Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/2884—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD44
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
  • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
  • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
  • A61P35/04—Antineoplastic agents specific for metastasis
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

• This invention relates to new uses of the human glycoprotein PRG4, also known as lubricin. More particularly, it relates to using PRG4 to treat cancer and conditions related to or incident to cancer.
• proteoglycan 4 gene encodes megakaryocyte stimulating factor
• “superficial zone protein” also known as lubricin.
• Superficial zone protein was first localized at the surface of explant cartilage from the superficial zone and identified in conditioned medium.
• Lubricin was first isolated from synovial fluid and demonstrated lubricating ability in vitro similar to synovial fluid at a cartilage-glass interface and in a latex-glass interface. It was later identified as a product of synovial fibroblasts, and its lubricating ability was discovered to be dependent on O-linked b (1-3) Gal-GalNAc oligosaccharides within a large mucin like domain of 940 amino acids encoded by exon 6.
• Lubricin molecules are differentially glycosylated and several naturally occurring splice variants have been reported. They are collectively referred to herein as PRG4.
• PRG4 has been shown to be present inside the body at the surface of synovium, tendon, articular cartilage such as meniscus, and in the protective film of the eye, among other sites, and plays an important role in joint lubrication and synovial homeostasis.
• rhPRG4 Full-length recombinant human PRG4 (rhPRG4) protein has been expressed successfully at large scale making it available for basic and translational-based investigations.
• rhPRG4 has been shown to retain appropriate higher order structure and glycosylations, and thus displays efficient in vitro lubricating and anti-adhesive function (Abubacker el aI., Ahh Biomed Eng. 2016; 44(4): 1128-37; Samsom et al., Exp Eye Res. 2014;127: 14-9).
• rhPRG4 provides effective in vivo therapeutic value in preservation of joint health via intra-articular injection in preclinical in vivo osteoarthritis models (Elsaid et al. , Osteoarthritis and Cartilage. 2015;23(1): 114-21 ; Walker et al. , Am. J. Sports Med. ,
• lubricin has an effect on cancer cells and can be used to treat cancer and conditions incident to cancer.
• Applicants have now discovered that lubricin has an effect on cancer cells and can be used to treat cancer and conditions incident to cancer.
• lubricin has an effect on cancer cells and can be used to treat cancer and conditions incident to cancer.
• PRG4 can alter the phenotype of neoplastic cells as well as the stress response of neoplastic cells, for example, making tumor cells less invasive and less migratory.
• the invention includes in one aspect a method of treating cancer or slowing the growth or progression of a cancer in a patient where PRG4 is administered to the patient to treat the cancer or to slow the growth or progression of the cancer.
• the PRG4 is recombinant human PRG4 comprising the amino acid sequence of residues 25-1404 of SEQ ID NO: 1. In one embodiment, the PRG4 has at least 99% sequence identity with residues 25-1404 of SEQ ID NO: 1. In another embodiment, the PRG4 has at least 99.5% sequence identity with residues 25-1404 of SEQ ID NO: l.
• the cancer is selected from adrenal cancer, anal cancer, bile duct cancer, bladder cancer, bone cancer, brain/CNS cancer, basal cell skin cancer, breast cancer, Castleman disease, cervical cancer, colorectal cancer, endometrial cancer, esophagus cancer, dermatofibrosarcoma protuberans, Ewing family of tumors, eye cancer, gall bladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor (GIST), gastric cancer, gestational trophoblastic disease, glioma, glioblastoma, head and neck cancer, hepatocellular carcinoma (HCC), Hodgkin disease, Kaposi sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, leukemia, lung cancer, liver cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, melanoma, multiple myeloma, myeloma, myelodysplastic syndrome, nasal
• the cancer may be breast cancer.
• the cancer may be head or neck cancer, breast cancer, pancreatic cancer, gastrointestinal cancer, colorectal cancer, prostate cancer, colon cancer, bladder cancer, or leukemia.
• the cancer may be hepatocellular carcinoma.
• the PRG4 is administered in connection with another anti cancer agent.
• the anti-cancer agent may be chemotherapy or radiologic treatment.
• the radiologic treatment may be, for example, external beam radiation therapy, brachytherapy, or stereotactic body radiation therapy (SBRT).
• the PRG4 is administered in connection with another anti cancer agent, where the anti-cancer agent is administered at a dose that is less than the therapeutically effective dose of the anti-cancer agent to treat the cancer administered alone without PRG4.
• the anti-cancer agent is sorafenib administered at a dose less than 800 mg per day or less than 400 mg twice daily.
• the anti-cancer agent is regorafenib administered at a dose less than 160 mg daily.
• the cancer is hepatocellular carcinoma.
• the chemotherapy may be selected from actinomycin, abraxane, altretamine, aranose, azacitidine, azathioprine, bendamustine, bleomycin, bortezomib, busulfan, cabazitaxel, capecitabine, carboplatin, carmofur, carmustine, chlorambucil, chlormethine, chlorozotocin, cisplatin, cladribine, clofarabine, crizotinib, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, dasatinib, daunorubicin, decitabine, docetaxel, doxifluridine, doxorubicin, epirubicin, ertramustine, ethylnitrosourea, erlotinib, etoposide, floxuridine, fludarabine, fluorouracil,
• the chemotherapy is sorafenib and/or regorafenib.
• the cancer is hepatocellular carcinoma and chemotherapy is sorafenib and/or regoraff
• the chemotherapy may be an antibody treatment selected from alemtuzumab, bevacizumab, blinatumomab, brentuximab, certolizumab, cetuximab, daratumumab, dinutuximab, ibritumomab, obinutuzumab, ofatumumab, olaratumab, panitumumab, pertuzumab, ramucirumab, rituximab, siltuximab, trastuzumab, rituximab, inotuzumab, gemtuzumab, bevacizumab, camiplimab, or spartalizumab.
• an antibody treatment selected from alemtuzumab, bevacizumab, blinatumomab, brentuximab, certolizumab, cetuximab, daratumumab, dinutuximab,
• PRG4 is administered systemically to the patient, whereas in other embodiments PRG4 is administered by subcutaneous, intramuscular, or intravenous administration. PRG4 may also be administered locally to the location of the cancer. Administration may be by injection. PRG4 may be administered in an amount of 0.1 pg/kg to 4,000 pg/kg.
• the PRG4 enhances chemosensitivity of the cancer to the anti-cancer agent. In some embodiments, the combination of PRG4 and the anti-cancer agent treats the cancer.
• the invention provides a method for preventing or inhibiting recurrence of a previously treated cancer.
• the method includes administering to a patient in need thereof a therapeutically effective amount of PRG4 to prevent recurrence or growth of a previously treated cancer in the patient.
• the PRG4 is recombinant human PRG4 comprising the amino acid sequence of residues 25-1404 of SEQ ID NO: 1
• the PRG4 has at least 99% sequence identity with residues 25-1404 of SEQ ID NO: 1.
• the PRG4 has at least 99.5% sequence identity with residues 25-1404 of SEQ ID NO: l.
• the previously treated cancer is the cancer is selected from adrenal cancer, anal cancer, bile duct cancer, bladder cancer, bone cancer, brain/CNS cancer, basal cell skin cancer, breast cancer, Castleman disease, cervical cancer, colorectal cancer, endometrial cancer, esophagus cancer, dermatofibrosarcoma protuberans, Ewing family of tumors, eye cancer, gall bladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor (GIST), gastric cancer, gestational trophoblastic disease, glioma, glioblastoma, head and neck cancer, hepatocellular carcinoma, Hodgkin disease, Kaposi sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, leukemia, lung cancer, liver cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, melanoma, multiple myeloma, myeloma, myelodysplastic
• the cancer is breast cancer.
• the cancer is triple negative breast cancer.
• the cancer is head or neck squamous cell carcinoma, breast cancer, pancreatic cancer, gastrointestinal cancer, colorectal cancer, prostate cancer, colon cancer, bladder cancer, or leukemia.
• the cancer is hepatocellular carcinoma.
• the PRG4 is administered locally to the site of the cancer that was previously treated.
• local administration can occur by topical administered or by injection to the site.
• the PRG4 is administered systemically to the patient.
• PRG4 may be administered in amount of 0.1 pg/kg to 4,000 Pg/kg.
• the previously treated cancer was removed from the patient by surgical resection and PRG4 is administered to the patient after the surgical resection of the tumor.
• PRG4 may be administered locally to the site of the surgical resection of the tumor.
• PRG4 may be administered in amount of 0.1 pg/kg to 4,000 Pg/kg.
• the patient is in complete remission from the previously treated cancer, whereas in other embodiments, the patient is in partial remission from the previously treated cancer.
• the recurrence of the previously treated cancer is prevented for one year, two years, three years, four years or five years by administration of the PRG4.
• the invention includes a method of treating cancer involving administering to a patient in need thereof PRG4 in combination with an immunotherapy agent, wherein the combination of the PRG4 and the immunotherapy treats the cancer.
• the immunotherapy is an anti-PDl or anti-PD-Ll antibody.
• the immunotherapy is selected from atezolizumab, avelumab, durvalumab, pembrolizumab, nivolumab, cemiplimab, ipilimumab.
• treatment of the patient with PRG4 and an immunotherapy agent improves the treatment of the cancer as compared to treatment with the immunotherapy alone.
• the cancer may be selected from adrenal cancer, anal cancer, bile duct cancer, bladder cancer, bone cancer, brain/CNS cancer, basal cell skin cancer, breast cancer, Castleman disease, cervical cancer, colorectal cancer, endometrial cancer, esophagus cancer, dermatofibrosarcoma protuberans, Ewing family of tumors, eye cancer, gall bladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor (GIST), gastric cancer, gestational trophoblastic disease, glioma, glioblastoma, head and neck cancer, hepatocellular carcinoma (HCC), Hodgkin disease, Kaposi sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, leukemia, lung cancer, liver cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, melanoma, multiple myeloma, myeloma, myelody
• nasopharyngeal cancer neuroendocrine cancer, neuroblastoma, Non-Hodgkin lymphoma, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary Tumors, prostate cancer, renal cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, squamous cell skin cancer, small intestine cancer, stomach cancer, testicular cancer, thymus cancer, thyroid cancer, uterine cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macroglobulinemia, or Wilms tumor.
• the cancer may be breast cancer in one embodiment, triple negative breast cancer in another embodiment, or the cancer may be head or neck cancer, breast cancer, pancreatic cancer, gastrointestinal cancer, colorectal cancer, prostate cancer, colon cancer, bladder cancer, or leukemia.
• the cancer is hepatocellular carcinoma.
• the PRG4 is administered to the patient systemically, whereas in another embodiment, the PRG4 is administered to the patient locally at a site of a cancer. In one embodiment, the PRG4 is administered in amount of 0.1 pg/kg to 4,000 pg/kg. In yet another embodiment, the PRG4 is recombinant human PRG4 comprising the amino acid sequence of residues 25-1404 of SEQ ID NO: 1. In one embodiment, the PRG4 has at least 99% sequence identity with residues 25-1404 of SEQ ID NO: 1. In another embodiment, the PRG4 has at least 99.5% sequence identity with residues 25-1404 of SEQ ID NO: l.
• the invention comprises PRG4 for use in treating cancer.
• the PRG4 is recombinant human PRG4 comprising the amino acid sequence of residues 25-1404 of SEQ ID NO: 1.
• the PRG4 has at least 99% sequence identity with residues 25-1404 of SEQ ID NO: 1.
• the PRG4 has at least 99.5% sequence identity with residues 25-1404 of SEQ ID NO: l.
• FIGS. 1A-C are bar graphs presenting data demonstrating the binding of recombinant human proteoglycan 4 (rhPRG4), high-molecular weight hyaluronic acid (HMW HA), and medium molecular weight hyaluronic acid (MMW HA) to recombinant human CD44 receptor as detected by TMB-ELISA at 450 nm. Data represents the average of 4 independent experiments with triplicate wells per group.
• FIG. 1A depicts binding of rhPRG4, HMW HA, MMW HA and vitronectin to CD44-IgGlFc and using IgGl Fc.
• the star (*) indicates that the 450 nm absorbance in the CD44-IgGl Fc wells were statistically significantly higher (pO.001) than the IgGl Fc wells for rhPRG4, HMW HA and MMW HA.
• FIG. IB shows the concentration-dependent CD44 binding of rhPRG4, HMW HA and MMW HA. CD44 binding to rhPRG4 was significantly higher than to HMW HA or MMW HA (p ⁇ 0.001).
• the double stars (**) indicate that CD44 binding to rhPRG4 was significantly higher than to MMW HA (pO.001).
• 1C depicts the competition between rhPRG4 (5 pg/mL) and either HMW HA or MMW HA (0.01 pg/mL to 50 pg/mL) on binding to CD44 coated on 96-well ELISA plates.
• the star (*) indicates the percentage CD44 binding in HMW HA+rhPRG4 wells was significantly lower than rhPRG4 wells (p ⁇ 0.05);
• (**) indicates the percentage CD44 binding in MMW HA+rhPRG4 wells was significantly lower than rhPRG4 wells (p ⁇ 0.05).
• FIGS. 2A-B depict binding of recombinant human proteoglycan 4 (rhPRG4) to recombinant CD44 and competition between rhPRG4 and high molecular weight hyaluronic acid (HMW HA) on CD44 binding using surface plasmon resonance.
• FIG. 2A is a sensogram depicting the concentration-dependent association and dissociation of rhPRG4 (300 pg/mL to 50 pg/mL) to immobilized CD44-IgGiFc. Dashed line curves represent the binding curves of rhPRG4 to CD44 chimeric protein and the black lines represent the fitted 1 : 1 binding model.
• FIG. 1 depict binding of recombinant human proteoglycan 4 (rhPRG4) to recombinant CD44 and competition between rhPRG4 and high molecular weight hyaluronic acid (HMW HA) on CD44 binding using surface plasmon resonance.
• FIG. 2A is
• 2B is a plot showing the relative response-HMW HA binding vs. relative response-rhPRG4 binding.
• rhPRG4 was injected at 300 (1), 250 (2), 200 (3), 150 (4), 100 (5), 50 (6) and 0 (7) pg/mL.
• HMW HA was injected at 50 pg/mL. As the concentration of rhPRG4 increased, subsequent HMW HA binding to CD44 decreased.
• FIGS. 3A-B show the impact of sialidase-A and O-glycosidase digestion of recombinant human proteoglycan 4 (rhPRG4) on binding of rhPRG4 to CD44. Data represents the average of 4 independent experiments with triplicate wells per group.
• FIG. 3A is a bar graph depicting binding of rhPRG4, sialidase-A digested rhPRG4, O-glycosidase digested rhPRG4 and sialidase-A + O-glycosidase digested rhPRG4 to CD44.
• the 450 nm absorbance values across different groups were normalized to the absorbance values in the undigested rhPRG4 group.
• the (*) indicates that CD44 binding in the sialidase A-digested and O-glycosidase-digested rhPRG4 was significantly higher compared to undigested rhPRG4 ( p ⁇ 0.01 ).
• (**) indicates that CD44 binding in the Sialidase-A +0-Glycosidase digested rhPRG4 was significantly higher compared to sialidase-A digested, O-glycosidase- digested and undigested rhPRG4 (p ⁇ 0.01 ).
• 3B is a photograph of an SDS-PAGE of rhPRG4, sialidase-A digested rhPRG4, O-glycosidase digested rhPRG4 and a combination of sialidase-A and O-glycosidase digested rhPRG4. The gel was stained overnight with
• FIGS. 4A-G rhPRG4 suppresses TGFp-induced invasive growth of
• FIG. 4A Representative DIC light microscopy images of 8-day old three-dimensional MDA-MB-231 cell-derived organoids that were left untreated or incubated with 100 pM TGFP, without or with increasing concentrations of rhPRG4 (0.1, 10 and 100 pg/mL) in complete growth medium.
• FIG. 4B Bar graph depicts mean ⁇ SEM proportion of spherical organoids expressed as a percentage of total colonies counted for each experimental condition from four independent experiments including the one shown in A.
• FIG. 4C Representative DIC light microscopy images of 8-day old three- dimensional MDA-MB-231 cell-derived organoids that were incubated with 10 pg/mL of mouse IgG or anti-PRG4 mAh 4D6, along with or without 100 pM TGF and 100 pg/mL rhPRG4 in different combinations in complete growth medium.
• FIG. 4D Bar graph depicts mean ⁇ SEM proportion of spherical organoids expressed as a percentage of total colonies counted for each experimental condition from three independent experiments including the one shown in C.
• FIG. 4E Representative DIC light microscopy images of untreated or 100 pM TGF -treated 8-day old three-dimensional MDA-MB-231 cell-derived organoids using Matrigel that was mixed with vehicle or 100 pg/mL rhPRG4.
• FIG. 4F Bar graph depicts mean ⁇ SEM proportion of spherical organoids expressed as a percentage of total colonies counted for each experimental condition from three independent experiments including the one shown in E.
• 4G Representative fluorescence microscopy images of nuclear (Hoechst 33342, blue), actin (TRITC- phalloidin, yellow), and laminin (Rat anti-laminin/ anti - rat Alexa 647, red) staining of formaldehyde-fixed 8 day old MDA-MB-231 cell-derived organoids that were left untreated or incubated with TGF , with or without rhPRG4, in complete growth medium. This experiment was repeated two independent times with similar outcomes. Significant difference, ANOVA: *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001. Scale bar indicates 50 pm. For FIGS.
• green and red arrows indicate spherical and invasive organoids respectively.
• Green arrows appear in all boxes on the top row of FIG. 4A and on the bottom row in the two boxes on the right. The two boxes in the bottom row on the left have red arrows.
• the first, third, and fourth boxes have green arrows, whereas the second box from the left has a red arrow.
• the first box on the left in the bottom row has a green arrow whereas the remaining boxes on the bottom row have red arrows.
• all boxes have a green arrow except the left hand box on the bottom row, which has a red arrow.
• green arrows indicate cortical actin (bottom row, middle box for both TGF + and TGF -), yellow arrows indicate stress-fiber like actin (top row, middle box for both TGF + and TGF -), blue arrows indicate intact laminin rings (TGF -, far right image in top and bottom rows as well as far right image in bottom row of TGF +), red arrow indicates disruption of laminin ring (TGF +, top row far right image), and white arrows (TGF +, top row far right image) indicate representative sites of laminin loss.
• FIGS. 5A-D rhPRG4 suppresses breast cancer cells’ invasive and migratory abilities.
• FIG. 5A Representative DIC light microscopy images of crystal violet- stained 12h-serum-starved MDA-MB-231 cells appearing on the underside of Matrigel- coated membrane of a transwell insert, with the bottom well containing complete growth medium without (-) or with 100 pM TGFp. alone or with 10 mM of TbM inhibitor SB435142 (KI) or 100 pg/mL of rhPRG4. Scale bar represents 150 pm.
• FIG. 5A Representative DIC light microscopy images of crystal violet- stained 12h-serum-starved MDA-MB-231 cells appearing on the underside of Matrigel- coated membrane of a transwell insert, with the bottom well containing complete growth medium without (-) or with 100 pM TGFp. alone or with 10 mM of TbM inhibitor SB435142 (KI) or 100 pg/mL of
• FIG. 5B Bar graph depicts mean ⁇ SEM proportion of invaded cells counted from eight randomly chosen non overlapping fields for each experimental conditions from three independent experiments including the one shown in A.
• FIG. 5C Representative DIC light microscopy images of serum-starved MDA-MB-231 cells seeded in wells of a 12-well plate at 0 and 36h after the introduction of a scratch, and incubated with 0.2% FBS -containing medium without (-) or with 100 pM TGF , alone or with 10 pM KI or 100 pg/mL rhPRG4. Scale bar represents 500pm.
• FIG. 5D Bar graph depicts mean ⁇ SEM proportion of scratch closure (%) at 36h with respect to the 0 hour of 5 non-overlapping images of each experimental condition from three independent experiments including the one shown in C. Significant difference,
• FIGS. 6A-D rhPRG4 does not affect TGFp-Smad signaling.
• FIG. 6A phospho-Smad2 (pSmad2), total Smad2/3 (tSmad2/3) and actin immunoblots of lysates of MDA-MB-231 cells which were either left untreated (control) or incubated with 100 pM TGF , without or with 10 pM KI or 100 pg/mL rhPRG4 in complete growth medium for 12 h.
• FIG. 6B Bar graph represents the mean ⁇ SEM of the proportion of pSmad2 relative to the total protein abundance of Smad2/3 and expressed as fold change with respect to the control from four independent experiments including the one shown in A.
• FIG. 6A Bar graph represents the mean ⁇ SEM of the proportion of pSmad2 relative to the total protein abundance of Smad2/3 and expressed as fold change with respect to the control from four independent experiments including the one shown in A.
• FIG. 6C A schematic representation of the 3TP-Lux reporter construct with three consecutive TPA (12-0- tetradecanoylphorbol 13-acetate) response elements (TREs) and a portion of the plasminogen activator inhibitor 1 (PAI-1) promoter region driving the expression of luciferase gene.
• TGF treatment triggers the phosphorylation, nuclear translocation, and binding of the Smads to 3TP promoter leading to increase in the abundance of the luciferase enzyme.
• FIG. 6D MDA-MB-231 cells were transfected with the 3TP-Lux reporter construct along with a Renilla luciferase expression construct driven by a CMV promoter.
• Bar graph represents the 3TP promoter-driven luciferase values normalized to the Renilla luciferase expression (relative light units), and the normalized data are expressed relative to the normalized luciferase data in lysates of untreated cells.
• FIGS. 7A-E rhPRG4 suppresses low molecular weight hyaluronic acid
• FIG. 7A Lysates of MDA-MB-231 cells were subjected to immunoprecipitation using a CD44 antibody (CD44 IP) or a non specific Rat IgG antibody (IgG IP) followed by CD44 immunoblotting of the CD44 antibody
• FIG. 7B Representative DIC light microscopy images of 8-day old three-dimensional MDA-MB-231 cell-derived organoids incubated with growth medium without or with increasing concentrations of LMWHA (10, 100 or 400 pg/mL), alone or together with 100 pg/mL rhPRG4. Scale bar indicates 50 pm. Green arrows (Top row, two left hand images and all images in bottom row) and red arrows (top row, two right hand images) indicate spherical and invasive organoids respectively.
• FIG. 7B Representative DIC light microscopy images of 8-day old three-dimensional MDA-MB-231 cell-derived organoids incubated with growth medium without or with increasing concentrations of LMWHA (10, 100 or 400 pg/mL), alone or together with 100 pg/mL rhPRG4. Scale bar indicates 50 pm. Green arrows (Top row, two left hand images and all images in bottom row) and red arrows (top row, two right hand images) indicate spherical and
• FIG. 7C Bar graph depicts mean ⁇ SEM proportion of spherical organoids expressed as a percentage of total colonies counted for each experimental condition from three independent experiments including the one shown in B.
• FIG. 7D Representative DIC light microscopy images of crystal violet- stained 12h-serum-starved MDA-MB-231 cells appearing on the underside of Matrigel- coated membrane of a transwell insert, with the bottom well containing complete growth medium without (-) or with 400 pg/mL LMWHA, alone or with 5 pg/mL CD44 neutralizing antibody or 100 pg/mL rhPRGL Scale bar represents 150pm.
• FIG. 7D Representative DIC light microscopy images of crystal violet- stained 12h-serum-starved MDA-MB-231 cells appearing on the underside of Matrigel- coated membrane of a transwell insert, with the bottom well containing complete growth medium without (-) or with 400 pg/mL LMWHA, alone or with 5 pg/m
• FIGS. 8A-F CD44 is crucial for TGFp-induced invasiveness in MDA-
• FIG. 8A CD44 immunoblot of lysates of MDA-MB-231 cells transfected with the pU6 RNAi vector (vector control), or the plasmids CD44i-l, CD44i-2, alone or together (CD44i-l+2) that expresses shRNAs targeting two distinct sequences of CD44 mRNA. Actin was used as loading control.
• FIG. 8A CD44 immunoblot of lysates of MDA-MB-231 cells transfected with the pU6 RNAi vector (vector control), or the plasmids CD44i-l, CD44i-2, alone or together (CD44i-l+2) that expresses shRNAs targeting two distinct sequences of CD44 mRNA. Actin was used as loading control.
• FIG. 8A CD44 immunoblot of lysates of MDA-MB-231 cells transfected with the pU6 RNAi vector (vector control), or the plasmids CD44i-l, CD44i-2,
• FIG. 8C Representative DIC light microscopy images of untreated (-), 100 pM TGFP or 400 pg/mL LMWHA-treated, 8-day old three-dimensional organoids in complete growth medium, derived from MDA-MB-231 cells, transfected with vector control or CD44i-l and CD44i-2, individually or in combination.
• FIG. 8C Representative DIC light microscopy images of untreated (-), 100 pM TGFP or 400 pg/mL LMWHA-treated, 8-day old three-dimensional organoids in complete growth medium, derived from MDA-MB-231 cells, transfected with vector control or CD44i-l and CD44i-2, individually or in combination.
• FIG. 8D Bar graph depicts mean ⁇ SEM proportion of spherical organoids expressed as a percentage of total colonies counted for each experimental condition from three independent experiments including the one shown in C.
• FIG. 8E CD44 and FLAG immunoblots of lysates of MDA-MB-231 cells transfected with an empty vector or CD44/FLAG expression plasmids. Actin was used as loading control.
• FIG. 8F Representative DIC light microscopy images of vector control or CD44/FLAG expressing 8 day-old MDA-MB-231 cell-derived organoids grown in complete growth medium without (-) or with 100 pM TGFP or 400 pg/mL LMWHA, alone or with 100 pg/mL rhPRG4.
• FIG. 8G Bar graph depicts mean ⁇ SEM proportion of spherical organoids expressed as a percentage of total colonies counted for each experimental condition from three independent experiments including the one shown in F. Significant difference,
• Green arrows and red arrows indicate spherical and invasive organoids respectively. Green arrows appear on all images in FIG. 8C except the far right images of the middle and bottom rows; red arrows appear on all images in FIG. 8F -rhPRG4 except the top row far left image which is green; green arrows appear on all images in the +rhPRG4 panel.
• FIGS. 9A-D TGFp induces invasiveness in the breast cancer cells in a HA-
• FIG. 9A Representative DIC light microscopy images of 8-day old three-dimensional MDA-MB-231 cell-derived organoids that were left untreated (-) or incubated with different concentrations of LMWHA (100 or 400 pg/mL), without or with 100 pM TGFP, along with or without KI (10 pM), CD44 neutralizing antibody (2.5 pg/mL), or rhPRG4 (100 pg/mL), in complete growth medium.
• FIG. 9B Bar graph depicts mean ⁇
• FIG. 9C Representative DIC light microscopy images of 8-day old three-dimensional MDA-MB-231 cell-derived organoids that were treated without or with 0.5 mM 4-MU, without or with 100 pM TGFP, along with or without 400 pg/mL LMWHA, and LMWHA with 100 pg/mL rhPRG4, in complete growth medium.
• FIG. 9D Bar graph depicts mean ⁇ SEM proportion of spherical organoids expressed as a percentage of total colonies counted for each experimental condition from three independent experiments including the one shown in C.
• FIGS. 10A-E rhPRG4 and TGFp have opposing effects on the protein abundance of CD44 and HAS2.
• FIG. 10A CD44 and phospho-Smad2 (pSmad2) immunoblots of lysates of MDA-MB-231 cells incubated in complete growth medium without (control) or with 100 pM TGFP, alone or together with 10 pM KI or 100 pg/mL rhPRG4. Actin was used as loading control.
• FIG. 10B Bar graph depicts mean ⁇ SEM proportion of CD44 immunoreactive band in each treatment condition from four independent experiments including the one shown in A.
• FIG. 10A CD44 and phospho-Smad2 (pSmad2) immunoblots of lysates of MDA-MB-231 cells incubated in complete growth medium without (control) or with 100 pM TGFP, alone or together with 10 pM KI or 100 pg/mL rhPRG4. Actin was used as loading control.
• IOC Representative CD44 (Rat anti- CD44/anti-rat Alexa 647, red; appears in columns labeled“CD44”), and nuclei (Hoechst, blue; appears in columns labeled“nuclei”) fluorescence microscopy images of fixed 8 day- old MDA-MB-231 cells-derived organoid that were incubated in complete growth medium without or with 100 pM TGFP, alone or together with 100 pg/mL rhPRG4. This experiment was repeated two times with similar outcomes. Scale bar indicates 50 pm. FIG.
• FIG. 10D HAS2 and phospho-Smad2 (pSmad2) immunoblots of lysates of MDA-MB-231 cells incubated in complete growth medium without (control) or with 100 pM TGF , alone or together with 10 pM KI or 100 pg/mL rhPRG4. Actin was used as loading control.
• FIG. 11 is the amino acid sequence of full length (non-truncated) human
• FIG. 12 is the nucleic acid sequence for the PRG4 gene (SEQ ID NO: 2) encoding the full length 1404 AA human PRG4 protein.
• FIG. 13 shows Kaplan Meier survival curves of hepatocellular carcinoma
• HCC human Crohn's disease .
• lubricin CSPG4, VC AN, and HSPG2
• the Y-axis is cumulative survival and the X-axis is survival in months.
• the patients are stratified as high or low according to values above or below the median mRNA expression value for any marker of interest.
• the data show that lubricin expression is positively correlated with HCC patients survival.
• FIGS. 14A-B show lubricin protein expression in HCC and the tissue localization.
• FIG. 14A shows Western blot analysis and quantification of lubricin protein levels in tumoral and peritumoral paired tissues of 14 HCC patients.
• FIG. 14B shows the immunofluorescence of HCC tumor tissues displaying the localization of lubricin (green) and aSMA (red). Nuclei are represented by blue. In the far right panel of the bottom row, only blue and red are seen. Green and red are seen together to the largest extent in the first and second panels of the top row. Green and red are seen together to a smaller extent in the last panel of the top row and the first two panels of the bottom row.
• FIG. 15 is a series of bar graphs showing that TGF induces lubricin expression in CAFs (top row) and ex-vivo cultured HCC tissues (bottom row).
• the mRNA levels of the control, LY, TGF, and TGF + LY are shown from left to right in each graph.
• the mRNA levels of each of LY, TGF, and TGF + LY vs control are shown from left to right in each graph.
• the levels of aSMA, CSPG4, HSPG2, lubricin, and VCN are shown.
• FIG. 16 shows Kaplan Meier curves showing the cumulative survival of 78
• FIGS. 17A-B show that CD44 silencing in HCC cells impairs cell adhesion to rhPRG4, but not migration.
• bar graphs show cell adhesion in HLE and HLF cells as a % of FN.
• the Y-axis is cell adhesion as a % of FN.
• the dark bars are for control- shRNA while the light bars are for CD44-shRNA.
• the results for uncoated, lubricin, and FN are shown from left to right.
• the top row is control-shRNA and the bottom is CD44-shRNA, with the wells being for uncoated, lubricin, and FN from left to right.
• the images for vehicle are found in the top row, while images for lubricin are found in the bottom row.
• the accompanying bar graph shows number of cells/microscopic field for vehicle versus lubricin for control-shRNA (HLE), CD44-shRNA (HLE), control-shRNA (HLF), and CD44-shRNA (HLF) from left to right.
• FIG. 18 shows that rhPRG4 enhances sorafenib and regorafenib effectiveness in inhibiting cell proliferation, preferentially in high CD44-expressing HCC cells.
• Cells were tested for growth rate for 72 hours in the presence or absence of sorafenib, regorafenib (2.5 mM), and increasing rhPRG4 concentrations (0 to 100 pg/ml). Drug effectiveness is calculated as % of growth inhibition subtracted by the rhPRG4 inhibitory contribution.
• T- Test * p ⁇ 0.05; ** p ⁇ 0.01; *** p ⁇ 0.001. Cell count is shown in the graphs on the top row, while the second row shows plots of cell growth vs.
• FIGS. 19A-B shows CD44 silencing in HCC cells offsets the enhancement of drug effectiveness by lubricin.
• cells were transduced via lentiviral infection and further selected for stable CD44-silencing.
• a 72-hour proliferation test was performed and the net effect of lubricin in enhancing the sorafenib or regorafenib inhibitory action was plotted both for Control- and CD44-shRNA cells.
• the first row shows plots of cell growth vs. concentration of rhPRG4. Control is shown in a dark line, while the results for sorafenib are marked with an“X” and results for regorafenib are marked with a“T.”
• the second row shows plots of enhancement of drug inhibitory effect as a % vs. concentration of rhPRG4 for control-shRNA (solid line) and CD44-shRNA (dotted line).
• HCC CAFs were stimulated for 48 hours with TGF i and further incubated for 48 hours (without TGF i) in serum-free conditions to allow enrichment of the conditioned medium (CM). The CM was then lubricin concentrated and depleted or not.
• FIG. 19B is a western blot showing lubricin depletion from CM of TGF i -treated CAFs.
• ID immunodepleted TGF i- treated CAFs-CM using isotype or anti-lubricin antibody
• IP immunoprecipitated lubricin from TGFp i -treated CAFs-CM using isotype or anti-lubricin antibody.
• ID immunodepleted TGF i- treated CAFs-CM using isotype or anti-lubricin antibody
• IP immunoprecipitated lubricin from TGFp i -treated CAFs-CM using isotype or anti-lubricin antibody.
• ID immunodepleted TGF i- treated CAFs-CM using
• FIG. 19B the effect of TGF i -treated CAFs-CM lubricin depleted/not depleted on sorafenib and regorafenib inhibitory action against HLF cell proliferation is shown; 20 pg/ml of CM proteins were used in a 72-hour growth test in the presence of 1% FBS.
• T-Test * p ⁇ 0.05; ** p ⁇ 0.01; *** p ⁇ 0.001.
• FIG. 20 shows CD44 silencing efficiency in HLE and HLF cell lines transduced with lentiviral particles carrying control non-targeting (V), or specific CD44- targeting shRNA sequences.
• FIGS. 21A-B shows the level of various sternness markers (OV6, CD133,
• CD44 and CD90 epithelial markers (AFP, E-Cadh, EpCAM), mesenchymal markers (Vim, N-Cadh, aSMA), and other cancer-related surface proteins (CD 13, CD151) detected on the surface of the primary HCC cell line PLC/DC19 isolated from freshly collected surgically resected HCC specimens.
• epithelial markers AFP, E-Cadh, EpCAM
• mesenchymal markers Vim, N-Cadh, aSMA
• CD 13, CD151 cancer-related surface proteins
• rhPRG4 represses TGF -dependent increase in the protein abundance of CD44 and of the enzyme HAS2, which is involved in HA biosynthesis. It is widely accepted that TGF has both tumor suppressing and tumor promoting roles in cancer. Applicant’s finding that rhPRG4 opposes HAS2 and CD44 induction by TGF has implications for downregulating the tumor promoting roles, while maintaining the tumor suppressive aspects of TGF actions. These findings support a clinical utility of PRG4 as a therapeutic treatment for cancer.
• PRG4 also referred to as lubricin
• MSF megakaryocyte stimulating factor
• PRG4 is a ubiquitous, endogenous glycoprotein that coats the articulating surfaces of the body.
• Lubricin is highly surface active molecule (e.g., holds onto water), that acts primarily as a potent cytoprotective, anti-adhesive and boundary lubricant.
• the molecule has a long, central mucin-like domain located between terminal protein domains that allow the molecule to adhere and protect tissue surfaces.
• Natural lubricin typically comprises multiple redundant forms of this repeat, which typically includes proline and threonine residues, with at least one threonine being glycosylated in most repeats.
• the threonine anchored O-linked sugar side chains are critical for lubricin’s boundary lubricating function.
• the side chain moiety typically is a b( 1 -3)Gal-GalNAc moiety, with the b( 1 -3)Gal- GalNAc typically capped with sialic acid or N-acetylneuraminic acid.
• the polypeptide also contains N-linked oligosaccharides.
• the gene encoding naturally-occurring full length lubricin contains 12 exons, and the naturally -occurring MSF gene product contains 1,404 amino acids (including the secretion sequence) with multiple polypeptide sequence homologies to vitronectin including hemopexin-like and somatomedin-like regions.
• Exon 6 contains 940 residues.
• Exon 6 encodes the repeat rich, O- glycosylated mucin-like domain. This extensive O-linked glycosylated mucin-like domain is necessary for PRG4’s boundary lubricating and dis-adhesive properties at various biointerfaces in the body including articular cartilage, tendons, the pericardium, and the ocular surface (Jay et al., Matrix Biol., 2014; 39: 17-24).
• the amino acid sequence of the protein backbone of lubricin may differ depending on alternative splicing of exons of the human MSF gene. This robustness against heterogeneity was exemplified when researchers created a recombinant form of lubricin missing 474 amino acids from the central mucin domain, yet still achieved reasonable, although muted, lubrication (Flannery et al., Arthritis Rheum 2009; 60(3):840-7). PRG4 has been shown to exist not only as a monomer but also as a dimer and multimer disulfide- bonded through the conserved cysteine-rich domains at both N- and C-termini.
• Lubris, LLC has developed a full-length recombinant form of human lubricin.
• the molecule is expressed using the Selexis Chinese hamster ovary cell line (CHO-M), with a final apparent molecular weight of 450-600 kDa, with poly disperse multimers frequently measuring at 1,000 kDa or more, all as estimated by comparison to molecular weight standards on SDS tris-acetate 3- 8% polyacrylamide gels.
• CHO-M Selexis Chinese hamster ovary cell line
• poly disperse multimers frequently measuring at 1,000 kDa or more, all as estimated by comparison to molecular weight standards on SDS tris-acetate 3- 8% polyacrylamide gels.
• Of the total glycosylations about half comprise two sugar units (GalNAc-Gal), and half three sugar units (GalNAc-Gal-Sialic acid).
• This method of recombinant human PRG4 production is disclosed in International Patent Application No. PCT/US0
• any one or more of various native and recombinant PRG4 proteins and isoforms may be utilized in the various embodiments described herein.
• U.S. Patent Nos. 6,433,142; 6,743,774; 6,960,562; 7,030,223, and 7,361,738 disclose how to make various forms of human PRG4 expression product, each of which is incorporated herein by reference.
• Preferred for use in the practice of the invention is full length, glycosylated, recombinant PRG4, or lubricin, expressed from CHO cells.
• This protein comprises 1,404 amino acids (see FIG.
• SEQ ID NO: l including a central exon comprising repeats of the sequence KEPAPTT (SEQ ID NO: 3) variously glycosylated with O-linked b (1-3) Gal- GalNAc oligosaccharides, and including N and C-terminal sequences with homology to vitronectin.
• the molecule is polydisperse with the glycosylation pattern of individual molecules varying, and can comprise monomeric, dimeric, and multimeric species.
• PRG4 is used interchangeably with the term
• Lubricin refers to any functional isolated or purified native or recombinant PRG4 proteins, homologs, functional fragments, isoforms, and/or mutants thereof.
• All useful molecules comprise the sequence encoded by exon 6, or homologs or truncated versions thereof, for example, versions with fewer repeats within this central mucin-like KEPAPTT-repeat domain, preferably together with O-linked glycosylation.
• All useful molecules also comprise at least the biological active portions of the sequences encoded by exons 1-5 and 7-12, i.e., sequences responsible for imparting to the molecule its affinity for ECM and endothelial surfaces.
• a preferred PRG4 protein has an average molar mass of between 50 kDa and 500 kDa, preferably between 224 to 467 kDa, comprising one or more biological active portions of the PRG4 protein, or functional fragments, such as a lubricating fragment, or a homolog thereof.
• a PRG4 protein comprises monomers of average molar mass of between 220 kDa to about 280 kDa.
• PRG4 has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% , at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, or at least 99.7% amino acid sequence identity with the amino acid sequence of residues 25-1404 of SEQ ID NO: 1. In one embodiment, the sequence identity is at least 98% with the amino acid sequence of residues 25-1404 of SEQ ID NO: 1.
• the sequence identity of PRG4 is at least 99% with the amino acid sequence of residues 25-1404 of SEQ ID NO: l. In one embodiment, the sequence identity of PRG4 is 99.5% with the amino acid sequence of residues 25-1404 of SEQ ID NO: 1. In one embodiment, the sequence identity of PRG4 is 99.6% with the amino acid sequence of residues 25-1404 of SEQ ID NO: l. In one embodiment, the sequence identity of PRG4 is 99.7% with the amino acid sequence of residues 25-1404 of SEQ ID NO: l.
• the method starts with cloning and isolating mRNA and cDNA encoding PRG4 proteins or isoforms using standard molecular biology techniques, such as PCR or RT-PCR.
• the isolated cDNA encoding the PRG4 protein or isoform is then cloned into an expression vector, and expressed in a host cell for producing recombinant PRG4 protein, and isolated from the cell culture supernatant.
• a method for production of recombinant human PRG4 is provided in
• PRG4 The function of PRG4 heretofore has been almost entirely associated with reduction of friction and prevention of wear between articulating joints and lubrication of interfacing tissues such as between the surface of the eye and eyelid.
• CACP camptodactyly-arthropathy-coxa vara-pericarditis (CACP) disease syndrome in humans.
• CACP is manifest by camptodactyly, noninflammatory arthropathy, and hypertrophic synovitis, with coxa vara deformity, pericarditis, and pleural effusion.
• PRG4-null mice cartilage deterioration and subsequent joint failure were observed. Therefore, PRG4 expression is a necessary component of healthy synovial joints.
• Applicant has now determined that PRG4 can be used to treat or inhibit cancer.
• CD44 is a glycoprotein and a major cell surface receptor with various isoforms generated by alternative splicing and glycosylation that plays a major role in inflammation (Cutly et al. , J Cell Biol 1992;
• CD44 is expressed in a large number of mammalian cell types and its levels of expression vary between cell types and their activation state. Cancerous or neoplastic cells may also express CD44 and the presence of CD44 on such cells is indicative of its involvement in the regulation and metastasis of cancer. In humans, CD44 is encoded by the CD44 gene on chromosome 1. Signaling through CD44 induces T cell proliferation and IL-2 production, dose-response-dependent enhancement of NK cytotoxic activity, and macrophage production of cytokines and chemokines, as well as other functions.
• HMW HA high molecular weight
• LMW HA and MMW HA are also ligands for CD44.
• HA/CD44 interactions are prevalent in a variety of disease states. For example, carcinomas arising from colon epithelia tend to develop in an HA-rich microenvironment, wherein CD44 receptors on epithelial tumor cells activate a tyrosine kinase mediated cell survival pathway, leading to unchecked cell division and proliferation (Misra S et al. Connect Tissue Res.
• CD44 is also recognized as a marker for cancer stem cells (CSC) and HA is expressed by cancer cells. ( Chen et al, J. Hematol. Oncol., 2018; 1:64).
• CD44 has been noted in head and neck squamous cell carcinoma, breast cancer, pancreatic cancer, gastrointestinal cancers, colorectal adenocarcinoma, prostate cancer, colon cancer, bladder cancer, and leukemia.
• HA binding to CD44 results in activation of cell signaling pathways that induce cell proliferation, increase cell survival, modulate cytoskeletal changes, and enhance cellular motility.
• CD44 ligands include extracellular matrix components e.g. collagens, fibronectin and laminin (Naor et al., Adv Cancer Res 1997; 71 :241-319; Knudson et al, Cell Mol. Life Sci. 2002; 59:36-44), matrix metalloproteinase-9, the HA-serum-derived hyaluronan associated protein complex (HA-SHAP), hemopexin, EMMPRIN, somatomedin- B, osteopontin, OKT3, or complement related proteins (such as C3a, CD3, CD46).
• extracellular matrix components e.g. collagens, fibronectin and laminin (Naor et al., Adv Cancer Res 1997; 71 :241-319; Knudson et al, Cell Mol. Life Sci. 2002; 59:36-44
• matrix metalloproteinase-9 matrix metalloproteinase-9
• HA-SHAP the HA-
• Example 1 As demonstrated by the data presented in Example 1 below, the lubricin-CD44 interaction shows that this glycoprotein has functions beyond its boundary lubricating and mechanical properties.
• Examples 1 A-D show that lubricin acts as a ligand, binding CD44. Accordingly, because lubricin binds CD44, lubricin may be used as a CD44 antagonist to prevent binding to CD44 of ligands, such as hyaluronic acid, and therefore prevent the activation of cell signaling pathways by CD44 activation that induce cell proliferation, increase cell survival, modulate cytoskeletal changes, and enhance cellular motility— activities which are implicated in cancer.
• ligands such as hyaluronic acid
• rhPRG4 suppresses the invasive and migratory ability of cancer cells, specifically showing the direct impact administration of PRG4 can have on curtailing negative behaviors of cancer cells necessary for tumor progression. As demonstrated by the data presented herein, this is achieved at least through rhPRG4’s ability to suppress low molecular weight Hyaluronan (LMW HA) signaling via CD44, preventing induction of cancer cell growth.
• LMW HA low molecular weight Hyaluronan
• PRG4 can be used to bind to CD44 on a cancer cell surface to inhibit CD44 signaling involved in cancer cell growth, survivability, progression or metastatic activity.
• PRG4 is administered to a patient having cancer or a patient at risk of developing cancer to treat the cancer or slow the growth or progression of a cancer or tumor.
• PRG4 may be administered concurrently with a chemotherapeutic or radiologic treatment for cancer. Accordingly, in one embodiment, PRG4 is administered to a patient having cancer wherein the PRG4 is administered to treat the cancer, or wherein the lubricin is administered in connection with another cancer drug or treatment in order to treat the cancer. In one embodiment, the cancer is in a human subject.
• the PRG4 is administered to the patient in combination with a chemotherapeutic or radiologic treatment for cancer.
• the chemotherapeutic agent is selected from actinomycin, abraxane, altretamine, aranose, azacitidine, azathioprine, bendamustine, bleomycin, bortezomib, busulfan, cabazitaxel, capecitabine, carboplatin, carmofur, carmustine, chlorambucil, chlormethine, chlorozotocin, cisplatin, cladribine, clofarabine, crizotinib, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, dasatinib, daunorubicin, decitabine, docetaxel, doxifluridine, doxorubicin, epirubicin, ertramustine, e
• procarbazine oxaliplatin, paclitaxel, pemetrexed, pentostatin, ranimustine, raltitrexed, regorafenib, romidepsin, semustine, sorafenib, streptozotocin, tafluposide, tamoxifen, taxotere, tegafur, temozolomide, temsirolimus, teniposide, tioguanine, tofacitinib, opotecan, valrubicin, vemurafenib, vinblastine, vincristine, vincristine, vindesine, vinflunine, vinorelbine, vorinostat, or vismodegib.
• the chemotherapeutic agent is regorafenib and/or sorafenib. In one embodiment, the chemotherapeutic agent is regorafenib and/or sorafenib and the cancer is hepatocellular carcinoma.
• the chemotherapeutic agent is an antibody selected from alemtuzumab, bevacizumab, blinatumomab, brentuximab, certolizumab, cetuximab, daratumumab, dinutuximab, ibritumomab, obinutuzumab, ofatumumab, olaratumab, panitumumab, pertuzumab, ramucirumab, rituximab, siltuximab, trastuzumab, rituximab, inotuzumab, gemtuzumab, bevacizumab, camiplimab, or spartalizumab.
• an antibody selected from alemtuzumab, bevacizumab, blinatumomab, brentuximab, certolizumab, cetuximab, daratumumab, dinutuxima
• the PRG4 is administered to the patient in combination with a radiologic treatment for cancer.
• the radiologic treatment is external beam radiation therapy, brachytherapy, or stereotactic body radiation therapy (SBRT).
• the administration of PRG4 in combination with a chemotherapeutic or radiologic treatment for cancer enhances the cancer’s sensitivity or responsiveness to the chemotherapeutic or radiologic treatment. Accordingly, in one embodiment, administration of PRG4 in combination with a chemotherapeutic or radiologic treatment improves the treatment of the cancer as compared to treatment with the chemotherapeutic or radiologic treatment alone. For example, the combination results increases the speed at which the patient experiences a partial or complete remission of the cancer from the treatment, or the combination increases the likelihood that a patient experiences a partial or complete remission of the cancer from the treatment as compared to treatment with the chemotherapeutic or radiologic treatment alone. In other words, the combination therapy is more effective at treating the cancer than treatment with the chemotherapeutic or radiologic treatment alone.
• Co-administration of PRG4 with anti-cancer agents can reduce the toxicity of such agents by allowing them to be administered at lower doses having less toxic effects in patients. Accordingly, in another embodiment, the administration of PRG4 in combination with a chemotherapeutic or radiologic treatment for cancer allows the chemotherapeutic or radiologic treatment to be administered at a dose that is lower than the therapeutic dose for treating the cancer when the chemotherapeutic or radiologic treatment is administered alone.
• A“therapeutically effective dose” refers to the dose that is demonstrated to show efficacy in treating a specific cancer in a human patient.
• A“therapeutically effective dose administered alone” refers to the dose of an anti-cancer agent that is demonstrated to show efficacy in treating the specific cancer in a human patient when that anti-cancer agent is the sole anti cancer agent administered to the patient to treat the specific cancer.
• the dose may be a daily dose administered over a period of time defining the course of treatment.
• the dose may be a single dose administered at one time as part of a dosing schedule defining a course of treatment.
• the therapeutically effective dose may be a dose approved by a government agency.
• the therapeutically effective dose may be the dose approved by the European Medicines Agency to treat a given cancer.
• the therapeutically effective dose may be the dose approved by the United States Food and Drug Administration to treat a cancer.
• PRG4 is administered with regorafenib, where regorafenib is administered at a dose of less than 160 mg/day. In one embodiment, PRG4 is administered with regorafenib, where regorafenib is administered at a dose of less than 160 mg/day and the cancer is hepatocellular carcinoma. In another embodiment, PRG4 is administered with sorafenib where sorafenib is administered at a dose of less than 800 mg/day or 400 mg/ two times per day.
• PRG4 is administered with sorafenib where sorafenib is administered at a dose of less than 800 mg/day or 400 mg/ two times per day and the cancer is hepatocellular carcinoma.
• sorafenib is administered at a dose of less than 800 mg/day or 400 mg/ two times per day and the cancer is hepatocellular carcinoma.
• chemotherapeutic agents when PRG4 is co-administered with such anti-cancer treatments. Consequently, such anti-cancer treatments may be administered at lower doses than otherwise required for therapeutic efficacy.
• PRG4 is administered in combination with an immunotherapy to treat cancer, where the combination treats the cancer.
• the immunotherapy may be atezolizumab, avelumab, durvalumab, pembrolizumab, nivolumab, cemiplimab, ipilimumab, or another drug that targets PD-L1 or PD-1.
• administration of PRG4 in combination with an immunotherapy improves the treatment of the cancer as compared to treatment with the immunotherapy alone.
• the combination results increases the speed at which the patient experiences a partial or complete remission of the cancer from the treatment, or the combination increases the likelihood that a patient experiences a partial or complete remission of the cancer from the treatment as compared to treatment with the immunotherapy treatment alone.
• the combination therapy is more effective at treating the cancer than treatment with the immunotherapy treatment alone.
• the invention provides a method of preventing or inhibiting recurrence of a previously treated cancer in patient.
• the method involves administering to a patient a therapeutically effective amount of PRG4 to inhibit or prevent recurrence of cancer in the patient where the patient has previously received cancer treatment and experienced remission of the cancer treated, or has had surgery to resect the cancer.
• the patient has previously experience a complete remission of the cancer, where as in another embodiment, the patient has previously experienced a partial remission of the cancer.
• the prevention or inhibition of recurrence is for at least one year, at least two years, at least three years, at least four years, at least five years, at least six years, at least seven years, at least eight years, at least nine years, at least ten years or more.
• the PRG4 is administered at the site of the previously treated cancer annually, bi-annually, quarterly, or biennially after the patient experiences remission or resection of the cancer to prevent or inhibit recurrence of a previously treated cancer in a patient.
• the PRG4 is administered systemically to the patient having a previously treated cancer annually, bi-annually, quarterly, or biennially after the patient experiences remission or resection of the cancer to prevent or inhibit recurrence of the previously treated cancer in the patient.
• “treating,”“treat,” or“treatment” of cancer refers to therapeutic intervention that results in reduction in the number and/or size of a tumor, a decrease in the number and/or size of metastases, a decrease in the rate of tumor growth or proliferation, or a decrease in a symptom of the tumor.
• treating cancer according to the methods of the invention results in a patient experiencing complete remission or partial remission of the cancer.
• “preventing,”“prevent,” or“prevention” of cancer refers to inhibiting the partial or full development of a cancer.
• “preventing” cancer means that a non-cancerous growth or tumor is inhibited from turning into a cancerous tumor, while in some embodiments, prevention of cancer means a cancer is inhibited from recurring, for example, when the cancer has previously been in remission.
• Cancers that may be treated with PRG4 according to the method of the invention include adrenal cancer, anal cancer, bile duct cancer, bladder cancer, bone cancer, brain/CNS cancer, basal cell skin cancer, breast cancer, Castleman disease, cervical cancer, colorectal cancer, endometrial cancer, esophagus cancer, dermatofibrosarcoma protuberans, Ewing family of tumors, eye cancer, gall bladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor (GIST), gastric cancer, gestational trophoblastic disease, glioma, glioblastoma, head and neck cancer, hepatocellular carcinoma (HCC), Hodgkin disease, Kaposi sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, leukemia, lung cancer, liver cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, melanoma, multiple myeloma, myeloma,
• the cancer is breast cancer.
• the cancer is triple-negative breast cancer.
• the cancer is hepatocellular carcinoma.
• the patient whose cancer is being treated is preferably a human; however, the patient may be any mammal, for example a horse, a cow, a pig, a rat, a mouse, a dog, or a cat.
• PRG4 may be co-administered with any of the aforementioned anti-cancer agents.
• co-administration means sequential administration of PRG4 and an anti-cancer agent, for example, one after the other, for example on the same day.
• co-administration can occur where PRG4 is administered on a different day than the anti-cancer agent(s).
• co-administration includes
• PRG4 and the anti-cancer agent together in one formulation.
• co-administration refers to PRG4 and the anti-cancer agent(s) being provided at different times during the same course of treatment even if they are not administered at the same moment in time.
• PRG4 is administered prior to administration of an anti-cancer agent.
• PRG4 is administered after administration of an anti-cancer agent.
• PRG4 may be administered to the patient systemically or locally according to the methods of the invention disclosed herein.
• Local administration may be warranted in cases where the cancer is localized to a specific tissue or organ and accessing the tissue or organ is possible by, for example, injection or local administration.
• lubricin may be administered locally according to the methods of the invention disclosed herein.
• lubricin may be locally administered topically or by local injection to the site of a tumor or the site where a tumor has been resected or at a location around or in the vicinity of the tumor site.
• the lubricin is administered at the time of a surgical resection of a tumor to the site of the resection after the tumor has been removed.
• the lubricin is administered by injection to a non-resectable tumor and/or at or around the site of the non- resectable tumor.
• lubricin may be administered systemically according to the methods of the invention disclosed herein.
• Systemic administration is contemplated by some embodiments of the invention, for example, when the cancer is in the blood, lymph, or otherwise cannot be treated by local administration.
• Systemic administration also may be warranted when the cancer is not localized in one area of the patient but is found throughout the patient or in more than one location in the patient, for example, if the cancer has metastasized.
• Examples of acceptable modes of systemic administration include enteral delivery, such as oral, rectal, sublingual, sublabial, or buccal delivery or parenteral, such as nasal, by inhalation, intravenous, intramuscular, subcutaneous, intradermal, intraperitoneal or transmucosal delivery.
• Another acceptable method of systemic administration is by injection, for example, by intravenous administration, by subcutaneous injection, or by intramuscular injection.
• lubricin is provided in an amount that is insufficient to provide boundary lubrication. Applicants have determined that the effects of lubricin on cancer can be achieved at concentrations much lower than what is necessary to achieve boundary lubrication. Accordingly, in one embodiment, lubricin is administered in an amount ranging from 0.1 pg/kg to 4,000 pg/kg. For example, lubricin may be administered in an amount ranging from 0.1 pg/kg to 2000 pg/kg. For example, lubricin may be administered in an amount ranging from 50 pg/kg to 500 pg/kg. For example, lubricin may be administered in an amount ranging from 500 pg/kg to 1000 pg/kg.
• lubricin may be administered in an amount ranging from 100 pg/kg to 1000 pg/kg.
• lubricin may be administered in an amount ranging from 2000 pg/kg to 3000 pg/kg.
• lubricin may be administered in an amount ranging from 2000 pg/kg to 4000 pg/kg.
• lubricin is administered in an amount ranging from 0.1 pg/mL to 100 mg/mL, or 25-75 mg/mL, or 30-60 mg/mL.
• lubricin is administered at 30 mg/mL and is administered in small volumes of 1 to 100 pL per dose.
• lubricin is administered in volumes of 100 pL to 4 L per dose. In a further embodiment, lubricin is systemically administered to achieve a blood concentration in the range of 10 pg/mL to 100 pg/mL. In yet another embodiment, lubricin is administered in small volumes at the site of a tumor or resected tumor in the amount of 100 pL-5 mL, where the concentration of the lubricin is provided in a range of 0.1 pg/mL to 100 pg/mL or in the range of 10 pg/mL to 1 mg/mL.
• the amount of lubricin administered will depend on variables such as the size, type, and location of the cancer and the extent of any metastasis, the pharmaceutical formulation, and the route of administration.
• the initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue level. Alternatively, the initial dosage can be smaller than the optimum, and the dosage may be progressively increased during the course of treatment. Patients may be provided with an induction dose to achieve a certain blood level followed by one or more treatment or maintenance doses. The optimal dose can be determined by routine experimentation.
• PRG4 can be administered according to the methods of the invention disclosed herein on a variety of different dosing schedules. For example, in one embodiment, PRG4 is administered once locally at the time of a surgical resection of a cancer. In another embodiment, PRG4 is administered to a patient to treat or prevent cancer every day, every other day, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 14 days, or every 28 days. For example, the patient may receive treatment with PRG4 until the patient experiences a complete or partial remission.
• PRG4 is administered to a patient having a tumor that is not yet cancerous to prevent the tumor from becoming cancerous on a yearly basis, on a biannual basis, on a quarterly basis or on a monthly basis.
• the PRG4 is administered to a patient on the same day the patient receives another anti-cancer treatment such as chemotherapy or radiation and is administered each time the patient receives that other anti-cancer treatment.
• the PRG4 is administered to a patient on the day before the patient receives another anti-cancer treatment such as chemotherapy or radiation and is administered the day before each time the patient receives that other anti-cancer treatment.
• another anti-cancer treatment such as chemotherapy or radiation
• the PRG4 is administered to a patient on the day after the patient receives another anti-cancer treatment such as chemotherapy or radiation and is administered the day after each time the patient receives that other anti-cancer treatment.
• another anti-cancer treatment such as chemotherapy or radiation
• lubricin is preferably combined with a pharmaceutically acceptable carrier.
• pharmaceutically acceptable carrier means buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
• the carrier(s) should be “acceptable” in the sense of being compatible with the other ingredients of the formulations and not deleterious to the recipient.
• Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration.
• Carriers may also include biomaterials such as a matrices, hydrogels, polymers, tissue scaffolds, and resorbable carrier materials including collagen sponges. Exosomes and the like may also be used as carriers. The use of such media and agents for pharmaceutically active substances is known in the art. Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington’s Pharmaceutical Sciences, 18 th ed. (Mack Publishing Company, 1990).
• Formulation components suitable for parenteral administration include a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.
• Lubricin for administration can be presented in a dosage unit form and can be prepared by any suitable method and should be formulated to be compatible with its intended route of administration.
• Rheumatoid arthritis fibroblast-like synoviocytes were stimulated with interleukin-1 beta (IL-Ib) or tumor necrosis factor alpha (TNF-a) for 48 hours in the presence or absence of rhPRG4 or HMW HA at 20, 40 and 80 pg/mL and cell proliferation was measured. CD44 contribution was assessed by co-incubation with an anti-CD44 antibody (IM7).
• IM7 anti-CD44 antibody
• High-binding microtiter plates (Coming, Sigma Aldrich, USA) were coated with rhPRG4 (M £240 KDa), high molecular weight HA (HMW HA; M r ol,500 KDa) (R &
• rhPRG4 is a full-length product produced by CHO-M cells (Lubris, Framingham, MA, USA). Following washing with PBS+0.1% Tween 20, wells were blocked with 2% bovine serum albumin (BSA; 300 pL per well) for at least 2 hours at room temperature.
• BSA bovine serum albumin
• FIG. 1A Binding of rhPRG4, HMW HA, MMW HA and vitronectin to CD44-IgGiFc fusion protein and IgGiFc is presented in FIG. 1A.
• the 450 nm absorbance in the CD44- IgGiFc group was significantly higher (pO.001) than the absorbance in the IgGiFc group for rhPRG4, HMW HA and MMW HA-coated wells.
• rhPRG4 HMW HA and MMW HA specifically bind to chimeric CD44 with extremely low non-specific binding.
• vitronectin that shares significant sequence homology with lubricin does not show any specificity towards CD44 binding. Because rhPRG4 binds CD44, it may function as an antagonist of CD44, thereby interfering with CD44 pro-inflammatory signaling.
• the concentration-dependent binding of rhPRG4, HMW HA and MMW HA to CD44 was performed by coating microtiter plates with 400, 200, 100, 20, 4, 2 and 0.1 pg/mL of the macromolecules. The assay was performed as described above. The absorbance values in the IgGiFc wells were subtracted from the absorbance values in the CD44 IgGiFc wells and the corrected CD44 IgGiFc absorbance values were normalized to those of the 400 pg/mL rhPRG4 group and data was expressed as percentage binding to CD44.
• the concentration-dependent binding of rhPRG4, HMW HA and MMW HA to recombinant CD44 is depicted in FIG. IB.
• the percentage recombinant CD44 binding was significantly higher (p ⁇ 0.001) in the rhPRG4-coated wells compared to the HMW HA or MMW HA-coated wells for the 400, 100, 20, 4 and 2 pg/mL concentrations. Additionally, the percentage recombinant CD44 binding was significantly higher (p ⁇ 0.001) in the rhPRG4- coated wells compared to the MMW HA coated wells for the 200 pg/mL concentration.
• microtiter plates were coated with either CD44 IgGiFc or IgGiFc at 1 pg/mL (100 pL per well) overnight at 4 °C. Subsequently, wells were washed with PBS+0.1% tween 20 and wells were blocked using 2% BSA (300 pL per well) for at least 2 hours at room temperature.
• rhPRG4 at 5 pg/mL or a combination of rhPRG4 (5 pg/mL) and HMW HA or MMW HA at 0.01, 0.05, 0.25, 1, 5 or 50 pg/mL were added to the wells (100 pL per well) and incubated at room temperature for 60 min.
• lubricin-specific monoclonal antibody (Mab 9G3) was added at 1 : 1 ,000 (100 pL per well) and incubated for 60 min at room temp.
• FIG. 1C The competition between rhPRG4 and HMW HA or MMW HA in binding to recombinant CD44 is presented in FIG. 1C.
• Binding of rhPRG4 to CD44-IgGlFc was investigated using surface plasmon resonance (Biacore T100, GE Healthcare Lifesciences, NJ, USA). See FIG. 1C. Series S chips were functionalized using the human antibody capture kit (GE Life Sciences) and either CD44-IgGiFc or IgGiFC was allowed to bind to the surface of the functionalized chips in flow cell 1 (Fci) and flow cell 2 (Fc2), respectively.
• rhPRG4 was injected at 30 pL/min for 8 min at concentrations of 300, 250, 200, 150, 100 and 50 mg/mL followed by a 10 min dissociation using 0.1M HEPES, 1.5M NaCl, 30mM EDTA, and 0.5% P20 (GE Life Sciences). The surface of the chip was regenerated at the end of each cycle with 1 min pulse of 3M MgCh. Each analyte concentration was injected in duplicate. The resulting curves were double referenced (i.e. FC2-FCI, followed by subtraction of the 0 pg/mL curve). The binding kinetics and binding affinity were determined by BiaEvaluation software, using 1 : 1 binding/conformational change model or by steady-state equilibrium, respectively.
• rhPRG4 was injected at concentrations ranging between 0 and 300 pg/mL as described above. Following the end of dissociation phase, HMW HA was injected at 50 pg/mL (30 pL per min) for 1 min. The double-referenced binding signals of rhPRG4 (at various concentrations) to CD44 were then plotted against the binding signals generated by HMW HA binding to CD44 following rhPRG4 injections.
• rhPRG4 displayed a concentration-dependent association with, and dissociation from immobilized CD44-IgGiFc (FIG. 2A), with an apparent Kd o 38 nM based on a rhPRG4 molecular weight of 240 KDa.
• rhPRG4 interfered with binding of HMW HA to recombinant CD44 as shown by an inverse relationship between the HMW HA binding signal intensity ( x-axis ) and the rhPRG4 binding signal intensity (y-axis ) (FIG. 2B).
• Lubricin s boundary lubricating ability is mediated by the O-linked (b ⁇ -3)
• Gal-GalNAc oligosaccharides (Jay et al, Glucoconj J 2001; 18(10):807-15).
• a combination of neuraminidase and beta 1,3, 6 galactosidase digestions reduced lubricin’s boundary lubricating ability by 50% (Jay et al, Glucoconj J 2001; 18(10):807-15).
• Lubricin isolated from RA SF samples contains increased core 1 glycosylation structures and displays the sulfated epitope that is proposed to be part of the L-selectin ligand (Estrella et al, Biochem J 2010; 429(2):359-67).
• lubricin from RA SF binds L-selectin in a glycosylation- dependent manner and coats polymorphonuclear granulocytes recruited to inflamed synovia and SF of patients with RA (Jin et al. JBiol Chem 2012; 287(43):35922-33).
• rhPRG4 was digested using sialidase A (Prozyme, USA), O-glycosidase (New
• sialidase A 12 pL of the enzyme (1U/200 pL) was added to rhPRG4 in a total reaction volume of 180 pL and a rhPRG4 final concentration of 300 pg/mL.
• O-glycosidase digestion 4.8 pL of the enzyme (40million units/mL) was added to rhPRG4 in a total reaction volume of 180 pL and a rhPRG4 final concentration of 300 pg/mL under non denaturing conditions.
• sialidase-A and O-glycosidase digestion the enzymes were used in volumes identical to the ones stated above and incubated with rhPRG4 in a total reaction volume and final rhPRG4 concentration as stated above.
• the effect of sialidase-A and O-glycosidase digestions on rhPRG4 apparent molecular weight was determined by SDS-PAGE using 4-12% Bis-Tris gel (NuPage, life technologies, USA). A total of 20 pL of rhPRG4 or enzyme-digested rhPRG4 was run under reducing conditions (200 mV for 60 min) followed by staining using Gelcode Blue Stain (Thermo Scientific, USA).
• Binding of enzymatically digested rhPRG4 to CD44 was compared to undigested rhPRG4 using the direct ELISA approach described above and using an rhPRG4 coating concentration of 30 pg/mL. Data represents the average of 4 independent experiments, each with triplicate wells per group.
• Sialidase-A digestion resulted in a significant increase (p ⁇ 0.001) in the percentage binding of rhPRG4 to CD44 compared to untreated control as shown in FIG. 3A.
• There was no significant difference in percentage CD44 binding between the sialidase-A digested and the O-glycosidase codigested rhPRG4 (p 0.105).
• the enhancement in CD44 binding indicates that neither the core 1 glycosylation nor the sialic acid terminal residues are required in rhPRG4 binding to CD44. Accordingly, the level of sialylation and core 1 glycosylations on rhPRG4 protein core are not essential to the PRG4’s ability to bind CD44. In contrast, removal of these residues may lead to a conformational change in the rhPRG4 semi-rigid rod shaped structure that results in enhanced interaction with CD44.
• CD44i-l and CD44i-2 pU6/CD44 RNA interference-2/CMV-EGFP expression vectors, abbreviated as CD44i-l and CD44i-2, containing the CD44 sequences
• the pCMV5B/CD44/FLAG expression vector was generated by a T4 DNA ligase (New England BioLabs, USA)-based ligation of a C-terminally FLAG tagged human open reading CD44 cDNA (CD44/FLAG) into the pCMV5B vector (Kavsak et al, Molecular Cell.
• CD44/FLAG DNA was generated by a polymerase chain reaction (PCR) using Pwo polymerase (Roche Diagnostics, USA), polyA-enriched cDNA as template, and 5’ CCCACGCGTACCATGGACAAGTTTTGGTGGC 3’, and 5’
• TCGTCGTCCTTGTAGTCCAGTCGACCCACCCCAATCTTCATGTCC 3’ were generated by subjecting MDA-MB- 231 cell TRIzol-(Ambion Life technologies, Canada) extracted mRNA to reverse
• RT reverse transcriptase
• Superscript II transcriptase Invitrogen, Canada
• primer oligo-(dT)12-18 Amersham Biosciences, UK
• CD44i-l/2, and CD44/FLAG plasmids were verified by DNA sequence analyses (University of Calgary Core Sequencing Facility).
• MDA-MB-231 cells were purchased from American Type Culture Collection
• Thermo Fisher, Canada Thermo Fisher, Canada.
• the cells were kept in 37°C in a 5% CO2 humidified cell incubator, and were routinely passaged every 3-4 days.
• the MDA-MB-231 cells were transfected using Lipofectamine 3000 reagents (Invitrogen, Canada).
• TGF human mature transforming growth factor beta
• R&D systems, USA; stock IOmM Low molecular weight hyaluronic acid
• LMWHA Low molecular weight hyaluronic acid
• Anti-PRG4 mAh 4D6 (Gift from Dr. Phillip Messersmith, University of California, Berkeley) (Abubacker et al, Connective Tissue Research. 2016;57(2): 113-23; Chawla et al., Acta biomater ialia. 2010;6(9):3388-94), Mouse Immunoglobulin G (Mouse IgG; Santa Cruz, USA), 4-methylumbelliferone (4-MU; Millipore-Sigma, Canada; stock 10 mM in DMSO).
• DIC differential interference contrast
• TRITC isothiocyanate
• the DNA binding dye bisbenzimide was used to detect nuclei.
• CD44 knockdown analysis the vector or CD44 shRNA transfected cells were identified by GFP signal. Immunofluorescence images were captured using an epifluorescence microscope with a 40X objective lens (Olympus Bx WI Confocal Microscope, Canada). Exposure times for laminin, actin, nuclei and GFP-specific signals were kept constant in each experiment. For each condition, 3 colonies/fields per experiment were captured, which were chosen as representative of the stained cells within each slide per experiments. Each experiment was repeated two independent times.
• MB-231 cells were used for the transwell invasion using polycarbonate filters (24-well insert, pore size 8 pm; BD Biosciences, Canada). Prior to addition of cells, each insert was placed within a well of a 24-well tissue culture plate and equilibrated with 0.5 mL serum-free DMEM, added both to the upper and lower chambers at 37°C for 2h. The equilibration media was then gently removed and upper chamber surface of the insert was coated with 50 pL of 3% Matrigel and allowed to solidify at 37°C for lh. 1X10 5 serum-starved MDA-MB-231 cells were resuspended in 0.5 mL of serum-free DMEM and added to the upper Matrigel- coated chamber.
• Lysates were boiled for 3 minutes at 95°C in dithiothreitol (DTT)-containing Laemmli sample buffer.
• DTT dithiothreitol
• lysates were incubated with appropriate antibodies at 4°C with gentle rocking for 3h after which immunocomplexes were incubated with Protein G- conjugated agarose beads (UBPBio,
• the blots were blocked using 5% skim milk followed by overnight incubation with mouse anti-actin (Santa Cruz, USA), rabbit anti-pSmad2 (Abeam, Canada), Mouse anti-Smad2/3 (Millipore-Sigma, Canada), rat anti- CD44 (Thermo Fisher, Canada), Mouse anti-HAS2 (Santa Cruz, USA) or Mouse anti-FLAG (Millipore-Sigma, Canada) as the primary antibody at 4°C.
• HRP-conjugated goat anti mouse or anti-rabbit IgG Jackson Laboratories, USA
• anti-rat IgG Millipore-Sigma, Canada
• HRP-conjugated goat anti mouse or anti-rabbit IgG Jackson Laboratories, USA
• anti-rat IgG Millipore-Sigma, Canada
• signal detection using a VersaDoc 5000 Imager Bio-Rad Laboratories. Densitometric analyses were performed using Quantity One software (Bio-Rad Laboratories, Canada).
• MDA-MB-231 cells were seeded in 24-well plates at approximately 6X10 4 cells/well one day prior to transfections. Cells were co-transfected with the PAI1 -promoter- driven firefly luciferase Reporter (3TP-Lux) and the CMV-Renilla luciferase control reporter constructs. 18h post transfection, cells were serum-starved (0.2% FBS containing DMEM) for 4h and then incubated in fresh low-serum (0.2% FBS containing DMEM) containing media in the absence or presence of 100 pM TGF , 100 pg/mL rhPRG4 alone or together and left overnight. Lysates were prepared and analyzed for luciferase activity using a
• Biochemical and organoid related data were subjected to statistical analysis by Student’s t-test or One-way analysis of variance (ANOVA) followed by Tukey-Kramer or Student-Newman-Keuls post hoc test using InStat (Graphpad, USA). Values of P ⁇ 0.05 were considered statistically significant. Data were presented graphically as mean ⁇ SEM from experiments that were repeated at least three independent times.
• EXAMPLE 2 rhPRG4 promotes anti-invasive growth of 3D-breast cancer cell-derived organoids
• TNBC MDA-MB-231 breast cancer cell line represents a widely used TNBC cell model for in vitro and in vivo cancer studies including in three-dimensional culture models
• TGF transforming growth factor b
• TGF extracellular matrix
• rhPRG4 acted in a dose-dependent manner to drastically repress TGF -induced invasiveness of 3D-breast cancer cell-derived organoids.
• the anti-PRG4 monoclonal antibody (mAh) 4D6 specifically recognizes PRG4 (Abubacker et al, Connective Tissue Res. 2016;57(2): 113-23; Chawla et al. Acta biomaterialia.
• PRG4 acts in a specific manner to preserve the non-invasive phenotypes of the TNBC-derived organoids even in the presence of TGF , raised the key question whether addition of PRG4 to the Matrigel prior to addition of isolated cells is sufficient to counteract TGF -induced invasive growth of breast cancer cell-derived organoids.
• applying rhPRG4 to the Matrigel even prior to the setting of the three-dimensional culture was sufficient to suppress TGF -induced invasive growth of the 3D-TNBC derived organoids ( Figures 4E, 4F).
• Basal lamina disruption and cortical to stress-fiber-like actin reorganization are two requisite factors for cells to become invasive ( Akhavan et al. , Cancer Res.
• TGF TGF disrupted basement membrane organization around the organoid as indicated by loss of the laminin ring surrounding the organoids, and promoted actin stress-fiber like appearance.
• These TGF effects are consistent with its ability to increase mobility and invasion of the cellular components of the 3D-MDA-MB-231 organoids (Dadakjujaev et al, Oncoscience. 2014;l(3):229-40, Chanda et al, Plos One, 2017: 12(5):e0177639).
• rhPRG4 promoted cortical actin organization and solid laminin ring formation in these multicellular structures in the absence or presence of TGF .
• TGF acted in a TpRI-signaling-dependent manner to promote the invasion of MDA-MB-231 cells as compared to untreated control ( Figures 5A, 5B).
• rhPRG4 blocked the ability of MDA-MB-231 cells to be invasive in the absence or presence of TGF .
• migration plays an important role in the ability of cancer cells to move to sites outside the primary tumor site for metastasis (Bendas et aI., Ih ⁇ . J. Cell Biol. 2012:676731).
• in vitro scratch assays were performed to test the effect of PRG4 on migratory behavior of the cancer cells.
• TGF led to significant induction of 3TP-Lux reporter activity ( Figure 6C, 6D).
• rhPRG4 did not alter TGF -induced 3TP-Lux reporter activity in MDA-MB-231 cells.
• rhPRG4 may act downstream of TGF -Smad-induced transcription to affect the biological processes of migration and invasion.
• EXAMPLE 5 rhPRG4 suppresses hyaluronan-induced invasion of breast cancer cells
• TGF can increase the abundance of hyaluronan synthase 2 (HAS2) enzyme that catalyzes the production and secretion of hyaluronan (HA), especially the low molecular weight hyaluronan (LMWHA) in the stroma (Misra et al. , Front. Immunol., 2015;6:201 ; Porsch et al. , Oncogene,
• HAS2 hyaluronan synthase 2
• TGF is suggested to increase the expression of the HA receptor CD44 on tumor cells (Li et al. , Int. J. Mol. Med. , 2015;36(1): 113-22).
• LMWHA associate with CD44, triggering the activation of specific signaling pathways that enhance invasion and metastatic ability of tumor cells (Meran et al. ,
• the 3D-MDA-MB-231 cells were left untreated or incubated with increasing concentrations of LMWHA either alone or in combination with rhPRG4.
• LMWHA acted in a dose-dependent manner to increase the proportion of invasive organoids, and as reflected by the decrease in the proportion of spherical organoids ( Figures 7B, 1C).
• rhPRG4 suppressed the ability of LMWHA to promote the invasive growth of breast cancer cell-derived organoids. Consistent with the results from the 3D- cultures, in transwell invasion assays, we found that LMWHA increased the proportion of invading cells ( Figures 7D, 7E).
• CD44 is crucial for TGFp-induced invasiveness in MDA-MB-231 cells
• RNA interference RNA interference
• shRNAs small hairpin RNAs
• CD44 immunofluorescence analysis of fixed MDA-MB-231 cells transfected with the RNAi control vector or a plasmid expressing CD44i-l/2 showed drastic CD44i-l/2-induced knockdown of endogenous CD44 ( Figure 8B).
• RT-PCR was used to amplify an open reading frame of CD44 cDNA from the MDA-MB-231 cells and was then subcloned into a CMV-based plasmid to express CD44/FLAG in MDA-MB-231 cells which was confirmed by CD44 and FLAG
• CD44/FLAG promoted invasive growth of the 3D-organoids even in the absence of TGFP or LMWHA.
• rhPRG4 suppressed the ability of overexpressed CD44 to promote invasive growth of MDA-MB-231 cell-derived organoids in the absence or presence of TGFP or LMWHA.
• EXAMPLE 7 HA-CD44 axis mediates TGFp-induced invasive growth of breast cancer cell-derived organoids
• EXAMPLE 8 HA-CD44 signaling axis is regulated by TGFp and PRG4
• HAS2 inhibitor 4-MU suppressed TGF -induced invasiveness of 3D- breast cancer cell-derived organoids suggested that TGF may regulate the production of HA in the MDA-MB-231 cells.
• TGF may regulate the production of HA in the MDA-MB-231 cells.
• HAS 1/2/3 isoforms HAS2 is the most prevalent enzyme in these MDA-MB-231 cells (Schwertfeger et al, Front Immunol. 2015;6:236).
• Immunoblotting analyses showed that TGF increased the protein abundance of HAS2 in MDA-MB-231 cells ( Figures 10D, 10E).
• rhPRG4 suppressed the protein abundance of HAS2 in the absence or presence of TGF .
• Examples 3-8 demonstrate the novel anti-migratory and anti-invasive roles for the mucin-like glycoprotein rhPRG4 in carcinoma cells derived from a patient with triple-negative breast cancer (TNBC).
• TNBC triple-negative breast cancer
• rhPRG4 preserves a non-invasive spherical morphology of these multicellular structures.
• Epistatic studies revealed that rhPRG4 acts downstream of TGF -Smad signaling to achieve its anti-migratory and anti-invasive effects.
• TGF plays a dual role in cancer initiation and progression (31, 46). At initial stages of neoplastic disease, evidence suggest that TGF acts as a tumor suppressor, while at the later stages of cancer, it can promote invasiveness and metastasis of different carcinomas including breast (Massague, Nat. Rev. Mol. Cell. Biol., 2012;13(10):616-30; Lebrun et al.,. ISRN Mol. Biol. 2012:381428). Thus, identifying ways to downregulate the tumor promoting role of TGF without affecting its tumor suppressive property may further control tumor growth.
• rhPRG4 suppresses TGF -induced invasive growth without affecting phosphorylation and the transcriptional activity of the receptor-regulated Smads (R- Smad, e.g. Smad2) raises the possibility that the ability of TGF to suppress tumor growth might be intact, which can be the subject of future investigations.
• That rhPRG4 anti-invasive actions on the MDA-MB-231 -derived organoids are mediated by blockade of a LMWHA- CD44 signaling axis may have in vivo relevance.
• enrichment of the cell surface glycoprotein CD44 in tumor cells including breast is correlated with invasive and metastatic characteristics of the cancer and hence poor prognosis (Zoller, Nat. Rev. Cancer,
• HA which is elevated in different carcinomas including breast cancer stroma (Auvinen et al., Am. J. Pathology, 2000;156(2):529-36) and blood serum (Wu et al, FASEB J, 2015;29(4): 1290-8; P eng et al, Inti. J. Cancer, 2016;138(10):2499-509) acts as a ligand for CD44.
• HA is generally classified as high molecular weight hyaluronic acid (HMWHA) and low molecular weight hyaluronic acid (LMWHA) Misra et al, Front.
• HMWHA high molecular weight hyaluronic acid
• LMWHA low molecular weight hyaluronic acid
• LMWHA-CD44 binding can trigger activation of distinct signaling pathways that ultimately promote cancer cell invasion, migration and proliferation ( Li et al., Int. J. Mol. Med., 2015;36(l): 113-22; Wobus et al., Appl Immunohistochem. Mol Morphol. , 2002;10(l):34-9; Nam et al, Cellular Signaling. 2015;27(9): 1882-94; Liu et al, Cancer Res.,
• LMWHA-CD44 clusters can act to induce remodeling of the stromal ECM at the invasive front of a tumor mass (Yu et al. , Genes & Development,
• rhPRG4 negatively affects HA-CD44-induced invasiveness of cancer cells is consistent with other studies suggesting that PRG4 antagonizes HA-CD44-mediated inflammatory signaling that induce synoviocyte proliferation in rheumatoid arthritis and osteoarthritis diseases and a number of inflammatory cytokine production in human and murine macrophages (Alquraini et al, Arthritis Research & Therapy. 2017;19(1):89; Al-Sharif et al, Arthritis Rheumatol.
• TGF promotes the expression of HAS enzymes, particularly HAS2, which results in the accumulation of high levels of HA in the ECM of breast cancer cells (Misra et al, Front. Immunol., 2015;6:201; Porsch et al. , Oncogene, 2013;32(37):4355-65).
• HAS HAS enzymes
• TGF has also been shown to promote the expression of CD44 in a Smad-dependent manner (Li et al., Int. J. Mol.
• rhPRG4 suppression of the ability of overexpressed CD44 to induce invasive growth of the MDA-MB-231 cell-derived organoids may involve reducing HA-CD44 binding, and/or by reduction of CD44 and HAS2 protein levels, as indicated by
• rhPRG4 can suppress TGF -induced invasion and migration of MDA-MB-231 TNBC cells in vitro, at least in part through suppression of the HA-CD44 signaling axis’ ability to mediate the TGF stimuli.
• Our findings demonstrate that rhPRG4 can antagonize TGF -induced increase in the protein abundance of CD44 and HAS2, which may explain its suppression of TGF -induced invasiveness of these cells.
• rhPRG4 also can inhibit LMWHA-induced invasiveness of these cells.
• EXAMPLE 10 Treatment of a human with triple negative breast cancer.
• a human female diagnosed with non-metastatic triple negative breast cancer is administered recombinant human PRG4 (rhPRG4) by local injection to the area of the tumor. Administration is done under local anesthesia. A total amount of 2 mL of rhPRG4 in physiological saline at a concentration of 100 ug/mL is administered via a 14 gauge needle. Several injections are made into the tumor and over its surface in order to disperse the dose throughout the tumor area. The dose is administered once weekly for four weeks. After four weeks, a CT scan reveals that the tumor has shrunk in size.
• EXAMPLE 11 Treatment of a human with prostate cancer.
• An 80kg human male diagnosed with colon cancer is administered recombinant human PRG4 (rhPRG4) by systemic administration via a central venous catheter.
• rhPRG4 recombinant human PRG4
• a total amount of 500 mg of rhPRG4 in 250 mL of physiological saline at a concentration of 2.0 mg/mL of lubricin is administered to create a blood concentration of approximately 100 pg/mL.
• the dose is administered once weekly for four weeks. After four weeks, a CT scan reveals that the tumor in the colon has decreased in size.
• EXAMPLE 12 Treatment of a human with triple negative breast cancer.
• a human female diagnosed with non-metastatic triple negative breast cancer is administered recombinant human PRG4 (rhPRG4) by local injection to the area of the tumor. Administration is done under local anesthesia. A total amount of 2 mL of rhPRG4 in physiological saline at a concentration of 100 ug/mL is administered via a 14 gauge needle. Several injections are made into the tumor and over its surface in order to disperse the dose throughout the tumor area. The dose is administered once weekly for four weeks. During the dosing rhPRG4 schedule, the patient also receives a cocktail of taxane and doxorubicin per standard protocols. After four weeks, a CT scan reveals that the tumor has shrunk in size and at a rate faster than in patients being treated solely with the taxane and doxorubicin.
• Hepatocellular carcinoma is one of most frequent and lethal neoplasms, and often proves refractory to currently employed therapies.
• Sorafenib and Regorafenib administration is among the preferential drug-based approaches to treat this cancer, overall it does not result in a satisfactory benefit.
• coupling these drugs with various other compounds to enhance their effectiveness is a promising strategy that is being increasingly pursued.
• lubricin PRG4
• PRG4 is expressed in HCC and more importantly that it is strongly correlated (p ⁇ 0.001) with increased survival of HCC patients.
• this example shows that non-synthetic physiologically -produced compound rhPRG4, alone or in combination with Sorafenib and Regorafenib, may act as an anti -tumor agent and be of value in the treatment of HCC.
• Hepatocellular carcinoma is among the most frequent causes of cancer- related death worldwide. As the majority of patients with HCC are not eligible for curative therapies, based on surgical approaches or radiofrequency ablation, systemic drug-based therapy is necessary. However, multi-year experience in the administration of compounds such as sorafenib and regorafenib has yielded disappointing results in terms of overall survival. (Kudo et al., Lancet 2018. doi: 10.1016/S0140-6736(18)30207-l; Brui x et al.
• CAFs may be phenotypically programmed by adjacent malignant cells and, in turn, enhance HCC cells proliferation and spread, likely through the deposition or secretion of different molecules including extra-cellular matrix (ECM) proteins (Mazzocca A et al, Hepatology 2011. doi: 10.1002/hep.24485; Mazzocca et al. , Hepatology 2010. doi: 10.1002/hep.23285).
• ECM extra-cellular matrix
• PGs glycoproteins like fibronectin, laminin, hyaluronan, elastin, and proteoglycans.
• The.Proteoglycans (PGs) are a class of heavily glycosylated high molecular weight proteins, that are widely expressed in all fibrotic tissue, in particular in the cartilage tissues, where they have a lubrication function, allowing sliding of the joints.
• PRGs such as versican (VCAN)
• TGFj-b transforming growth factor
• TGF has been widely reported to promote a more invasive and aggressive phenotype in HCC.
• this example investigates its role in a patient setting, as well as its function to limit the growth of HCC cells and to enhance the in vitro cell growth-inhibitory potential of sorafenib and regorafenib.
• HLE and HLF cell lines were purchased from JCRB Cell Bank (Japan). Hep3B and PLC/PRF/5 cell lines were purchased from ATCC (USA). All these cell lines were cultured in DMEM (Dulbecco's Modified Eagle Medium) supplemented with Sodium Pyruvate, antibiotic-antimycotic, Hepes and 10% fetal bovine serum (FBS) (Thermo Fisher Scientific). Full length recombinant human PRG4 (rhPRG4) was provided from Lubris Biopharma (Weston, MA, USA).
• DMEM Dulbecco's Modified Eagle Medium
• FBS fetal bovine serum
• rhPRG4 Full length recombinant human PRG4 (rhPRG4) was provided from Lubris Biopharma (Weston, MA, USA).
• Stable CD44 silencing HLE and HLF cell lines were transduced with lentiviral particles carrying control non-targeting (V), or specific CD44-targeting shRNA sequences (A to D), and selected with puromycin dihydrochloride (Thermo Fisher Scientific) to obtain stable CD44 silencing, according to manufacturer instructions (OriGene
• Control-shRNA sequence (V) and CD44- shRNA sequence B were used in all the experiments involving CD44 downregulation. CD44 silencing efficiency is shown in FIG. 20.
• Adhesion assay Diluted in 100 pi of serum free DMEM medium (+ 0.5% BSA), 50,000 cells, were seeded onto uncoated, rhPRG4, or fibronectin (FN)-coated wells of a 96-well plate, and then incubated at 37°C, 5% CO2 for 30 minutes. An equal volume of 4% PFA (pH 7.2 in PBS) was added and the plates were immediately flicked for a few seconds to allow mixing. Thirty minutes later, the medium was removed and the adherent cells were stained with crystal violet for 10 min.
• Trans-well migration assay The assay was performed as previously described. (Dituri et al., PLoS One 2013. doi: 10.1371/joumal.pone.0067109). Briefly,
• proteins were extracted using a tissue homogenizer. The lysates were incubated on ice for 30 min and vortexed every 10 min. Then, the samples were clarified through centrifugation at 13,000 rpm (at 4°C) for 20 min to precipitate insoluble debris. The supernatants (containing the extracted proteins) were assayed for protein concentration using Bradford Reagent (Bio-Rad). The proteins were then mixed with Laemmli buffer and 10% b-mercapto ethanol (BME), and denatured at 95°C for 5 min. Ten to 20 pg of total proteins were loaded onto 4-20% PAA gels and run in SDS-PAGE.
• BME b-mercapto ethanol
• RNA extraction and cDNA synthesis Thirty to 60 pg of frozen ex-vivo treated
• HCC tissues were ground with a mortar-pestle in the presence of liquid nitrogen until a thin powder was obtained.
• the ground tissues were lysed with 0.5-1 ml of RLT buffer + 1% (BME) and then processed according to the manufacturer's recommendations (RNeasy kit, Qiagen).
• RNA isolation from CAFs was performed following the procedure suggested by the RNeasy kit handbook. The obtained RNA was assayed for quality and concentration using the NanoDrop 2000/2000c (Thermo Fisher Scientific).
• cDNA was synthetized using the High Capacity cDNA reverse transcription kit (Thermo Fisher Scientific), according to relative datasheet.
• CAFs isolation Immediately after surgical resection, HCC tumoral and peritumoral specimens were minced into 0.5-1 cm pieces and left in MACS Tissue Storage Solution (Miltenyi Biotec). The tissues were then further cut into smaller size pieces (1-2 mm), washed three times in Hanks balanced salt solution (HBSS), and then incubated in HBSS in the presence of type IV collagenase (Thermo Fisher Scientific) and 3 mM CaCh at 37°C under gentle rotation for 4 hours. At the end of this step, the dissociation was mechanically facilitated by pipetting up-down the digested tissues with a large size orifice 50 ml pipette.
• the floating cells were collected and washed three times with HBSS and seeded in normal culture conditions in IMDM + 20% FBS.
• the decanted, partially digested tissue specimens were subjected to a second round of digestion (as previously described).
• the resulting dissociated cells were washed with HBSS and cultured in IMDM + 20% FBS.
• CAFs treatments and lubricin immunodepletion of CAFs conditioned medium CAFs were treated for 48 hours in the presence/absence of TGF i (Peprotech) at the final concentration of 5 ng/ml in complete IMDM medium (+ 20% FBS), then washed three times with serum-free medium, and incubated in serum-free medium for another 48 hours for secretome enrichment. The conditioned medium was then collected, concentered using a centricon device (3 kDa cut-off, Merck-Millipore), and incubated with anti-lubricin, or isotype antibody-bound PBS pre-washed magnetic microbeads, according to the
• HCC cell line PLC/DC/19
• the immunophenotypic characterization of cells was carried out after several ( ⁇ 10) culture passages, by using antibodies to detect sternness markers (OV6, CD133, CD44 and CD90), epithelial markers (AFP, E-Cadh, EpCAM), mesenchymal markers (Vim, N-Cadh, aSMA), and other cancer- related surface proteins (CD13, CD151) (FIG. 21).
• Microarray analysis M i croarray analysis was performed as already described (gut 2016). Briefly, using Trizol (Invitrogen, Carlsbad, CA, USA), total RNA was isolated from non-tumoral (NT) and tumoral (T) liver tissues obtained in a cohort of prospectively enrolled patients at first identification of HCC. RNA was processed using 4x44K whole genome oligonucleotide-based gene expression microarrays (Agilent Technologies, Palo Alto, CA; Genomics Service Department of Miltenyi Biotec GmbH Bergisch Gladbach, Germany). Labeling and hybridization procedures were performed according to the instructions provided by Agilent, using the Quick Amp Labeling Kit and the One Color Microarray-Based Gene Expression Analysis Protocol.
• RNA conversion into cDNA After RNA conversion into cDNA, during a labeling and amplification step cDNA was converted into cRNA and labeled with Cy3-CTP. Once purified, cRNA were hybridized to Agilent Whole Human Genome Oligo Microarrays 4x44K. After quantification of the signal and normalization of the results using a linear lowness method, data were imported into Resolver software (Rosetta Biosoftware, Kirkland, WA) for database management, quality control, and analysis. The gene expression data are available at the Gene Expression Omnibus website (www.ncbi.nlm.nih.gov/geo) under accession number: GSE54236.
• PRGs expression levels in tumoral tissues ofHCC patients We analyzed the expression levels of different PRGs including Chondroitin Sulfate Proteoglycan 4 (CSPG4), Perlecan (HSPG2), Versican (VC AN) and lubricin (PRG4) in a cohort of 78 prospectively recruited HCC patients, coupled with matched microarray gene expression analysis of paired tumoral and peritumoral tissues from the same subjects. Patients were stratified according to mRNA expression levels of each PRG above or below the median values. Expression values of genes of interest in tumors were subtracted from the values in peritumoral tissues to obtain the net gene expression changes, normalized to the background peritumoral expression of the same genes, as previously reported.
• CSPG4 Chondroitin Sulfate Proteoglycan 4
• HSPG2 Perlecan
• VC AN Versican
• PRG4 lubricin
• this example shows that lubricin is expressed in HCC tissues, and high levels are correlated with longer survival.
• Lubricin is present in HCC tumoral and peritumoral tissues and is expressed under TGFb stimulation
• TGFb TGFb stimulation
• western blotting we investigated the presence of lubricin protein in two normal livers and in 14 tumoral and paired surrounding non-cancerous specimens from HCC patients. Then, we also compared the amount of lubricin in the different specimens. As reported in FIG. 14A, the protein expression levels of lubricin were similar among normal liver, tumoral and peritumoral tissues, although highly variable among different samples. This suggests that the amount of lubricin protein expression is not an epiphenomenon related to tumor development but rather to a unique feature of individual tumoral or peritumoral tissue microenvironments.
• LY2157299 (galunisertib), or both, for 48 hours and then analyzed the PRG4 mRNA expression.
• TGF significantly enhanced the expression of lubricin in both CAFs (p ⁇ 0.01) and in HCC samples (p ⁇ 0.05), whereas LY2157299 offset this effect (p ⁇ 0.01).
• LY2157299 also downregulated the expression of lubricin in comparison to controls. This probably depends, at least partially, on the blockade of the endogenous TGF pathway exerted by this drug.
• TGF myofibroblast phenotype of CAFs was increased by TGF (as shown by the enhanced aSMA expression).
• TGF also significantly increased the expression levels of HSPG2 and VCAN in HCC cultured tissues (p ⁇ 0.05 and p ⁇ 0.01, respectively), and VCAN but not HSPG2 in CAFs, suggesting that CSPG4 expression is not regulated by TGF , and that HSPG2 may be produced in HCC under the control of this cytokine by cells other than CAFs (FIG. 15).
• Lubricin is correlated with a better prognosis in HCC patients with lower
• CD44 expression To investigate the clinical role of the previously described associations, we stratified the patients according to higher or lower expression levels of lubricin and other related genes in relation to tumor aggressiveness and overall survival. Transcriptomic analysis of lubricin in the tumor demonstrated that lower expression levels were associated with higher biological aggressiveness of the tumor (aggressive vs. bland tumors: 11.1 ⁇ 3.0 vs. 13.4 ⁇ 1.6, p ⁇ 0001). While the increased lubricin expression was significantly (p ⁇ 0.001) correlated to a beher prognosis in patients with lower CD44 expression, TGF , CD44 and aSMA expression levels were not associated with any clinical outcome.
• Lubricin inhibits adhesion and migration ofHCC cells To understand how lubricin improves overall survival in HCC patients, and in particular in those with CD44 expression levels below the median value (FIGS. 13 and 16), we investigated whether rhPRG4 affects some key features required for HCC cell aggressiveness, namely adhesion and migration and whether, in turn, the expression of CD44 is implicated. HLE and HLF are two strongly CD44 positive invasive HCC cell lines (as described below, FIG. 18). Adhesion to lubricin is impaired upon silencing of CD44 expression, as regards the adhesion to fibronectin (FIG. 17A).
• soluble rhPRG4 (25 pg/ml) impairs the migration of the same cells on fibronectin, while CD44 downregulation does not affect motility (FIG. 17B). This suggests that the lubricin expressed in the HCC microenvironment might more efficiently saturate CD44 receptor, when it is less expressed, and that other lubricin receptors are likely involved, other than CD44, in limiting cell migration and invasion.
• CD44/lubricin axis boosts Sorafenib and Regorafenib effectiveness on
• HCC cells To explore in further detail the biological role of the lubricin/CD44 axis, we challenged HLE, HLF and PLC/DC/19 HCC CD44 positive cells and Hep3B and PLC/PRF5 HCC CD44 negative cells with Sorafenib and Regorafenib in the presence/absence of rhPRG4. All HCC cells were grown for 72 hours in the presence/absence of rhPRG4 and Sorafenib or Regorafenib at a concentration (2.5 mM) lower than the IC50 ( ⁇ 5 mM) under the same experimental conditions.
• rhPRG4 alone did not markedly impair the cell proliferation but, when coupled with Sorafenib or Regorafenib, it strongly and synergistically improved their effectiveness on HLE, HLF and PLC/DC/19 cells, at concentrations spanning from 12.5 to 100 pg/ml.
• the rhPRG4-drug synergistic effect was present during Hep3B proliferation, even if lower than that obtained with HLE, HLF and PLC/DC/19 cells, but only at the highest rhPRG4 concentrations. Instead, PLC/PRF5 cells did not respond at all (FIG. 18).
• CAFs conditioned medium stimulated by TGlf increases Sorafenib and Regorafenib effectiveness via lubricin secretion.
• TGF stimulates CAFs that secrete lubricin, improving the drug effectiveness of both Sorafenib and Regorafenib on HCC cells.
• FIG. 19B CAFs were incubated with TGF in complete medium for 48 hours and in starving condition (serum free) for additional 48 hours (without TGF ) to allow the enrichment of secreted proteins pull.
• the conditioned medium was then collected, incubated with isotype, or anti-lubricin antibody, assayed for protein concentration, and used to challenge HCC cells to proliferate in the presence of 1.5 mM sorafenib and regorafenib and/or 20 pg/ml lubricin-depleted or not-depleted conditioned medium (CM) from TGF -stimulated CAFs.
• CM pg/ml lubricin-depleted or not-depleted conditioned medium
• the conditioned medium from TGF -stimulated CAFs significantly (p ⁇ 0.01) increased Sorafenib and Regorafenib effectiveness on HLF cells as compared to lubricin-depleted conditioned medium (FIG. 19B). This suggests that the CD44/lubricin axis enhances the drug effectiveness of Sorafenib and Regorafenib.
• cancer cells have always been considered the only reliable therapeutic target, with the few exceptions of those drugs directed against immunological check-points, although the results in terms of clinical outcomes are often unsatisfactory, as in the case of HCC.
• the cells grow in, and penetrate through, the surrounding tissue derived from the chronic liver disease, that has a rich content of ECM proteins, inflammatory cells and CAFs.
• ECM proteins e.g., ECM proteins
• CAFs e.g., lubricin, a glycoprotein belonging to the PG family, so far known to be present at the cartilage sites of the joints, is expressed in the liver.
• lubricin a glycoprotein belonging to the PG family, so far known to be present at the cartilage sites of the joints, is expressed in the liver.
• its expression is positively correlated to longer survival in a cohort of 78 patients followed up over five years (REF Villa, GUT).
• CD44 is a sternness marker in HCC, and its expression has been reported to be induced by TGF (Fernando et al., Int J Cancer 2015. doi: 10.1002/ijc.29097) and, consistently, inhibited by a TGF inhibitor (Rani et al.Cell Death Dis 2018.
• hyperlipidemic mouse models already predisposed to atherosclerosis development namely apolipoprotein E knockout (ApoE KO) mice and low-density lipoprotein receptor knockout (Ldlr KO) mice (Nahon et al., Atherosclerosis. 2018.
• TGF-b signaling Reduced expression of TGF-b signaling is associated with age-related osteoarthritis in humans.
• lubricin has proven effective to prevent the onset of this disease, due to its joints lubrication function (Chavez et al, PLoS One 2019. doi: 10.1371/joumal. pone.0210601).
• TGF signaling can affect CD44 expression/activation, and was shown to rely on CD44 functions to promote cancerous invasion. It has also been demonstrated that TGF up-regulates the expression of the CD44 cancer-related CD44V6 isoform through EGR1- mediated AP-1 (activator protein-1) activation in pulmonary fibroblasts (Ghatak et al, J Biol Chem 2017.
• CD44 inhibition may be coupled with rhPRG4 administration in high CD44 expression HCCs.
• potency of sorafenib and regorafenib may be greatly enhanced by a synergic administration with rhPRG4.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Organic Chemistry (AREA)
• Immunology (AREA)
• Epidemiology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Oncology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Genetics & Genomics (AREA)
• Gastroenterology & Hepatology (AREA)
• Zoology (AREA)
• Marine Sciences & Fisheries (AREA)
• Microbiology (AREA)
• Mycology (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Peptides Or Proteins (AREA)

Priority Applications (4)

Applications Claiming Priority (4)

Publications (1)

Family

ID=73652433

Family Applications (1)

Country Status (5)

Cited By (2)

Families Citing this family (1)

Citations (3)

• 2020
  • 2020-06-03 JP JP2021570319A patent/JP2022534724A/ja active Pending
  • 2020-06-03 EP EP20818641.1A patent/EP3976085A4/en not_active Withdrawn
  • 2020-06-03 WO PCT/US2020/035841 patent/WO2020247440A1/en not_active Ceased
  • 2020-06-03 CN CN202080049571.8A patent/CN114173805A/zh active Pending
  • 2020-06-03 US US17/596,066 patent/US20220332839A1/en not_active Abandoned

Patent Citations (3)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events