siBRCA2 (ON-TARGETplus SMART pool - Cat # L-003462-00-0005, Dharmacon.), siEXD2 - CAGAGGACCAGGUAAUUUA (SEQ ID NO: 3) and Dharmacon SMART POOL (Cat # L-020899-02-0005), siMRE11 - GGAGGUACGUCGUUUCAGA, ON- TARGETplus Non-targeting Pool (D-00180-10-20, Dharmacon), or siRNA targeting luciferase - CGTACGCGGAATACTTCGA (SEQ ID NO: 8) were used as control siRNAs where appropriate. Oligonucleotides were transfected using HiPerfect reagent (Qiagen), according to the manufacturer’s protocol.
  • micronuclei cells were analysed using a protocol adapted from (Broderick et al. , Nat Cell Biol 18, 271 -280, 2016). Briefly, cells were collected by mitotic shakeoff and spun onto poly-L-Lysine coated slides at 1000 x g for 3 min. Mitotic cells were then fixed using 4% PFA in PBS for 10 min at room temperature and mounted with Vectashield containing DAPI. Images were acquired using a Zeiss LSM 710 laser scanning confocal microscope with Zen software using a 63x objective. Image analysis was carried out with FIJI (ImageJ) software.
  • FIJI ImageJ
  • U20S EJ2-GFP cells (Gunn et al., The Journal of Biological Chemistry 286, 42470-42482, 2011 ) were transfected using Amaxa nucleofection with an l-Scel expression vector (pCMV-l-Scel) or a vector expressing mCherry fluorescent protein (pmCherry-C1 ). 72 hours after l-Scel transfection cells were harvested and analysed by flow cytometry (BD LSR II). 2x10 4 cells were analysed per experimental condition. Number of GFP-positive cells per 1000 m Cherry-positive cells was determined using BD FACS DIVA software. The data were then related in each experiment to siControl treated sample set as 1. Statistical significance was determined with the Student’s f-test.
  • chromosome banding staining slides were mounted with 0.1 pg/ml DAPI in Vectashield antifade medium (Vector Laboratories, Burlingame, CA). Images of chromosome spreads were captured using a x63 magnification lens on a fluorescent Axio-lmager Z1 , Zeiss microscope, equipped with a MetaSystems charge-coupled device camera and the MetaSystems Isis software. Chromosome lesions were recorded as breaks per chromosome number, per metaphase, in 75 metaphase spreads per condition, pooled from 3 independent experiments.
  • exonuclease activity is synthetic lethal with the deficiency in BRCA1/2 genes suggesting that EXD2 could be an effective target in cancer therapy (Example 1 ).
  • EXD2 could be an effective target in cancer therapy (Example 1 ).
  • the screen entails the use of oligonucleotides to generate a specific DNA substrate that is preferentially digested by purified EXD2 in vitro ( Figure 4, schematic A and Figure 5).
  • the DNA substrate is labelled with two dyes: a fluorophore (6-FAM) at the 3'end of the“template strand”, and a dark quencher (Iowa Black FQ) at the 5' end of the“nascent strand”.
  • the inhibitory activity of a compound with the potential to block EXD2 nuclease activity is determined by a reduction in fluorescence signal.
  • We tested this by using three candidate compounds predicted to have an inhibitory activity towards DEDD-type nucleases - (Fluang et al. , J. Med. Chem., 59(17):8019- 29, 2016).
  • ATA - Aurintricarboxylic acid
  • GST-His- EXD2 K76-V564 was purified as described previously (Broderick et al. , Nat Cell Biol 18, 271 -280, 2016). Briefly, GST protein expression was induced with 0.1 mM IPTG (isopropyl-p-d-thiogalactopyranoside) (Sigma-Aldrich) at 16°C for 18 hours. Bacteria were harvested by centrifugation and resuspended in lysis buffer containing 50 mM phosphate pH 8.0, 300mM NaCI, 1 mM DTT, 1 % Triton X-100, 10 mM imidazol and PMSF. Lysates were sonicated and cleared by centrifugation.
  • Glutathione HiCap Matrix (Qiagen) for 2 h with rotation at 4°C. Beads were washed with buffer containing increasing concentration of NaCI, elution buffer (50 mM Tris- HCI pH 7.0, 150 mM NaCI, 1 mM EDTA, 1 mM DTT, 0.2% Triton X-100) and resuspended in elution buffer supplemented with PreScission Protease (50 units/ml) (GE Healthcare) and incubated for 18 h with rotation at 4°C. Eluates were dialysed to buffer containing 20 mM Hepes-KOH pH7.2, 100 mM NaCI, 1 mM DTT, 10% glycerol, aliquoted and stored at -80°C.
  • elution buffer 50 mM Tris- HCI pH 7.0, 150 mM NaCI, 1 mM EDTA, 1 mM DTT, 0.2% Triton X-
  • ssDNA oligo was labelled using [y- 32 P] dATP and PNK enzyme (New England Biolabs).
  • ssDNA oligos were mixed in an equimolar ratio and annealed by heating at 100 °C for 5 min followed by gradual cooling to room temperature.
  • Exonuclease assays - was performed as in 2 . Briefly, reactions were carried out in a buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCI, 0.5 mM DTT, 10 mM MnCh, 0.05% Triton-X, 0.1 mg ml 1 BSA, 5% glycerol, and EXD2 protein and initiated by adding substrate and incubated at 37 °C for the indicated amounts of time.
  • the resection reaction was carried out as outlined above (in vitro nuclease assay). Fluorescence was measured using a SpectraMax M5 instrument (Molecular Devices) (Ex 494 nm, Em 519 nm, Cutoff 515 nm).

Abstract

L'invention concerne le domaine du cancer. En particulier, l'invention concerne des procédés de sélection de patients et des procédés de traitement de cancers qui utilisent une approche de létalité synthétique, des cancers qui sont déficients en recombinaison homologue (HR) étant de préférence supprimés lorsqu'ils sont traités avec un agent capable d'inhiber EXD2. L'invention concerne également des procédés de criblage d'inhibiteurs d'EXD2 destinés à être utilisés dans les procédés de traitement de l'invention.
PCT/GB2020/051522 2019-06-25 2020-06-24 Inhibiteur d'exd2 pour le traitement du cancer WO2020260870A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1909135.4 2019-06-25
GBGB1909135.4A GB201909135D0 (en) 2019-06-25 2019-06-25 Means and methods for treating cancer

Publications (1)

Publication Number Publication Date
WO2020260870A1 true WO2020260870A1 (fr) 2020-12-30

Family

ID=67511677

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2020/051522 WO2020260870A1 (fr) 2019-06-25 2020-06-24 Inhibiteur d'exd2 pour le traitement du cancer

Country Status (2)

Country Link
GB (1) GB201909135D0 (fr)
WO (1) WO2020260870A1 (fr)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US626550A (en) 1899-06-06 Valve
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5580717A (en) 1990-05-01 1996-12-03 Affymax Technologies N.V. Recombinant library screening methods
US5733743A (en) 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO2009140039A2 (fr) 2008-04-23 2009-11-19 The Arizona Board Of Regents Acting For And On Behalf Of Arizona State University Anticorps synthétiques

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US626550A (en) 1899-06-06 Valve
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US5580717A (en) 1990-05-01 1996-12-03 Affymax Technologies N.V. Recombinant library screening methods
US5565332A (en) 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5733743A (en) 1992-03-24 1998-03-31 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
WO2009140039A2 (fr) 2008-04-23 2009-11-19 The Arizona Board Of Regents Acting For And On Behalf Of Arizona State University Anticorps synthétiques

Non-Patent Citations (47)

* Cited by examiner, † Cited by third party
Title
AGASTI ET AL., J AM CHEM SOC., vol. 134, no. 45, 2012, pages 18499 - 18502
ANN REV BIOCHEM., vol. 82, 2013, pages 775 - 797
ANSEL ET AL.: "Pharmaceutical Dosage Forms and Drug Delivery Systems", 2004, NATIONAL CENTER FOR ADVANCING TRANSLATIONAL SCIENCES
ATSUSHI SHIBATA ET AL., MOLECULAR CELL, vol. 53, no. 1, 2014, pages 7 - 18
BARTOSOVAKREJCI, FEBS LETT., vol. 588, 2014, pages 2446 - 56
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426
BRODERICK ET AL., NAT CELL BIOI, vol. 18, 2016, pages 271 - 280
BRODERICK ET AL., NAT CELL BIOL, vol. 18, 2016, pages 271 - 280
BUCK ET AL., IN VITRO, vol. 18, 1982, pages 377 - 381
CHAUDHURI ET AL., NATURE, vol. 539, 2016, pages 456
CHEN ET AL., HUMAN GENE THERAPY., vol. 5, no. 5, 1994, pages 595 - 601
CHEN ET AL., PRECISION ONCOLOGY, vol. 1, no. 37, 2017
CIESIOLKA ET AL., RNA, vol. 1, 1995, pages 538 - 550
COLAS ET AL., NATURE, vol. 380, 1996, pages 548 - 550
CREW ET AL., J. MEDICINAL CHEMISTRY, 2017
DREAN, A. ET AL.: "Modeling Therapy Resistance in BRCA1/2-Mutant Cancers", MOLECULAR CANCER THERAPEUTICS, vol. 16, 2017, pages 2022 - 2034
GEBAUER, M.SKERRA, A., CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 13, no. 3, 2009, pages 245 - 255
GUNN ET AL., THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 286, 2011, pages 42470 - 42482
HARLOWLANE: "Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS
HOLLIGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448
HOPPE ET AL., J NATL CANCER INST., vol. 110, no. 7, 2018, pages 704 - 713
HOWARD ET AL., PLOS GENETICS, vol. 11, 2015, pages e1004943
HUANG ET AL., J. MED. CHEM., vol. 59, no. 17, 2016, pages 8019 - 29
HUGHES-DAVIES ET AL., CELL, vol. 115, pages 523 - 535
HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883
K.K. KHANNAS.P. JACKSON, NAT. GENET., vol. 27, no. 3, 2001, pages 247 - 254
KIBBE ET AL.: "Remington: The Science and Practice of Pharmacy with Facts and Comparisons: Drugfacts Plus", 2000, PHARMACEUTICAL PRESS
KING ET AL., SCIENCE, vol. 302, 2003, pages 643 - 646
KOHLERMILSTEIN, NATURE, vol. 256, 1975, pages 495 - 497
MATEOS-GOMEZ ET AL., NATURE, vol. 518, 2015, pages 254 - 257
MCCABE NUALA ET AL: "Deficiency in the repair of DNA damage by homologous recombination and sensitivity to poly(ADP-ribose) polymerase inhibition", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 66, no. 16, 15 August 2006 (2006-08-15), pages 8109 - 8115, XP002482543, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-06-0140 *
MCCAFFERTY ET AL., NATURE, vol. 348, 1990, pages 552 - 553
NIEMINUSZCZY JADWIGA ET AL: "EXD2 Protects Stressed Replication Forks and Is Required for Cell Viability in the Absence of BRCA1/2", MOLECULAR CELL, ELSEVIER, AMSTERDAM, NL, vol. 75, no. 3, 26 June 2019 (2019-06-26), pages 605, XP085796961, ISSN: 1097-2765, [retrieved on 20190626], DOI: 10.1016/J.MOLCEL.2019.05.026 *
POLJAK ET AL., STRUCTURE, vol. 2, 1994, pages 1121 - 1123
PRAKASH ET AL., COLD SPRING HARBOR PERSPECTIVES IN BIOLOGY, vol. 7, 2015, pages a016600
RADICE P., J EXP CLIN CANCER RES., vol. 21, no. 3, 2002, pages 9 - 12
RONAN BRODERICK ET AL: "EXD2 promotes homologous recombination by facilitating DNA end resection", NATURE CELL BIOLOGY, vol. 18, no. 3, 25 January 2016 (2016-01-25), GB, pages 271 - 280, XP055729745, ISSN: 1465-7392, DOI: 10.1038/ncb3303 *
ROSS-INNES ET AL., NATURE, vol. 481, no. 7381, 2012, pages 389 - 393
STOLTENBURG, J. ANAL. METH. CHEM. 2012, 2012, pages 415697
STOVER ET AL., CLINICAL CANCER RESEARCH, 27 September 2016 (2016-09-27)
SYLVIE M NOORDERMEER ET AL., NATURE, vol. 560, no. 7716, 2018, pages 117 - 121
SYLVIE M. NOORDERMEERHAICO VAN ATTIKUM, TRENDS IN CELL BIOLOGY, vol. 29, no. 10, 2019
THOMAS: "The Metabolic Enzyme Hexokinase 2 Localizes to the Nucleus in AML and Normal Hematopoietic Stem/Progenitor Cells to Maintain Stemness | Blood | American Society of Hematology", BLOOD, VOLUME 134, PAGE 2532, 13 November 2019 (2019-11-13), pages 2532 - 2532, XP055729886, Retrieved from the Internet <URL:https://ashpublications.org/blood/article/134/Supplement_1/2532/423253/The-Metabolic-Enzyme-Hexokinase-2-Localizes-to-the> [retrieved on 20200911] *
TRAVIS H. STRACKER: "EXD2: A new regulator of mitochondrial translation and potential target for cancer therapy", MOLECULAR & CELLULAR ONCOLOGY, vol. 5, no. 3, 27 March 2018 (2018-03-27), pages e1445943, XP055729759, DOI: 10.1080/23723556.2018.1445943 *
TUERKGOLD, SCIENCE, vol. 249, no. 4968, 1990, pages 5Q5 - 10
WINTER ET AL., ANNU. REV. IMMUNOL., vol. 12, 1994, pages 433 - 455
WOOD ET AL., SCIENCE, vol. 291, 2001, pages 1284 - 1289

Also Published As

Publication number Publication date
GB201909135D0 (en) 2019-08-07

Similar Documents

Publication Publication Date Title
Gallo et al. CCNE1 amplification is synthetic lethal with PKMYT1 kinase inhibition
Sandoval et al. Binding of TMPRSS2-ERG to BAF chromatin remodeling complexes mediates prostate oncogenesis
Lin et al. Anaplasma phagocytophilum AnkA secreted by type IV secretion system is tyrosine phosphorylated by Abl‐1 to facilitate infection
Wen et al. Recurrent ECSIT mutation encoding V140A triggers hyperinflammation and promotes hemophagocytic syndrome in extranodal NK/T cell lymphoma
US10202605B2 (en) Methods of identifying and treating poor-prognosis cancers
US20230374603A1 (en) Synthetic lethality and the treatment of cancer
US20170114124A1 (en) SLIT-ROBO-Myo9-RHOA PATHWAY AND CANCER
Liao et al. Chromosomal translocation-derived aberrant Rab22a drives metastasis of osteosarcoma
Yan et al. DNA methylation reactivates GAD1 expression in cancer by preventing CTCF-mediated polycomb repressive complex 2 recruitment
JP2017516463A (ja) Ｆｇｆｒ融合体
US20210388040A1 (en) Non-canonical swi/snf complex and uses thereof
WO2015005473A1 (fr) Procédé de prédiction de réponse d&#39;un cancer à un traitement
Zhao et al. RNA‐binding protein Musashi2 stabilizing androgen receptor drives prostate cancer progression
WO2013075237A1 (fr) Mutations des protéines histones associées aux troubles prolifératifs of
Desplancq et al. Targeting the replisome with transduced monoclonal antibodies triggers lethal DNA replication stress in cancer cells
US20140142180A1 (en) Methods of treating tumors having elevated mct1 expression
Liu et al. Hypoxia-induced proteasomal degradation of DBC1 by SIAH2 in breast cancer progression
Na et al. SPRTN protease-cleaved MRE11 decreases DNA repair and radiosensitises cancer cells
Guo et al. Linear ubiquitination of PTEN impairs its function to promote prostate cancer progression
WO2017073619A1 (fr) Procédé de détermination de la présence/absence de développement d&#39;un lymphome malin ou d&#39;une leucémie, et médicament pour le traitement et/ou la prévention de la leucémie
Shijie et al. Deregulation of CLTC interacts with TFG, facilitating osteosarcoma via the TGF‐beta and AKT/mTOR signaling pathways
Wang et al. BCAS2, a protein enriched in advanced prostate cancer, interacts with NBS1 to enhance DNA double-strand break repair
CN114045336B (zh) Cga基因作为靶点在制备用于诊断和治疗耐药实体瘤药物的应用
Li et al. Pro-prion, as a membrane adaptor protein for E3 ligase c-Cbl, facilitates the ubiquitination of IGF-1R, promoting melanoma metastasis
WO2020260870A1 (fr) Inhibiteur d&#39;exd2 pour le traitement du cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20735662

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20735662

Country of ref document: EP

Kind code of ref document: A1