WO2020249946A1

WO2020249946A1 - Assays and inhibitors of oxygen-dependent n-terminal oxidation

Info

Publication number: WO2020249946A1
Application number: PCT/GB2020/051401
Authority: WO
Inventors: Emily Gudrun FLASHMAN; Peter John Ratcliffe; Mark David WHITE; Norma Masson; Thomas Peter KEELEY; Francesco LICAUSI; Beatrice GIUNTOLI; Pierdominico PERATA
Original assignee: Oxford University Innovation Limited
Priority date: 2019-06-11
Filing date: 2020-06-10
Publication date: 2020-12-17
Also published as: GB201908332D0

Abstract

The invention relates to cyclised peptide or peptidomimetic inhibitors of cysteamine (2- aminoethanethiol) dioxygenase (ADO) and methods for identifying and producing inhibitors of ADO. The invention also relates to the use of inhibitors of ADO to modulate protein activity, stability and/or degradation, to treat conditions associated with hypoxia.

Description

ASSAYS AND INHIBITORS OF OXYGEN-DEPENDENT N-TERMINAL

OXIDATION

Field of the invention

The disclosure relates to methods for assaying cysteamine (2-aminoethanethiol) dioxygenase (ADO)-related activities, in particular ADO-catalysed N-terminal cysteine oxidation, to methods of identifying modulators of ADO activity, to peptidomimetic or cyclised peptide inhibitors of ADO activity, and to uses thereof.

Background to the Invention

Organisms must respond to hypoxia to preserve oxygen homeostasis. Oxygen homeostasis is critical for most forms of life, and is impaired in most human diseases. Previous work identified the hypoxia inducible factor (HIF) hydroxylases as human oxygen sensors (1).

These regulatory enzymes are 2-oxoglutarate (2-OG) dependent dioxygenases, with high K_mO₂ values, which catalyze trans- 4-prolyl hydroxylation of the transcription factor HIF (2, 3), to target it for proteolysis. Hence they regulate a broad range of transcriptional responses to hypoxia (reviewed in (4)). Although the prolyl hydroxylation of HIF was unprecedented as a signaling system, subsequent work has revealed different systems of enzymatic protein oxidation, which signal hypoxia in representatives of all four eukaryotic kingdoms (5-7). In each system the protein oxidation event is linked to protein degradation.

According to the Cys-branch of the N-degron pathway(8), following the action of methionine aminopeptidases, oxidation of protein N-terminal cysteines creates a substrate for arginyl-transferases. Arginyl-transferases catalyze addition of this N-terminal destabilizing residue, promoting degradation of the protein. No cysteine-modifying enzyme was defined in humans, but N-terminal cysteine oxidation was shown to be affected by nitric oxide (9), and based on in vitro studies, cysteine oxidation has been considered likely to be non-enzymatic.

Subsequently, in plants, it was shown that the Cys-branch of the N-degron pathway controls the stability of ethylene response transcription factors (ERF-VII) (10, 11). Further studies in

Arabidopsis thaliana revealed that Cys-oxidation is catalyzed by a series of plant cysteine oxidases (PCOs), which act as oxygen sensors directing hypoxic adaptation (7, 12). White et al.

2018 J Biol Chem, demonstrates PCOs as oxygen sensors. However, enzymatic oxidation of protein

N-terminal cysteines has not been reported in animals. Summary of the Invention

The present inventors have identified a thiol oxidase, previously assigned as cysteamine (2-aminoethanethiol) dioxygenase (ADO), as a high K_mO₂ N-terminal cysteine dioxygenase that transduces the oxygen-regulated stability of proteins by the N-degron pathway in human cells. The inventors have developed a method for assaying the newly discovered activity of ADO, for identifying protein and peptide substrates and modulators of ADO N-terminal cysteine protein oxidation activity, and new uses thereof.

Accordingly in a first aspect the disclosure provides a peptidomimetic or cyclised peptide or peptidomimetic inhibitor of cysteamine (2-aminoethanethiol) dioxygenase (ADO), wherein the peptidomimetic or cyclised peptide or peptidomimetic inhibitor has the amino acid and/or amino acid mimetic sequence of a polypeptide or peptidomimetic substrate of ADO-catalysed N- terminal cysteine oxidation, except for (a) the substitution of an N-terminal cysteine in the substrate with a cysteine analogue in the inhibitor; and/or (b) cyclisation of the polypeptide or peptidomimetic substrate, and wherein the peptidomimetic and/or cyclised peptide is an inhibitor of ADO N-terminal cysteine protein oxidation activity.

In a further aspect the disclosure provides method of treating hypoxia, hypoxic disease, cardiovascular disease, ischaemic disease, myocardial ischaemia, renal ischaemia, cerebral ischaemia, cancer, a neurological or psychiatric disease, obesity, diabetes, or HIV, of increasing immune or inflammatory responses, or of reducing the side-effects and/or promoting the analgesic action of an opiate drug, wherein the method comprises administering to a subject in need thereof a peptidomimetic or cyclised peptide or peptidomimetic inhibitor of cysteamine (2- aminoethanethiol) dioxygenase (ADO), wherein the peptidomimetic or cyclised peptide or peptidomimetic inhibitor has the amino acid and/or amino acid mimetic sequence of a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation, except for (a) the substitution of a N-terminal cysteine in the substrate with a cysteine analogue in the inhibitor; and/or (b) cyclisation of the polypeptide or peptidomimetic substrate, and wherein the peptidomimetic and/or cyclised peptide is an inhibitor of ADO N-terminal cysteine protein oxidation activity.

In further aspects, the disclosure provides a peptidomimetic or cyclised peptide or peptidomimetic inhibitor of cysteamine (2- aminoethanethiol) dioxygenase (ADO) for use in a method of treating hypoxia, cardiovascular disease, cancer, neurological or psychiatric disease, obesity, diabetes, or HIV, of increasing immune or inflammatory responses, or of reducing the side- effects and/or promoting the analgesic action of an opiate drug, wherein the peptidomimetic or cyclised peptide or peptidomimetic inhibitor has the amino acid and/or amino acid mimetic sequence of a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation, except for (a) the substitution of a N- terminal cysteine in the substrate with a cysteine analogue in the inhibitor; and/or (b) cyclisation of the polypeptide or peptidomimetic substrate, wherein the

peptidomimetic and/or cyclised peptide or peptidomimetic is an inhibitor of ADO N- terminal cysteine protein oxidation activity, and wherein the method comprises administering the peptidomimetic and/or cyclised peptide or peptidomimetic inhibitor of ADO to a subject in need thereof;

use of a peptidomimetic or cyclised peptide or peptidomimetic inhibitor of cysteamine (2-aminoethanethiol) dioxygenase (ADO) in the manufacture of a medicament for treating hypoxia, cardiovascular disease, cancer, neurological or psychiatric disease, obesity, diabetes, or HIV, of increasing immune or inflammatory responses, or of reducing the side-effects and/or promoting the analgesic action of an opiate drug, wherein the peptidomimetic or cyclised peptide or peptidomimetic inhibitor has the amino acid and/or amino acid mimetic sequence of a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation, except for (a) the substitution of a N-terminal cysteine in the substrate with a cysteine analogue in the inhibitor; and/or (b) cyclisation of the polypeptide or peptidomimetic substrate, wherein the peptidomimetic and/or cyclised peptide or peptidomimetic is an inhibitor of ADO N-terminal cysteine protein oxidation activity, and wherein the method comprises administering the peptidomimetic and/or cyclised peptide or

peptidomimetic inhibitor of ADO to a subject in need thereof.

In a further aspect the disclosure provides a method for producing an inhibitor of ADO

N-terminal cysteine protein oxidation activity, the method comprising (i) substituting an N- terminal cysteine of a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation with a cysteine analogue; or (ii) cyclising a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation.

In a further aspect the disclosure provides a method for identifying a peptide, protein or peptidomimetic substrate for ADO-catalysed N-terminal cysteine oxidation, the method comprising (i) contacting ADO with a peptide, protein or peptidomimetic having an N-terminal cysteine; (ii) measuring dioxygenation of the peptide, protein or peptidomimetic; and (iii) identifying a peptide, protein or peptidomimetic that is dioxygenated in the presence of ADO, or a protein having a N-terminal amino acid sequence corresponding to a peptide that is dioxygenated in the presence of ADO, as a substrate for ADO-catalysed N-terminal cysteine oxidation.

In a further aspect the disclosure provides a method for assaying for ADO N-terminal cysteine oxidation activity, the method comprising (i) contacting ADO with a polypeptide or peptidomimetic having an N-terminal cysteine; and (ii) measuring dioxygenation of the N- terminal cysteine.

In a further aspect the disclosure provides a method for identifying an inhibitor of ADO N-terminal cysteine protein oxidation activity, the method comprising (i) contacting ADO with a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation in the presence of a test agent; (ii) measuring reduced dioxygenation of the substrate in the presence of the test agent; and (iii) identifying the test agent as an inhibitor of ADO N-terminal cysteine protein oxidation activity.

In a further aspect the disclosure provides an inhibitor of ADO N-terminal cysteine protein oxidation activity for use in a method of modulating the expression or activity of a protein, increasing the stability of a protein or decreasing degradation of a protein.

In a further aspect the disclosure provides an inhibitor of ADO N-terminal cysteine protein oxidation activity for use in a method of promoting angiogenesis or of promoting cell survival or decreasing cellular damage in a cell or tissue exposed to a hypoxic environment.

In a further aspect the disclosure provides a method of promoting angiogenesis or of promoting cell survival or decreasing cellular damage in a cell exposed to a hypoxic

environment, the method comprising contacting the cell with an inhibitor of ADO. In a further aspect the disclosure provides a method for identifying a modulator of oxygen-dependent protein degradation or activity the method comprising (i) contacting a cell that expresses ADO with a test agent; and (ii) determining whether the test agent modulates ADO- regulated degradation or activity of proteins expressed in the cell.

The disclosure will now be described in more detail, by way of example and not limitation, and by reference to the accompanying drawings. Many equivalent modifications and variations will be apparent, to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the disclosure set forth are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the scope of the disclosure. All documents cited herein, whether supra or infra, are expressly incorporated by reference in their entirety.

The present disclosure includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or is stated to be expressly avoided. As used in this specification and the appended claims, the singular forms“a”,“an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to“a peptide” includes two or more such peptides.

Section headings are used herein for convenience only and are not to be construed as limiting in any way.

Description of the Figures

Fig. 1 - Comparison of changes in RAP_1-5 GFP:V5 reporter protein and transcript level in cells exposed to hypoxia or dipyridyl.

U-2OS cells stably expressing a wild-type RAP_1-5 GFP:V5 reporter ( RAP_1-5 V5) or its C2A mutant ( RAP_1-5 (C2A):V5) were exposed to (A) hypoxia (1% O₂) or (B) dipyridyl (2,2DIP, 100mM) for 4 h. The effect of the treatments on reporter transcript levels are shown as mean ±

SD n=4, alongside representative protein immunoblots from cells harvested in parallel. RAP_1- ₅₀:GFP-V5 transcript level is unaffected by exposure to hypoxia or dipyridyl, while RAP_1- ₅₀:GFP:V5 protein level is increased.

Fig. 2 - Regulation of plant and animal N-degron substrates by oxygen in human cells. (A) Levels of fusion proteins linking the N-terminal 1-50 residues of plant RAP2.12 or a C2A mutant to a GFP:V5 cassette (RAP_1-5 V5; RAP_1-5(C2A):V5) in stably transfected U-2OS cells exposed to hypoxia or the indicated inhibitors. (B) RAP_1-5 V5 reporter protein half-life in cells incubated in hypoxia (16 h, 1% O₂) then treated with cycloheximide (100 mM, 10min), then maintained in hypoxia or re-oxygenated for the indicated times. (C) Expression of C-terminal hemagglutinin (HA) tagged human RGS4, (RGS4:HA) or a C2A mutant in stably transfected RKO cells exposed to hypoxia or inhibitors. (D and E) Expression of endogenous RGS4 and RGS5 proteins in SH-SY5Y cells exposed to inhibitors (D) or graded hypoxia (E). Similar patterns of response were observed for the plant fusion-protein reporter, transfected RGS4:HA and endogenous RGS4/5 proteins; responses of exogenous proteins were abolished by C2A mutation. 2,2 DIP, 2,2-dipyridyl (100 mM); DFO, desferrioxamine (100 mM); DMOG, dimethyloxalylglycine (1 mM); PHI, N-terminal cysteine oxidation inhibitor (125 mM); MG132, proteasomal inhibitor (25 mM). All exposures of cells to hypoxia or inhibitors were for 4 h unless otherwise indicated. In panel A HIF-1a immunoblots are provided for comparison.

Fig. 3 - Quantification of RAP2.12 fusion protein half-life under hypoxic and

reoxygenated conditions.

U-2OS cells stably expressing a wild-type RAP_1-5: GFP:V5 reporter ( RAP_1-5:V5) were exposed to hypoxia (1% O₂) for 16 h, then treated with cycloheximide (100mM, 10min), then maintained in hypoxia or re-oxygenated for the indicated times. Densitometric analysis of blots shown in Fig. 2B, and two further independent experiments were conducted, plotted against time and subjected to exponential decay regression analysis to determine a half-life (t_1/2), as indicated on the graph.

Fig. 4 - Concordant regulation of plant RAP2.12 and animal RGS4 fusion protein reporters in different human cells.

U-2OS cells (A and B) or RKO cells (C and D) stably expressing either the wild type or C2A mutant RAP_1-5:GFP:V5 reporters (RAP_1-5 V5, A and C) or wild-type RGS4_1-20:GFP (B and D) fusion proteins. Immunoblots show fusion protein levels in cells exposed to hypoxia (1% O₂) or dipyridyl (2,2DIP, 100 mM) for 4 h. In A and B, HIF-1a immunoblots are shown for comparison.

Fig. 5 - Levels of transcript and protein for RGS4 and RGS5 in human and mouse cell lines exposed to graded hypoxia. Human SH-SY5Y, RKO and EA.hy926 cells, and mouse C3H/10T1/2 cells were subjected to 5,

1 or 0.2% O₂ for 4 h and lysates collected for analysis of mRNA and protein expression in parallel. Only SH-SY5Y cells exhibited detectable expression of RGS5 protein, whereas all cells expressed RGS4. In SH-SY5Y cells, RGS4 transcript showed induction by hypoxia which was not observed in RKO, EA.hy926 or C3H/10T1/2 cells. In contrast, when expressed at detectable levels, both RGS4 and RGS5 protein increased proportionally to the decline in O₂ in all cell types tested, even in the absence of changes in transcript level. Data are mean ± S.D. n=3.

Fig. 6 - ADO controls the oxygen dependent Cys-branch of the N-degron pathway.

(A) RGS4:HA and RGS4(C2A):HA protein levels in 293T cells after co-expression with either control (EV), ADO, CDO1 or PCO1. Cells were exposed to hypoxia (0.5% O₂, 16 h) or maintained in air. Comparable enzyme levels were confirmed by separate FLAG- immunoblotting. (B) Expression of endogenous RGS4 and RGS5 proteins in ADO-deficient SH-SY5Y cells (ADO KO); RGS4 and RGS5 are constitutive and insensitive to iron chelators or hypoxia. (C) Over-expression of ADO does not repress constitutive stabilization of RGS5 in ATE 1 -deficient (ATE1 KO) cells. (D) Expression of human ADO restores wild type phenotype in 4pco A. thaliana mutants; 3pco mutants which did not manifest this phenotype were unaffected by ADO. (E) Box plots showing relative mRNA level of hypoxia-inducible genes in wild type and pco mutant plants that express ADO. ADO significantly reduced expression of the hypoxia-inducible genes PDC1 , ADH, LBD41 and SAD6 in 4pco mutants, Mean ± S.D. *P<0.05; Mann- Whitney Rank Sum Test) with levels of non-hypoxia-inducible genes unchanged (Fig.

12). (F) Relative luciferase activity (Fluc/Rluc) in S. cerevisiae cells expressing C-DLOR (Cys) or A-DLOR (Cys to Ala mutant) reporter under aerobic and hypoxic conditions in the presence or absence of human ADO or CDO1 , mean ± S.D. *P<0.05; 2-way ANOVA followed by Holm- Sidak post hoc test.

Fig. 7 - Effect of catalytic inhibition or genetic inactivation of overexpressed ADO on the expression ofRGS4:HA.

293T cells were transiently co-transfected with the RGS4:HA reporter, together with empty vector (EV), or vector expressing either WT ADO (ADO) or a catalytically inactive mutant -

( H112A, H114A). (A) Transfected cells were exposed to dipyridyl (2,2DIP, 100 mM) or hypoxia

(1% O₂), or both for 16 h. Catalytic inhibition by combined iron chelation and hypoxia was able to overcome the action of overexpressed ADO on RGS4:HA. (B) Genetic inactivation of ADO by a H112A+H114A mutation prevents the ability of overexpressed ADO to suppress hypoxic stabilization of RGS4:HA.

Fig. 8 - Regulation of RGS proteins by hypoxia in CDO 1 -deficient cells.

Immunoblots illustrate the up-regulation of RGS4_1-20:GFP fusion protein together with endogenous RGS4 in and RGS5 by hypoxia (0.1% O₂ for 4h) in CDO 1 -deficient RKO cells (A) and endogenous RGS5 in CDO1 -deficient SH-SY5Y cells (B).

Fig. 9 - Regulation of RGS4-HA and endogenous RGS4 in ADO-defiicient and ADO re- expressing RKO cells.

(A) Immunoblots showing RGS4:HA in wild-type and ADO-deficient RKO cells exposed to hypoxia (0.5% O₂) or dipyridyl (2,2 DIP, 100mM) for 4h. (B) ADO-deficient RKO cells transduced with lentivirus expressing the indicated enzymes or empty vector (EV); ADO and PCO1 repress RGS4:HA and restore regulation by hypoxia, whereas CDO1 has no effect.

Similar levels of ADO, CDO1 and PCO1 were verified using parallel immunoblots. HIF-1a immunoblots demonstrate the effect of hypoxia and dipyridyl. (C) Wild-type and ADO-deficient RKO cells exposed to hypoxia, dipyridyl, or desferrioxamine (DFO, 100mM) for 4 h. The response of endogenous RGS4 to these treatments is abrogated in ADO deficient cells.

Fig. 10 - Effect of nitric oxide on RGS4 levels.

Wild-type or ADO-deficient SH-SY5Y and RKO cells were treated with the NO donor 2,2'- (hydroxynitrosohydrazono)bis-ethanimine (DETA NONOate, 100 mM) for 4 h under normoxic or hypoxic (0.5% O₂) conditions. RGS4 accumulation during hypoxia was attenuated in the presence of NO in wild-type, but not ADO-deficient, cells. Densitometric analysis from three independent blots is shown, with significance assessed by 2-way ANOVA, *p<0.05.

Fig. 11 - Regulation of RGS5 in ADO-deficient SH-SY5Y cells expressing ADO, CDO1 or

PCO1.

Re-expression of ADO and overexpression of PCO1, but not CDO1 , in ADO-deficient SH- SY5Y cells suppresses expression of RGS5. Comparable protein levels of each enzyme were verified by immunoblotting. High levels of transfected protein allow ADO, but not PCO1, to overcome effective inhibition by hypoxia. The HIF-1a immunoblot demonstrates that HIF-1 was unaffected by overexpression of these enzymes.

Fig. 12 - Regulation of plant gene expression and Fluc/Rluc reporter by human ADO and CDO1. (A) Box plots showing relative mRNA level of ACT2 and At2g28390, two genes whose expression is not affected by ERF -VII activity and hypoxia, in plants corresponding to wild-type Arabidopsis plants and pco mutants that express human ADO. (B) and (C) In contrast with ADO, expression of human CDO1 did not restore wild-type phenotype (B) and did not counteract the induction of anaerobic genes ( PDC1 , ADH, LBD41 and SAD 6) (C) in 4pco A. thaliana mutants; a different pPCO1 :ADO line from the one shown in Figure 6F was analyzed as an independent control (line #2). Box plots show relative mRNA levels (n=5), asterisks indicate statistically significant difference (*0.01<p<0.05, **0.001<p<0.01, ***p<0.001) according to the Mann- Whitney Rank Sum Test for PDC1, ADH, LBD41 and SAD6. A student's t-test was used for ACT2 and At2g28390. (D) ADO, but not CDO1, reduces the stability of a RAP_1-28-Fluc reporter in transiently transfected mesophyll protoplasts from wild type A. thaliana. The unrelated enzyme b-glucuronidase (GUS) was included as a control. Five iig of each effector plasmid were used, along with 2.5 mg reporter plasmid. (E) Effect of increasing amount of ADO on RAP_1-28- Fluc activity. Titration of the ADO effector plasmid is shown. Asterisks indicate statistically significant difference from the control (**0.001<p<0.01, ***p<0.001), according to the Holm- Sidak test.

Fig. 13 - The effects of thiol dioxidase expression on the RAP2.12-based dual luciferase reporter stability in yeast.

(A) Structure and processing of the Dual Luciferase Oxygen Reporter (DLOR), based on the ubiquitin fusion devised by Bachmair et al.(27). Deubiquitinating enzymes (DUB) separate Renilla reniformis luciferase, fused to a 1-76 fragment of the Arabidopsis UBQ1 protein

(Q42202-1) (pale purple), from Photinus pyralis luciferase, preceded by a 2-28 fragment of the RAP2.12 protein (green) exposing either a Cys, (C-DLOR), or an Ala residue (A-DLOR) at the N-terminus. (B) Representative immunoblots of RAP_2-28-FIUC and Rluc-UBQ fragments in yeast cells bearing C-DLOR and expressing either vector control (GUS), ADO or CDO1 (confirmed by real time quantitative PCR). (C) Densitometric analysis from two independent experiments. Expression of ADO, but not CDO1 , reduces RAP_2-28-FLUC abundance in S. cerevisiae cells in air. Hypoxia corresponds to 6 h treatment at 1 % O₂.

Fig. 14 - Phylogenetic analysis of PCO/ADO domain containing proteins.

(A) Phylogenetic tree of PCO/ADO domain containing proteins from selected representative species, determined by the Maximum Likelihood method. (B) A graphical illustration of the conserved PCO/ADO domain, determined using a hidden Markov model based on the annotated PCO/ADO domain across all UniProt-verified sequences within the Pfam database (EMBL- EBI). Highest amino-acid conservation was observed within the regions between amino acids 48-75 and 1 17-157, which conform to the known sequences of cupin domains (15). Residues corresponding to H1 12 and H114 of the human ADO sequence, mutated to produce a catalytically inactive enzyme in Figs. 7 and 21 , have been annotated. (C) Summary of the number of species possessing a PCO/ADO-like protein (left column), and the total number of PCO/ADO-like proteins (right column) within each Kingdom, identified within the Pfam database. Numbers in brackets give the percentage of the total number of species/proteins so identified across all Kingdoms, respectively.

Fig. 15 - ADO catalyzes the dioxygenation of the N-terminal Cys ofRGS4/5 peptides.

(A) MS spectra show a mass shift of +32 Da when RGS5 N-terminal peptide was incubated with recombinant human ADO, but not with recombinant human CDO 1. Similar results were obtained when an RGS4 N-terminal peptide was used (Fig. 16). (B) The ADO-catalyzed +32 Da mass addition is absent when reactions were conducted under anaerobic (100% N₂) conditions; ¹⁸O labelling demonstrates incorporation of 2 oxygen atoms derived directly from molecular O₂ and not H₂O. (C) Summary table of reaction kinetics for ADO-catalyzed dioxygenation of N- terminal RGS4/5 peptides. The influence of varying peptide concentration under atmospheric conditions (k_catPep and K_mPep^app) and O₂ levels using a fixed, non-limiting concentration of peptide (k_catO₂ and K_mO₂ ^app) were examined to determine sensitivities to both substrates. Source data are in Fig. 18.

Fig. 16 - Modification of the RGS4 N-terminal peptide.

(A) Purified recombinant human ADO or CDO1 , as used in the described assays, displayed by Coomassie stain following SDS-PAGE (molecular weights indicated in kDa). (B) Mass spectrometry (LC-MS) analyses of the indicated RGS4 N-terminal peptide, incubated aerobically with or without recombinant ADO or CDO1 (1h; 37°C).

Fig. 17 - MS² spectra of RGS4 and 5 N-terminal peptides before and after incubation with recombinant ADO.

Fragmentation ion spectra derived from RGS4 (A) and RGS5 (B) N-terminal peptides incubated with (lower panels) or without (upper panels) recombinant ADO. Fragment assignment revealed that in each case incubation with ADO resulted in a mass addition of 32 Da on the N-terminal cysteine.

Fig. 18 - Kinetic analysis of ADO activity with respect to RGS4/RGS5 peptides and O₂· Michaelis-Menten kinetic plots of ADO activity with respect to the indicated peptide

concentration (left panels), and oxygen concentration (right panels). For the activity

measurements at different O₂ levels, a peptide concentration was used at which ADO activity was maximal at atmospheric O₂. Data represent mean ± SEM, n=3.

Fig. 19 - Inhibition of ADO-dependent RGS5 dioxygenation by cysteine and cysteamine. The effect of free cysteine and cysteamine on the ADO-dependent turnover of RGS5 was determined using a competition assay in which the rate of RGS5 oxidation by ADO was monitored in the presence of different concentrations of cysteine and cysteamine. The data points were normalized to samples measured in the absence of cysteine and cysteamine and plotted to a log inhibitor model versus normalized response model to estimate IC50 values. Only high concentrations (mM) of cysteine and cysteamine reduce RGS5 turnover. Data represent mean ± SEM, n=3.

Fig. 20 - Roles of ADO in human cellular physiology.

(A-D) ADO regulates G-protein signalling in SH-SY5Y cells. (A) MAPK (p44/42)

phosphorylation in WT, ADO KO and ATE1 KO cells. Immunoblot lanes represent separate biological replicates, with densitometric analysis provided below. Mean ± S.D. n=3, ***P<0.001 one-way ANOVA with Holm-Sidak post hoc test. (B) Re-expression of ADO increases phosphorylated p44/42 in ADO KO, but not ATE1 KO cells, mean ± S.D. n=3, **P<0.01 two- way ANOVA with Holm-Sidak post hoc test. (C) Carbachol (CCh) stimulated rises in [Ca²⁺]_i are attenuated in ADO-deficient (KO) compared with wild-type (WT) cells. A representative trace is provided and mean peak change in R405/495 intensity at each CCh concentration is shown (inset). n=8-12, ***P<0.001, 3-parameter non-linear regression analysis. (D) Ionomycin (O. ImM) is equipotent at stimulating Ca²⁺ release in ADO KO cells infected with either control (EV) or ADO-containing lentivirus, whereas responses to CCh are recovered by ADO re-expression. Mean ± S.D. n=6-7, *P<0.05, two-way ANOVA with Holm-Sidak post hoc test. (E-F)

Regulation of IL-32 by ADO in RKO cells. (E) IL-32, but not asparagine synthetase or JunB, are regulated by ADO. Antibody specificities were confirmed by expression analyses in transfected 293T cells. (F) ADO-dependent regulation of IL-32 by hypoxia is observed at the protein but not mRNA level. Fig. 21 - ADO catalytic activity towards candidate mammalian peptides.

14-mer peptides corresponding to the N-termini (Met-cleaved) of the indicated proteins were incubated with recombinant ADO under aerobic conditions at 37°C for 1 min to determine specific activity. Cysteine dioxygenation (UPLC-MS determined mass increase of 32 Da corresponding to the addition of 2 oxygen atoms) was detectable and enzyme-dependent for all tested substrates, though with widely variable rates.

Fig. 22 - IL-32 is a target of ADO-catalyzed N-terminal cysteine dioxygenation.

(A) Mass spectrometry (UPLC-MS) analyses of the indicated IL-32 N-terminal peptide incubated aerobically with or without recombinant ADO (1h; 37°C), showing a +32 Da shift when incubated with ADO, indicative of the addition of O₂. The small peak at -845 m/z in the absence of ADO (top panel) was confirmed to correspond to a potassium adduct of the un oxidized peptide. (B) Fragmentation ion spectra derived from the IL-32 N-terminal peptide incubated with or without recombinant ADO. Fragment assignment revealed that incubation with ADO resulted in a mass addition of +32 Da to the N-terminal cysteine as expected (b* series ions have a consistent -81 Da mass loss likely due to small losses of e.g. SO₂ and NFL upon fragmentation; y series ions confirm modification on N-terminal cysteine). (C) Michaelis- Menten kinetic plots of ADO activity with respect to IL-32 peptide concentration, with derived k_cat and K_m constants listed alongside. (D) 293T cells co-transfected with plasmids encoding C- terminally FLAG-tagged IL-32 or an IL-32(C2A) mutant, and either empty pRRL vector (EV), ADO or a catalytically inactive ADO mutant (H112A+H114A), and exposed to hypoxia (1% O₂) for 16 h. IL-32 levels were assessed using an anti-FLAG antibody. Hypoxic accumulation of IL- 32 was evident in EV and mutant ADO, but not ADO, co-transfected cells, whilst C2A mutation abolished sensitivity to both hypoxia and ADO overexpression. Note that co-transfection with mutant ADO appears to increase basal levels of IL-32, consistent with possible competition with endogenous ADO for substrate binding.

Fig. 23 - ADO catalyzes the dioxygenation of N-terminal Cys initiating substrates USP27X, TMEM168 and ANKRD29.

MS spectra show a mass shift of +32 Da when N-terminal peptides representing each substrate were incubated with recombinant human ADO for 1 minute at 37 °C.

Fig. 24 Inhibition of ADO-catalysed RGS4 oxidation by inhibitors MC7 and MC9 Recombinant ADO was incubated with 14-mer peptide representing the N-terminus (Met- cleaved) of RGS4 in the presence and absence of MC7 and MC9. Reactions were conducted under aerobic conditions at 37°C for up to 10 mins with ADO activity monitored using UPLC- MS to detect and quantify cysteine oxidation via mass increase of 32 Da. Reactions were conducted in triplicate on two different occasions. Graphs show 0 600s and 0 180s timecourses, both revealing significant inhibition of ADO activity by both MC7 and MC9.

Fig. 25 Inhibition of ADO-catalysed IL-32 oxidation by inhibitor MCI

Recombinant ADO was incubated with 14-mer peptide representing the N-terminus (Met- cleaved) of IL-32 in the presence and absence of MC7 and MC9. Reactions were conducted under aerobic conditions at 37°C for up to 10 mins with ADO activity monitored using UPLC- MS to detect and quantify cysteine oxidation via mass increase of 32 Da. Reactions were conducted in triplicate. Graphs show 0 600s and 0 180s timecourses. ADO activity towards IL-32 was significantly inhibited in the presence of MC7 however it was not possible to detect the effect of MC9 due to overlapping mass observations in the UPLC-MS that confounded analysis of ADO activity.

Fig. 26 Summary of ADO- and ATE 1 -deficient cell lines described in Example 13.

(A) Table of knock-out cell lines. (B-F) fmmunoblots showing gene silencing/loss of detectable protein.

Fig. 27 Fluorescent protein demonstrating ADO-dependent changes in expression.

(A) A diagram illustrating the construction of a fluorescent protein reporter based on the fusion of the first 11 amino acids of human RGS4 to the N-terminus of enhanced green fluorescent protein (eGFP). Co-translational activity of methionine aminopeptidases (MetAP) cleave the initiating methionine, exposing an N-terminal cysteine. (B) Changes in RGS4 _1-11GFP reporter protein levels in WT or ADO knockout RKO cells following 4h treatment with the iron chelator 2,2 dipyridyl (2,2DIP) or 0.5% O₂. HIF-1a protein expression was used as a positive control for 2,2DIP and hypoxia treatment. (C) Real time changes in GFP fluorescence in WT or ADO KO RKO cells exposed to hypoxia, with WT cells pre-treated with 2,2DIP overnight used as a positive control. Fluorescence was monitored using a multi-well plate reader.

Fig. 28 Inflammatory mediators impact ADO activity towards IL32

Representative immunoblot (A) and quantification (B) of wild-type (WT) or ADO knockout

HepG2 cells treated with traditional inflammatory cytokines interleukin 1b (IL-1b) or tumour necrosis factor a (TNFa) for 16 h, then exposed to hypoxia for a further 2h.

Description of the Sequences

SEQ ID NO: 1 sets forth the sequence of human ADO.

SEQ ID NO: 2 sets forth the sequence of human ADO with N-terminal His6 tag.

SEQ ID NOs: 3 and 4 set forth the sequences of ADO inhibitors MC7 and MC9.

SEQ ID NOs: 6 to 31 set forth the sequence 14-mers corresponding to the N-termini of substrates of ADO-catalysed N-terminal cysteine oxidation.

SEQ ID NOs: 32 and 33 set forth variants of SEQ ID NO. 6.

SEQ ID NOs: 5 and 34 to 57 set forth the sequence 7-mers corresponding to the N-termini of substrates of ADO-catalysed N-terminal cysteine oxidation.

SEQ ID NO: 58 sets forth the sequence of an N-terminal fragment of SEQ ID NO: 33

SEQ ID Nos: 59 to 143 set forth the sequence 14-mers corresponding to the N-termini of substrates of ADO-catalysed N-terminal cysteine oxidation described in Table 5.

SEQ ID Nos: 144 to 320 set forth further sequences in the Examples.

Detailed Description of the Invention

Cysteamine (2-aminoethanethiol) dioxygenase (ADO)

The present inventors have for the first time identified a human cysteine-modifying enzyme that regulates protein degradation through the N-degron pathway. They have surprisingly discovered that the thiol oxidase previously assigned as cysteamine (2- aminoethanethiol) dioxygenase (ADO) is a high K_m O₂ N-terminal cysteine dioxygenase that is sensitive to hypoxic conditions. The inventors have shown that ADO regulates the RGS4 and RGS5 (regulator of G-protein signalling) N-degron substrates and modulates downstream G- protein coupled Ca²⁺ signals and MAPK (mitogen-activated protein kinase) activity. The inventors have further developed a method for assaying ADO N-cysteine protein oxidation activity and for identifying other N-Cysteine protein substrates of ADO, which include the angiogenic cytokine IL-32.

According to the present invention ADO or an ADO polypeptide is typically human

ADO or a homologue thereof, a variant or fragment thereof, which retains N-terminal cysteine protein oxidation activity. The sequence of human ADO is set out in SEQ ID NO: 1. Homologues thereof may be derived from other species, including in particular mammalian species. Exemplary species include orangutan, cow, rat and mouse.

The ADO polypeptide may have an amino acid sequence having at least about 60% sequence identity, or at least about 70% 80%, 90%, 95% or 99% sequence identity, with SEQ ID NO: 1 over its entire length or over an active fragment thereof.

Sequence identity may be calculated using any suitable algorithm. For example, the UWGCG Package provides the BESTFIT program can be used to infer homology (for example used on its default settings) (Devereux et al. (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can be used to infer homology or line up sequences (typically on their default settings), for example as described in Latched (1993) J. Mol. Evol 36:290-300; Latched et al. (1990) J. Mol. Biol. 215:403-10.

The ADO polypeptide may be a polypeptide encoded by any naturally occurring ADO gene in humans, such as a gene encoding ADO having the amino acid sequence of SEQ ID NO:

1 or variants thereof, or any naturally occurring homologue in other organisms. Variants may include allelic variants and the deletion, modification or addition of single amino acids or groups of amino acids, for example from about 1, 2 or 3 to about 10, 20 or 30 substitutions, deletions or additions, within the protein sequence, as long as the polypeptide retains N-terminal cysteine protein oxidation activity. Conservative substitutions may be made, for example according to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other.

Table 1 Conservative amino acid substitutions

Variant polypeptides within the scope of the invention may be generated by any suitable method, for example by gene shuffling techniques.

The terms“fragment” or“fragment of a polypeptide” as used herein refer to a string of amino acids or an amino acid sequence typically of reduced length relative to the or a reference polypeptide and comprising, over the common portion, an amino acid sequence identical to the reference polypeptide. Such a fragment according to the disclosure may be, where appropriate, included in a larger polypeptide of which it is a constituent.

The present invention includes use of active portions, fragments, derivatives and functional mimetic of the polypeptides of the invention. An "active portion" of a polypeptide means a peptide which is less than said full-length polypeptide, but which retains N-terminal cysteine protein oxidation activity. An active fragment of ADO may typically be identified by monitoring for N-terminal cysteine protein oxidation activity as described in more detail below. Such an active fragment may be included as part of a fusion protein.

The fragment may have up to about 100, 150, 200, or 250 or more amino acids. The fragment may comprise any region from the amino acid sequence shown in SEQ ID NO: 1 , such as from amino acid 2, 3, 4, 5 or about 10 to about amino acid 100, 150, 200, 250 or 270.

Useful fragments include N-terminal and/or C-terminal truncated fragments of the amino acid sequence shown in SEQ ID NO: 1. Other suitable fragments may readily be identified, for example by comparing the ADO amino acid sequence to the amino acid sequence of one or more known thiol oxidases and identifying which regions are homologous to regions having catalytic activity. The regions having catalytic activity are typically included in the active fragments.

Such fragments can be used to construct chimerical molecules. Fragments of any ADO polypeptide having at least about 60%, such as at least about 70%, 80%, 90%, 95% or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 1, which fragments have N- terminal cysteine protein oxidation activity may also be used in an assay of the invention and are encompassed within the term“ADO polypeptide” used herein.

The ADO polypeptide may comprise one or more particular site directed mutations.

ADO polypeptides may be synthetically prepared. The polypeptides may be chemically or biochemically modified, e.g. post-translationally modified. For example, they may be glycosylated or comprise modified amino acid residues. They may also be modified by the addition of histidine residues (typically six), or other sequence tags such as a maltose binding protein tag or intein tag, to assist their purification or by the addition of a nuclear localisation sequence to promote translocation to the nucleus or mitochondria, and or by post -translational modification including hydroxylation or phosphorylation. Polypeptides of the invention may be GST or other suitable fusion polypeptides. The ADO polypeptide may also be modified by addition of fluorescent tags (such as green or yellow fluorescent protein) to enable visualisation within cells or organelles or to aid purification of the protein or cells expressing ADO. Such modified polypeptides fall within the scope of the term "ADO polypeptide".

In some cases the ADO polypeptide may be present in a partially purified or in a substantially isolated form. The polypeptide may be mixed with carriers or diluents, which will not interfere with its intended use and still be regarded as substantially isolated. The polypeptide may also be in a substantially purified form, in which case it will generally comprise at least about 90%, e.g. at least about 95%, 98% or 99%, of the proteins, polynucleotides, cells or dry mass of the preparation.

The ADO polypeptide used in a method of the invention may be recombinant ADO or naturally occurring ADO. Naturally occurring ADO may be obtained from any organism that produces an ADO polypeptide. Preferably, recombinant ADO is used especially where ADO is required for purposes requiring large (> 1 mg) amounts of protein such as for biophysical assays or for high throughput analyses. Recombinant ADO may be produced using standard expression vectors that comprise nucleotide sequences encoding ADO. Such expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals which may be necessary, and which are positioned in the correct orientation, in order to allow for protein expression. Other suitable vectors would be apparent to persons skilled in the art. By way of further example in this regard we refer to Sambrook et al. (1989).

The ADO polypeptide may be present in a cell, including, but not limited to, human- derived cells. For example, methods of the invention may utilise cells that have been modified to express an ADO polypeptide as defined herein. The ADO may also be present in a cell extract or in a partially or substantially purified form. ADO polypeptides may be purified by standard techniques known in the art. Polypeptides, Peptidomimetics and Cyclised Peptides

The methods and assays of the present invention typically use a polypeptide, or peptidomimetic having an N-terminal cysteine as a substrate, binding agent or inhibitor of the ADO polypeptide or as a test agent thereof. The polypeptide or peptidomimetic typically has an N-terminal cysteine, cysteine analogue as described herein, or serine, The present invention is also concerned with inhibitors of ADO activity or ADO N-terminal cysteine oxidation activity, that are derivatives of a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation.

In some cases the invention may use a polypeptide or peptidomimetic that is cleaved or processed to produce a polypeptide/analogue having a N-terminal cysteine or cysteine analogue or cysteine that acts as a substrate or binding agent for the ADO polypeptide. Typically the polypeptide or peptidomimetic is N-terminal Met-cleaved. For example, the invention may in some cases relate to any of the polypeptides of Table 2 or Table 3 that are Met-cleaved, or analogues, derivatives, variants, peptidomimetics and/or N-terminal fragments thereof, as described herein, including cyclised peptides. The methods or assays of the invention may in some cases be carried out, or partly carried out, under conditions suitable for cleavage or processing of the polypeptide to produce the polypeptide or peptidomimetic having a cysteine or cysteine analogue or serine at the N-terminal end.

The term“polypeptide” as used herein, refers to a full-length protein, a portion of a protein, or a peptide, characterized as a string of amino acids linked by peptide or amide bonds. The polypeptides may comprise any or all of the twenty canonical amino acids (i.e.,“naturally occurring” or“natural” amino acids), which include the L-enantiomers of Glycine, Alanine, Valine, Leucine, Isoleucine, Proline, Phenylalanine, Tyrosine, Tryptophan, Serine, Threonine, Cysteine, Methionine, Asparagine, Glutamine, Lysine, Arginine, Histidine, Aspartate (Aspartic acid) and Glutamate (Glutamic acid). The polypeptides may also comprise the naturally occurring but non-canonical (i.e., non-standard) amino acids pyrrolysine, selenocysteine or N- formylmethionine. In some cases the amino acids may also have post-translationalor branch modifications.

As used herein, the term“peptide” refers to a short polypeptide comprising between 2, or

3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15 and 5, or 6, or 7, or 8, or

9, or 10, or 1 1, or 12, or 13, or 14, or 15, or 20, or 25, or 30, or 35, or 40, or 45, or 50 amino acids. Examples of peptide substrates for the ADO polypeptide include peptides having the amino acid sequence of any of SEQ ID NOs: 3 to 34, wherein the“X” is a cysteine. Other examples are any of SEQ ID NOs: 59 to 143, wherein the“X” is a cysteine.

Longer polypeptides or proteins may be up to 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250 or 300 amino acids in length or more. A full length protein which is a substrate for the ADO polypeptide can be used. Examples of full length protein substrates for the ADO polypeptide include Met-cleaved human RGS5 (O15539), IL-32 (P24001), RPL4 (H3BM89), EFCAB6 (Q5THR3), GPX1 (P07203), CDX1 (A0A087WTJ6), RIMKLA (Q8IXN7),

ARHGAP45 (F5H1R4), ZUP12 (Q504Y0), SRR (Q9GZT4), ARL16 (B4E3H0), GFPT2 (094808), VDAC3 (Q9Y277), DHX30 (H7BXY3), ORC6 (H3BT22), CALHM4 (Q5JW98), DYNLL1 (P63167), ALS2CL (Q60I27), TRIM36 (E9PBG3), JUNB (P17275), ASNS

(F8WEJ5), NBPF14 (A0A0B4J2B3), NADSYN1 (A0A0B4J216), USP27X (A6NNY8), TMEM168 (Q9H0V1) and ANKRD29 (Q8N6D5) (with Uniprot accession numbers). Further example include any of the full length polypeptides of Table 5. Corresponding Uniprot accession numbers are provided in Tables 2 and 3.

The term“peptidomimetic” as used herein, refers to a molecule that is structurally and functionally similar to a peptide but that has a main chain comprising at least one unit that is not a naturally-occurring amino acid as defined above, and/or at least one bond that is not a peptide or amide bond. Specifically, a peptidomimetic according to the present invention is capable of binding to the active site of ADO and acting as a substrate or inhibitor of ADO N-terminal cysteine oxidation activity. Typically a peptidomimetic as described herein is characterized as a string of naturally-occurring and/or canonical amino acids, but comprises one or more amino acid mimetics, such as one or more unnatural amino acids, one or more constrained amino acids and/or peptide bonds and/or one or more amino acid and/or peptide bond isosteres. In some cases, the peptidomimetic may have one or up to 2 or up to 3, 4, 5, 6, 7, 8, 9 or 10 amino acid mimetics, such as unnatural amino acids, constrained amino acids and/or amino acid isosteres, and/or one or up to 2 or up to 3, 4, 5, 6, 7, 8, 9 or 10 peptide bond isosteres, or combinations thereof. In some cases the peptidomimetic may comprise up to 5%, 10%, 15%, 20%, 25%, 30%, 35% or 40% amino acid mimetics such as unnatural or constrained amino acids or amino acid isosteres, and/or up to 5%, 10%, 15%, 20%, 25%, 30%, 35% or 40% peptide bond isosteres, or combinations thereof. In specific cases the peptidomimetic may have an N-terminal or amine end analogue of cysteine. The term“cysteine analogue” as used herein refers to a chemical entity which resembles cysteine in chemical and physical nature and that binds to the ADO active site in a manner that is competitive with a natural cysteine substrate, particularly a cysteine substrate at the N-terminal end of a reference or cognate substrate as described herein. Examples of a cysteine analogue that may be used in accordance with the invention include a seleno-cysteine, a homo-cysteine, a N-acetyl cysteine, a S-methyl cysteine, cysteic acid, cys-sulfinic acid, a cys- sulfenyl halide, a cys-sulfinyl halide, cys-sulfinylamine, S-alkyl cysteine thioethers, b-mercapto amino acids, b-alkyl cysteine, a-alkyl cysteine or D-analogues thereof. In other cases, the N- terminal cysteine may be substituted with a serine residue.

The term“unnatural amino acid” (also referred to as“non-natural”,“non-canonical”, “non-standard”,“non-coding” or“non-proteinogenic” amino acids) as used herein may include natural or synthetic chemical derivatives of natural amino acids. Typically an unnatural amino acid is a molecule capable of incorporation into a protein or peptidomimetic translatable from an RNA template via ribosome-mediated chain elongation, with the proviso that it is not a“natural amino acid” as defined above. The unnatural amino acid may be any organic compound comprising an amine (-NH₂) and a carboxyl (-COOH) functional group and that is capable of peptide bond formation. Non-limiting examples of unnatural amino acids include any of the D- amino acids, such as D-serine, D-tyrosine, D-alanine, D-tryptophan; any N-methylated amino acid, such as N-methyl alanine, N-methyl b-alanine, N-methyl-leucine, N-methyl-valine; homo amino acids; alpha-methyl amino acids; beta amino acids; peptoids; citrulline, ornithine, norleucine, beta-alanine, hypoxyproline, nitroarginine and pyroglutamic acid. Further non- limiting examples of unnatural amino acids include any fluorophore, such as BODIPY FL, which also comprises a functional group such that it is capable of peptide bond formation;

selenocysteine, pyrrolysine, N- formylmethionine, a-Amino-n-butyric acid, norvaline, norleucine, alloisoleucine, t- leucine, a-Amino-n-heptanoic acid, pipecolic acid, a,b- diaminopropionic acid, a,g- diaminobutyric acid, ornithine, allothreonine, homocysteine, homoserine, b-alanine, b-amino-n-butyric acid, b-aminoisobutyric acid, g-aminobutyric acid, a- aminoisobutyric acid, isovaline, sarcosine, N-ethyl glycine, N-propyl glycine, N- isopropyl glycine, N-ethyl alanine, N-ethyl b-alanine, N-chloroacetyl-methionine, N-chloroacetyl- tryptophan, p -propargyloxyphenylalanine, p -azidophenylalanine (AzF), p- propargyloxyphenylalanine, or n-propargyllysine (PrK). Further non-limiting examples of unnatural amino acids include 3-Aminoadipic acid, beta-Aminopropionic acid, 2-Aminobutyric acid, 4-Aminobutyric acid, piperidinic acid, 6-Aminocaproic acid, 2-Aminoheptanoic acid, 2- Aminoisobutyric acid, 3-Aminoisobutyric acid, 2-Aminopimelic acid, 2,4 Diaminobutyric acid, Desmosine; 2,2’-Diaminopimelic acid; 2,3-Diaminopropionic acid; N-Ethylasparagine;

Hydroxylysine; allo-Hydroxylysine; 3-Hydroxyproline; 4-Hydroxyproline; Isodesmosine; allo- Isoleucine; N-Methylglycine, sarcosine; N-Methylisoleucine; 6-N-Methyllysine; N- Methylvaline; Norvaline

The term“constrained amino acid” as used herein refers to an amino acid-like structure which is modified such that the torsional angles within or adjacent to the conserved amino acid in the polypeptide sequence are restricted compared to the natural or unmodified amino acid. Typical modifications include backbone N-alkylation, backbone Ca-alkylation, D-amino acid /proline substitution, peptide bond isosteres, cyclic amino acids, dehydroamino acids and/or b- alkylation.

Examples of constrained amino acids include oindoline- 1 -carboxylic acid, indoline-2- carboxylic acid, 2,5-propanoproline a-aminoisobutryic acid (alanine), dialkylglycine, a-methyl cysteine, a-methyl threonine (and other a-methyl amino acids), a- aminocycloalkane carboxylic acid, D-allothreonine, b-methyl amino acids, 2,4-methanoproline, 5,5-dimethylthiazolidine-4- carboxylic acid (proline analogue), azyline-2-carboxylic acid (proline analogue), azetine-2- carboxylic acid (proline analogue), pipecolic acid (proline analogue), spirolactam (proline analogue), cyclic b-amino acids (e.g. cispentacin, tilidin, oxetin, ixofungipen, oryzoxymicin).

Example peptidomimetics of the invention comprising a constrained amino acid include those comprising or consisting of the amino acid sequence of any one of SEQ ID NOs: 3 to 55, or 3 to 58, and/or 59 to 143, or SEQ ID NOs: 4 or 7 with the“F” replaced by ioindoline-1- carboxylic acid or indoline-2-carboxylic acid; and peptidomimetics comprising or consisting of the amino acid sequence of any one of SEQ ID NOs: 3 to 55, or 3 to 58, and/or 59 to 143, or SEQ ID NOs: 4, 6, 7, 31 or 32 with the“P” replaced by 2,5-propanoproline, or fragments, analogues, peptidomimetics or fragments thereof.

An“amino acid isostere” has chemical and physical properties similar to a natural amino acid, such as a similar shape and ability to bind to other biological molecules and optionally similar electronic properties to naturally-occurring amino acids. Typical examples include halogenated phenylalanine, ring replacements (e.g. phenyl group in phenylalanine replaced by pyridine, pyrazine, thiazole, pyrimidine rings), replacement of carboxylic acid groups (at C- terminus, or in aspartate or glutamate residues) with phosphonate, sulfonate, hydroxamic acid, acylcyanamide, sulphonamide, sulfonimide, tetrazole, hydroxyisoxazole, oxadiazolone.

A“peptide bond isotere” refers to the replacement of the amide/peptide bond (which is susceptible to hydrolysis) with groups that have similar chemical and physical properties but which have increased stability. Examples include replacing peptide bond with an ester, thioamide, C=C double bond (alkene), hydroxyethyl, alpha-difluoroketone, N-alkylation and substituting the C-terminal amino acid with a dehydroamino acid or to generate an azapeptide. Examples of peptidomimetics of the invention comprising a peptide bond isotere are those in which an E or Z alkenes to replaces one or more prolyl peptide bonds and/or wherein

dihydropyrazinones replaces X-Ser peptide bonds.

The skilled person would be capable of identifying one or more suitable amino acid mimetics, unnatural amino acids, constrained amino acids and/or amino acid or peptide bond isosteres to substitute one or more naturally-occurring amino acids or peptide bonds in a polypeptide described herein to arrive at a peptidomimetic suitable for use in accordance with the present invention. Amino acid substitution(s) with constrained amino acids may be used, for example, to confer increased stability on a peptide. Amino acid and/or peptide bond

substitution(s) with isoteres may be used, for example, to confer increased potency on a peptide such as a peptide inhibitor of an enzyme. Amino acid substitution(s) with unnatural amino acids may be used, for example, to confer increased stability or potency on a peptide. Any suitable polypeptide or peptidomimetic can be used, as long as the polypeptide contains a cysteine residue capable of oxidation by ADO, or a cysteine analogue or serine capable of binding in the active site of ADO. The cysteine, cysteine analogue or serine is typically at the N-terminal end of the polypeptide or peptidomimetic.

The polypeptide or peptidomimetic may be modified by the addition of or conjugation to further polypeptide or peptidomimetic sequences to facilitate assays or other uses. For example, a fluorescent group may be added, for example to facilitate imaging or sorting, a tag may be added for purification or separation, or a cell-penetrating peptide may be added to facilitate cell entry. Many such modifications are routinely used and described in the scientific literature. In some cases, the substrate used in the methods and assays disclosed herein is a polypeptide substrate for ADO in vivo, or a homologue, variant, peptidomimetic, cyclised peptide or peptidomimetic or fragment thereof. In some cases the polypeptide is naturally expressed by a human or animal subject, or a homologue, variant, peptidomimetic or fragment thereof.

In some cases the polypeptide or peptidomimetic has the N-terminal amino acid sequence of any one of the human proteins listed in Table 2, or a homologue, variant, peptidomimetic cyclised peptide or peptidomimetic thereof. In some cases the polypeptide or peptidomimetic has the N-terminal amino acid sequence of any one of the human proteins listed in Table 3, or a homologue, variant, peptidomimetic cyclised peptide or peptidomimetic thereof.

Table 2 Uniprot numbers for human proteins bearing a Met-Cys N-terminus

Table 3 Uniprot numbers for human proteins bearing a Met-Cys N-terminus

Variants and derivatives may include allelic variants and the deletion, modification or addition of single amino acids or groups of amino acids, for example up to 1, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 substitutions, deletions or additions, within the polypeptide sequence, as long as the resultant polypeptide or peptidomimetic retains the ability to bind to, inhibit or act as a substrate for ADO. Typically the variant retains a cysteine residue capable of oxidation by ADO, or a cysteine analogue or serine capable of binding in the active site of ADO, typically at the N-terminal end. Typically, a variant of a reference polypeptide as described herein (e.g. a peptide substrate for ADO-catalysed N-terminal cysteine oxidation ) has an amino acid sequence having at least about 60%, or at least about 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity with the reference polypeptide. Conservative substitutions may be made, for example as described elsewhere herein.

In some cases the polypeptide or peptidomimetic is a derivative or variant of a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 3 to 55, or 3 to 58, and/or SEQ ID NOs: 59 to 143. In some cases the variant may comprise or consist of a sequence having at least 70% or at least 85% sequence identity with a polypeptide having an amino acid sequence selected from SEQ ID NOs: 3-5 and 34 to 55, or 34 to 58, and/or selected from SEQ ID NO: 59 to 143 and/or selected from SEQ ID NOs: 3 to 5. In some cases the variant may have at least 70% or at least 75%, 80%, 85%, 90%, 95% sequence identity with a polypeptide having an amino acid sequence selected from SEQ ID NOs: 6 to 33 and/or SEQ ID NO: 59 to 143. In some cases the variant may have at least 70% or at least 75%, 80%, 85%, 90%, 95% sequence identity with a peptide, preferably a 7-mer, or in some cases a 14-mer, or other fragment as described herein, corresponding to the N-termini (M-cleaved) of any one of the human proteins listed in Table 2 or Table 3. For example a variant may be a variant of or comprise of consist of the sequence of SEQ ID NO: 5 or 6, but with a substitution or conservative substitution of the “A” at position 6, as in SEQ ID NO: 3.

In some cases, the polypeptide comprises or consists of the amino acid sequence of any one of SEQ ID NOs: 3 to 7, or 8 to 55, or 8 to 58 and/or SEQ ID NOs: 59 to 143, or is a variant, peptidomimetic or fragment thereof.

Sequence identity may be calculated and variants made as described elsewhere herein.

In some cases, the polypeptide or peptidomimetic may be a C-terminal truncated fragment of a substrate of ADO-catalysed N-terminal cysteine oxidation, or an variant thereof. Such fragments may at be least 5, or 6, 7, 8, 9, 10,11 , 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length and may in some cases correspond to the N-termini of any polypeptide or peptidomimetic described herein, such as any of SEQ ID NOs: 59 to 143. In some cases the fragment may correspond to a Met-cleaved N-termini of any of human RGS5, IL-32, RPL4, EFCAB6, GPX1, CDX1, RIMKLA, ARHGAP45, ZUP12, SRR, ARL16, GFPT2, VDAC3, DHX30, ORC6, CALHM4, DYNLL1, ALS2CL, TRIM36, JUNB, NBPF14, NADSYN1 USP27X, TMEM168 and ANKRD29 proteins, or any protein listed in Table 2 or Table 3 or Table 5, or a derivative, variant, analogue or peptidomimetic thereof.

The term“cyclised peptide” as used herein, refers to a polypeptide as defined herein wherein the amino acid chain contains a circular sequence of bonds. A cyclised peptide may be a cyclic peptide comprising a continuous circle of amino acids connected by peptide or amide bonds (cyclic peptides). In other cases the circular sequence may be formed through a connection of either the amino end or carboxyl end with a side chain, leaving a non-cyclised carboxyl- or amino-end“tail”. Accordingly the circular sequence of bonds may in some cases be completed by one bond that is not a peptide or amide bond. Cyclised peptides may in some cases also have more complex structures comprising two or more cyclised regions.

A“cyclised peptidomimetic” is similar to a“cyclised peptide”, but the amino acid chain comprises at least one unit that is not a naturally-occurring amino acid as defined herein, and/or at least one bond that is not a peptide or amide bond, typically in addition to any non-amine or peptide bond that connects the amino or carboxyl end to a side chain.

In some aspects the present invention is concerned with cyclised peptides or cyclised peptidomimetics as inhibiors or binding agents of ADO or test agents thereof.

In some cases the invention is concerned with cyclised variants of any of the

polypeptides, peptides or peptidomimetics described herein. In specific examples, the invention relates to a cyclic or cyclised peptide having the amino acid sequence of any one of SEQ ID NOs: 3-5, 6 to 33 and 34 to 55, or 34 to 58, and/or SEQ ID NOs: 59 to 143 or a peptidomimetic analog thereof.

Methods for producing cyclised variants of polypeptides and peptides are well known in the art and any suitable method known in the art may be used. Examples include head-to-tail lactamization, internal disulphide or thioether formation, ring closing olefin metathesis, cycloaddition of azides to aklynes, nitrogen arylation between two lysine residues using a perfluoroaryl linker, generation of libraries of cyclic peptides using RaPID system (Random nonstandard Peptide Integrated Discovery) which uses artificial ribozyme (flexizyme).

ADO Inhibitors

In some aspects the invention is concerned with inhibitors of ADO. More specifically, the invention is concerned with inhibitors of ADO N-terminal cysteine oxidation (or dioxygenation) activity or ADO-catalysed cysteine oxidation (or dioxygenation) of polypeptides, which is newly described herein. This activity of ADO has a K ₂ ^app of >500 mM. The activity is sensitive to oxygen concentrations below the physiological range, i.e. physiologically hypoxic conditions. Thus, the invention is concerned with inhibitors of an oxygen-dependent activity of ADO.

The inhibitors of the invention are derivatives or peptidomimetics of substrates of ADO- catalysed N-terminal cysteine oxidation. A substrate of ADO-catalysed N-terminal cysteine oxidation is a polypeptide or peptidomimetic having an N-terminal cysteine that is oxidised by ADO under suitable conditions, such as those described in the Examples herein. Oxidation of the N-terminal cysteine may be determined by any suitable method known in the art, such as by any method described herein, such as in Example 9.

In some embodiments the present disclosure provides a peptide, cyclised peptide or peptidomimetic inhibitor of cysteamine (2-aminoethanethiol) dioxygenase (ADO), wherein the inhibitor is a variant of a peptide substrate for ADO-catalysed N-terminal cysteine oxidation, and inhibits ADO N-terminal cysteine protein oxidation activity.

In some cases the inhibitor of the invention is a polypeptide or peptidomimetic substrate with a substitution of the N-terminal cysteine with a cysteine analogue, or in some cases with a serine. Without necessarily wishing to be bound by theory, such inhibitors are believed to bind to ADO, or more specifically the active site of ADO, but the cysteine analogue or the serine is non-oxidisable by ADO, or is oxidised by ADO at a lower rate than the cognate substrate having an N-terminal cysteine in place of the N-cysteine analogue or serine. Typically the inhibitor is oxidised at a rate at least 10, or at least 20, 30, 40, 50, 70, 100, 200, 500 or 1000 x slower than the cognate substrate having an N-terminal cysteine. Relative rates of oxidation of an inhibitor and cognate substrate may be determined using any suitable method as known in the art, such as any method described herein. In a specific example, oxidation is measured using the method described in Example 9 herein.

In some cases the cysteine analogue is a seleno-cysteine. In other cases the cysteine analogue is a homo-cysteine, a N-acetyl cysteine, a S-methyl cysteine, cysteic acid, cys-sulfinic acid, a cys-sulfenyl halide, a cys-sulfinyl halide, cys-sulfinylamine, S-alkyl cysteine thioethers, b- mercapto amino acids, b-alkyl cysteine, a-alkyl cysteine, or a D-analogue thereof. Methods for producing polypeptides and peptides having N-terminal cysteine analogues are well known in the art and any suitable method known in the art may be used. Automated solid phase peptide synthesis, C-term to N-term, using Boc or Fmoc groups for N^a protection and coupling reagents such as carbodiimides, aminium/uranium and phosphonium salts or propanephosphonic acid anhydride. Solid phase support is typically cross-linked polystyrene, e.g. (a-Amino-a-p-xylyl hydrochloride) polystyrene crosslinked with divinylbenzene (MBHA). Cyclisation may be on- or off-resin. Incorporation of unnatural amino acids/isosteres, etc. may require use of alternative protection, deprotection, coupling and/or cleaving reagents, e.g.

monobenzyl protecting groups for phosphorylated amino acids.

In other cases the inhibitor is a cyclic or cyclised version of a polypeptide or

peptidomimetic substrate of ADO. The cyclised inhibitor may in some cases otherwise have the same sequence as a cognate substrate of the ADO activity, or may additionally have a substitution of the N-terminal cysteine in the substrate with a cysteine analogue in the cognate inhibitor as described herein.

Cyclic peptides, or semi-cyclic peptides will retain amino-like and thiol-like groups for active site coordination to the metal (for efficient binding to the enzyme) as well as amino acids (or analogues/isosteres) important for interacting effectively with the enzyme. However cyclised versions will be more stable (increasing bioavailability) and their cyclised nature (vs. linear) will be optimised for maximal binding and occupancy of the ADO active site. This will enhance interaction with the enzyme and inhibitory potency.

In some cases the inhibitor of the invention is a variant of a peptide corresponding to the

N-termini of any one of the proteins listed in Table 2 or Table 3 or Table 5 or of human RGS5,

IL-32, RPL4, EFCAB6, GPX1 , CDX1, RIMKLA, ARHGAP45, ZUP12, SRR, ARL16, GFPT2,

VDAC3, DHX30, ORC6, CALHM4, DYNLL1 , ALS2CL, TRIM36, JUNB, ASNSNBPF14,

NADSYN1, USP27X, TMEM168 and ANKRD29 (Met-cleaved) as described herein, for example a 7-mer C-tmncated fragment having the N-terminal cysteine substituted with a seleno- cysteine. In other cases the inhibitor corresponds to a C-terminal truncated fragment having at least 4, or 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 25, or 30 amino acids and a seleno-cysteine, a cysteine analogue or a serine at the N-terminal end, or a cyclised variant thereof. In some cases the inhibitor of the invention is a peptidomimetic or cyclised peptide or peptidomimetic comprising or consisting of the amino acid sequence of any one of SEQ ID NOs: 3 to 5, 6 to 33 or 34 to 55, or 34 to 58, and/or SEQ ID NOs: 59 to 143 wherein the X is a serine or a seleno-cysteine or a cysteine analogue as described herein. In some cases the inhibitor of the invention is a cyclised peptide or peptidomimetic comprising or consisting of the amino acid sequence of any one of SEQ ID NOs: 3 to 5, 6 to 33 or 34 to 55, or 34 to 58, and/or SEQ ID NOs: 59 to 143, wherein the X is a cysteine, a serine or a seleno-cysteine or a cysteine analogue as described herein. In some cases, the inhibitor may be a C-terminal truncated fragment of a polypeptide having an amino acid sequence selected from SEQ ID NOs: 3-5, 34 to 55 or 34 to 58, and/or 6 to 33, and/or SEQ ID NOs: 59 to 143, or variant thereof as described herein. Such fragments may at be least 5, or 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length and may in some cases correspond to the Met-cleaved N-termini of any of human RGS5, IL-32, RPL4, EFCAB6, GPX1, CDX1 , RIMKLA, ARHGAP45, ZUP12, SRR, ARL16, GFPT2, VDAC3, DHX30, ORC6, CALHM4, DYNLL1 , ALS2CL, TRIM36, JUNB, ASNSNBPF14, NADSYN1, USP27X, TMEM168 and ANKRD29, and/or any protein of Table 5.

Methods and Assays

The present invention provides a method for assaying N-terminal cysteine protein oxidation activity, the method comprising contacting ADO with a polypeptide or a

peptidomimetic having an N-terminal cysteine; and measuring oxidation or dioxygenation of the polypeptide the peptidomimetic or the N-terminal cysteine. The polypeptide or peptidomimetic may be any suitable substrate for ADO N-terminal cysteine protein oxidation activity as described herein.

Thus ADO activity may be assayed by monitoring N-terminal cysteine protein oxidation activity of ADO in the presence of substrate. The substrate and ADO polypeptide are typically contacted under conditions suitable for oxidation activity. Such assays may use purified materials or be carried out in cells, in vivo, ex vivo or in vitro.

In some cases, the methods and assays of the invention may be used to identify a modulator of ADO activity. The assay may be carried out in the presence of a test agent to determine whether the test agent is a modulator of ADO activity. Any suitable assay may be carried out to identify modulators of ADO N-terminal cysteine oxidation activity. A number of different examples of suitable assays are described herein. The assays of the invention may be used to identify an agent which modulates, such as inhibits or activates, ADO N-terminal cysteine oxidation activity.

In a method of the invention ADO activity may be assayed by monitoring oxidase activity of an ADO polypeptide in the presence of substrate. The substrate may in some cases be any described herein. The substrate and ADO polypeptide, and optionally the test agent, are typically contacted under conditions suitable for oxidase (N-terminal cysteine oxidation) activity.

Oxidation or dioxygenation of the substrate may be assayed directly or indirectly. Such assays may employ techniques such as chromatography, NMR, MS or fluorescence

spectroscopy. In some cases dioxygenation of substrate may be detected or measured by using one or more probes for cys-sulfinic acid. Suitable probes have for example been described in Akter S et al. 2018 Nat Chem Biol 14: 995.

In an assay to identify a modulator of ADO activity, the components of the assay are preferentially contacted under conditions in which ADO has N-terminal cysteine oxidation activity both in the absence of the test agent and in the presence of the test agent so that the effect of the test agent on ADO activity may be determined. The assay may also be used to detect agents that increase or decrease the activity of ADO activity by assaying for increases or decreases in activity including in whole organisms. Other assay configurations may rely on methods for assessing binding, e.g. by displacement of an appropriately labelled ADO binding peptide from the ADO active site. Cell-based assays in which the oxidation status of a substrate, such as RSG4 or IL-32 or peptides corresponding to the N-termini thereof, is assessed either by mass spectrometry or by use of appropriate antibodies or probes are also suitable.

Assays of the present invention may be used to identify inhibitors of oxidase activity and are thus preferably, but not necessarily, carried out under conditions under which ADO is active as an oxidase (a N-terminal cysteine oxidation) in the absence of the test agent. The ADO oxidase activity in the presence of the test agent is compared to ADO oxidase activity in the absence of the test substance to determine whether the test substance is an inhibitor of ADO oxidase activity. In the alternative, the assays may be used to look for promoters of ADO oxidase activity, for example, by looking for increased conversion of co-substrate and/or oxidatation of substrates compared to assays carried out in the absence of a test substance. The assays may also be carried out, either with purified materials in cells or in animals, under conditions in which ADO oxidase activity is reduced or absent, such as under hypoxic conditions, and the presence of or increased activity can be monitored under such conditions.

In medicinal applications, for example, it is often advantageous to modulate oxidase activity of a single enzyme or group of enzymes. The assays of the invention may also be used to identify inhibitors or activators that are specific for N-terminal cysteine oxidations, such as ADO (or homologues of ADO) and which do not have activity or are less active with other oxidases, including other human oxidases. Conversely, the assays of the invention may be used to identify inhibitors or activators specific for one or more oxidases which do not inhibit ADO activity. Thus, the invention also provides methods for screening for compounds that do not inhibit ADO.

The precise format of any of the assay or screening methods of the present invention may be varied by those of skill in the art using routine skill and knowledge. The skilled person is well aware of the need to additionally employ appropriate controlled experiments. The assays of the present invention may involve monitoring for oxidation (or deoxygenation) of the substrate, monitoring for the utilisation of substrates and co- substrates, monitoring for the production of the expected products. Assay methods of the present invention may also involve screening for the direct interaction between components in the system. Alternatively, assays may be carried out which monitor for downstream effects mediated by the substrate, for example using suitable reporters or by monitoring for the upregulation of genes or alterations in the expression patterns of genes known to be regulated directly or indirectly by the substrate.

Assays are typically carried out at a temperature of from about 25 °C to about 40°C, for example at a temperature of from about 30°C to about 39°C, or from about 35°C to about 38°C or about 37°C. The pH of the assay mixture is typically between about pH 7 to about pH 9, for example from about pH 7.5 to about pH 8. Suitable buffers, such as Tris or HEPES, may be used to maintain the pH of the assay mixture.

Typically, assays are carried out under normoxic conditions, but may be carried out at oxygen concentrations above or below atmospheric levels. The assay may also be carried out under conditions in which hydroxylation or oxidation is reduced or absent, such as under hypoxic conditions, in order to detect modulation of oxidase activity by an agent which enhances oxidation.

Alternatively, the end-point determination may be based on conversion of the substrate or substrate fragments (including synthetic and recombinant peptides or nucleic acids) derived from the polypeptide or nucleic acid substrate into detectable products. Substrates may be modified to facilitate the assays so that they can be rapidly carried out and may be suitable for high throughput screening.

Uses of Inhibitors of ADO

The inhibitors of the invention may be used to inhibit the ADO N-terminal cysteine oxidation activity or ADO-catalysed N-terminal cysteine oxidation of polypeptides or to induce, promote or inhibit downstream effects. The inhibitors may, for example, be used to inhibit ADO activity in a cell or tissue in vivo, ex vivo, in vitro or in a cell free system for protein expression or for assaying the stability, degradation, expression or activity of one or more polypeptide substrate(s) for ADO-catalysed N-terminal cysteine oxidation or downsteam effectors. Such uses typically comprises contacting a cell, tissue or cell-free system with the inhibitor in the presence of ADO and one or more polypeptide substrates of ADO-catalysed N-terminal cysteine oxidation under conditions suitable for the oxidation of the polypeptide substrate by ADO.

It is known that the oxidation of N-terminal cysteines of proteins may act through the N- degron pathway to promote the degradation of N-terminal cysteine oxidised proteins. The present inventors have demonstrated that ADO oxidises the RGS4/5 N-degron substrates (and other suitable peptide substrates) and regulates RGS4/5 and downstream signalling pathways in an oxygen-dependent manner. Accordingly, an inhibitor of ADO may be used to decrease the rate of degradation or increase stability or expression or modify or regulate the activity of a polypeptide that is oxidised by ADO. Specifically an ADO inhibitor may be used to decrease the degradation or increase the stability and/or expression or modify or regulate the activity of one or more polypeptide(s) that are targeted for degradation via ADO-catalysed N-terminal cysteine oxidation. An ADO inhibitor may also be used to modulate or regulate the expression or activity of downstream effectors.

The present inventors have shown that ADO N-terminal cysteine oxidation activity is oxygen-dependent and sensitive to hypoxia. Accordingly in some cases an inhibitor of ADO may be used to mimic or augment a biological, cellular or tissue response to hypoxia. For example, an inhibitor of ADO may be used in a method of decreasing cellular or tissue damage or increasing cell survival in a cell or tissue exposed to hypoxic conditions. Insofar as hypoxic conditions may trigger protective responses in cells and tissues via down-regulation of ADO activity, an inhibitor of ADO activity may also promote cell survival and/or reduce cellular damage even in cells that are not exposed to hypoxic condition or that are exposed to other conditions that are otherwise damaging to cells and tissues. An inhibitor of ADO could also be used to trigger or promote physiological processes that are responsive to low oxygen levels or hypoxia and/or protect cells and tissues from cellular or tissue damage. For example, the present inventors have shown that IL-32 is a substrate for ADO-catalysed N-terminal cysteine oxidation. IL-32 is a known regulator of angiogenesis. Accordingly in some cases in accordance with the invention an ADO inhibitor could be used in a method of promoting angiogenesis.

In some cases the inhibitor of ADO may be any described elsewhere herein.

In some cases the methods and uses described herein may further comprise detecting or measuring the effect of the presence of the inhibitor on ADO activity or N-terminal cysteine oxidation (as further described elsewhere herein), on the stability, degradation, expression or activity of one or more polypeptide substrates of ADO oxidation, and/or on the expression or activity of one or more downstream effectors of ADO activity.

In some cases the invention relates to a polynucleotide such as an RNA or DNA or RNA or DNA vector that encodes a peptide or peptidomimetic inhibitor as described herein, or a cell that expresses the DNA, RNA, vector peptide or peptidomimetic.

Medical Uses of ADO Inhibitors

In one aspect the invention provides an ADO inhibitor for use as a medicament. The inhibitor may be any described herein.

In one aspect, the invention provides a peptidomimetic and/or cyclised peptide or peptidomimetic inhibitor of cysteamine (2-aminoethanethiol) dioxygenase (ADO) for use as a medicament, wherein the peptidomimetic or cyclised peptide or peptidomimetic inhibitor has the amino acid and/or amino acid mimetic sequence of a polypeptide or peptidomimetic substrate of

ADO-catalysed N-terminal cysteine oxidation, except for (a) the substitution of a N-terminal cysteine in the substrate with a cysteine analogue in the inhibitor; and/or (b) cyclisation of the polypeptide or peptidomimetic substrate, and wherein the peptidomimetic and/or cyclised peptide is an inhibitor of ADO N-terminal cysteine protein oxidation activity.

In some cases the invention provides a method for treating hypoxia, hypoxic disease or conditions associated with hypoxia, cardiovascular disease, ischaemic disease, myocardial ischaemia, renal ischaemia, cerebral ischaemia, cancer, a neurological or psychiatric disease, obesity, diabetes, or HIV, of increasing immune or inflammatory responses, or of reducing the side-effects and/or promoting the analgesic action of an opiate drug, the method comprising administering an inhibitor of ADO as described herein to a subject in need thereof.

Hypoxia is a condition in which tissues in the body receive an inadequate oxygen supply and may affect the whole body or be localised to a particular tissue or region of the body.

Conditions associated with hypoxia include hypoxemia; anoxemia; local hypoxia, including, for example, cyanosis; hypoxia associated with low blood haemoglobin levels (anaemic hypoxia) or an impaired or reduced ability of blood haemoglobin to carry oxygen, for example expression of abnormal haemoglobin variants or as a result of chemical oxidation of heamoglobin's iron atom to its ferric form; ischaemia (ischemic hypoxia), including ischaemic disease, myocardial ischaemia, renal ischaemia, cerebral ischaemia, and ischaemia resulting from cardiovascular disease, an embolic event, heart attack, trauma, peripheral vascular disease or anaerobic metabolism; gangrene, including gangrene as a complication of diabetes; hypoxemic hypoxia; carbon monoxide poisoning; histotoxic hypoxia, for example due to cyanide or other poisoning; hypoxia associated with conditions of low partial pressure of oxygen, such as when diving or at high altitude including, for example, altitude sickness, high altitude pulmonary edema (HAPE) and high altitude cerebral edema (HACE); hypoxia associated with use of a re-breather system; and hypoxia associated with pre-term birth.

The present inventors have demonstrated that analogues of peptide substrates of ADO N- terminal cysteine oxidation having a seleno-cysteine in place of the N-terminal cysteine are potent inhibitors of ADO-catalysed oxidation of peptide substrates derived from RGS4 and IL-32

(see Figs. 23 and 24). RGS4 is known to be a target of the Cys-branch of the N-degron pathway in humans and mice. Inhibiting ADO-catalysed N-terminal cysteine oxidation would therefore be expected to promote reduced degradation and up-regulated expression of the RGS4 protein.

Increased RGS4 and RGS5 (another substrate of ADO-catalysed oxidation as shown herein) has therapeutic potential in treating cardiovascular disease. For example, increased levels of RGS4 has been shown in transgenic mice to delay the onset of cardiac hypertrophy (J. Mol Cell Cardiol. 2001 33 209-218). Increased RGS5 has been reported to protect against cardiac hypertrophy and fibrosis (PNAS 2010 107 13818-13823) and may protect against arrhythmia since RGS5-deficient mice display an enhanced susceptibility to atrial tachyarrhythmia (PloS One 2012 7 e46856). Inhomogeneity in G-protein signalling in, for example, ischaemic or post- ischaemic myocardium may be caused by inhomogeneous oxygen levels leading, via ADO, to variable stability of RGS proteins and in-coordinate ventricular function and arrhythmia. This may be corrected by inhibiting RGS protein degradation. RGS 5 has also been reported to promote arterial collateral growth during arteriogenesis (EMBO Mol Med 2014 6 1075-1089). RGS4 has been shown to be protective in murine models of ischaemia-reperfusion in the kidneys (Siedlecki AM, Jin X, Thomas W, Hruska KA, and Muslin AJ). Further, RGS4 has been reported to improve renal function in ischemia-reperfusion injury. Kidney Int 80: 263-271, 2011. The role of RSG proteins has also been described in Rorabaugh BR, Chakravarti B, Mabe NW, Seeley SL, Bui AD, Yang J, Watts SW, Neubig RR, J Pharmacol Exp Ther. 2017; 360(3):409-416; and Fisher RA. Regulator of G Protein Signaling 6 Protects the Heart from Ischemic Injury. J Pharmacol Exp Ther 360: 409-416, 2017.

Accordingly, ADO inhibitors as described herein could be used in the treatment of cardiovascular disease, cardiac hypertrophy, cardiac fibrosis, in-coordinate ventricular function arrhythmia and ischaemia including ischemia-reperfusion.

Increased RGS4 and RGS5, as may be obtained by inhibition of ADO, also has therapeutic potential in neurological and psychiatric diseases such as schizophrenia and mood disorders such as depression, anxiety and bipolar disorders. RGS4 is a crucial modulator of antidepressant drug action (PNAS 2013 110 8254-8259). Agents that favour RGS4 stability or increase protein activity are therefore targets for antidepressents. For example, RGS4 is a negative modulator of opiate reward but promotes the analgesic actions of certain opiate drugs. Several lines of evidence suggest that low levels of RGS4 in the prefrontal cortex are causally related to schizophrenia (for example Molecular Psychiatry 2001 6 293-301).

The ADO inhibitors described herein may also be used in the treatment of cancer, since RGS4 is known to be down-regulated in some cancers and overexpression of RGS4 in non-small cell lung cancer has been shown to decrease invasion and migration. The ADO inhibitors may therefore be used in the treatment of cancer or for inhibiting cancer cell invasion, migration or metastasis.

RGS4 knock-out mice have diabetes and liver steatosis and increasing RGS4 expression has been suggested as an anti-diabetic and anti-obesity strategy (Endocrinology (2008) 149 5706-5712). The ADO inhibitors described herein may therefore find use in the treatment of diabetes or obesity.

Increased IL-32 (as may be obtained by inhibition of ADO) has potential to enhance immune and inflammatory responses. This may be of use in the enhancing induced immune responses (e.g. in vaccination) or in promoting anti-tumour immunity (Seminars in Immunology 2018 38 24-32). IL-32g induced maturation and activation of dendritic cells and enhanced T helper responses (J Immunol. 2011 186 6848-6859). IL-32 has also been reported to have anti- viral (anti-HIV) action (J Immunol 2008 181 557-565). The ADO inhibitors described herein may therefore be used to promote immune or inflammatory responses, particularly in vaccination and/or the treatment of tumours or cancer or viruses such as HIV.

In some cases in accordance with the invention the inhibitor as described herein is the active ingredient of the treatment, but is expressed in vivo in the treated subject. The

composition that is administered to the subject may be a DNA or RNA composition or a composition comprising an DNA or RNA vector that encodes the inhibitor or a cell that expresses or is capable of expressing the inhibitor. For a cell-based composition, the polypeptide may be processed and/or presented by cells of the composition, for example autologous dendritic cells or antigen presenting cells pulsed with the polypeptide or comprising an expression construct encoding the polypeptide. The pharmaceutical composition may comprise a polynucleotide or cell encoding one or more active ingredients.

The subject may be a mammalian subject, such as a cow, pig, sheep, horse, cat or dog. In some cases the subject is a human subject.

Pharmaceutical Compositions and Modes of Administration

An inhibitor of ADO as described herein may be formulated into to a pharmaceutical composition and methods of producing an inhibitor of ADO as described herein may further comprise formulating the inhibitor as a pharmaceutical composition for use as a medicament, for example in any method of treatment described herein. A pharmaceutical composition as described herein may comprise, in addition to one or more inhibitor of ADO, a pharmaceutically acceptable excipient, carrier, diluent, buffer, stabiliser, preservative, adjuvant or other materials well known to those skilled in the art. Such materials are preferably non-toxic and preferably do not interfere with the pharmaceutical activity of the active ingredient(s). The pharmaceutical carrier or diluent may be, for example, water containing solutions. The precise nature of the carrier or other material may depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intradermal, and intraperitoneal routes.

The pharmaceutical compositions of the disclosure may comprise one or more “pharmaceutically acceptable carriers”. These are typically large, slowly metabolized macromolecules such as proteins, saccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, sucrose (Paoletti et al., 2001, Vaccine, 19:2118), trehalose (WO 00/56365), lactose and lipid aggregates (such as oil droplets or liposomes). Such carriers are well known to those of ordinary skill in the art. The pharmaceutical compositions may also contain diluents, such as water, saline, glycerol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present. Sterile pyrogen-free, phosphate buffered physiologic saline is a typical carrier (Gennaro, 2000, Remington: The Science and Practice of Pharmacy, 20th edition, ISBN:0683306472).

The pharmaceutical compositions of the disclosure may be lyophilized or in aqueous form, i.e. solutions or suspensions. Liquid formulations of this type allow the compositions to be administered direct from their packaged form, without the need for reconstitution in an aqueous medium, and are thus ideal for injection. The pharmaceutical compositions may be presented in vials, or they may be presented in ready filled syringes. The syringes may be supplied with or without needles. A syringe will include a single dose, whereas a vial may include a single dose or multiple doses.

Liquid formulations of the disclosure are also suitable for reconstituting other medicaments from a lyophilized form. Where a pharmaceutical composition is to be used for such extemporaneous reconstitution, the disclosure provides a kit, which may comprise two vials, or may comprise one ready- filled syringe and one vial, with the contents of the syringe being used to reconstitute the contents of the vial prior to injection. The pharmaceutical compositions of the disclosure may include an antimicrobial, particularly when packaged in a multiple dose format. Antimicrobials may be used, such as 2- phenoxyethanol or parabens (methyl, ethyl, propyl parabens). Any preservative is preferably present at low levels. Preservative may be added exogenously and/or may be a component of the bulk antigens which are mixed to form the composition (e.g. present as a preservative in pertussis antigens).

The pharmaceutical compositions of the disclosure may comprise detergent e.g. Tween (polysorbate), DMSO (dimethyl sulfoxide), DMF (dimethylformamide). Detergents are generally present at low levels, e.g. <0.01%, but may also be used at higher levels, e.g. 0.01 50%.

The pharmaceutical compositions of the disclosure may include sodium salts (e.g. sodium chloride) and free phosphate ions in solution (e.g. by the use of a phosphate buffer).

In certain embodiments, the pharmaceutical composition may be encapsulated in a suitable vehicle either to deliver the inhibitor, for example to increase the stability. A variety of vehicles are suitable for delivering a pharmaceutical composition of the disclosure. Non-limiting examples of suitable structured fluid delivery systems may include nanoparticles, liposomes, microemulsions, micelles, dendrimers and other phospholipid-containing systems. Methods of incorporating pharmaceutical compositions into delivery vehicles are known in the art.

Examples of suitable compositions and methods of administration are provided in Esseku and Adeyeye (2011) and Van den Mooter G. (2006). Encapsulation within liposomes, which is also envisaged, is described by Fullerton, US Patent 4,235,877.

In some embodiments, the compositions disclosed herein are prepared as a nucleic acid composition. In some embodiments, the nucleic acid composition is a DNA composition. In some embodiments, DNA compositions, or gene compositions, comprise a plasmid with a promoter and appropriate transcription and translation control elements and a nucleic acid sequence encoding one or more polypeptides of the disclosure. In some embodiments, the plasmids also include sequences to enhance, for example, expression levels, intracellular targeting, or proteasomal processing. In some embodiments, DNA compositions comprise a viral vector containing a nucleic acid sequence encoding one or more polypeptides of the disclosure.

In some embodiments, the DNA composition is introduced by a needle, a gene gun, an aerosol injector, with patches, via microneedles, by abrasion, among other forms. In some forms the DNA composition is incorporated into liposomes or other forms of nanobodies. In some embodiments, the DNA composition includes a delivery system selected from the group consisting of a transfection agent; protamine; a protamine liposome; a polysaccharide particle; a cationic nanoemulsion; a cationic polymer; a cationic polymer liposome; a cationic nanoparticle; a cationic lipid and cholesterol nanoparticle; a cationic lipid, cholesterol, and PEG nanoparticle; a dendrimer nanoparticle. In some embodiments, the DNA compositions is administered by inhalation or ingestion. In some embodiments, the DNA composition is introduced into the blood, the thymus, the pancreas, the skin, the muscle, a tumor, or other sites.

In some embodiments, the compositions disclosed herein are prepared as an RNA composition. In some embodiments, the RNA is non-replicating mRNA or virally derived, self- amplifying RNA. In some embodiments, the non-replicating mRNA encodes the peptides disclosed herein and contains 5’ and 3’ untranslated regions (UTRs). In some embodiments, the virally derived, self-amplifying RNA encodes not only the peptides disclosed herein but also the viral replication machinery that enables intracellular RNA amplification and abundant protein expression. In some embodiments, the RNA is directly introduced into the individual. In some embodiments, the RNA is chemically synthesized or transcribed in vitro. In some embodiments, the mRNA is produced from a linear DNA template using a T7, a T3, or an Sp6 phage RNA polymerase, and the resulting product contains an open reading frame that encodes the peptides disclosed herein, flanking UTRs, a 5’ cap, and a poly(A) tail. In some embodiments, various versions of 5’ caps are added during or after the transcription reaction using a vaccinia vims capping enzyme or by incorporating synthetic cap or anti-reverse cap analogues. In some embodiments, an optimal length of the poly(A) tail is added to mRNA either directly from the encoding DNA template or by using poly(A) polymerase. The RNA encodes one or more peptides comprising a fragment that is a T cell epitope capable of binding to at least three HLA class I and/or at least three HLA class II molecules of a patient. In some embodiments, the fragments are derived from an antigen that is expressed in cancer. In some embodiments, the

RNA includes signals to enhance stability and translation. In some embodiments, the RNA also includes unnatural nucleotides to increase the half-life or modified nucleosides to change the immunostimulatory profile. In some embodiments, the RNAs is introduced by a needle, a gene gun, an aerosol injector, with patches, via microneedles, by abrasion, among other forms. In some forms the RNA composition is incorporated into liposomes or other forms of nanobodies that facilitate cellular uptake of RNA and protect it from degradation. In some embodiments, the RNA composition includes a delivery system selected from the group consisting of a transfection agent; protamine; a protamine liposome; a polysaccharide particle; a cationic nanoemulsion; a cationic polymer; a cationic polymer liposome; a cationic nanoparticle; a cationic lipid and cholesterol nanoparticle; a cationic lipid, cholesterol, and PEG nanoparticle; a dendrimer nanoparticle; and/or naked mRNA; naked mRNA with in vivo electroporation; protamine- complexed mRNA; mRNA associated with a positively charged oil-in-water cationic

nanoemulsion; mRNA associated with a chemically modified dendrimer and complexed with polyethylene glycol (PEG)-lipid; protamine-complexed mRNA in a PEG-lipid nanoparticle; mRNA associated with a cationic polymer such as polyethylenimine (PEI); mRNA associated with a cationic polymer such as PEI and a lipid component; mRNA associated with a

polysaccharide (for example, chitosan) particle or gel; mRNA in a cationic lipid nanoparticle (for example, l ,2-dioleoyloxy-3-trimethylammoniumpropane (DOTAP) or

dioleoylphosphatidylethanolamine (DOPE) lipids); mRNA complexed with cationic lipids and cholesterol; or mRNA complexed with cationic lipids, cholesterol and PEG-lipid. In some embodiments, the RNA composition is administered by inhalation or ingestion. In some embodiments, the RNA is introduced into the blood, the thymus, the pancreas, the skin, the muscle, a tumor, or other sites, and/or by an intradermal, intramuscular, subcutaneous, intranasal, intranodal, intravenous, intrasplenic, intratumoral or other delivery route.

Polynucleotide or oligonucleotide components may be naked nucleotide sequences or be in combination with cationic lipids, polymers or targeting systems. They may be delivered by any available technique. For example, the polynucleotide or oligonucleotide may be introduced by needle injection, preferably intradermally, subcutaneously or intramuscularly. Alternatively, the polynucleotide or oligonucleotide may be delivered directly across the skin using a delivery device such as particle-mediated gene delivery. The polynucleotide or oligonucleotide may be administered topically to the skin, or to mucosal surfaces for example by intranasal, oral, or intrarectal administration.

Uptake of polynucleotide or oligonucleotide constructs may be enhanced by several known transfection techniques, for example those including the use of transfection agents. Examples of these agents include cationic agents, for example, calcium phosphate and DEAE-Dextran and lipofectants, for example, lipofectam and transfectam. The dosage of the polynucleotide or oligonucleotide to be administered can be altered.

Administration is typically in a "prophylactically effective amount" or a "therapeutically effective amount" (as the case may be, although prophylaxis may be considered therapy), this being sufficient to result in a clinical response or to show clinical benefit to the individual, e.g. an effective amount to prevent or delay onset of the disease or condition, to ameliorate one or more symptoms, to induce or prolong remission, or to delay relapse or recurrence.

The dose may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the individual to be treated; the route of administration; and the required regimen. A physician will be able to determine the required route of administration and dosage for any particular individual. The dose may be provided as a single dose or may be provided as multiple doses, for example taken at regular intervals.

Typically peptides are administered in the range of 1 pg to 1 mg, more typically 1 pg to 10 mg for particle mediated delivery and 1 mg to 1 mg, more typically 1-100 mg, more typically 5-50 mg for other routes.

Examples of the techniques and protocols mentioned above can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.

Solid dosage forms for oral administration include capsules, tablets, caplets, pills, powders, pellets, and granules. In such solid dosage forms, the active ingredient is ordinarily combined with one or more pharmaceutically acceptable excipients, examples of which are detailed above. Oral preparations may also be administered as aqueous suspensions, elixirs, or syrups. For these, the active ingredient may be combined with various sweetening or flavoring agents, coloring agents, and, if so desired, emulsifying and/or suspending agents, as well as diluents such as water, ethanol, glycerin, and combinations thereof.

One or more compositions of the disclosure may be administered, or the methods and uses for treatment according to the disclosure may be performed, alone or in combination with other pharmacological compositions or treatments, for example chemotherapy and/or immunotherapy and/or vaccine and or opioids and/or antidepressants. The other therapeutic compositions or treatments may for example be one or more of those discussed herein, and may be administered either simultaneously or sequentially with (before or after) the composition or treatment of the disclosure. Examples

Example 1

Human osteosarcoma U-2OS and colon cancer RKO cells were generated that stably express a fusion protein comprising N-terminal sequences that are sufficient for oxygen- dependent degradation of the ERF-VII transcription factor RAP2.12 (Related to APETALA2) in plants, linked to a GFP:V5 reporter, and exposed these cells to hypoxia. To distinguish responses from those transduced by HIF, known inhibitors of the HIF N-terminal cysteine oxidations that differ in their specificity for these versus other iron-dependent dioxidases were also tested. Hypoxia and the non-specific iron chelator, dipyridyl, induced expression of the RAP_1- ₅₀:GFP:V5 reporter protein, but not that of a C2A mutant, without affecting reporter transcript levels (Fig. 1). In contrast, neither reporter was induced by non-specific 2-OG dioxidase inhibitors (DFO and DMOG), or a HIF N-terminal cysteine oxidation inhibitor (PHI), all of which robustly induced HIF (Fig. 2A). For cells exposed to hypoxia for 16 h, then treated with cycloheximide, before being re-oxygenated or maintained in hypoxia, we found that hypoxia prolonged the reporter protein half-life from ~5 to 35 min (Fig. 2B and Fig. 3). These findings demonstrated an iron and oxygen-dependent activity in human cells that is distinct from the HIF N-terminal cysteine oxidations and that operates in a Cys2-dependent manner on amino-acid sequences from plant RAP2.12.

Example 2

The response described in Example 1 was compared with that of members of the R4 group of RGS proteins, which are targets of the Cys-branch of the N-degron pathway in humans and mice (13, 14). Experiments on RKO cells stably expressing HA-tagged RGS4 (RGS4:HA) and an RGS4:GFP fusion (RGS4_1-20:GFP), each encoding wild-type or C2A mutant sequences, revealed induction of wild-type, but not mutant proteins by hypoxia and dipyridyl, but not

DMOG or DFO (Fig. 2C and Fig. 4). Endogenous RGS4 and RSG5 proteins in human neuroblastoma SH-SY5Y cells responded identically to the same set of compounds (Fig. 2D).

Responses of these RGS proteins to graded hypoxia were further examined in a series of human

(SH-5Y5Y, RKO, human endothelial EA.hy926) and mouse embryonic sarcoma (C3H/10T1/2) cells, revealing progressive accumulation of RGS4 or RGS5 proteins in response to

physiological hypoxia (Fig. 2E and Fig. 5). These changes were observed at the level of proteins and not mRNAs, with the exception of RGS4 in SH-SY5Y. Thus, plant and human reporter proteins and endogenous RGS proteins appeared to be regulated similarly, suggesting that human cells might regulate their stability using enzyme(s) similar to the PCOs.

Example 3

Inspection of the human genome revealed two candidate thiol oxidases, cysteine di oxidase (CDO1) and an enzyme previously assigned as cysteamine (2-aminoethanethiol) dioxygenase (ADO) (15, 16). Genes encoding these enzymes and PCO1 were co-transfected with the RGS4:HA gene into human embryonic kidney 293T cells. Overexpressed ADO, but not CDO1 , suppressed hypoxic induction of RGS4:HA, in a manner dependent on cysteine at position 2 (Fig. 6A). At these levels of overexpression, RGS4:HA was not suppressed by PCO1. The ability of ADO to suppress RGS4:HA was inhibited by combined exposure to hypoxia and dipyridyl and ablated by H112A+H114A mutations (Fig. 7) that prevent assembly of the catalytic iron center (15). These experiments indicated that the catalytic activity of overexpressed ADO was sufficient to suppress RGS4:HA.

Example 4

ADO and CDO1 was inactivated in SH-SY5Y and RKO cells, using CRISPR/Cas9- mediated gene editing. Inactivation of ADO but not CDO 1 led to constitutive upregulation of endogenous and tranfected RGS4 and RGS5 proteins irrespective of oxygen levels (Fig. 6B, 8 and 9). Responses to the nitric oxide donor DETA-NO in wild type and ADO-deficient cells were also tested, in view of reported actions of nitric oxide on RGS proteins (9, 17). Suppression of hypoxic RGS4 levels by DETA-NO in wild-type SH-SY5Y and RKO cells was also abrogated in ADO-deficient cells (Fig. 10). Stable re-expression of ADO, but not overexpression of CDO1 , suppressed levels of RGS proteins (Figs. 9 and 1 1). Under these conditions, expression of PCO1 also suppressed RGS proteins and restored regulation by oxygen, demonstrating oxygen- dependent activity of the plant enzyme on endogenous human proteins. Next, the arginyl- transferase ATE-1 that operates downstream of the proposed Cys-oxidation in the N-degron pathway was inactivated in SH-SY5Y cells. Up-regulation of RGS5 in ATE 1 -deficient and ADO-deficient cells was similar, and was not suppressed by overexpression of ADO in ATE 1 - deficient cells (Fig. 6C). Thus ADO is required for oxygen-dependent degradation of RGS proteins. This activity was dependent on the integrity of ATE1, consistent with ADO acting upstream of ATE1 in the N-degron pathway. Example 5

To explore whether ADO can complement deficient PCO in plants, PCO-depleted Arabidopsis thaliana mutant was generated by crossing plants in which four of the five known PCO (1, 2, 4 and 5) genes were inactivated by T-DNA insertional mutagenesis. Homozygous quadruple pco1/2/4/5 mutant plants ( 4pco ), but not triple pco1/2/4 ( 3pco ), manifested severe developmental defects (Fig. 6D) and upregulation of hypoxia-responsive genes under aerobic conditions (Fig. 6E). When human ADO, but not CDO1 , was introduced into 4pco plants under control of the PCO1 promoter, the constitutive upregulation of anaerobic genes in air was corrected and the plants developed normally (Figs. 6D and 6E, and Fig. 12). Consistent with complementation of defective PCO function, co-expression of ADO in A. thaliana protoplasts caused dose-dependent suppression of RAP2.12 luciferase fusion protein activity (Fig. 12). Example 6

Interestingly, in budding yeast, Cys is not a destabilizing N-terminal residue (18). To determine if deficiency of an ADO-like enzyme might be responsible for the stability associated with N-Cys in yeast, ADO or CDO1 was introduced into yeast cells together with a ratio-metric reporter in which the activity of a RAP2.12 -Firefly Luciferase fusion protein or a C2A mutant is normalized to Renilla Luciferase (Fig. 13). Expression of human ADO but not CDO1 reduced the activity of, and conferred hypoxic regulation on, the RAP_2-28-FLUC protein but not a C2A mutant (Fig. 6F and Fig. 13). Consistent with this, phylogenetic analyses revealed potential ADO/CDO orthologues across most plants, animals and at least some protist species, but not fungi (Fig. 14). Together, these findings explain the lack of activity of cysteine as a destabilizing residue in yeast, but suggest the pathway might otherwise operate widely in eukaryotic species. Example 7

Cross-complementation suggested that ADO catalyzes a form of N-terminal cysteine di oxygenation similar to that catalyzed by the PCOs. To test this, recombinant human ADO and CDO1 were produced in E. coli, reacted these enzymes with synthetic peptides corresponding to residues 2-15 of human RGS4 and RGS5 and examined the products by mass spectrometry. The peptides were modified by +32 Da mass addition by ADO but not CDO1 (Figs. 15A and 16).

Further , this modification was suppressed in anaerobic conditions (Fig. 15B). To confirm dioxygenation, the reactions were conducted in an atmosphere of ¹⁸ O₂ or in the presence of ¹⁸O- labelled water (H₂ ¹⁸O). These experiments revealed a single +36 Da mass addition in ¹⁸ O₂, and a single +32 Da mass addition in the presence of ¹⁸O-labelled water, demonstrating that two oxygen atoms were incorporated directly into the peptide from molecular oxygen and confirming dioxygenation (Fig. 15B). MS2 assigned the modification to the N-terminal cysteine (Fig. 17). Thus, human ADO catalyzes the dioxygenation of N-Cys residues in RGS4 and RGS5 to cysteine sulfinic acid. Kinetic measurements on human ADO (Fig. 15C and Fig. 18) revealed high k_catPep values of 20.1 and 16.9 s^-1 on RGS4 and RGS5 peptides under atmospheric conditions, but marked sensitivity to oxygen (K_mO₂ ^app >500 mM). Thus ADO resembles the HIF N-terminal cysteine oxidation enzymes in manifesting a K_mO₂ that is significantly above the physiological range, suggesting a role in oxygen homeostasis. Given that ADO was previously considered to be a cysteamine dioxygenase, competition of N-Cys peptide dioxygenation by free cysteamine and cysteine was examined. However, inhibition occurred only at high

concentrations of these metabolites (IC₅₀ 37 and 13mM, respectively, Fig. 19).

Example 8

RGS4 and RGS5 regulate heterotrimeric G-protein signaling by enhancing Ga-coupled

GTP hydrolysis and hence attenuating G-protein signals. Since the catalytic activity of ADO lowers levels of RGS4 and 5, ADO-deficient cells in which levels of these proteins are increased, should manifest attenuation of G-protein signaling on relevant pathways. Ga proteins can regulate the activity of mitogen-activated protein kinase (MAPK) pathways (14, 19). Consistent with this, mouse cells and embryos with a defective N-degron pathway due to loss of the arginyl- transferase ATE1, have been shown to exhibit reduced activation of MAPK kinase ( 14).

Phosphorylation of MAPK (p44/p42) was therefore assayed in ADO-deficient SH-SY5Y cells

(Fig. 20A). These experiments revealed reduced levels of phosphorylated MAPK in ADO- deficient SH-SY5Y cells that were similar to levels of phosphorylated p44/p42 in ATE1- deficient SH-SY5Y cells. Reduction in phosphorylated p44/p42 was reversed by expression of

ADO in ADO KO but not ATE1 KO cells (Fig. 20B). Carbachol is a cholinergic agonist whose muscarinic receptor is coupled via Gaq to the regulation of intracellular Ca²⁺. Carbachol was examined to test the effects of ADO on responses to a specific G-protein coupled agonist.

Attenuation of Ca²⁺ mobilization in response to carbachol (Fig. 20C), but not the receptor- independent ionophore, ionomycin (Fig. 20D), was observed in ADO-deficient cells and was reversed by re-expression of ADO. Given the complexity of interactions among RGS proteins and G-protein signalling pathways, it cannot be certain that these effects are entirely caused by effects of ADO on RGS4 and RGS5 proteins. Nevertheless, these experiments establish a role for ADO in the regulation G-protein signalling, consistent with its role as a Cys-modifying enzyme in the N-degron pathway regulating RGS proteins.

Example 9

N-terminal sequence analyses of proteins encoded by plant and animal genomes have suggested the existence of many other potential substrates for the Cys-branch of the N-degron pathway (7, 9) and ADO is more widely expressed in human cells and tissues than RGS4/5(2d).

It was therefore investigated whether ADO-mediated oxygen-dependent regulation of human proteins extended beyond the identified RGS proteins. First recombinant ADO was reacted with a diverse series of peptides derived from proteins predicted to be processed to generate N-Cys polypeptides, and monitored for di oxygenation (+32 Da mass shift) by MS. These experiments revealed substrate-dependent catalytic activity of ADO, ranging from close to zero, to levels that were similar to those using RGS5 peptide (Table 4 and Figs. 21, 22). Table 4 Catalytic activity od ADO on peptides

Available antibodies were used examined endogenous protein levels corresponding to peptide substrates that supported high (IL-32) or very low (asparagine synthetase, (ASNS) and JunB) ADO-catalyzed dioxygenation. These experiments were conducted in the previously engineered ADO-deficient RKO cells as IL-32 was not detected in SH-SY5Y cells.

Immunoblotting revealed that the abundance of IL-32, but not ASNS or JunB, was increased in hypoxic cells, accumulated constitutively in ADO-deficient cells and was reduced by re- expression of transfected ADO (Fig. 20E). Experiments in wild type and ADO-deficient RKO cells confirmed IL-32 regulation at the protein but not mRNA level (Fig. 20F). Further experiments confirmed dioxygenation of the N-terminal cysteine following reaction of the IL-32 peptide with recombinant ADO, and that this residue was necessary for ADO-mediated suppression of co-transfected IL-32 in cells (Fig. 22). These findings demonstrate that ADO target proteins do extend beyond RGS proteins, including, for example, to human IL-32. The tested peptides represent only a small fraction of N-Cys polypeptides that might be generated in cells and it is therefore likely that other ADO-regulated targets exist.

Example 10

Conservation of ADO and the PCOs as human and plant oxygen sensors contrasts with the absence of conservation of their known substrates, and with different challenges to oxygen homeostasis that are encountered by animals and plants. In plants, the ERF -VII pathway directs transcriptional responses to hypoxia that require time for the transcriptional output to engage adaptive responses. In animal cells the principal process regulating transcriptional responses to hypoxia is the prolyl hydroxylation of HIF. In contrast, direct operation of ADO on the protein stability of signalling molecules has the potential to transduce more rapid responses to hypoxia than HIF. RGS4 and RGS5 have been implicated in oxygen homeostasis in mammals through effects on the cardiovascular system and angiogenesis( 13, 19, 21). IL-32 is an atypical cytokine that regulates pro-inflammatory cytokine networks and angiogenic growth factors( 22, 23).

Example 11

Three further substrates of ADO-catalysed N-terminal cysteine oxidation were identified using similar experiments to those described in Example 9. Each experiment was run in triplicate. The peptide sequences were USP27X: NH2-CKDYVYDKDIEQIA-COOH;

TMEM168: NH2-CKSLRY CFSHCLYL-COOH; and ANKRD29: NH2 -CKD YVYDKDIEQIA- COOH. Results are shown in Figure 23. Example 12

ADO substrate analogue were generated. “MC7” is a 7-mer having the N-terminal sequence of Met-cleaved RGS4 with substitutions of the N-terminal cysteine with seleno- cysteine and substitution of the alanine at position 6 with a leucine (the latter being the result of a mistake in the manufacture). MC7 accordingly has the sequence (SEQ ID NO: 210) ZKGLALL (wherein Z = seleno-cysteine). “MC9” is a 7-mer having the N-terminal sequence of Met- cleaved IL-32 with substitution of the N-terminal cysteine with seleno-cysteine. MC9 has the sequence (SEQ ID NO: 21 1) ZFPKVLS (wherein Z = seleno-cysteine).

The influence of the MC7 and MC9 substrate analogues on ADO turnover was determined by monitoring the activity of 0.05 mM recombinant ADO with 20 mM RGS5_2-15 in the presence of 200 mM substrate analogue; also present in each reaction mix was 5 mM TCEP,

20 mM FeSO₄ and 1 mM sodium ascorbate in 50 mM bis-tris propane/ 50 mM NaCl/ pH 7.5.

Aliquots were quenched at 1 , 3 and 10 minutes with 1 % formic acid (v/v). Control reactions were conducted in the absence of substrate analogue or in the absence of enzyme. Oxidation was monitored by high throughput MS using a RapidFire RF360 sampling robot connected to an

Agilent 6530 Accurate-Mass Q-ToF mass spectrometer (Agilent) operated in positive ion mode.

Source conditions were adjusted to maximize sensitivity and minimize fragmentation. Samples were injected onto a C-4 solid phase extraction (SPE) cartridge equilibrated with deionised water containing 0.1 % formic acid (v/v), washed with the equilibration solution and eluted in 85 % acetonitrile and 0.1 % formic acid (v/v). Turnover was quantified by comparing the integrated area underneath the product and substrate ions extracted from the total ion current chromatogram using the RapidFire Integrator software. Results are shown in Figure 23. Similar experiments were conducted using IL-32_2-15 as substrate. Results are shown in Figure 24. Both of the substrate analogues having an N-terminal seleno-cysteine (MC7 and MC9) were potent inhibitors of oxidation of RGS4 peptide; MC7 was a potent inhibitor of oxidation of IL32 peptide.

Example 13 Novel ADO knockout human and murine cell models

Novel ADO- and ATE 1 -deficient cell lines were constructed as shown in Figure 26A. All cell lines were constructed using CRISPR-Cas9 genetic editing technology to silence either ADO or ATE1, or both. Immunoblotting provided evidence of gene silencing/loss of detectable protein. Cells were treated with a range of iron chelators (2,2 DIP, DFO) or prolyl hydroxylase inhibitors (DMOG, IOX3) or hypoxia, to demonstrate inducibility (or lack thereof) of ADO target proteins RGS4, RGS5 or IL-32. Note, U87-MG cells do not express any of the above target proteins at detectable levels, so functional silencing could not be validated. HIF-1a protein expression is used as a positive control for the treatments. The results shown in Figure 26 demonstrate that stability of:

1. RGS4 is regulated in an ADO-, Fe- and Oxygen-dependent manner in RKO cells;

2. IL32 is regulated in an ADO- and oxygen-dependent manner in HepG2 cells

(independent of HIF regulation);

3. RGS4 is regulated (perhaps less strongly) in an ADO- (and partially oxygen-) dependent manner in C3H10T1/2 cells; and

4. RGS5 is regulated in an ADO-, Fe-, oxygen- and ATE 1 -dependent manner in SH-Sy5Y cells.

Example 14 - Fluorescent reporter assay for in-cell ADO activity

A GFP reporter protein, with a modified N-terminus to incorporate the N-terminus of RGS4, was developed as an assay for in-cell ADO activity (Figure 27A). The stability of this reporter protein, similar to that of endogenous ADO substrates, is dependent on ADO, Fe and oxygen. When this protein was expressed in cells, GFP fluorescence increased with exposure to hypoxia (i.e. the GFP reporter accumulates in hypoxia as it is not targeted for degradation by ADO) (Figures 27 B and C).

Example 15 - Inflammatory mediators impact ADO activity towards IL32

The interactions between ADO and inflammatory mediators was investigated. Wild-type

(WT) or ADO knockout HepG2 cells were treated with traditional inflammatory cytokines interleukin 1 b ( IL-1b) or tumour necrosis factor a (TNFa) for 16 h, then exposed to hypoxia for a further 2h. Protein and mRNA extracts were collected and analysed for IL-32 expression. A representative immunoblot is shown, and the quantification of 3 independent experiments is shown in Figure 28. ADO restricts the ability of inflammatory mediators such as IL-1b and TNF-a to induce IL-32 in HepG2 cells under normoxia. Inhibition of ADO activity, either by exposure to hypoxia or genetic silencing, results in exaggerated IL-32 accumulation.

Example 16 - Identification of novel ADO substrates

ADO catalysed oxidation of novel substrates was determined using two different assays.

For mass spectrometry assay (MS assay) 14mer peptides from candidate ADO substrates were incubated with AD for 1 minute followed by analysis by mass spectrometry. This revealed Nt- Cys oxidation at rates comparable to that of RGS4; rates ranged from 0.34% RGS4 oxidation to 158% RGS4 oxidation (n=3+) (Table 5). A yeast reporter assay (Masson N et al Science, 2019) was used to determine increase in expression of potential ADO substrates in hypoxia vs.

normoxia (Table 5 shows initial 14 amino acids but substrates used were ~50 residues in this assay).

Table 5

Materials and Methods

Reagents

Unless otherwise stated, all reagents were purchased from Sigma-Aldrich. DMOG was from Frontier Scientific. PHI [(1-chloro-4-hydroxy-isoquinoline-3-carbonyl)-amino]-acetic acid was from C.J. Schofield (University of Oxford). MG- 132 (Z-Leu-Leu-Leu-CHO) was from BioMol International.

Plasmid Construction

Mammalian expression plasmids.

To generate the RAP_1-5 GFP:V5 reporter plasmid, a synthetic oligonucleotide (GeneArt,

Thermo Fisher Scientific), encoding the first 50 amino acids of the RAP2.12 plant transcription factor (Uniprot Q9SSA8, with either a Cys or Ala at position 2) fused to eGFP was inserted into the pcDNA6.2/V5 DEST Gateway vector. The RGS4_1-20:GFP reporter plasmid (encoding the first 20 amino acids of the human RGS4 isoform 1 , Uniprot P49798-1 fused to eGFP) was produced by ligation of a synthetic oligonucleotide into pcDNA3.1 (GeneArt, Thermo Fisher Scientific). Similarly the RGS4:HA reporter plasmid was produced by ligation of a synthetic cDNA corresponding to full length human RGS4 isoform 1 with a C-terminal HA tag into pcDNA3.1. The RGS4(C2A):HA reporter plasmid was then generated by PCR-based introduction of the Cys2 to Ala mutation. Human ADO cDNA (Image ID

5295674/IRATp970D0689D [BC067740.1]) was from Source BioScience and CDO1 cDNA (pCMV3-Flag- CDO1 [BC024241]) was from Sino Biological. Codon optimized (for mammalian expression) cDNA encoding FLAG-tagged PCO1 (from A. ihaliana, NCBI reference

NM_121516) was produced synthetically (GeneArt, Thermo Fisher Scientific). ADO, CDO1 and FLAG-PCO1 cDNAs were used as templates to produce PCR products which were inserted by BamHI-SnaBI restriction enzyme digest into pRRL-IRES-GFP (provided by K. Kranc,

University of London). pRRL-IRES-RFP was then created by replacing the GFP cDNA with RFP (provided by M. E. Cockman, The Francis Crick Institute). Catalytically inactive ADO, in which histidines 112 and 1 14 were mutated to alanine, was produced as a synthetic

oligonucleotide (GeneArt, Thermo Fisher Scientific) and inserted into pRRL-IRES-RFP or GFP as described above. A plasmid encoding human IL-32, tagged with a FLAG epitope at the C- terminal, was from Genscript, and a Cys2 to Ala mutant produced synthetically and ligated into the same vector (pcDNA3+, GeneArt, Thermo Fisher Scientific).

Plant expression plasmids

Synthetic cDNAs codon-optimized for expression in A. thaliana (GeneArt, Thermo

Fisher Scientific) and encoding human ADO and CDO1 proteins with a C-terminal nuclear localization sequence (SEQ ID NO: 144 PYPGPKVFPPKKKRKV) were inserted into pENTR™/D-TOPO™ (Thermo Fisher Scientific). The Gateway® destination vector pH7WG2 for functional Agrobacterium plant transformation was modified to contain the PCO1 promoter by removing the 35S CaMV promoter (using Spel and Sacl restriction enzymes) and ligating the

1143 bp PCO1 promoter using Anza T4 DNA ligase (Thermo-Fisher Scientific) to create pH7WG(pPCO1). pENTR-ADO:NLS and pENTR-CDO1 :NLS were then recombined into pH7WG(pPCO1) using the LR clonase II enzyme mix (Thermo Fisher Scientific) to generate T-

DNA binary plasmids that express either ADO:NLS or CDO1 :NLS cDNAs under the control of the PCO1 promoter (pH7WG(pPCO1)AD0/CDO1 :NLS). The p2GW7 gateway vector was used for transient transformation of protoplasts to express ADO, CDO1, the bacterial enzyme b- glucuronidase (GUS) or renilla luciferase, under control of the constitutive 35S CaMV promoter (35S:). The 35S:RAP_1-28 FLUC reporter plasmid expressing firefly luciferase C-terminally fused to the initial 28 amino acids of RAP2.12 has been described(7).

Yeast expression plasmids

The pENTR-ADO:NLS and pENTR-CDO1 :NLS plasmids were used for recombination into pAG415GPD-ccdB (provided by Susan Lindquist, Addgene plasmid #14146) to direct the constitutive expression of ADO:NLS and CDO 1 :NLS in S. cerevisiae. The same parent vector pAG415GPD-ccdB was used as a control when expressing the unrelated enzyme b- glucuronidase (GUS). The Cys-containing Dual Luciferase O₂ Reporter (C-DLOR) cDNA and its (Cys to Ala) N-degron pathway insensitive counterpart (A-DLOR) were synthesized

(GeneArt, Thermo Fisher Scientific), inserted into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and then recombined into the integrative pAG304GPD-ccdB plasmid (provided by Susan Lindquist Addgene plasmid # 14136).

Cell culture and hypoxic exposure

U-2OS, RKO, EA.hy926 and HEK 293T cells were cultured in DMEM, and SH-SY5Y in DMEM-F12. C3H/10T1/2 cells were cultured in BME. All media were supplemented with 10% fetal bovine serum, 2mM L-Glutamine, 100 U/ml penicillin and 10mg/ml streptomycin, and additionally with endothelial cell growth supplement for EA.hy926 cells. Cells were maintained at 37°C under an atmosphere of 5% CO₂ in air. Hypoxic incubations were conducted within an atmosphere-regulated workstation set at 0.1-5% O₂: 5% CO₂: balance N₂ (fnvivo 400, Baker- Ruskinn Technologies).

Transient transfection of 293T cells

For transient co-transfection experiments, 293T cells were plated at ~40% confluence and transfected the following day with 1 -4mg pRRL plasmid and 2mg pcDNA3-RGS4:HA using polyethylenimine reagent. After 8 h, transfected cells were then split into two separate plates and incubated under normoxia (-18% O₂) or hypoxia (0.1-1% O₂) for 4-16 h. Equal expression of thiol dioxidase protein was confirmed by a comparison of untagged versus N-terminally FLAG- tagged enzymes. Expression of C-terminally tagged IL-32 and its C2A mutant counterpart was achieved using 1 mg of the relevant plasmid.

Generation of stable reporter cell lines To generate stable reporter cell lines, U-2OS or RKO cells at -40% confluence were transfected with pcDNA6/3 RAP_1-5 GFP:V5, RGS4_1-20:GFP or RGS4:HA reporter plasmid using GeneJuice (Novagen). After 24 h, cells were seeded at limiting dilution in selection medium (containing 5-10mg/ml Blasticidin S [InvivoGen] for pcDNA6 based reporters) or 0.8- 1.5mg/ml G418 [Santa Cruz Biotechnology] for pcDNA3-based reporters) and resistant clones isolated and expanded. Clones stably expressing the reporters were identified by

immunoblotting.

Generation of thiol dioxidase-overexpressing cell lines

To generate ADO, CDO1 and FLAG-PCO1 stable overexpressing lines, cells were incubated with pRRL lentivirus containing supernatant; produced by transfecting 293T cells with the appropriate pRRL vector, together with the lentiviral packaging plasmid, pCMVDR8.2 and envelope plasmid, pCMV-VSVG. The 293T viral supernatant was collected 48 h post- transfection, filtered and mixed with 15 mg/ml Polybrene. The ratio of lentiviral supernatant: cell medium applied to the target cells, was kept between 1 :5 and 1 :2 to produce >90% infection efficiency (confirmed by GFP fluorescence imaging of the cells). To confirm comparable protein expression of ADO, CDO1 and FLAG-PCO1 enzymes, N-terminally FLAG-tagged versions of ADO and CDO1 were also used to enable the cross-referencing of protein levels by parallel FLAG-immunoblotting.

CRISPR/Cas9-mediated genetic editing of RKO and SH-SY5Y cells

Single guide RNA (sgRNA) design and RNA-ribonucleoprotein (RNP) complex transfections were undertaken with the help of J. Riepsaame (University of Oxford).

Production of sgRNAs

Single guide RNAs (sgRNAs) were transcribed in vitro from double-stranded DNA templates. In brief, 60-mer DNA oligos harboring an 18-20-mer protospacer sequence flanked 5’

(upstream) by a T7 promoter sequence (SEQ ID NO: 145; TAATACGACTCACTATAGG) and

3’ (downstream) by part of the conserved tracrRNA domain sequence (SEQ ID NO: 146

;GTTTTAGAGCTAGAAATAGCAA) was annealed to a universal 80-mer oligo (SEQ ID NO:

147 ; AAAAGCACCGACT CGGT GCCACTTTTT CAAGTT GATAACGGA

CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) harboring the remainder of the tracrRNA and gap-filled using T4 DNA polymerase (NEB). The resulting double-stranded DNA template was column purified using a DNA Clean & Concentrator kit (Zymo Research) and 500 ng used in a 30mL in vitro transcription reaction using the HiScribe T7 High Yield RNA

Synthesis Kit, and the manufacturer’s protocol (NEB). After 4 h incubation at 37°C, the remaining DNA template was degraded by adding 2 ml of DNAsel and 18 ml water to the reaction. Finally, sgRNAs were purified using a MEGAclear Transcription Clean-Up Kit (Thermo Fisher Scientific) according to the manufacturer's instructions and eluted in 25mL nuclease-free water. Guide RNA concentration and purity was measured using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). For each gene target multiple guide sequences were used to generate the sgRNAs as follows:

sgRNAs for CDO1 and ATE1 were designed to span an intron/exon or exon/intron boundary (in order to disrupt splicing), whereas ADO is a single exon gene.

RNP transfection of target cells

Genetically edited cell lines were generated by nucleofection of target cells with a

Cas9/sgRNA-RNP complex; produced by combining l mg of each sgRNA with 5mg HiFi Cas9

Nuclease (IDT) in a total volume of 2 ml IDT Duplex Buffer (IDT), re-suspending five times and incubating at 37°C for 5 min. Resulting RNP mixes were added directly to cells prior to nucleofection using the Neon Transfection system (Thermo Fisher Scientific), associated Neon

Transfection System 10 mL kit (Thermo Fisher Scientific) and recommended nucleofection settings for RKO and SH-SY5Y cell lines. After nucleofection, cells were allowed to recover for

48 h and then seeded at limiting dilutions to grow into individual colonies.

Identification of CRISPR/Cas9 edited clones

Colonies derived from ADO and ATE1 RNP transfections were screened by immunoblot in the first instance to identify candidate edited clones. CDO 1 clones together with ADO and

ATE 1 candidate edited clones (identified by immunoblot) were then further verified by a combination of genomic PCR and Sanger sequencing. Genomic DNA was extracted from cell pellets by incubation in lysis buffer (100mM Tris pH 8.0, 5mM EDTA, 200 mM NaCl, 0.2% SDS and 100 mg/ml Proteinase K) with shaking at 55°C for 2 h, followed by isopropanol precipitation and a 70% ethanol wash. Precipitated genomic DNA was then re-suspended in TE buffer (10mM Tris-HCl pH 8.0 containing ImM EDTA) by an incubation at 60°C with shaking for 2 h. Genomic target regions were then PCR amplified (CDO 1 forward primer:

CCACGAGAT GGAACAGACCG (SEQ ID NO: 154)and reverse primer:

GGGGTT AACGAT GGCTTGGG (SEQ ID NO: 155; ATE1 forward primer:

GCGCCAGGCTTCGCT CTCCAC (SEQ ID NO: 156) and reverse primer:

CGAGAGTGCCCCCTCCGTCTCG (SEQ ID NO: 157) with Phusion High-Fidelity PCR Master Mix (NEB) according to the manufacturer's protocol using 30 cycles, denaturation at 98°C and an annealing temperature of 63°C. For ADO genomic PCR (ADO forward primer: GCTCAGAGGGGGCTCAAG (SEQ ID NO: 158) and reverse primer:

GT CT AGCTT GTCCAT GCAGC (SEQ ID NO: 159)), KAPA2G Fast Hotstart Genotyping Mix (Sigma Aldrich) was used as per the manufacturer's protocol using 35 cycles, denaturation at 95°C and an annealing temperature of 64°C. Following analysis of PCR products on agarose gels, DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen) and Sanger sequenced. Immunoblotting

Cell lysates were prepared as follows: cells (~4 x 10⁶) were washed in phosphate buffered saline and then lysed in 300 ml Igepal lysis buffer (10 mM Tris pH 7.5, 0.25 M NaCl, 0.5% Igepal) containing Complete™ protease inhibitor cocktail (Sigma Aldrich) at 4°C for 5 min. Samples were centrifuged at 13,000 rpm for 5 min at 4°C, after which the supernatant (cell lysate) was mixed with Laemmli sample buffer. For determination of IL-32 expression by immunoblot, cells were lysed in SDS lysis buffer (50 mM Tris pH 6.8, 2% SDS, 10% Glycerol) and sonicated, before mixing with Laemmli sample buffer. Proteins were separated by SDS-polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membrane (Immobilon-P, Millipore) and blocked in either 4% fat free milk (in phosphate- buffered saline containing 0.1% Tween 20) or 2% bovine serum albumin (in Tris-buffered saline containing 0.1% Tween 20) for p44/42 MAPK immunoblotting. Primary antibodies used were: V5 (MCA1360, Serotec), GFP (11814460001, Sigma Aldrich), HIF-1a (610959, BD Biosciences), HRP conjugated HA (3F10, Sigma Aldrich), HRP-conjugated FLAG (A8592, Sigma-Aldrich), ADO

(abl34102, Abeam), ATE1 (HPA038444) and CDOl (HPA057503) from Atlas Antibodies. Phospho- p44/42 MAPK (Thr202/Tyr204) antibody (9101), p44/42 MAPK Antibody (9102), RGS4 (15129) and JunB (3753) from Cell Signaling Technologies, RGS5 (sc-514184), IL-32 (sc-517408) and ASNS (sc- 365809) from Santa Cruz Biotechnology. HRP-conjugated secondary antibodies (DAKO) and chemiluminescence substrate (West Dura, 34076, Thermo Fisher Scientific) were used to visualize proteins, using a ChemiDoc XRS+ imaging system (BioRad). After immunoblot analysis, membranes were stained with Coomassie brilliant blue to visualize separated proteins, and this was used as a reference of sample loading. Densitometric analysis was performed using ImageJ software (NIH) and values presented relative to Coomassie blue staining. For analysis of p44/42 MAPK phosphorylation, phospho- and total-p44/42 MAPK were probed on separate blots and corrected for their respective Coomassie stain. Loading-corrected phospho-p44/42 MAPK signal was then expressed as a ratio to the corresponding total p44/42 MAPK signal.

Real-time quantitative PCR

Mammalian cells were lysed in TRIzol and mRNA extracted by phase separation. Equal amounts of mRNA were used for cDNA synthesis using the High Capacity cDNA Kit (Applied Biosystems). Expression analyses were performed using Fast SYBR Green Master Mix on a StepOne thermocycler (both from Applied Biosystems, now Thermo Fisher Scientific) using the AACt method. Primers used for analysis were as follows: RAP_1-50:GFP:V5 reporter transcript (forward primer: ACCCCGACCATATGAAGCAG (SEQ ID NO: 160) and reverse primer: GGCCCT GGT CTTGTAGTT GC(SEQ ID NO: 161), HPRT (forward primer:

GACCAGTCAACAGGGGACAT (SEQ ID NO: 162) and reverse primer:

AACACTTCGTGGGGTCCTTTTC (SEQ ID NO: 163), RGS4 (forward primer:

GCAAAGGGCTT GC AGGT CT (SEQ ID NO: 164) and reverse primer:

CAGCAGGAAACCTAGCCGAT (SEQ ID NO: 165), RGS5 (forward primer:

TGGTGACCTTGTCATTCCG (SEQ ID NO: 166) and reverse primer:

TTGTTCTGCAGGAGTTTGTCC (SEQ ID NO: 167), and 1L32 (forward primer:

CTT CCCGAAGGT CCT CT CT GAT (SEQ ID NO: 168) and reverse primer:

GTCCTCAGTGTCACACGCT (SEQ ID NO: 169). Primers used for analysis of mouse transcripts were as follows: Hprt (forward primer: GTTGGATACAGGCCAGACTTT (SEQ ID NO: 170)and reverse primer: CCACAGGACTAGAACACCTGC (SEQ ID NO: 171)) and Rgs4 (forward primer: TGCCTTTCTCTCCTCGCTAA (SEQ ID NO: 172) and reverse primer: CAGCCGAT GTTT CAT GTCCT (SEQ ID NO: 173).

Intracellular Ca²⁺ measurements

SH-SY5Y parental (WT) and ADO (CRISPR/Cas9) edited cells (KO), seeded on coverslips the previous day, were loaded with 5mM Indo-1AM (Life Technologies) a UV light- excitable, ratiometric Ca²⁺ indicator for 60 min at room temperature. Coverslips were then mounted in a continuous perfusion system above a microspectrofluorimeter (Nikon Diaphot 200) equipped with a xenon lamp light source and photomultiplier tubes (Thom EMI). Indo-1 was excited at 340 nm and emitted fluorescence intensity measured at 405 nm and 495 nm. The ratio of fluorescence emission (R405/495) was used as a measure of intracellular Ca²⁺. Coverslips were perfused with bicarbonate-buffered Tyrode solution (1 17 mM NaCl, 4.5 mM KC1, 1 mM CaCl₂, 1 mM MgCl₂, 2.5 mM NaHCO₃, 11 mM Glucose) at 37°C and gassed with 5% CO₂ in air. Carbachol (CCh, 0.05 to 10mM) or ionomycin (Iono, 0.1 mM) were prepared as separate solutions and administered via a rapid, in-line switching mechanism. To account for variation in drug stability or dye loading, the WT and ADO KO cells were tested alternatively. Raw fluorescence intensity values were background-corrected and smoothed using Prism 7

(GraphPad). Peak change above baseline was measured by using an‘analyze peaks’ algorithm, plotted against [CCh] and subjected to 3 parameter log(agonist) vs response non-linear regression analysis.

Plant assays

A. thaliana growth conditions

A. thaliana Columbia-0 (Col-0) was used as the wild-type ecotype. Seeds were sown in moist soil containing pit and perlite in a 3: 1 ratio, stratified at 4°C in the dark for 48 h and then germinated at 22°C day/18°C night with a photoperiod of 12 h of light and 12 h of darkness with 100±20 mmol photons m^-2 s^-1 intensity. Adult plants at the vegetative stage (i.e. 7 weeks of age in the case of 4pco and 4pco+CDO1 plants and 4 weeks for the remaining genotypes) were used for the analyses. Seeds for 4pco and 4pco+CDO1 plants were sown 3 weeks earlier than the other genotypes to enable the parallel harvest of plants.

4pco mutant generation

The quadruple 4pco mutant was generated by subsequent rounds of crossing by manual pollination of Arabidopsis T-DNA mutants followed by PCR-assisted selection of homozygous insertions in the relevant genes. All T-DNA mutant lines were purchased from the Nottingham Arabidopsis Stock Centre (uNASC). T-DNA insertion line for PCO1 ( At5gl5120 ) was N451210, for PCO2 ( At5g39890 ) was N116554, for PCO4 ( At2g42670 ) was N471015 and for PCO5 ( At3g58670 ) was N684949. The allelic status of each T-DNA insertion was tested by two parallel genomic PCR reactions using the following primer sets: insPCO1fw

(AATGGT GGTCCT GGT GTTATT C (SEQ ID NO: 174) with insPCO1rv

(GCAAGGTAACAACGACAAACAA (SEQ ID NO: 175) and insPCO1fw with LB1GK (AT ATT GACC AT CAT ACT C ATT GC (SEQ ID NO: 176) for PCO1, ins PCO2fw

(TGTTCTTTTGCCCTCTTCTCTC (SEQ ID NO: 177) with ins PCO2rv

(TCCGGGT GAT GT ACAAAT AC AA (SEQ ID NO: 178) and insPCO2rv with dspm5

(CGGGAT CCGAC ACT CTTT AATT AACT GAC ACT C (SEQ ID NO: 179) for PCO2, insPCO4fw (CAT GAGCCT GAAGT CT GCAAA A (SEQ ID NO: 180) with insPCO4rv

(GCCGT CAT CT CAGT AT CCTT CA (SEQ ID NO: 181) and insPCO4fw with LB1GK for PCO4, ins PCO5fw (GCCCATTTAGGTAGCT GCAGT G (SEQ ID NO: 182) with ins PCO5rv (AGCTTCCT GTT CGAGACC AA (SEQ ID NO: 183) and ins PCO5fw with LBbl

(GCGT GGACCGCTT GCT GCAACT (SEQ ID NO: 184) for PCO5.

A. thaliana transformation and genotyping of human ADO and CDO1 expressing plants

Quadruple 4pco mutant plants were transformed by Agrobacterium-mediated infiltration using the floral dip method to enable expression of human ADO or CDO 1 with a C-terminal nuclear localization sequence under the control of the PCO1 promoter (pPCO1 :ADO:NLS or pPCO1 : CDO1 :NLS) . Briefly, PCO1^-/- ;PCO2^-/- ; PCO4^-/- PCO5^-/- (T₀;) plants were used for T- DNA insertion. The allelic status of the PCO5 locus in the T2 population was then assessed by two parallel genomic PCR reactions employing insPCO5fw and LBb1 (T-DNA specific) reverse primer, or insPCO5fw and insPCO5rv primers. The presence of the transgene was evaluated by resistance to hygromycin and confirmed by PCR (attB1 forward primer:

GGGACAAGTTTGTACAAAAAAGCAGGCT (SEQ ID NO: 185) and either ADO reverse primer: AGCAGGT CCTT CAAC AGCGT (SEQ ID NO: 186) or CDO1 reverse primer:

CGAAAGCGTGGCAGGTATCG (SEQ ID NO: 187).

A. thaliana gene expression analyses

A T₂ segregating population was used for the phenotypic and molecular characterization of the ADO or CDO 1 effect, after genotyping for T -DNA insertion in the PCO5 locus as described above. RNA was extracted from fully developed rosette leaves as follows: following lysis in a buffer composed of 50 mM TrisHCl pH 8, 300 mM NaCl, 5mM EDTA pH 8, 2% SDS and 180 mM b-mercaptoethanol, cell debris was precipitated in the presence of 400 mM KC1 and mRNA isolated from the supernatant by phase separation and ethanol precipitation. Equal mRNA amounts were processed into cDNA with the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). Real-time qPCR amplification was carried out in the ABI Prism 7300 sequence detection system (Applied Biosystems), using the PowerUp™ SYBR® Green Master Mix (Thermo Fisher Scientific) and 15 ng cDNA in each reaction. Primers used for analysis of transcript levels from the following genes were PYRUVATE DECARBOXYLASE 1 (At4g33070) (PDC1 forward primer: CACAGAATCTTCAATGTTCTTACC (SEQ ID NO: 188) and reverse primer: CCAT GATAAAGCGTACAT GGAA (SEQ ID NO: 189), ALCOHOL

DEHYDROGENASE (Atlg77120), (ADH forward primer: T ATT CG AT GC AAAGCT GCTGTG (SEQ ID NO: 190) and reverse primer: CG AACTT CGT GTTT CT GCGGT (SEQ ID NO: 191), LATERAL ORGAN BOUNDARY DOMAIN CONTAINING PROTEIN 41 (At3g02550) (LBD41 forward primer: TGAAGCGCAAGCTAACGCA (SEQ ID NO: 192)and reverse primer:

ATCCCAGGACGAAGGT GATT G (SEQ ID NO: 193), STEAROYL-ACYL CARRIER PROTEIN A9-DESATURASE6 (Atlg43800) (SAD6 forward primer:

TT GGCAACCCGCTT CTTT CTTACC (SEQ ID NO: 194) and reverse primer:

TTT CCCT CAGCT CACGAACCT G (SEQ ID NO: 195), ACT2 (At3g18780) (ACT2 forward primer: GGCAAGTCATCACGATTGG (SEQ ID NO: 196) and reverse primer:

CAGCTTCCATTCCCACAAAC (SEQ ID NO: 197), At2g28390 (forward primer:

AACT CT AT GCAGC ATTT GAT CC ACT (SEQ ID NO: 198) and reverse primer:

T GATT GCAT AT CTTT ATCGCC AT C (SEQ ID NO: 199) and as reference gene UbiquitinlO ( At4g05320 ) (UBQ10 forward primer: GGCCTTGTATAATCCCTGATGAATAAG (SEQ ID NO: 200) and reverse primer: AAAGAGAT AAC AGGAACGGA AACAT AGT (SEQ ID NO: 201). Relative gene expression values were calculated with the AACt method.

A. thaliana protoplast assays

Protoplasts were isolated from wild type leaves, following an enzymatic digestion in an isotonic solution containing 0.4 M mannitol, 20 mM KC1, 20 mM MES (pH 5.7), 10 mM CaCl₂,

1% cellulase (w/v), and 0.4% macerozyme (w/v). Cells were washed in 154 mM NaCl, 125 mM CaCl₂, 5 mM KC1 and 2 mM MES (W5 solution), and re-suspended up to 5 x 10⁵ cells ml^-1 in

0.4 M mannitol, 15 mM MgCh, 5 mM MES. Protoplasts (100 ml) were transformed with naked

DNA using an equal volume of a 40% PEG 4000 (w/v), 100 mM CaCl₂ and 200 mM mannitol solution. Transfections of RAP_1-28-Fluc reporter construct with either human ADO, CDO1 or control GUS, were carried out in biological quintuplicate, using 2.5 mg of reporter construct in each and variable amounts of the effector constructs, as specified in the text. An equal amount of a 35S:Rluc construct expressing renilla luciferase was included in every transfection, to permit the normalization of the firefly luciferase signal. W5 was used to block the transfection and cells were incubated in 500 mM mannitol, 4 mM MES, and 20 mM KC1. The stability of the RAP_1-28- Fluc protein was evaluated by means of the Dual Luciferase Assay kit (Promega), following the manufacturer's protocol. 18 h after transfection protoplasts were spun down from the suspension, flash frozen in liquid nitrogen and lysed in 50 ml Passive Lysis Buffer. Six ml cleared lysate was then used for the measurements. Relative luciferase activity was expressed as Fluc/Rluc.

Yeast assays

Yeast transformation

The S. cerevisiae strain MAV203 was transformed with plasmids using the LiAc method to result in expression of DLOR, ADO and CDO 1. The parental (unrecombined) plasmid or plasmid expressing GUS was used as negative control. Transformed colonies were selected based on auxotrophy complementation and the expression of ADO, CDO1 and control□- glucuronidase (GUS) assessed by real-time quantitative PCR (ADO forward primer:

CGGT GGT GGACA AAGGCCT A (SEQ ID NO: 202), ADO reverse primer:

AGCAGGTCCTTCAACAGCGT (SEQ ID NO: 203), CDO1 forward primer:

CT CTTTTCGCTT GGCCGGAC (SEQ ID NO: 204), CDO1 reverse primer

CGAAAGCGTGGCAGGTATCG (SEQ ID NO: 205), GUS forward primer

CT CT GGC AACCGGGT GAAGG (SEQ ID NO: 206), GUS reverse primer

CCTTCACTGCCACTGACCGG (SEQ ID NO: 207), using the Actin1 housekeeping gene as the reference (ACT1 forward primer: CCATCCAAGCCGTTTTGTCC (SEQ ID NO: 208), ACT1 reverse primer GGCGTGAGGTAGAGAGAAACC (SEQ ID NO: 209). The selected colonies were grown on liquid synthetic drop-out medium overnight. Subsequently, the cultures were diluted to OD₆₀₀ 0.1 and treated for 6 h under either aerobic (21% O₂) or hypoxic (1% O₂) conditions. At the end of the treatments, cells were collected by centrifugation and used for protein immunoblotting and luciferase activity assays.

Immunoblotting of yeast proteins

Total protein was extracted in a buffer containing 50 mM Tris-HCl pH 7.6, 1 mM EDTA,

100 mM NaCl, 2% SDS and 0.05% Tween-20, separated by SDS PAGE on 10% acrylamide midigels (Bio-Rad) before transfer onto a polyvinylidene difluoride membrane (Bio-Rad). A polyclonal anti-PpLuc (G7451 Promega) and a monoclonal anti-RrLuc (MAB4410, Millipore) were used at 1 : 1 ,000 dilutions to detect firefly and renilla luciferases, respectively. Protein loading was evaluated by Coomassie staining of the membrane.

Yeast Luciferase assay

Y east extracts were prepared and luciferase activity assayed using the Dual Luciferase Reporter Assay kit (Promega) and the manufacturer's protocol. Luciferase measurements were taken using a Lumat 9507 luminometer (Bechtold).

Recombinant enzyme assays

Recombinant human ADO and CDO1 protein production

Synthetic cDNAs codon-optimized for expression in E. coli and encoding human ADO and CDO1 (GenScript) were used as templates to generate PCR products which were inserted into the Ndel and Xhol restriction sites of pET28a. The resulting plasmid was transformed into Rosetta (DE3) competent E. coli cells (Merck) for recombinant N-terminal His-tagged protein production in 2YT media supplemented with 40 mg mL^-1 kanamycin. Cultures were grown to an OD6OO of approximately 0.8 by shaking at 180 rpm and 37°C, before being induced with 0.5 mM IPTG overnight at 20°C. Cells were harvested by centrifugation at 10000g for 10 min. Cell pellets were then re-suspended in 50 mM Tris, 400 mM NaCl pH 7.5, supplemented with DNase I (Thermo Fisher Scientific) and a Complete™ EDTA-free protease inhibitor cocktail (Sigma Aldrich) before being lysed by sonication. Cellular debris was removed by centrifugation at 48000g for 30 min and filtration through a 0.45 mm membrane. The soluble supernatant was loaded onto an equilibrated HisTrap HP column (GE Healthcare, now Sigma Aldrich) and washed with resuspension buffer containing increasing concentrations of imidazole until a definitive A_{280 nm} peak was collected. Imidazole was then removed using a desalting column. Protein purity was verified by SDS-PAGE and protein concentrations were estimated using A₂₈₀ _nm measurements.

Activity assays using recombinant human ADO and CDO1 protein

The enzymatic activities of recombinant His-tagged human ADO and CDO 1 proteins were examined by incubating 400 mM synthesized peptide (GL Biochem) corresponding to the first 14 amino acids of the Met-excised N-terminus of RGS4 and RGS5 (i.e. RGS4_2-15 and

RGS5_2-15, respectively) with and without 4 mM enzyme in a bench top thermomixer at 37°C for 1 h. The following reaction buffer was used: 5 mM Tris (2-carboxyethyl)phosphine hydrochloride (TCEP), 20 mM FeSO₄ and 1 mM ascorbate were added to buffer (50 mM Bis-Tris Propane, 50 mM NaCl, pH 7.5) to maintain a reductive environment and provide exogenous cofactors. The reaction was quenched by mixing the sample 1 : 1 with 1 % formic acid (v/v). Oxidation was monitored by ultrahigh-performance liquid chromatography (UPLC) mass spectrometry (MS) using an Acquity UPLC system coupled to a Xevo G2-S Q-ToF mass spectrometer (Waters) operated in positive electrospray mode. Instrument parameters, data acquisition, and data processing were controlled by MassLynx 4.1 with source conditions adjusted to maximize sensitivity and minimize fragmentation. Samples were injected onto a Chromolith Performance RP-18e 100 2-mm column (Merck) heated to 40°C and eluted at 0.3 ml/min using a gradient of 95% deionized water supplemented with 0.1% (v/v) formic acid to 95% acetonitrile. The same experimental conditions were used to examine the activity of His-tagged human ADO with a peptide (Genscript) corresponding to the first 14 amino acids of the Met-excised N-terminus of IL-32 (i.e. IL-32_2-15).

Tandem mass spectrometric analysis of RGS and IL-32 peptides

Fragmentation spectra of the RGS4_2-15, RGS5_2-15 substrate and (recombinant enzyme reaction) product ion species were obtained to verify the position of the modification using a NanoAcquity-UPLC coupled to an Orbitrap Elite mass spectrometer possessing an EASY-Spray nano-electrospray ion source (Thermo Fisher Scientific). The peptides were trapped on an in- house packed guard column (75 mm i.d. x 20 mm, Acclaim PepMap C18, 3mm, 100 Å) using solvent A (0.1% formic acid in water) at a pressure of 140 bar and separated on an EASY-spray Acclaim PepMap® analytical column (75 mm i.d. × 50 mm, RSLC C18, 3mm, 100 Å ) using a linear gradient (length: 100 min, 3% to 60% solvent B (0.1% formic acid in acetonitrile), flow rate: 300 nL/min). The separated peptides were electrosprayed directly into the mass spectrometer that was operating in a data-dependent mode using a collision-induced dissociation (CID) based method. Full scan MS spectra (scan range 350-1500 m/z, resolution 120000, AGC target le6, maximum injection time 250 ms) and subsequent CID MS/MS spectra (AGC target 5e4, maximum injection time 100 ms) of the 10 most intense peaks were acquired in the Ion Trap. CID fragmentation was performed at 35% of normalized collision energy and the signal intensity threshold was kept at 500 counts. The CID method used performs beam-type CID fragmentation of the peptides. The most abundant precursor charge states were subjected to electron-transfer dissociation (ETD) fragmentation. Ion peaks were analyzed using PEAKS Studio 8.5 (Bioinformatics Solutions Inc.).

Fragmentation spectra of IL-32_2-15 substrate and product peptide ions were obtained using a targeted approach on the UPLC-MS described above, selecting the [M+2H+]²⁺ parent species for CID with a typical energy ramp of 30 to 40 eV. Analysis was carried out with the same source settings, flow rate and column elution conditions described above for initial activity assays. Daughter ions were manually assigned by examining the spectra in MassLynx 4.1.

Determining the source of O-atoms used during recombinant human ADO catalyzed

modification of RGS peptides

The source of oxygen atoms used to modify RGS peptides during reaction with purified recombinant His-tagged human ADO was verified by monitoring the mass shifts in the product peptides following incubation with N₂, air (i.e. ¹⁶O₂), ¹⁸O₂ and H₂ ¹⁸O. 100 mL of 400 mM RGS4₂- 15 or RGS5_2-15 dissolved in reaction buffer (described above), was rendered anaerobic in a septum sealed glass vial by purging the sample with 100% N₂ for 10 min at 100 mL min^-1 using a mass flow controller (Brooks Instruments). 4 mM ADO was added to the solution using a gas- tight Hamilton syringe and the reaction mixture was purged with a balloon containing approximately 0.7 L N₂, air (i.e. ¹⁶O₂) or ¹⁸O₂ for 10 min at room temperature. The samples were then transferred to a water bath for an additional 20 min incubation at 37°C, before being quenched 1 : 1 with 1% formic acid (v/v) and analysed by UPLC-MS, as described above.

Reactions in the presence of H₂ ¹⁸O were conducted as described for the air sample, replacing 75% of the water used in the final reaction sample with H₂ ¹⁸O.

Kinetic analysis of recombinant human ADO with RGS and IL-32 peptides under atmospheric conditions

The kinetic parameters of purified recombinant His-tagged human ADO under atmospheric conditions were determined by measuring the rate of RGS peptide oxidation at different substrate concentrations using a stopped assay. Reaction mixtures (buffer as above) containing 15 to 1000 mM RGS4_2-15 or RGS5_2-15, or IL-32_2-15 were mixed with 0.05 to 0.2 mM human ADO and incubated at 37 °C before being quenched at regular time intervals 1 : 10 with

1% formic acid (v/v). Oxidation was monitored by high throughput MS using a RapidFire RF360 sampling robot connected to an Agilent 6530 Accurate-Mass Q-ToF mass spectrometer (Agilent) operated in positive ion mode. Source conditions were adjusted to maximize sensitivity and minimize fragmentation. Samples were injected onto a C-4 solid phase extraction (SPE) cartridge equilibrated with deionized water containing 0.1% formic acid (v/v), washed with the equilibration solution and eluted in 85% acetonitrile and 0.1% formic acid (v/v). Turnover was quantified by comparing the integrated area underneath the product and substrate ions extracted from the total ion current chromatogram using the RapidFire Integrator software. All figures and kinetic parameters were generated using Prism (GraphPad).

Determining the O₂ sensitivity of recombinant human ADO

The kinetic parameters of purified recombinant His-tagged human ADO with molecular oxygen were determined by measuring the rate of RGS peptide turnover at different O₂ concentrations using a stopped assay. A concentration of peptide that generated the highest level of activity under atmospheric conditions was used for analysis (i.e. 320 mM). 100 mL aliquots of RGS4_2-15 or RGS5_2-15 were prepared in reaction buffer (described above), transferred into a septum sealed glass vial, and equilibrated with different ratios of nitrogen and oxygen gas (0 to 80% O₂) for 10 min using a mass flow controller (Brooks Instruments). 1 mL of 0.1 mM recombinant human ADO was added to the solution using a gas-tight syringe (Hamilton) to initiate the reaction, which was allowed to proceed for 1 min (i.e. within the linear range of activity). Turnover was terminated by injecting 10 mL 10% formic acid and oxidation was analyzed by high throughput MS, as above.

Activity assays using recombinant human ADO and additional N-Cys peptides

Peptides (Genscript and GL Biochem) representing the N-terminus of candidate ADO substrates were synthesized as N-terminal amine 14-mers and incubated with recombinant ADO under aerobic conditions at 37°C in reaction buffer using a peptide: enzyme ratio of 100 mM: 0.1 mM. Reactions were quenched with 1% formic acid (v/v) at 0 and 1 minute time points and ADO activity measured using UPLC-MS as described above. Turnover was quantified by comparing the integrated area underneath the product and substrate ions extracted from the total ion current chromatogram using MassLynx 4.1 , enabling determination of specific activity.

ADO competition assays with cysteine and cysteamine

The influence of free cysteine and cysteamine on ADO turnover was determined by monitoring the activity of 0.2 mM recombinant ADO with 320 mM RGS5_2-15 in the presence of 5 mM to 500 mM cysteine or cysteamine. Single time points were taken in triplicate by quenching the reaction with 1% formic acid (v/v) after 30 seconds. The level of turnover was analyzed by high throughput MS, as described above, and normalized to activity measurements in the absence of cysteine or cysteamine. IC50 values were estimated using the log inhibitor versus normalized response model in Prism.

Phylogenetic analysis of ADO/PCO domain-containing proteins

The Pfam database (EMBL-EBI) was used to collate protein sequences with sufficient similarity to a ADO/PCO conserved sequence, predefined by comparison of 21 seed (known) ADO/PCO 1 proteins (PF07847). Evolutionary history between these sequences was then inferred by the Maximum Likelihood method using MEGA X.

Statistical analyses

Mammalian cells

Reference to an experiment denotes a set of samples collected on a single day, whereas an independent clone denotes separate cultures propagated from a single parent culture. All immunoblots shown are representative of at least three experiments or independent clones.

Where quantified, data represent the mean ± S.D. Statistical significance was tested by either a two-sided, one-way (Fig. 4A) or two-way (4B and D, S8) ANOVA with Holm-Sidak post hoc test. Statistical analysis relevant to a specific data set is described in detail within the appropriate section. Transcript analyses are representative of three independent experiments and are expressed as mean ± S.D.

Arabidopsis thaliana

A segregating T2 population (n=68) from the initial transformation of pPCO1 :ADO into a quadruple pco mutant genotype (pco1/2/4/5 ^+/- was used for initial gene expression analysis.

Four genotypic classes were examined: wild type (n=5), 4pco (n=4), 3pco+ ADO (n=17),

4pco+ ADO (n=10). The statistical significance of the effect of ADO overexpression on gene expression in Arabidopsis was assessed by non-parametric one-way ANOVA on ranks, followed by a Mann- Whitney Rank Sum Test comparing 3pco+ ADO and 4pco+ ADO (Figure 2G and fig. S10A). In additional analyses, an independent pPCO1 :ADO line from the one shown in Figure 2F (i.e. line #2) was derived from the quadruple pco mutant genotype (pco 1/2/4/5 ⁴) and compared with a similarly derived pPCO1. CDO1 line (fig. S10B and C). From the above T2 segregating population for pPCO1 :ADO, pPCO1 : ADO expressing plants in the triple mutant genotype (pco1/2/4/5^+/+ ) were also analyzed as an additional control. In these additional experiments (fig. S10B and C) the following genotypic classes were examined: wild type (n=5), 4pco (n=5), 3pco+ ADO (n= 5), 4pco+ ADO, (n=5) 4pco+CDO1 (n=5).

S. cerevisiae

Relative luciferase activity data (Figure 2H) represent the mean ± S.D of 5 independent clones. Statistical significance was tested by two-way ANOVA and a Holm-Sidak multiple comparison test. Y east immunoblots are representative images following analysis of two independent clones of each genotype and were in parallel with luciferase activity data (fig.

S11B).

References

1. A. C. R. Epstein et al. , C. elegans EGL-9 and mammalian homologues define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 107, 43-54 (2001).

2. M. Ivan et al. , HIFa targeted for VHL-mediated destruction by proline hydroxylation: implications for O₂ sensing. Science 292, 464-468 (2001).

3. P. Jaakkola et al. , Targeting of HIF-a to the von Hippel-Lindau ubiquitylation complex by O₂-regulated prolyl hydroxylation. Science 292, 468-472 (2001).

4. W. G. J. Kaelin, P. J. Ratcliffe, Oxygen sensing by metazoans: The central role of the HIF hydroxylase pathway. Molecular Cell 30, 393-402 (2008).

5. C. M. West, H. van der Wei, Z. A. Wang, Prolyl 4-hydroxylase- 1 mediates O₂ signaling during development of Dictyostelium. Development 134, 3349-3358 (2007).

6. B. T. Hughes, P. J. Espenshade, Oxygen-regulated degradation of fission yeast SREBP by Ofd1, a prolyl hydroxylase family member. E MB O Journal 27, 1491-1501 (2008).

7. D. A. Weits et al. , Plant cysteine oxidases control the oxygen-dependent branch of the hi- end-rule pathway. Nature communications 5, 3425 (2014).

8. A. Varshavsky, N-degron and C-degron pathways of protein degradation. PNAS 116,

358-366 (2019).

9. R. G. Hu et al. , The N-end rule pathway as a nitric oxide sensor controlling the levels of multiple regulators. Nature 437, 981-986 (2005).

10. F. Licausi et al. , Oxygen sensing in plants is mediated by an N-end rule pathway for protein destabilization. Nature 479, 419-422 (201 1). 11. D. J. Gibbs et al. , Homeostatic response to hypoxia is regulated by the N-end rule pathway in plants. Nature 479, 415-418 (2011).

12. M. D. White et al. , Plant cysteine oxidases are di oxygenases that directly enable arginyl transferase-catalysed arginylation of N-end rule targets. Nature communications 8, 14690 (2017).

13. Y. T. Kwon et al. , An essential role of N-terminal arginylation in cardiovascular

development. Science 297, 96-99 (2002).

14. M. J. Lee et al. , RGS4 and RGS5 are in vivo substrates of the N-end rule pathway. PNAS

102, 15030-15035 (2005).

15. J. E. Dominy, Jr. et al. , Discovery and characterization of a second mammalian thiol dioxygenase, cysteamine dioxygenase. J Biol Chem 282, 25189-25198 (2007).

16. M. H. Stipanuk, C. R. Simmons, P. A. Karplus, J. E. Dominy, Jr., Thiol dioxygenases: unique families of cupin proteins. Amino Acids 41, 91-102 (2011).

17. I. M. Jaba et al. , NO triggers RGS4 degradation to coordinate angiogenesis and

cardiomyocyte growth. J Clin Invest 123, 1718-1731 (2013).

18. A. Varshavsky, The N-end rule. Cell 69, 725-735 (1992).

19. C. Arnold et al. , Hypertension-evoked RhoA activity in vascular smooth muscle cells requires RGS5. FASEB J 32, 2021-2035 (2018).

20. M. Uhlen et al. , Proteomics. Tissue-based map of the human proteome. Science 347,

1260419 (2015).

21. J. Hamzah et al. , Vascular normalization in Rgs5-deficient tumours promotes immune destruction. Nature 453, 410-414 (2008).

22. C. A. Nold-Petry et al. , IL-32 promotes angiogenesis. Journal of immunology 192, 589- 602 (2014).

23. Y. J. E. Sloot, J. W. Smit, L. A. B. Joosten, R. T. Netea-Maier, Insights into the role of IL-32 in cancer. Semin Immunol 38, 24-32 (2018).

24. S. W. Olechnowicz, A. O. Fedele, D. J. Peet, Hypoxic induction of the regulator of G- protein signalling 4 gene is mediated by the hypoxia-inducible factor pathway. PLoS One 7, e44564 (2012).

25. Y. Jin et al. , RGS5, a hypoxia-inducible apoptotic stimulator in endothelial cells. J Biol Chem 284, 23436-23443 (2009). 26. M. Zahoor et al. , Hypoxia promotes IL-32 expression in myeloma cells, and high expression is associated with poor survival and bone loss. Blood Adv 1, 2656-2666 (2017).

27. A. Bachmair, D. Finley, A. Varshavsky, In vivo half-life of a protein is a function of its amino-terminal residue. Science 234, 179-186 (1986).

Sequence Listing

SEQ ID NO: 1 Human ADO

SEQ ID NO: 2 Human ADO with N-terminal His6 tag

SEQ ID NO: 3 - Met-cleaved N-termini of RGS5 with substitution of A at position 6 with L

SEQ ID NO: 4 Met-cleaved N-termini of IL-32

SEQ ID NO: 5 Met-cleaved N-termini of RGS5

SEQ ID NO: 6 Met-cleaved N-termini of RGS5

SEQ ID NO: 7 Met-cleaved N-termini of IL-32

SEQ ID NO: 8 - Met-cleaved N-termini of RPL4

SEQ ID NO: 9 - Met-cleaved N-termini of EFCAB6

SEQ ID NO: 10 - Met-cleaved N-termini of GPX1

SEQ ID NO: 1 1 - Met-cleaved N-termini of CDX1

SEQ ID NO: 12 - Met-cleaved N-termini of RIMKLA

SEQ ID NO: 13 - Met-cleaved N-termini of ARHGAP45

SEQ ID NO: 14 - Met-cleaved N-termini of ZUP12

SEQ ID NO: 15 - Met-cleaved N-termini of SRR

SEQ ID NO: 16 - Met-cleaved N-termini of ARL16

SEQ ID NO: 17 - Met-cleaved N-termini of GFPT2

SEQ ID NO: 18 - Met-cleaved N-termini of VDAC3

SEQ ID NO: 19 - Met-cleaved N-termini of DHX30

SEQ ID NO: 20 - Met-cleaved N-termini of ORC6

SEQ ID NO: 21 - Met-cleaved N-termini of CALHM4

SEQ ID NO: 22 - Met-cleaved N-termini of DYNLL1

SEQ ID NO: 23 - Met-cleaved N-termini of ALS2CL

SEQ ID NO: 24 - Met-cleaved N-termini of TRIM36

SEQ ID NO: 25 - Met-cleaved N-termini of JUNB

SEQ ID NO: 26 - Met-cleaved N-termini of ASNS

SEQ ID NO: 27 - Met-cleaved N-termini of NBPF14

SEQ ID NO: 28 - Met-cleaved N-termini of NADSYN1

SEQ ID NO: 29 - Met-cleaved N-termini of USP27X

SEQ ID NO: 30 - Met-cleaved N-termini of TMEMI68

SEQ ID NO: 31 - Met-cleaved N-termini of ANKRD29

SEQ ID NO: 32 Variant of SEQ ID NO: 6

SEQ ID NO: 33 - Variant of SEQ ID NO: 6

SEQ ID NO: 34 - Met-cleaved N-termini of RPL4

SEQ ID NO: 35 - Met-cleaved N-termini of EFCAB6

SEQ ID NO: 36 - Met-cleaved N-termini of GPX1

SEQ ID NO: 37 - Met-cleaved N-termini of CDX1

SEQ ID NO: 38 - Met-cleaved N-termini of RIMKLA

SEQ ID NO: 39 - Met-cleaved N-termini of ARHGAP45

SEQ ID NO: 40 - Met-cleaved N-termini of ZUP12

SEQ ID NO: 41 - Met-cleaved N-termini of SRR

SEQ ID NO: 42 - Met-cleaved N-termini of ARL16

SEQ ID NO: 43 - Met-cleaved N-termini of GFPT2

SEQ ID NO: 44 - Met-cleaved N-termini of VDAC3

SEQ ID NO: 45 - Met-cleaved N-termini of DHX30

SEQ ID NO: 46 - Met-cleaved N-termini of ORC6

SEQ ID NO: 47 - Met-cleaved N-termini of CALHM4

SEQ ID NO: 48 - Met-cleaved N-termini of DYNLL1

SEQ ID NO: 49 - Met-cleaved N-termini of ALS2CL

SEQ ID NO: 50 - Met-cleaved N-termini of TRIM36

SEQ ID NO: 51 - Met-cleaved N-termini of JUNB

SEQ ID NO: 52 - Met-cleaved N-termini of ASNS

SEQ ID NO: 53 - Met-cleaved N-termini of NBPF14

SEQ ID NO: 54 - Met-cleaved N-termini of NADSYN1

SEQ ID NO: 55 - Met-cleaved N-termini of USP27X

SEQ ID NO: 56 - Met-cleaved N-termini of TMEMI68

SEQ ID NO: 57 - Met-cleaved N-termini of ANKRD29

SEQ ID NO: 58

Claims

1 . A peptidomimetic or cyclised peptide or peptidomimetic inhibitor of cysteamine (2- aminoethanethiol) dioxygenase (ADO), wherein the peptidomimetic or cyclised peptide or peptidomimetic inhibitor has the amino acid and/or amino acid mimetic sequence of a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation, except for

(a) the substitution of a N-terminal cysteine in the substrate with a cysteine analogue in the inhibitor; and/or

(b) cyclisation of the polypeptide or peptidomimetic substrate,

and wherein the peptidomimetic and/or cyclised peptide is an inhibitor of ADO N- terminal cysteine protein oxidation activity.

2. The peptidomimetic or cyclised peptide or peptidomimetic inhibitor of claim 1, wherein the cysteine analogue is selected from the group consisting of a seleno-cysteine, a homo- cysteine, a N-acetyl cysteine, a S-methyl cysteine, cysteic acid, cys-sulfinic acid, a cys- sulfenyl halide, a cys-sulfinyl halide, cys-sulfinylamine, S-alkyl cysteine thioethers, b- mercapto amino acids, b-alkyl cysteine, a-alkyl cysteine, and D-analogues thereof.

3. The peptidomimetic or cyclised peptide or peptidomimetic of claim 2, wherein the

cysteine analogue is a seleno-cysteine.

4. The peptidomimetic or cyclised peptide or peptidomimetic inhibitor of any one of the preceding claims, wherein the inhibitor comprises an amino acid sequence having at least 70% sequence identity to any one of SEQ ID NOs: 3 to 55, or a cyclised analogue thereof, wherein X is a cysteine analogue, or wherein the inhibitor is a cyclised peptide and the X is a cysteine or a cysteine analogue.

5. The peptidomimetic or cyclised peptide or peptidomimetic inhibitor of any one of claims 1 to 3, wherein the inhibitor comprises an amino acid sequence having at least 70% sequence identity to any one of SEQ ID NOs: 56 to 143, or a cyclised analogue thereof, wherein X is a cysteine analogue, or wherein the inhibitor is a cyclised peptide and the X is a cysteine or a cysteine analogue.

6. The peptidomimetic or cyclised peptide or peptidomimetic inhibitor of claim 4,

consisting of an amino acid sequence selected from SEQ ID NOs: 3 to 5, wherein X is seleno-cysteine.

7. The peptidomimetic or cyclised peptide or peptidomimetic inhibitor of any one of the preceding claims for use to inhibit cysteamine (2-aminoethanethiol) dioxygenase (ADO) activity.

8. A method of treating hypoxia, hypoxic disease, cardiovascular disease, ischaemic

disease, myocardial ischaemia, renal ischaemia, cerebral ischaemia, cancer, a

neurological or psychiatric disease, obesity, diabetes, or HIV, of increasing immune or inflammatory responses, or of reducing the side-effects and/or promoting the analgesic action of an opiate drug, wherein the method comprises administering to a subject in need thereof a peptidomimetic or cyclised peptide or peptidomimetic inhibitor of cysteamine (2-aminoethanethiol) dioxygenase (ADO), wherein the peptidomimetic or cyclised peptide or peptidomimetic inhibitor has the amino acid and/or amino acid mimetic sequence of a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation, except for

(c) cyclisation of the polypeptide or peptidomimetic substrate,

9. A peptidomimetic or cyclised peptide or peptidomimetic inhibitor of cysteamine (2- aminoethanethiol) dioxygenase (ADO) for use in a method of treating hypoxia, cardiovascular disease, cancer, neurological or psychiatric disease, obesity, diabetes, or HIV, of increasing immune or inflammatory responses, or of reducing the side-effects and/or promoting the analgesic action of an opiate drug, wherein the peptidomimetic or cyclised peptide or peptidomimetic inhibitor has the amino acid and/or amino acid mimetic sequence of a polypeptide or peptidomimetic substrate of ADO-catalysed N- terminal cysteine oxidation, except for

(b) the substitution of a N-terminal cysteine in the substrate with a cysteine analogue in the inhibitor; and/or

(d) cyclisation of the polypeptide or peptidomimetic substrate,

wherein the peptidomimetic and/or cyclised peptide or peptidomimetic is an inhibitor of ADO N-terminal cysteine protein oxidation activity, and wherein the method comprises administering the peptidomimetic and/or cyclised peptide or peptidomimetic inhibitor of ADO to a subject in need thereof.

10. A method for producing an inhibitor of ADO N-terminal cysteine protein oxidation

activity, the method comprising

(i) substituting an N-terminal cysteine of a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation with a cysteine analogue; or

(ii) cyclising a polypeptide or peptidomimetic substrate of ADO-catalysed N-terminal cysteine oxidation.

1 1 . The method of claim 8 or claim 10 or the peptidomimetic or cyclised peptide or

peptidomimetic inhibitor of ADO for use according to claim 9, wherein the inhibitor is as defined in any one of claims 2 to 6.

12. A method for identifying a peptide, protein or peptidomimetic substrate for ADO- catalysed N-terminal cysteine oxidation, the method comprising

(i) contacting ADO with a peptide, protein or peptidomimetic having an N-terminal cysteine;

(ii) measuring dioxygenation of the peptide, protein or peptidomimetic; and (iii) identifying a peptide, protein or peptidomimetic that is dioxygenated in the presence of ADO, or a protein having a N-terminal amino acid sequence corresponding to a peptide that is dioxygenated in the presence of ADO, as a substrate for ADO-catalysed N-terminal cysteine oxidation.

13. A method for assaying for ADO N-terminal cysteine oxidation activity, the method comprising

(i) contacting ADO with a polypeptide or peptidomimetic having an N-terminal cysteine; and

(ii) measuring dioxygenation of the N-terminal cysteine.

14. The method of claim 13, wherein ADO is contacted with the polypeptide or

peptidomimetic in the present of a test agent, and wherein the method further comprises (iii) determining whether the test agent is a modulator of ADO-catalysed N-terminal cysteine protein oxidation.

15. A method for identifying an inhibitor of ADO N-terminal cysteine protein oxidation activity, the method comprising

(i) contacting ADO with a polypeptide or peptidomimetic substrate of ADO- catalysed N-terminal cysteine oxidation in the presence of a test agent;

(ii) measuring reduced dioxygenation of the substrate in the presence of the test agent; and

(iii) identifying the test agent as an inhibitor of ADO N-terminal cysteine protein oxidation activity.

16. The method of any one of claims 12 to 15, wherein dioxygenation is measured by using one or more probes for cys-sulfinic acid or by mass spectrometry.

17. An inhibitor of ADO N-terminal cysteine protein oxidation activity for use in a method of modulating the expression or activity of a protein, increasing the stability of a protein or decreasing degradation of a protein.

18. An inhibitor of ADO N-terminal cysteine protein oxidation activity for use in a method of promoting angiogenesis or of promoting cell survival or decreasing cellular damage in a cell or tissue exposed to a hypoxic environment.

19. A method of promoting angiogenesis or of promoting cell survival or decreasing cellular damage in a cell exposed to a hypoxic environment, the method comprising contacting the cell with an inhibitor of ADO.

20. A method for identifying a modulator of oxygen-dependent protein degradation or

activity the method comprising

(i) contacting a cell that expresses ADO with a test agent; and

(ii) determining whether the test agent modulates ADO-regulated degradation or activity of proteins expressed in the cell.

21 . The method or the inhibitor of any one of claims 14 to 20, wherein the test agent or the inhibitor is a polypeptide and/or cyclised peptide or peptidomimetic as defined in any one of claims 1 to 5, or produced according to the method of claim 9.