WO2020242376A1

WO2020242376A1 - Method of treating a sall4-expressing cancer

Info

Publication number: WO2020242376A1
Application number: PCT/SG2020/050296
Authority: WO
Inventors: Lee Hong Justin TAN; Wai Leong Tam; Yoganathan S/O KANAGASUNDARAM; Siew Bee NG; Daniel Geoffrey TENEN; Li Chai
Original assignee: Agency For Science, Technology And Research; National University Of Singapore; Brigham & Women's Hospital
Priority date: 2019-05-28
Filing date: 2020-05-19
Publication date: 2020-12-03

Abstract

The present disclosure relates generally to the field of oncology. In particular, the invention discloses a method of treating a Sal-like protein 4 (SALL4) expressing cancer in a subject, the method comprising administering an inhibitor of mitochondrial oxidative phosphorylation (OXPHOS) for a sufficient time and under conditions to treat the subject of the SALL4 expressing cancer. Examples of the OXPHOS inhibitors include Oligomycin, Efrapeptin, Antimycin, Leucinostatin and PI-103.

Description

METHOD OF TREATING A SALL4-EXPRESSING CANCER

FIELD

The present disclosure relates generally to the field of oncology. In particular, the invention discloses a method of treating a Sal-like protein 4 (SALL4) expressing cancer in a subject.

BACKGROUND

Transcription factors are the second largest class of oncogenes, following enzymes. However, the molecular mechanisms by which these transcription factors exert their cancer-driving effects are not well understood. There is renewed interest in phenotypic cell-based screens for studying the underlying mechanisms of various diseases, aiding in subsequent drug discovery. Common methods for cell-based drug discovery include the screening of endogenous cell lines with and without the gene or mutation of interest, or the use of isogenic cell line systems in which the gene of interest is altered or expressed in an unaffected cell to control for genetic background. In both endogenous and isogenic systems, hits are defined by their ability to selectively target cells expressing the alteration of interest, while not affecting the control cells. The disadvantage of the endogenous system is that cell lines are genetically distinct, so the hits obtained may target pathways unrelated to the alteration of interest. The isogenic system avoids the genetic complexity of the endogenous system, but suffers the drawback of compound interference with the transgene, resulting in hits that might not be biologically relevant.

Liver cancer is the sixth most common cancer but is the second leading cause of cancer deaths worldwide owing to limited therapeutic interventions. HCC is the predominant subtype of liver cancer, with 85% of liver cancer patients suffering from HCC. The high mortality in HCC is due to a lack of effective treatment options since HCC tumor biology is complex and not well understood. The only approved targeted therapies for treating HCC, kinase inhibitors Sorafenib and Regorafenib, target tumor vasculature, but they are largely ineffective and are frequently used as a last resort. There is an increased urgency to discover and develop precision medicine interventions for this unmet need.

Accordingly, there is a need to overcome, or at least to alleviate, one or more of the above- mentioned problems.

SUMMARY OF THE INVENTION

In one aspect, there is provided a method of treating a Sal-like protein 4 (SALL4) expressing cancer in a subject, the method comprising administering an inhibitor of mitochondrial oxidative phosphorylation (OXPHOS) for a sufficient time and under conditions to treat the subject of the SALL4 expressing cancer.

In one aspect, there is provided a method of inhibiting proliferation of a SALL4 expressing cancer cell, the method comprising contacting the cancer cell with an inhibitor of mitochondrial oxidative phosphorylation for a sufficient time and under conditions to inhibit proliferation of the SALL4 expressing cancer cell.

In one aspect, there is provided an inhibitor of mitochondrial oxidative phosphorylation for use in treating a SALL4 expressing cancer in a subject.

In one aspect, there is provided the use of an inhibitor of mitochondrial oxidative phosphorylation in the manufacture of a medicament for treating a SALL4 expressing cancer in a subject.

In one aspect, there is provided a method of detecting and treating a SALL4 expressing cancer in a subject, the method comprising the steps of:

a) detecting SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates the presence of a SALL4 expressing cancer in the subject; and

b) administering an inhibitor of mitochondrial oxidative phosphorylation to the subject found to have a SALL4 expressing cancer.

In one aspect, there is provided a method of treating a SALL4 expressing cancer in a subject, the method comprising the steps of:

b) administering an inhibitor of mitochondrial oxidative phosphorylation to the subject found to have a SALL4 expressing cancer. BRIEF DESCRIPTION OF THE DRAWINGS

Some embodiments of the present invention will now be described by way of non-limiting example only, with reference to the accompanying drawings in which:

Figure. 1 A chemical genetic cell-based screen to identify compounds targeting SALL4 dependencies. (A) Schematic of screen involving the use of endogenous SALL4¹⁰ and SALL4^hl HCC lines and engineered isogenic SALL4 expressing lines. (B) Venn diagram illustrating overlap of hit compounds, from both small molecule and natural product extract libraries, which selectively decrease cell viability of the SALL4^hl lines over their respective SALL4¹⁰ controls. (C) Workflow of natural product extract screen to identify individual compound hits from extracts containing multiple chemical entities.

Figure. 2. SALL4-dependent cells are susceptible to mitochondrial oxidative phosphorylation inhibitors. (A) Cell viability dose-response curves for cells treated for 96 hrs with hit compounds from the natural product extract screen, Oligomycin, Efrapeptin, Antimycin, and Leucinostatin, measured with CellTiter-Glo reagent and normalized to untreated cell viability (mean of 3 replicates ± SD). (B) Diagram indicating oxidative phosphorylation targets of validated hit compounds.

Figure. 3. Oligomycin A suppresses SALL4-dependent HCC. (A) Cell viability dose- response curves for a panel of HCC cell lines treated with Oligomycin A for 72 hrs, measured with CellTiter-Glo reagent and normalized to untreated cell viability (mean of 3 replicates ± SD). (B) Tumor size plot of SALL4-high SNU-398 mouse xenografts injected (intraperitoneal) with vehicle, sorafenib, or oligomycin A (mean ± SD). (C) Plot of tumor size at day 13 of the xenograft experiments in (B) (mean ± SD). (D) Tumor size plot of SALL4-high PDX HCC26.1 mouse xenografts injected (intraperitoneal) with vehicle, sorafenib, oligomycin A, or a combination of 20 mg/kg sorafenib and 0.1 mg/kg oligomycin (mean ± SD). (E) Plot of tumor size at day 25 of the xenograft experiments in (D) (mean ± SD). (F) Tumor size plot of SALL4-low PDX1 mouse xenografts injected (intraperitoneal) with vehicle or oligomycin A (mean ± SD). (G) Plot of tumor size at day 32 of the xenograft experiments in (F) (mean ± SD). (H-J) Mouse weight quantification plot from the respective mouse xenograft experiments in (B-G) (mean ± SD). Figure. 4. SALL4 binds and upregulates oxidative phosphorylation gene expression (A)

Venn diagram of mitochondrial genes from the MitoCarta 2.0 dataset bound by SALL4 from a prior SALL4 ChIP-seq experiment performed on SNU-398 cells. Selected significant pathways from Gene Ontology analysis of the SALL4 bound genes are shown. (B) ChIP-seq region plots of the SALL4 bound mitochondrial genes in (A), representing the regions bound by SALL4 and marked by H3K27ac in SNU-398 cells (from analysis of prior data), -3 kb upstream of the transcription start site (TSS) and +3 kb downstream of the transcription end site (TES). (C) Representative ChIP-seq input, H3K27ac, and SALL4 peaks for control gene SUMOl and electron transport chain genes ATP5D, ATP5E, and NDUFA3. (D) RNA-seq expression level fold change for a panel of mitochondrial genes from the SALL4 bound list in (A), in the SALL4 expressing cell lines, normalized to expression levels in the empty vector control, performed in singlet. (E) Western blots for SALL4-bound oxidative phosphorylation genes and ACTB loading control in the cell lines used in the screen. Bands were quantified by densitometry with SNU- 387 and EV bands as references. (F) Western blots for the genes in (E) with SALL4 knockdown for 72 hrs in the SNU-398 cell line. Bands were quantified by densitometry with sh-scr bands as reference.

Figure. 5. SALL4 expression upregulates oxidative phosphorylation(A) OCR measurements of SALL4 endogenous and isogenic lines used in the screen, normalized to DNA content measured by CyQUANT reagent (mean of 3 replicates ± SD). (B) OCR measurements for SALL4 knockdown in SNU-398 endogenous SALL4-high cells, normalized to DNA content measured by CyQUANT reagent (mean of 3 replicates ± SD). (C) Representative images of SALL4 endogenous and isogenic cell lines stained with DAPI nuclear dye, Mitotracker Red mitochondrial membrane potential dye, and immunostained with cytochrome c antibody. Scale bars are 20 pm in length. (D) Quantification of cytochrome c fluorescence signal per cell, normalized to DAPI signal (median, quartile and range). (E) Quantification of MitoTracker fluorescence signal per cell, normalized to DAPI signal (median, quartile and range). (F) ATP levels per DNA content for the SALL4 isogenic cell lines measured by CellTiter-Glo ATP detection reagent values normalized to CyQUANT DNA quantification reagent values (mean of 3 replicates ± SD). (G) NADH/NAD+ values measured by HPLC-mass spectrometry metabolite profiling of the SALL4 isogenic cell lines (mean of 3 replicates ± SD). Figure. 6. SALL4 isogenic cell lines are dependent on SALL4 for cell viability. (A) SALL4 mRNA expression in SALL4 endogenous cell lines used in the screen, measured by qRT-PCR and normalized to ACTB (mean of 4 replicates ± SD). (B) SALL4 mRNA expression in SNU-387 isogenic empty vector, SALL4A, and SALL4B expressing cell lines used in the screen, measured by qRT-PCR and normalized to ACTB (mean of 2 replicates ± SD). (C) Western blot of SALL4 protein in the SALL4 endogenous cell lines, with ACTB loading control. Bands were quantified by densitometry with SNU-387 bands as reference. (D) Western blot of SALL4 protein isoforms and SALL4 knockdown validation in the isogenic cell lines, with ACTB loading control. Bands were quantified by densitometry with sh-scr bands as reference. (E) MTT oxidoreductase- dependent cell viability assay on SALL4 isogenic cell lines with SALL4 knockdown, normalized to day 5 sh-scr scrambled control (mean of 3 replicates ± SD). (F) Cell counts of SALL4- expressing isogenic cell lines over 10 days (mean of 3 replicates ± SD). (G) EdU incorporation, during DNA synthesis, measurements for the percentage of EdU labeled cells after 3 hrs of treatment for the SALL4-expressing isogenic cell lines (performed in singlet).

Figure. 7. Natural product and small molecule screening hits. (A) Cell viability fold change plots of control compounds obtained from the pilot screen and used for the complete screen, measured with CellTiter-Glo cell viability reagent, and normalized to DMSO-treated cell viability (mean of 3 replicates ± SD). (B) Cell viability dose-response curves for cells treated for 96 hrs with synthetic compound hit PI- 103, measured with CellTiter-Glo and CyQUANT reagents and normalized to untreated cell viability (mean of 3 replicates ± SD). (C) Cell viability dose-response curves for cells treated for 96 hrs with hit compounds from the natural product extract screen, Oligomycin, Efrapeptin, Antimycin, and Leucinostatin, measured with CyQUANT reagent and normalized to untreated cell viability (mean of 3 replicates ± SD). (D) Western blot for apoptosis marker cleaved caspase-3 and control total caspase-3 protein levels in Oligomycin A-treated SNU-398 cells. Bands were quantified by densitometry with DMSO bands as reference.

Figure. 8. Oligomycin A suppresses SALL4-dependent tumorigenesis. (A) SALL4 mRNA expression in HCC cell lines with respect to immortalized normal liver cell line THLE-3 SALL4 transcript levels, measured by qRT-PCR and normalized to 18S rRNA (mean of 3 replicates ± SD). Oligomycin A IC50 values from dose response curves in Fig. 3A are detailed above the bar graphs for corresponding cell lines. (B) SALL4 mRNA expression in a pair of SALL4^hl and SALL4¹⁰ NSCLC cell lines with respect to immortalized normal liver cell line THLE-3 SALL4 transcript levels, measured by qRT-PCR and normalized to 18S rRNA(mean of 2 replicates ± SD). Oligomycin A IC50 values from dose response curves in Fig. 8C are detailed above the bar graphs for corresponding cell lines. (C) Cell viability dose-response curves for lung cancer cell lines in (B) treated with Oligomycin A, measured with CellTiter-Glo reagent and normalized to untreated cell viability (mean of 3 replicates ± SD). (D) Tumor images from the SNU-398 mouse xenograft experiment in Fig. 3C. (E) Tumor images from the HCC26.1 mouse patient-derived xenograft experiment in Fig. 3E. (F) SALL4 immunohistochemistry on a PDX1 tumor section and a SALL4 positive control tumor section. (G) Tumor images from the PDX1 mouse patient- derived xenograft experiment in Fig. 3G. Four tumors were excised on day 32 as their size reached the designated animal protocol endpoint while the remaining mice continued drug treatment till day 36, when all remaining tumors reached the endpoint. (H) Open field test conducted on mice injected with vehicle (n=6) and 0.1 mg/kg Oligomycin A (n=6) over 3 weeks (mean ± SD). (I) Grip strength test conducted on the mice in (H) (mean ± SD). (J) Rotarod test conducted on the mice in (H) (mean ± SD). (K) HCC patient stratification by SALL4 expression and diabetics. Numbers above bar graphs indicate absolute patient numbers. (L) Cell viability dose-response curves for cells treated for 96 hrs with Phenformin or Oligomycin A, measured with CCK-8 dehydrogenase activity assay and normalized to untreated cell viability (mean of 3 replicates ± SD).

Figure. 9. SALL4 expression upregulates oxidative phosphorylation gene expression. (A)

RNA-seq expression level fold change for SALL4, in the SNU-398 SALL4 knockdown and isogenic SALL4 expressing cell lines, normalized respectively to expression levels in the SNU- 398 input and SNU-387 empty vector control cell line, performed in singlet. (B) RNA-seq expression level fold change for a panel of mitochondrial genes from Fig. 4D with SALL4 knockdown in the SNU-398 cells, normalized to expression levels in the SNU-398 control, performed in singlet. (C) mRNA expression validation of selected mitochondrial genes in the SALL4 expressing isogenic cell lines used in the screen, measured by qRT-PCR and normalized to 18S rRNA (mean of 3 replicates ± SD). (D) mRNA expression validation of the mitochondrial genes from (C) with SALL4 knockdown for 72 hrs in the SNU-398 cell line, measured by qRT- PCR and normalized to 18S rRNA (mean of 2 replicates ± SD). (E) GSEA plots for oxidative phosphorylation from analysis of the RNA-seq data set in (A). (F) Western blots for SALL4- bound mitochondrial genes and ACTB loading control in the cell lines used in the screen. Bands were quantified by densitometry with SNU-387 and EV bands as references. (G) Western blots for the genes in (F) in the SNU-398 cell line 72 hours after SALL4 knockdown. Bands were quantified by densitometry with sh-scr bands as reference.

Figure. 10. Oxidative phosphorylation and glycolysis metabolite changes induced by SALL expression. (A) Metabolite Set Enrichment Analysis (MSEA) of significantly altered metabolites (1.3 fold change, P < 0.05) in the SNU-387 Tg:SALL4A cells compared to empty vector control. (B) MSEA of significantly altered metabolites (1.3 fold change, P < 0.05) in the SNU-387 Tg. SALLAB cells compared to empty vector control. (C) Fold change of malate- aspartate shuttle metabolites in the SALL4-expressing isogenic lines normalized to empty vector control (mean of 3 replicates ± SD). (D) Fold change of glycolytic metabolites in the SALL4- expressing isogenic lines normalized to empty vector control (mean of 3 replicates ± SD). (E) L- lactate measurements, utilizing a lactate dehydrogenase enzymatic assay, in the SALL4 isogenic cell lines and no enzyme controls, normalized by cell number (mean of 2 replicates ± SD). (F) Extracellular acidification rate (ECAR) measurements per DNA content in the SALL4 isogenic lines, normalized to CyQUANT DNA quantification reagent values (mean of 3 replicates ± SD). (G) Glycolysis stress test assessing ECAR when cells are treated with glucose post starvation, ATP synthase inhibitor Oligomycin, and glycolysis inhibitor 2-Deoxy-D-glucose that quantifies glycolytic flux and glycolytic capacity, performed on the SALL4-expressing isogenic lines (mean of 3 replicates ± SD).

Figure 11: SALL4 does not directly regulate the Urea cycle and increases mtDNA copy number. (A) Fold change of urea cycle metabolites in the SALL4 -expressing isogenic lines normalized to empty vector control (mean of 3 replicates ± SD). (B) Representative ChIP-seq input, H3K27ac, and SALL4 peaks for urea cycle genes. (C) mtDNA quantification with primers to the Minor Arc, ND1 and ND4 genes in SALL4 endogenous and isogenic cell lines used in the screen, measured by qRT-PCR and normalized to B2M (mean of 3 replicates ± SD). (D) mRNA expression of mitochondrial biogenesis genes in the SALL4 expressing isogenic cell lines used in the screen, measured by qRT-PCR and normalized to 18S rRNA (mean of 3 replicates ± SD). (E) Representative ChIP-seq input, H3K27ac, and SALL4 peaks for the mitochondrial biogenesis genes in (D).

Figure 12: The chemical structures of some examples of oxidative phosphorylation inhibitors are shown. DETAILED DESCRIPTION

The present disclosure teaches a method of treating a cancer, in particular a SALL4 expressing cancer. In one aspect, there is provided a method of treating a SALL4 expressing cancer in a subject, the method comprising administering an inhibitor of mitochondrial oxidative phosphorylation (OXPHOS) for a sufficient time and under conditions to treat the subject of the SALL4 expressing cancer.

Without being bound by theory, SALL4 (Spalt- like transcription factor 4 or Sal-like protein 4) is an oncofetal protein that is essential for self-renewal and maintaining pluripotency in embryonic stem cells, and plays a critical role in early embryonic development as reviewed. It is subsequently silenced in most adult tissues, but aberrantly re-expressed to drive tumorigenesis in various cancers. In particular, SALL4 is highly expressed in fetal liver but is silenced in the adult liver, and often reactivated in HCC, in which 30-50% of tumours show significant SALL4 expression. There are two isoforms of SALL4 ( SALL4A and SALL4B ) that have overlapping but not identical binding regions in the genome, and SALL4B alone can maintain pluripotency. Both isoforms are derived from the same transcript, where SALL4A is the full length spliceoform and SALL4B lacks part of exon 2. It has been observed that these both SALL4 isoforms are co expressed when SALL4 is transcriptionally upregulated. SALL4 is a C2H2 zinc-finger transcription factor that can act both as a transcriptional activator or repressor. The repressive function of SALL4 is achieved through recruitment of the Nucleosome Remodelling and Deacetylase complex (NuRD). In cancer, SALL4 recruits NuRD to genes such as the PTEN tumour suppressor, deacetylating and silencing the locus. The transcriptional activation function of SALL4 also plays a role in cancer. SALL4 has been shown to transcriptionally activate the c- MYC oncogene in endometrial cancer and HOXA9 in acute myeloid leukemia. The in vivo tumorigenic potential of SALL4 is reflected in a mouse model of constitutive SALL4B expression, which results in the onset of acute myeloid leukemia (AML) and HCC. However, therapeutic interventions that target SALL4 and its dependencies remain elusive.

The inventors have developed a screening platform that encompasses both endogenous and isogenic methodologies, applying the platform to discover drugs targeting oncogene SALL4- induced dependencies in hepatocellular carcinoma (HCC). The platform utilizes an endogenous pair of SALL4-expressing (SALL4^hl) and SALL4 undetectable (SALL4¹⁰) HCC cell lines, as well as isogenic SALL4 undetectable cell lines engineered to express SALL4 isoforms. The inventors screened both synthetic and diverse natural product extract libraries to identify hit compounds that specifically decrease SALL4^hl cell viability. Unexpectedly, a stringent screen identified 4 oxidative phosphorylation inhibitors as being selective for SALL4^hl cells. The most potent and selective compound, ATP synthase Oligomycin, was able to selectively target a panel of SALL4^hl HCC and lung cancer cell lines, over SALL4¹⁰ cells. Oligomycin also demonstrated similar in vivo tumor suppressive activity as HCC standard-of-care drug Sorafenib, but at a 200 times lower dose. This in vivo efficacy is only observed in SALL4-high and not SALL4-low tumors. Analysis of SALL4 ChIP-seq data revealed SALL4 binding to a significant number of oxidative phosphorylation genes in SALL4^hl HCC. SALL4 predominantly upregulates expression of these genes, as revealed by RNA-seq, mRNA expression and protein analyses. SALL4 expression could also functionally increase oxidative phosphorylation, as measured by cellular oxygen consumption rate, and supported by imaging and metabolite profiling. The work demonstrates the ability of endogenous-isogenic combination cell-based screening methodology to successfully identify a metabolic pathway vulnerability, which is therapeutically actionable with a good therapeutic index, in SALL4-expressing cancers.

The inhibitor of mitochondrial oxidative phosphorylation may be a pharmaceutically acceptable salt, solvate or prodrug thereof.

As used herein, the inhibitor of mitochondrial oxidative phosphorylation may refer to inhibitors that block the process of formation of ATP in the mitochondria. Oxidative phosphorylation (or OXPHOS in short) is the metabolic pathway in which the mitochondria in cells use their structure, enzymes, and energy released by the oxidation of nutrients to move hydrogen from ADP to phosphate to reform ATP. The“oxidative phosphorylation inhibitor” can inhibit any one of the many enzymes in the electron transport chain, because inhibition of any step in this process will halt the rest of the process. For example, if oligomycin inhibits ATP synthase, protons cannot pass back into the mitochondrion. As a result, the proton pumps are unable to operate, as the gradient becomes too strong for them to overcome. NADH is then no longer oxidized and the citric acid cycle ceases to operate because the concentration of NAD+ falls below the concentration that these enzymes can use.

In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is an inhibitor of an enzyme or a protein of the mitochondrial oxidative phosphorylation pathway. In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is an inhibitor of Complex I, Complex II, Complex III, Complex IV, Complex V or may be a mitochondrial uncoupler. In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is a PBK/mTOR inhibitor, an F0 ATP synthase subunit inhibitor, an Fi ATP synthase subunit inhibitor or a cytochrome c reductase inhibitor. The inhibitor may inhibit the enzyme's activity or expression. The inhibitor can be an inhibitor capable of specifically reducing enzyme activity, generally by interacting with the protein of the enzyme, or can be an“enzyme expression inhibitor” capable of specifically reducing protein expression. The inhibitor may be a“direct inhibitor” or an indirect inhibitor” of an enzyme or protein of the mitochondrial oxidative phosphorylation pathway. An inhibitor may be a“direct inhibitor” of an enzyme or a protein of the mitochondrial oxidative phosphorylation pathway (such as Complex I, II, III, IV or V) by directly interacting with the enzyme or protein or with a nucleic acid encoding the enzyme or protein. The inhibitor may also be an“indirect inhibitor” of an enzyme or protein of the mitochondrial oxidative phosphorylation pathway (such as Complex I, II, III, IV or V) which interacts upstream or downstream of an enzyme or protein of the mitochondrial oxidative phosphorylation pathway and does not interact directly with the enzyme or protein or with a nucleic acid encoding the enzyme or protein. In one embodiment, the inhibitor is a“direct inhibitor” of an enzyme or protein of the mitochondrial oxidative phosphorylation pathway.

Examples of inhibitors of mitochondrial oxidative phosphorylation include Metformin, Phenformin, BAY84-2243, Carboxyamido triazole (CAI), ME344, Fenofibrate, MIBG, Pyrvinium, Canagliflozin, Pioglitazone, Rosiglitazone, Amobarbital, Nefazodone, Rotenone, Piericidin A, MPTP, aTos, Lonidamine, Malonate, Atovaquone, Meta-iodobenzylguanidine (mIBG), Antimycin A Myxothiazol, Stigmatellin, propylhexedrine, Arsenic trioxide, NO, Hydrocortisone, Cyanide, Azide, CO, Berberine, IACS-10759, AG311, Atpenins, 3-NP, DT- 010, Rosamine, Phenethyl isothiocynate, Tetrathiomolybdate, ADDA5, Meclizine, Bupivacaine, FCCP, BAM15, PI-103, Efrapeptin, Oligomycin, aurovertin B, Antimycin and Leucino statin.

In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is selected from the group consisting of PI-103, Efrapeptin, Oligomycin, Antimycin and Leucinostatin. In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is selected from the group consisting of PI-103, Efrapeptin, Oligomycin, Antimycin, Leucinostatin and analogues or derivatives thereof. In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is an inhibitor of mitochondrial complex I. In one embodiment, the inhibitor of oxidative phosphorylation is IACS-010759, Metformin, Phenformin, BAY84-2243, CAI, ME344, Fenofibrate, MIBG, Pyrvinium, Canagliflozin, Pioglitazone, Rosiglitazone, Amobarbital, Nefazodone, Rotenone, Piericidin A or MPTP.

In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is an inhibitor of mitochondrial complex II. In one embodiment, the inhibitor is aTos, Lonidamine, or Malonate. In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is an inhibitor of mitochondrial complex III (or cytochrome C reductase) selected from antimycin, myxothiazol, stigmatellin, atovaquone and propylhexedrine.

In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is an inhibitor of mitochondrial complex IV. In one embodiment, the inhibitor is selected from Arsenic trioxide, NO, Hydrocortisone, Cyanide, Azide and CO.

In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is an inhibitor of mitochondrial complex V (or ATP synthase). In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is an inhibitor of FO or FI ATP synthase subunit selected from efrapeptin, oligomycin, aurovertin B, Leucinostatin and azide.

In one embodiment, the inhibitor is IACS-010759, which has the following structure:

In one embodiment, the inhibitor is BAY84-2243, which has the following structure:

In one embodiment, the inhibitor is ME-344 with the following structure:

The SALL4 expressing cancer may be a SALL4 over-expressing cancer. The cancer may be liver cancer or lung cancer.

The terms“cancer” and“cancerous” refer to or describe the physiological condition in mammals that is typically characterized in part by unregulated cell growth. As used herein, the term “cancer” refers to non-metastatic and metastatic cancers, including early stage and late stage cancers. The term“precancerous” refers to a condition or a growth that typically precedes or develops into a cancer. By“non-metastatic” is meant a cancer that is benign or that remains at the primary site and has not penetrated into the lymphatic or blood vessel system or to tissues other than the primary site. Generally, a non-metastatic cancer is any cancer that is a Stage 0, 1, or II cancer, and occasionally a Stage III cancer. By“early stage cancer” is meant a cancer that is not invasive or metastatic or is classified as a Stage 0, I, or II cancer. The term“late stage cancer” generally refers to a Stage III or Stage IV cancer, but can also refer to a Stage II cancer or a sub-stage of a Stage II cancer. One skilled in the art will appreciate that the classification of a Stage II cancer as either an early stage cancer or a late stage cancer depends on the particular type of cancer.

The term "cancer" includes but is not limited to, breast cancer, large intestinal cancer, lung cancer, small cell lung cancer, gastric(stomach) cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, uterine sarcoma, ovarian cancer, rectal or colorectal cancer, anal cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, vulval cancer, squamous cell carcinoma, vaginal carcinoma, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue tumor, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, CNS tumor, glioma, astrocytoma, glioblastoma multiforme, primary CNS lymphoma, bone marrow tumor, brain stem nerve gliomas, pituitary adenoma, uveal melanoma (also known as intraocular melanoma), testicular cancer, oral cancer, pharyngeal cancer or a combination thereof. In one embodiment, the cancer is acute myeloid leukemia, myelodysplasic syndrome, B cell-acute lymphoblastic leukemia, chronic myelocytic leukemia, ALK+ T cell lymphoma, glioma, germ cell tumor, breast cancer, esophageal cancer, endometrial cancer, colorectal cancer, lung cancer, castric cancer, rhabdoid tumor or liver cancer (hepatocellular carcinoma). In one embodiment, the cancer is liver cancer or lung cancer. The liver cancer may, for example, be hepatocellular carcinoma (HCC). The lung cancer may, for example, be non- small-cell lung carcinoma.

In one embodiment, the cancer is a SALL4 expressing cancer. In one embodiment, the cancer is a SALL4 positive cancer. In one embodiment, the cancer is a SALL4 dependent cancer. In one embodiment, the cancer is a SALL4 driven cancer. In one embodiment, the cancer is a metastatic cancer.

In one embodiment, the cancer is a SALL4-expressing cancer selected from acute myeloid leukemia, myelodysplasic syndrome, B cell-acute lymphoblastic leukemia, chronic myelocytic leukemia, ALK+ T cell lymphoma, glioma, germ cell tumor, breast cancer, esophageal cancer, endometrial cancer, colorectal cancer, lung cancer, castric cancer, rhabdoid tumor and liver cancer (hepatocellular carcinoma).

In one embodiment, the cancer comprises a SALL4 expressing cancer cell. The SALL4 expressing cancer cell may be a SALL4 dependent cell. The SALL4 expressing cell may be a tumor-initiating cell.

In one embodiment, the cancer is a cancer that comprises one or more SALL4 expressing cancer cells. In one embodiment, the cancer is a cancer in which a certain percentage of cells in the cancer is SALL4 expressing or SALL4 positive. This can be, for example, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of cells in the cancer.

As used herein, a“SALL4 expressing cell” or“SALL4 expressing cancer cell” may refer to a cell with detectable SALL4 protein bands on a western blot and/or with a qRT-PCR relative fold change (delta delta Ct) value of > 1.2, as compared to, for example, the SALL4 mRNA level in a THLE-3 immortalized normal liver cell line, which is set as a fold change of 1. The SALL4 mRNA levels may be quantified relative to the abundance of 18S rRNA (see Fig. 8A).

The terms“overexpress,”“overexpression,” or“overexpressed” interchangeably refer to a gene (e.g., a SALL4 gene) that is transcribed or translated at a detectably greater level, usually in a cancer cell, in comparison to a normal cell. Overexpression therefore refers to both overexpression of protein and RNA (due to increased transcription, post transcriptional processing, translation, post translational processing, altered stability, and altered protein degradation), as well as local overexpression due to altered protein traffic patterns (increased nuclear localization), and augmented functional activity, e.g., as in an increased enzyme hydrolysis of substrate. Overexpression can also be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a normal cell or comparison cell.

The term“administering” refers to contacting, applying or providing a composition of the present invention to a subject.

As used herein, the term "effective amount" relates to an amount of compound which, when administered according to a desired dosing regimen, provides the desired therapeutic activity. Dosing may occur at intervals of minutes, hours, days, weeks, months or years or continuously over any one of these periods. Suitable dosages may lie within the range of about 0.1 ng per kg of body weight to 1 g per kg of body weight per dosage, such as is in the range of 1 mg to 1 g per kg of body weight per dosage. In one embodiment, the dosage may be in the range of 1 mg to 500 mg per kg of body weight per dosage. In another embodiment, the dosage may be in the range of 1 mg to 250 mg per kg of body weight per dosage. In yet another embodiment, the dosage may be in the range of 1 mg to 100 mg per kg of body weight per dosage, such as up to 50 mg per body weight per dosage.

Suitable dosage amounts and dosing regimens can be determined by the attending physician and may depend on the severity of the condition as well as the general age, health and weight of the patient to be treated.

In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is administered at a dose of about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 26 mg, about 27 mg, about 28 mg, about 29 mg, about 30 mg, about 31 mg, about 32 mg, about 33 mg, about 34 mg, about 35 mg, about 36 mg, about 37 mg, about 38 mg, about 38 mg, about 39 mg, about 40 mg, about 41 mg, about 42 mg, about 43 mg, about 44 mg, about 45 mg, about 46 mg, about 47 mg, about 48 mg, about 49 mg or about 50 mg.

The term“treating" as used herein may refer to (1) preventing or delaying the appearance of one or more symptoms of the disorder; (2) inhibiting the development of the disorder or one or more symptoms of the disorder; (3) relieving the disorder, i.e., causing regression of the disorder or at least one or more symptoms of the disorder; and/or (4) causing a decrease in the severity of one or more symptoms of the disorder.

The term“subject” as used throughout the specification is to be understood to mean a human or may be a domestic or companion animal. While it is particularly contemplated that the methods of the invention are for treatment of humans, they are also applicable to veterinary treatments, including treatment of companion animals such as dogs and cats, and domestic animals such as horses, cattle and sheep, or zoo animals such as primates, felids, canids, bovids, and ungulates. The“subject” may include a person, a patient or individual, and may be of any age or gender.

The expression level of SALL4 in sample can be assessed relative to that in a reference e.g. a non-cancerous specimen or cell. The sample could be a tissue sample or a cell sample obtained from a patient. The expression of SALL4 can be determined using any standard bioassay procedures known in the art for determination of the level of expression of a gene or protein, such as ELISA, RIA, immunoprecipitation, immunoblotting, immunofluorescence microscopy, RT-PCR, in situ hybridization, cDNA microarray, or the like.

The term "increased expression level" of SALL4 may refer to a 1.2 fold or greater difference between the expression (or mean expression) of SALL4 in a cancer specimen or cell as compared to in a control such as a non-cancerous cell. The term "increased expression level" may also refer to a fold difference of at least 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 11 fold, 12 fold, 13 fold, 14 fold, 15 fold, 16 fold, 17 fold, 18 fold, 19 fold, 20 fold, 21 fold, 22 fold, 23 fold, 24 fold, 25 fold, 26 fold, 27 fold, 28 fold, 29 fold, 30 fold, 31 fold, 32 fold, 33 fold, 34 fold, 35 fold, 36 fold, 37 fold, 38 fold, 39 fold, 40 fold, 41 fold, 42 fold, 43 fold, 44 fold, 45 fold, 46 fold, 47 fold, 48 fold, 49 fold, 50 fold, 51 fold, 52 fold, 53 fold, 54 fold, 55 fold, 56 fold, 57 fold, 58 fold, 59 fold, 60 fold, 61 fold, 62 fold, 63 fold, 64 fold, 65 fold, 66 fold, 67 fold, 68 fold, 69 fold, 70 fold, 71 fold, 72 fold, 73 fold, 74 fold, 75 fold, 76 fold, 77 fold, 78 fold, 79 fold, 80 fold, 81 fold, 82 fold, 83 fold, 84 fold, 85 fold, 86 fold, 87 fold, 88 fold, 89 fold, 90 fold, 91 fold, 92 fold, 93 fold, 94 fold, 95 fold, 96 fold, 97 fold, 98 fold, 99 fold or 100 fold.

An increased expression level of SALL4 in a cancer specimen or cell as compared to a non- cancerous specimen or cell may indicate that a subject has SALL4 expressing cancer. In other embodiments, the subject has a SALL4 expressing cancer when there is an increased expression level of SALL4 in a cancer specimen or sample as compared to a non-cancerous specimen or sample indicates that a subject has a SALL4 expressing cancer. In other embodiments, a subject has a SALL4 expressing cancer when a certain percentage of the cells in a cancer sample or specimen has increased expression of SALL4. This can be, for example, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of cells in the cancer sample.

In one embodiment, the inhibitor of mitochondrial oxidative phosphorylation is administered in combination with an anti-cancer therapy. The term "anti-cancer agent" may be any treatment for cancer including drugs, immunotherapy, targeted therapy, hormonal therapy, chemotherapy, including alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, kinase inhibitors and other anti-tumor agents, surgery and radiation therapy.

In an example, the anti-cancer therapy is selected from the group consisting of a chemotherapy, immunotherapy and a radiotherapy. The choice of therapy would depend upon the location and grade of the tumor and the stage of the disease, as well as the general state of the patient.

The chemotherapy may involve administering an anti-proliferative agent such as known anti proliferative alkylating agents, antitumor antibiotics, antimetabolites, natural alkaloids and inhibitors of protein tyrosine kinases and/or serine/threonine kinases. For instance, examples of such agents include:

(i) alkylating agents, such as cis-platinum(II)-diaminedichloride (platinol or cisplatin); oxaliplatin (Eloxatin or Oxaliplatin Medac); and carboplatin (Paraplatin);

(ii) antitumor antibiotics, including those selected from the group comprising anthracyclines, such as doxorubicin (Adriamycin, Rubex); (iii) antimetabolites, including folic acid analogues such as pyrimidine analogues such as 5-fluorouracil (Fluoruracil, 5-FU), gemcitabine (Gemzar), or histone deacetylase inhibitors (HDI) for instance, Vorinostat (rINN);

(iv) natural alkaloids, including paclitaxel (Taxol);

(v) inhibitors of protein tyrosine kinases and/or serine/threonine kinases including Sorafenib (Nexavar), Erlotinib (Tarceva), Dasatanib (BMS-354825 or Sprycel).

In one embodiment, the chemotherapy is a kinase inhibitor such as Sorafenib and/or Regorafenib

In one embodiment, there is provided a method of treating a SALL4 expressing cancer in a subject, the method comprising administering an inhibitor of SALL4 for a sufficient time and under conditions to treat the subject of the SALL4 expressing cancer. In one embodiment, the inhibitor of SALL4 is a nucleic acid or a small molecule. In one embodiment, the inhibitor of SALL4 is an inhibitor of OXPHOS.

In one aspect, there is provided a method of inhibiting proliferation of a SALL4 expressing cancer cell, the method comprising contacting the cancer cell with an inhibitor of mitochondrial oxidative phosphorylation for a sufficient time and under conditions to inhibit proliferation of the SALL4 expressing cancer cell. The method may be an in vitro , in vivo or ex vivo method. In one embodiment, the SALL4 expressing cancer cell is a tumour-initiating cell or a tumor stem cell. In one embodiment, the SALL4 expressing cancer cell is also a SALL4 dependent cancer cell.

In one embodiment, there is provided a method of eliminating a SALL4 expressing cancer cell, the method comprising contacting the cancer cell with an inhibitor of mitochondrial oxidative phosphorylation for a sufficient time and under conditions to eliminate the SALL4 expressing cancer cell.

In one embodiment, there is provided an inhibitor of mitochondrial oxidative phosphorylation for use in inhibiting proliferation of a SALL4 expressing cancer cell. In one embodiment, there is provided an inhibitor of mitochondrial oxidative phosphorylation for use in eliminating a SALL4 expressing cancer cell.

In one embodiment, there is provided the use of an inhibitor of mitochondrial oxidative phosphorylation in the manufacture of a medicament for inhibiting proliferation of a SALL4 expressing cancer cell.

In one embodiment, there is provided the use of an inhibitor of mitochondrial oxidative phosphorylation in the manufacture of a medicament for eliminating a SALL4 expressing cancer cell.

Provided herein are also pharmaceutical compositions, comprising an inhibitor of mitochondrial oxidative phosphorylation.

The compositions of the present invention may be administered in a single dose or a series of doses. For example, the composition may be administered as a single dose or in two doses over the duration of 24 hr. Such method of formulation of the composition is well known to those skilled in the art. The compositions may contain any suitable carriers, diluents or excipients. These include all conventional solvents, dispersion media, fillers, solid carriers, coatings, antifungal and antibacterial agents, dermal penetration agents, surfactants, isotonic and absorption agents and the like. It will be understood that the compositions of the invention may also include other supplementary physiologically active agents.

The carrier must be pharmaceutically "acceptable" in the sense of being compatible with the other ingredients of the composition and not injurious to the subject. Compositions include those suitable for oral, rectal, nasal, topical (including buccal and sublingual), vaginal or parental (including subcutaneous, intramuscular, intravenous and intradermal) administration. The compositions may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.

Injectables for such use can be prepared in conventional forms, either as a liquid solution or suspension or in a solid form suitable for preparation as a solution or suspension in a liquid prior to injection, or as an emulsion. Carriers can include, for example, water, saline (e.g., normal saline (NS), phosphate-buffered saline (PBS), balanced saline solution (BSS)), sodium lactate Ringer's solution, dextrose, glycerol, ethanol, and the like; and if desired, minor amounts of auxiliary substances, such as wetting or emulsifying agents, buffers, and the like can be added. Proper fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersion and by using surfactants. By way of example, the compound or composition can be dissolved in a pharmaceutically effective carrier and be injected into the vitreous of the eye with a fine gauge hollow bore needle (e.g., 30 gauge, 1/2 or 3/8 inch needle) using a temporal approach (e.g., about 3 to about 4 mm posterior to the limbus for human eye to avoid damaging the lens).

A person skilled in the art will appreciate that other means for injecting and/or administering the composition can also be used. These devices and methods can include, for example, biodegradable polymer delivery members that are inserted subcutaneously for long term delivery of medicaments.

The present invention also includes other modes of administration including topical administration. The composition of the invention may be suitable for topical administration to the skin may comprise the compounds dissolved or suspended in any suitable carrier or base and may be in the form of lotions, gel, creams, pastes, ointments and the like. Suitable carriers include mineral oil, propylene glycol, polyoxyethylene, polyoxypropylene, emulsifying wax, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water. Transdermal patches may also be used to administer the compounds of the invention. For example, solutions or suspensions of the compound or composition of the invention may be formulated as a paste or cream or ointment, or as a membranous ocular patch, which is applied directly to the surface of the skin. Topical application typically involves administering the compound of the invention in an amount between 0.1 ng and 10 mg. The composition of the invention may be suitable for topical administration in the mouth including lozenges comprising the natural compounds in a flavoured base, usually sucrose and acacia or tragacanth gum; pastilles comprising the natural compounds in an inert basis such as gelatine and glycerin, or sucrose and acacia gum; and mouthwashes comprising the active ingredient in a suitable liquid carrier.

The composition of the invention may also be suitable for intravenous administration. For example, a composition may be administered intravenously at a dose of up to 16 mg/m².

The composition of the invention may also be suitable for oral administration and may be presented as discrete units such as capsules, sachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The composition may also be presented as a bolus, electuary or paste. In another embodiment, the composition is orally administrable.

A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g. inert diluent, preservative disintegrant (e.g. sodium starch glycolate, cross-linked polyvinyl pyrrolidone, cross-linked sodium carboxymethyl cellulose) surface-active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile. Tablets may optionally be provided with an enteric coating, to provide release in parts of the gut other than the stomach.

It will also be understood that if a single dose is provided in the format of multiple tablets, the skilled person would know how to alter the total dosage of the composition such that a subset may be provided by each tablet.

Accordingly, in some embodiments, the composition is providable as a tablet or a capsule. In other embodiments, the composition is providable in a fruit chew form. The composition of the invention may be suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions which may contain antioxidants, buffers, bactericides and solutes which render the compound, composition or combination isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The composition may be presented in unit- dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

Preferred unit dosage compositions are those containing a daily dose or unit, daily sub-dose, as herein above described, or an appropriate fraction thereof, of the active ingredient.

It should be understood that in addition to the active ingredients particularly mentioned above, the compositions of this invention may include other agents conventional in the art having regard to the type of composition in question, for example, those suitable for oral administration may include such further agents as binders, sweeteners, thickeners, flavouring agents disintegrating agents, coating agents, preservatives, lubricants and/or time delay agents. Suitable sweeteners include sucrose, lactose, glucose, aspartame or saccharine. Suitable disintegrating agents include cornstarch, methylcellulose, polyvinylpyrrolidone, xanthan gum, bentonite, alginic acid or agar. Suitable flavouring agents include peppermint oil, oil of wintergreen, cherry, orange or raspberry flavouring. Suitable coating agents include polymers or copolymers of acrylic acid and/or methacrylic acid and/or their esters, waxes, fatty alcohols, zein, shellac or gluten. Suitable preservatives include sodium benzoate, vitamin E, alpha-tocopherol, ascorbic acid, methyl paraben, propyl paraben or sodium bisulphite. Suitable lubricants include magnesium stearate, stearic acid, sodium oleate, sodium chloride or talc. Suitable time delay agents include glyceryl monostearate or glyceryl distearate.

Methods for detecting a SALL4 expressing cancer is also provided herein. Provided herein is a method of detecting a SALL4 expressing cancer in a subject, the method comprising the step of: a) detecting SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates the presence of a SALL4 expressing cancer in the subject. The term“detecting the SALL4 expression” may also refer to determining the level of SALL4 expression.

Provided herein is also a method of detecting and/or treating a SALL4 expressing cancer in a subject, the method comprising the steps of: a) detecting SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates the presence of a SALL4 expressing cancer in the subject; and b) treating the SALL4 expressing cancer.

In one aspect, there is provided a method of detecting and treating a SALL4 expressing cancer in a subject, the method comprising the steps of: a) detecting SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates the presence of a SALL4 expressing cancer in the subject; and b) administering an inhibitor of mitochondrial oxidative phosphorylation to the subject found to have a SALL4 expressing cancer.

In one aspect, there is provided a method of treating a SALL4 expressing cancer in a subject, the method comprising the steps of: a) detecting SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates the presence of a SALL4 expressing cancer in the subject; and b) administering an inhibitor of mitochondrial oxidative phosphorylation to the subject found to have a SALL4 expressing cancer.

In one embodiment, there is provided a method of identifying a cancer subject who is likely to be responsive to treatment with an OXPHOS inhibitor, the method comprising the steps of: a) detecting SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates that the cancer subject is likely to be responsive to treatment with an OXPHOS inhibitor.

In one embodiment, there is provided a method of stratifying a subject into a likely responder or non-responder of a cancer therapy with an OXPHOS inhibitor, the method comprising determining the level of SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates that the subject is a likely responder to the cancer therapy, wherein an unchanged or decreased level of SALL4 expression as compared to a reference indicates that the subject is a likely non-responder to the cancer therapy.

In one embodiment, there is provided a kit for detecting a SALL4 expressing cancer in a subject, the kit comprising one or more reagents for detecting SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates the presence of a SALL4 expressing cancer in the subject.

In one embodiment, there is provided a high-throughput chemical screening methodology utilizing endogenous cancer cell lines and isogenic transgenic SALL4-expressing lines to successfully identify drugs that specifically target SALL4-dependencies.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications which fall within the spirit and scope. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

As used in this application, the singular form "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "an agent" includes a plurality of agents, including mixtures thereof.

Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavor to which this specification relates.

Certain embodiments of the invention will now be described with reference to the following examples which are intended for the purpose of illustration only and are not intended to limit the scope of the generality hereinbefore described.

EXAMPLES

Materials and Methods

Antibodies

Western blot antibodies are ACTB from Cell Signaling Technology (4970S), ARG2 from Abeam (abl37069), ATP5D from Abeam (ab97491), ATP5E from Santa Cruz Biotechnology (sc- 393695), ATP5G2 from Abeam (ab80325), CASP3 from Cell Signaling Technology (9662), Cleaved CASP3 from Cell Signaling Technology (9661S), MRPL24 from Santa Cruz Biotechnology (sc-393858), NDUFA3 from Abeam (ab68089), SALL4 from Santa Cruz Biotechnology (sc-101147), and SLC25A23 from Santa Cruz Biotechnology (sc-377109). The SALL4 antibody used for immunohistochemistry is from Santa Cruz Biotechnology (sc- 101147). The antibody used for immunofluorescence is Cytochrome c from BD Biosciences (556432).

Cell culture

Human hepatocellular carcinoma cell lines SNU-387, SNU-398, SNU-182, SNU-423, SNU-475, SNU-449, and HCC-M, and non small cell lung cancer cell lines H1299 and H661 (ATCC) were grown on standard tissue culture plates in filter sterilized RPMI (Gibco) with 10% heat- inactivated Fetal Bovine Serum (HyClone), 2 mM F-Glutamine (Gibco), and 1% Penicillin- Streptomycin (Gibco). Human hepatocellular carcinoma cell lines HepG2, Hep3B, and Huh-7 (ATCC) are grown on standard tissue culture plates in filter sterilized DMEM (Gibco) with 10% heat-inactivated Fetal Bovine Serum (HyClone), 2 mM F-Glutamine (Gibco), and 1% Penicillin- Streptomycin (Gibco). Human immortalized liver cell line THFE-3 is grown on standard tissue culture plates in filtered BEGM with additives (Lonza), 10% heat-inactivated Fetal Bovine Serum (HyClone), and 1% Penicillin-Streptomycin (Gibco). Cells are incubated at 37°C in a humidified atmosphere of 5% CO2. Primary HCC cell lines HCC9.2 and HCC26.1 are culture in a media containing Advanced F12/DMEM reduced serum medium (1: 1) (Gibco. 12643), lOmM HEPEs (Gibco), lOOU/ml Pen /Strep (Gibco), 2mM L-Glutamine (Gibco), 1% N2 (Gibco), 2% B27 (Gibco), 50ng/ml EGF (Millipore), 250ng/ml R-Spondinl (R&D), and 2mM SB431542 (Tocris). The cells are cultured on standard tissue culture dish coated with 3% matrigel (coming). Cells are incubated at 37°C in a humidified atmosphere of 5% CO2.

MTT cell viability assay

The MTT assay was used to examine the effect of SALL4 knockdown on isogenic SNU387 cell viability. Three day after viral infection, 3000 SNU-387 cells in a volume of 200 pL were plated into 96-well plates in triplicate, and incubated for the indicated time points. On the day of analysis, 20 pL of MTT solution (5 mg/mL, Sigma) was added, after which the plates were incubated for 2 hours at 37 °C to. After removal of the medium, the purple formazan crystals formed were dissolved in 100 pL DMSO with 10 minute incubation at 37 C. The optical density (OD) of dissolved purple crystal was measured by the S afire 2 plate reader (Tecan) at a wavelength of 570 nm.

Chemical genetic screen

SNU-387 empty vector, Tg:SALL4A, and Tg. SALLAB expressing isogenic cell lines were generated by transducing WT SNU-387 cells with previously published empty vector, SALL4A or SALL4B FUW-Luc-mCh-puro lentiviral constructs. Cells were plated in 50 pi of RPMI culture media in 384-well white flat-bottom plates (Coming) and incubated at 37°C in a humidified atmosphere of 5% CO2 overnight. Cell numbers per well were 1500 for SNU-398, and 750 for SNU-387 and SNU-387 isogenic lines. After overnight incubation, 0.5 pi of 100 pM dmg libraries or 10 mg/ml extract libraries were added to cells with the Bravo Automated Liquid Handling Platform (Agilent). Cells were then incubated for 72 hrs at 37°C in a humidified atmosphere of 5% CO2 before 10 pi of CellTiter-Glo reagent was added to the wells with the MultiFlo Microplate Dispenser (BioTek). Cells were incubated at room temperature for a minimum of 10 minutes after which luminescence readings were recorded by an Infinite M1000 Microplate Reader (Tecan).

Natural product extract dereplication

Active extracts were subjected to a dereplication procedure as described in Butler MS et al (J Antibiot (Tokyo) 2012;65:275-276). Active fractions were analyzed by accurate MS and MS- MS, and data matched against accurate mass of natural product compounds and A*STAR containing accurate mass and MS/MS mass spectra records of compounds that have been analysed under the same conditions. Oligomycin, 21-hydroxyoligomycin A, leucinostatin A and antimycin A were dereplicated by this method.

Fungi Strain F36017 Fermentation (Efrapeptin producing)

F36017 Tolypocladium niveum is a soil fungus isolated from United Kingdom. A 7 day old culture of F36017 grown on malt extract agar (Oxoid) was used to prepare 5 flasks of seed cultures, comprising of 50mL of seed medium [yeast extract 4 g/L (BD), malt extract lOg/L (Sigma), glucose 4 g/L (1^st Base), pH 5.5] placed in 250 mL Erlenmeyer flasks. These Seed cultures were allowed to grow for 5 days at 24°C with shaking at 200 rpm. At the end of the incubation period, the 5 flasks of seed cultures were combined and homogenized using rotor stator homogenizer (Omni). 5mL of the homogenized seed culture were then used to inoculate each of the 40 flasks containing 6g of vermiculite and 50mL of fermentation medium [maltose 30g/L (Sigma), glucose 10 g/L (1^st Base), yeast extract 0.8 g/L (BD), peptone 2 g/L (Oxoid), potassium phosphate monobasic 0.5 g/L (Sigma), magnesium sulphate heptahydrate 0.5 g/L (Merck), ferric chloride 10 mg/L (Sigma), zinc sulphate 2 mg/L (Merck), calcium chloride 55 mg/L (Sigma), pH 6.0]. Static fermentation was carried out for 14 days at 24°C. At the end of the incubation period, the cultures from all 40 flasks were harvested and freeze dried. The dried vermiculite cakes in each flask were scrambled lightly before extracting overnight 2 times with 100 mL methanol per flask. The insoluble materials from each extraction were removed by passing the mixtures through cellulose filter paper (Whatman Grade 4), and the filtrates were dried by rotary evaporation.

Efrapeptin isolation

The culture broths (40x 50 mL, total 2 L) of Tolypociadium niveum (F36017 were combined and freeze-dried, partitioned with DCM:MeOH:H₂0 1:1:1. The organic layer was then evaporated to dryness using rotary evaporation. The dried dichloromethane crude extract (0.7 g) was re dissolved in methanol and separated by C18 reversed-phase preparative HPLC (solvent A: H20 + 0.1% HCOOH, solvent B: ACN + 0.1% HCOOH; flow rate: 30 mL/min, gradient conditions: 70:30 isocratic for 3 minutes; 30% to 40% of solvent B over 12 minutes, 30% to 65% of solvent B over 60 minutes, followed by 65% to 100% of solvent B over 15 minutes, and finally isocratic at 100% of solvent B for 20 minutes) to give 0.6 mg of efrapeptin D (1, RT 18.5 min.), 1.0 mg of efrapeptin Ea (2, RT 20 min.), 0.5 mg of efrapeptin G (3, RT 25min.), and 1.0 mg of efrapeptin H (4, RT 27 min.). Efrapeptins were elucidated by comparison accurate mass and ¹ H NMR data to those of efrapeptins published with activity against bacteria and tumour cells (Boot CM et al (J Nat Prod 2006;69:83-92.)).

Drug treatment

Drugs used in the study are PI-103 (Selleckchem), Oligomycin A (Selleckchem, LKT Labs), 21- hydroxy Oligomycin A (Enzo Life Sciences), Oligomycin A, B, and C mix (Enzo Life Sciences), Sorafenib Tosylate (Selleckchem), Bortezomib (Selleckchem), Antimycin A (Sigma), Cyclosporine A (LC Laboratories), Leucinostatin A (BII NPL collection), and Phenformin (Sigma). Alpelisib (Selleckchem), SB2343 (Selleckchem), Idelalisib (Selleckchem), SB2602 (MedKoo Biosciences), CUDC-907 (Selleckchem), and TGX-221 (Selleckchem).

CvQUANT cell viability measurements

DNA content of plated cells was measured by application of the CyQUANT Direct Cell Proliferation Kit (Thermo Fisher Scientific) that contains a cell-permeable fluorescent DNA binding dye. Cells were plated in either 96- or 384-well black, clear bottom tissue culture plates (Greiner) and allowed to reach the appropriate confluency before the addition of the appropriate amount of CyQUANT reagent, as detailed in the manufacturer’s protocol. Cells were incubated for at least 1 hr at 37°C in a humidified atmosphere of 5% CO2, after which fluorescence readings were measured by an Infinite Ml 000 Microplate Reader (Tecan) within a wavelength range of 480-535 nm.

CCK-8 cell viability measurements

Cells were cultured overnight in 96-well plates with 50 pi RPMI 1640 medium (10% FBS) with 1,250 cells per well for SNU-387 Empty Vector and SNU-387 parental cells, and 750 cells per well for SNU387 TgSALL4A and B cells. Cells were grown overnight before drug treatment. Phenformin, at varying concentrations, was dissolved in culture media. 50 mΐ of the solution was then added to each well. After 96 hr incubation, 10 mΐ CCK-8 reagent (Dojindo) was added to each well. After 4 hr incubation, optical density values were determined at a wavelength of 450 nm on a SpectraMax M3 Microplate Reader (Molecular Devices).

EdU cell proliferation assay The Click-iT Plus EdU Alexa Fluor 488 Flow Cytometry Assay (Thermo Fisher Scientific) to assess cell proliferation was carried out following the manufacturer’s protocol. SNU-387 isogenic lines were seeded in a 6-well plate overnight, after which the cells were incubated with 10 pM Click-iT EdU for 3 hrs. The cells were harvested and washed with 1% BSA in PBS, and incubated with Click-iT fixative for 15 mins. After fixation, the cells were washed with 1% BSA in PBS and permeabilized in Click-iT saponin-based permeabilization and wash reagent. The click-it reaction was then performed by incubation the cells with Click-iT reaction cocktail for 30 mins to label the EdU-incorporated cells with Alexa Fluor488 dye. A standard flow cytometry method was used for determining the percentage of S-phase cells in the population using the BD LSR II Cell Analyzer (BD Biosciences).

Cell counts

SNU-387 isogenic cell lines growing at exponential phase were seeded in 6-well plates at a density of 1.5 x 10⁵ cells/well. Every 3-4 days, the cells were trypsinized, after which cell numbers were counted to record the growth of the cells. Then the cells were plated at equal cell number in new plates with fresh medium. Total cell number is presented as viable cells per well after split-adjustment.

SALL4 knockdown by lentiviral transduction

The lenti shRNA vector pLL3.7 for scrambled (sh-scr), shSALL4-l and shSALL4-2 were transfected into 293FT cells along with packaging plasmid (psPAX2) and envelope plasmid (pMD2.G) using jetPRIME® DNA transfection reagent (Polyplus-transfection® SA) according to the manufacturer’s protocol for viral packaging. Viral supernatants were collected twice at 48 hrs and 72 hrs after transfection, and filtered through 0.45 pm sterile filters. Virus stocks were concentrated by ultra-centrifuge at 21,000 g for 2 hrs at 4°C. Viral transduction were carried out using spinoculation. Briefly, fresh medium containing lentivirus and 5 pg/mL Polybrene were added to plated cells. The plates was then centrifuged at 800 g at 37 °C for 1 hr, and incubated at 37°C in a humidified atmosphere of 5% CO2.

Scrambled:

GGGTACGGTCAGGCAGCTTCTTTCAAGAGAAGAAGCTGCCTGACCGTACCCTTTTT TC (SEQ ID NO: 1) shSALL4-l :

GGCCTT G A A AC A AGCC A AGCT ATT C A AG AG AT AGCTT GGCTT GTTT C A AGGCCTTT TTC (SEQ ID NO: 2) shSALL4-2:

TGCTATTTAGCCAAAGGCAAATTCAAGAGATTTGCCTTTGGCTAAATAGCTTTTTTC

(SEQ ID NO: 3)

Immunohistochemistry

Immunohistochemistry was performed using Santa Cruz SALL4 antibody (sc-101147). Slides were first deparafinized with xylene, 100% ethanol, 95% ethanol, 70% ethanol and distilled water respectively. After deparafinizing, slides were then blocked for 30 mins in blocking buffer (65 ml 100% methanol, 3.5 ml 30% hydrogen peroxide, 31.5 ml water) to block endogenous peroxidase. Subsequently, antigen retrieval was conducted in lx pH6 citrate buffer (Sigma Aldrich) and boiled for 30 mins. Slides were washed 3 times with distilled water and blocked in normal blocking serum provided by Vectastain ABC kit for 1 hour in room temperature. Next, slides were then incubated in SALL4 primary antibody diluted 1 :400 in blocking serum for 1 hour in room temperature. Prior to staining with secondary antibody, slides were washed 3 times in PBS with 0.1% triton-X. After staining with secondary antibody, slides were incubated in ABC reagent (from Vectastain ABC kit) in a humidified chamber for 1 hour in room temperature following 3 times wash in PBS. Washing was carried out in PBS for 3 times before detection was done using DAB kit (Vector laboratory) and slides were incubated in the dark at room temperature for 5 mins. Lastly, counterstaining was performed in hematoxylin for 15 mins and dehydration in 70% ethanol, 95% ethanol, 100% ethanol and xylene respectively.

PDX1 HCC sample collection

The collection of HCC samples from HCC patients for research is performed under Domain Specific Review Board (DSRB) protocol 2011/01580 approved by the National Healthcare Group DSRB, which governs research ethics in Singapore that involves patients, staff, premises or facilities of the National Healthcare Group as well as any other institutions under its oversight.

Mouse Xenograft

Animals were maintained and studies were carried out according to the Institutional Animal Care and Use Committee protocols. For the SALL4-high models, SNU-398 cell line and HCC26.1 patient primary cells were cultured as detailed in the aforementioned“Cell culture” methods. NOD.Cg-Prkdc^scld Il2rg^tmlwjl SzJ (NSG) mice, both male and female, were anesthetized using 2.5% Isofluorane (Sigma). 1,000,000 cells in 200 pi of RPMI/Primary HCC cell media + Matrigel (1: 1 ratio) were injected subcutaneously per mouse flank. For the SALL4-low model, the PDX1 tumor was digested with collagenase and dispase, and passed through a 70 mM strainer to obtain a sincle-cell suspension in supplemented DMEM/F12 media. The suspension was treated with red blood cell lysis buffer and DNase. After washing the cells with PBS, the suspension was mixed with an equal volume of Matrigel and injected subcutaneously in the flank of 7 female NSG mice for initial tumor propagation. The 7 PDX1 tumors were harvested after 4 weeks and processed for injection as described previously. Viable cells were counted and mixed with Matrigel to obtain a 2,500,000 cells/ml single-cell suspension. 500,000 PDX1 cells were injected subcutaneously into the left flank of each of 12 NSG mice. Isoflurane was used to anesthetize mice during injections. Drug treatment was carried out when tumors are visible. Drugs were dissolved in vehicle, 5% DMSO (Sigma) and 95% corn oil (Sigma), and injected intraperitoneal at a dose of 20 mg/kg for Sorafenib and 0.1 mg/kg for Oligomycin A, with the same doses used in the combination treatment, once daily on weekdays, with no injections on weekends. Mouse weight and tumor size were recorded before each injection. Once tumors reached > 1.5 cm in diameter, mice were euthanized and tumors were snap frozen in liquid nitrogen.

Mouse Toxicity Testing

Female NSG mice were injected with vehicle or 0.1 mg/kg of Oligomycin A three times a week every Monday, Wednesday, and Friday for 3 weeks, then subjected to the following assays.

(1) Open field test (Locomotor testing): Mice were transported to the procedure room at least two hours prior to experiments to allow for habituation to the novel room. Locomotor activity recordings were carried out using a square open field (40x40cm) in a plexiglass cage, equipped with two rows of photocells sensitive to infrared light. The testing apparatus was enclosed in a ventilated, quiet procedure room. Measurements were performed under low levels of light to minimize stress levels of the mice, and allow for normal exploratory behavior. The mice were introduced into the locomotor cage and allowed to explore freely for 30 mins. Locomotor activity data was collected automatically. The exploratory behaviors were also captured through video recordings. The total distance travelled over 30 mins and the average velocity, from 6 independent measurements, was measured for each mouse. (2) Grip strength tests: These tests were performed using a grip strength meter. The forelimb and full body grips of each mouse were measured in three successive trials and recorded. Hindlimb measures were calculated using the difference between the grams-force (gF) recorded for the full body and the forelimb. The results of the three tests were averaged for each mouse.

(3) Rotarod test: Mice were placed on the rotor-rod apparatus which linearly accelerated from 4 to 40 rpm at a rate of 0.1 rpm/sec. Mice were tested in four trials, with a 15 minute rest period between tests. The latency to fall and distance travelled by each mouse was recorded.

(4) Home cage recording: Each mouse was monitored in its home cage for 24 hours through video recording, to capture any instances of abnormal neurological events such as seizures.

ChIP-seq analysis

ChIP-seq data were downloaded from NCBI GEO with accession number GSE112729. Reads were mapped by bowtie2 against human reference genome GRCh38. PCR duplicates were removed in the paired-end alignments by samtools rmdup. Peak calling was performed by macs2 with default options. Annotation of the peaks was done by annotatePeaks.pl in Homer software packages. Alignment files in BAM format were converted to signals by using bedtools, and the average coverage of each ChIP-seq experiment was adjusted to 1. bedGraphToBigWig was used to convert the result into bigWig format files. Heatmaps were generated by Deeptools2 along regions on mitochondria genes. Regions were sorted according to the strength of SALL4 signals.

RNA-seq

SALL4-targeting shRNA was transduced into SNU-398 hepatocellular carcinoma (HCC) cell line. Three days after transduction, the cytoplasm of the cells was removed by dounce homogenizer and nuclear RNA was extracted using the RNeasy Mini Kit (Qiagen). For SNU- 387 SALL4A and SALL4B-expressing isogenic cell lines, SNU-387 HCC cells were transduced with SALL4A or SALL4B FUW-Luc-mCh-puro lentiviral constructs. Puromycin was used to select for stable SALL4A or SALL4B-expressing cells. More than two weeks after selection, RNA was harvested from these isogenic cells using RNeasy Mini Kit (Qiagen). The quality of the harvested total RNA was analyzed on Bioanalyzer prior to generation of the sequencing libraries, a RIN value of >9 from all samples were observed. cDNA library construction was then performed using the stranded ScriptSeq Complete Gold kit (Human/Mouse/Rat) (Epicenter; now available through Illumina). Ribosomal RNA depletion was included in the library construction steps. Paired end 76bp sequencing was done using the Illumina HiSeq 2000 sequencer. The paired-end RNA-seq reads were mapped by TopHat2 pipeline against human reference genome GRCh38 with gene annotation GENCODE 24. PCR duplicates were removed in the paired-end alignments by samtools rmdup. Alignments with mapping quality < 20 were also removed. Based on the reads mapped in the transcriptome, gene expression levels in FPKM were determined by cuffdiff in the Cufflinks package. GSEA analysis was preformed following the manual of the GSEA software. Sequencing data has been deposited in the NCBI Gene Expression Omnibus database with accession number GSE114808.

RNA/DNA extraction & quantitative RT-PCR analysis

RNA isolation was performed using the RNeasy Plus Mini Kit (Qiagen). Genomic/mitochondrial DNA isolation was performed using the QIAamp DNA Mini Kit (Qiagen). cDNA was synthesized from purified RNA with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative PCR for cDNA or genomic/mitochondrial DNA was performed on the ViiA 7 Real-Time PCR system (ThermoFisher Scientific) using the PowerUP SYBR Green Master Mix (Applied Biosystems). The AACt method was used for relative quantification. RT-PCR primers are:

18S rRNA forward: 5’- GT AACCCGTTGAACCCC ATT -3’ (SEQ ID NO: 4)

18S rRNA reverse: 5’- CCATCCAATCGGTAGTAGCG -3’ (SEQ ID NO: 5)

ACTB forward: 5’- CAGAGCCTCGCCTTTGCCGATC -3’ (SEQ ID NO: 6)

ACTB reverse: 5’- CATCCATGGTGAGCTGGCGGCG -3’ (SEQ ID NO: 7)

ARG2 forward: 5’- CGCGAGTGCATTCCATCCT -3’ (SEQ ID NO: 8)

ARG2 reverse: 5’- TCCAAAGTCTTTTAGGTGGCAG -3’ (SEQ ID NO: 9)

B2M forward: 5’- CACTGAAAAAGATGAGTATGCC -3’ (SEQ ID NO: 10)

B2M reverse: 5’- AACATTCCCTGACAATCCC -3’ (SEQ ID NO: 11)

CLYBL forward: 5’- TCCCCAGACTTGGATATAGTTCC -3’ (SEQ ID NO: 12)

CLYBL reverse: 5’- TGCACAATCTACATTCAGGGATG -3’ (SEQ ID NO: 13)

MinorArc forward: 5’- CTAAATAGCCCACACGTTCCC -3’ (SEQ ID NO: 14)

MinorArc reverse: 5’- AGAGCTCCCGTGAGTGGTTA -3’ (SEQ ID NO: 15)

MRPL24 forward: 5’- GCC AGGT C A A ACTT GT GG AT -3’ (SEQ ID NO: 16)

MRPL24 reverse: 5’- CCCTGATCGTGTGGAGACTC -3’ (SEQ ID NO: 17)

ND1 forward: 5’- ACGCCATAAAACTCTTCACCAAAG -3’(SEQ ID NO: 18)

ND1 reverse: 5’- GGGTTCATAGTAGAAGAGCGATGG -3’(SEQ ID NO: 19)

ND4 forward: 5’- ACCTTGGCTATCATCACCCGAT -3’ (SEQ ID NO: 20)

ND4 reverse: 5’- AGTGCGATGAGTAGGGGAAGG -3’ (SEQ ID NO: 21)

NRF1 forward: 5’- AGGAACACGGAGTGACCCAA -3’ (SEQ ID NO: 22) NRF1 reverse: 5’- TGCATGTGCTTCTATGGTAGC -3’ (SEQ ID NO: 23)

NRF2 forward: 5’- A AGT G AC A AG AT GGGCTGCT -3’ (SEQ ID NO: 24)

NRF2 reverse: 5’- TGGACCACTGTATGGGATCA -3’ (SEQ ID NO: 25)

PGC-la forward: 5’- CAAGCCAAACCAACAACTTTATCTCT -3’ (SEQ ID NO: 26) PGC-la reverse: 5’- CACACTTAAGGTGCGTTCAATAGTC -3’ (SEQ ID NO: 27)

PGC-Ib forward: 5’- GGCAGGTTCAACCCCGA -3’ (SEQ ID NO: 28)

PGC-Ib reverse: 5’- CTTGCTAACATCACAGAGGATATCTTG -3’ (SEQ ID NO: 29) SALL4 forward: 5’- GCGAGCTTTTACCACCAAAG -3’ (SEQ ID NO: 30)

SALL4 reverse: 5’- CACAACAGGGTCCACATTCA -3’ (SEQ ID NO: 31)

SALL4A forward: 5’- TCCCC AGACTTGGAT AT AGTTCC -3’ (SEQ ID NO: 32)

SALL4A reverse: 5’- TGCACAATCTACATTCAGGGATG -3’ (SEQ ID NO: 33)

SALL4B forward: 5’- GGTGGATGTCAAACCCAAAG -3’ (SEQ ID NO: 34)

SALL4B reverse: 5’- ATGTGCC AGGAACTTC AACC-3’ (SEQ ID NO: 35)

SLC25A10 forward: 5’- GTGTCGCGCTGGTACTTC -3’(SEQ ID NO: 36)

SLC25A10 reverse: 5’- CACCTCCTGCTGCGTCTG -3’ (SEQ ID NO: 37)

SUMOl forward: 5’- TTGGAACACCCTGTCTTTGAC -3’ (SEQ ID NO: 38)

SUMOl reverse: 5’- ACCGTCATCATGTCTGACCA -3’ (SEQ ID NO: 39)

TFAM forward: 5’- CCGAGGTGGTTTTCATCTGT -3’ (SEQ ID NO: 40)

TFAM reverse: 5’- ACGCTGGGCAATTCTTCTAA -3’ (SEQ ID NO: 41)

Immunofluorescence assay and image analysis

Cells were plated in 96-well black, clear-bottom plates overnight at 50-80% confluency. The following day, MitoTracker Red CMXRos (300nM, Thermo Fisher Scientific) was added into live cells for 30 minutes at 37°C. Cells were then washed three times for 5 mins in PBS and fixed in 4% PFA for 15 mins at room temperature. Following 3 washes of PBS, cells were then incubated in blocking buffer (5% horse serum, 1% BSA, 0.2% Triton-X in PBS) for lh at room temperature. Cytochrome-c antibody (BD Pharmigen, clone 6H2.B4) was added at 1: 1000 dilution in blocking buffer and incubated overnight at 4°C. The next day, cells were washed three times for 5 mins in PBS and incubated with Alexa-Fluor-488 conjugated anti-mouse antibody (Life Technologies) at 1:400 dilution in blocking buffer for lh at room temperature. Nuclei were stained with DAPI in blocking buffer. Imaging and quantification of relative intensities of fluorescence signals were performed with the Cytation 5 multi-mode reader and Gen5 software (BioTek). Targeted mass spectrometry

Samples were re-suspended using 20 pL HPLC grade water for mass spectrometry. 5 pL were injected and analyzed using a hybrid 5500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu) via selected reaction monitoring (SRM) of a total of 256 endogenous water soluble metabolites for steady-state analyses of sample⁴⁵. Some metabolites were targeted in both positive and negative ion mode for a total of 289 SRM transitions using positive/negative ion polarity switching. ESI voltage was +4900 V in positive ion mode and -4500 V in negative ion mode. The dwell time was 3 ms per SRM transition and the total cycle time was 1.55 seconds. Approximately 10-14 data points were acquired per detected metabolite. Samples were delivered to the mass spectrometer via hydrophilic interaction chromatography (HILIC) using a 4.6 mm i.d x 10 cm Amide XBridge column (Waters) at 400 pL/min. Gradients were run starting from 85% buffer B (HPLC grade acetonitrile) to 42% B from 0-5 minutes; 42% B to 0% B from 5-16 minutes; 0% B was held from 16-24 minutes; 0% B to 85% B from 24-25 minutes; 85% B was held for 7 minutes to re equilibrate the column. Buffer A was comprised of 20mM ammonium hydroxide/20 mM ammonium acetate (pH=9.0) in 95:5 watenacetonitrile. Peak areas from the total ion current for each metabolite SRM transition were integrated using MultiQuant v2.0 software (AB/SCIEX).

Metabolite profile analyses

Relative intensities of metabolites were normalized to cell number. Metabolite Set Enrichment Analysis (MSEA) was performed on the Metabo Analyst web server with lists of metabolites with fold change more than or equal to 1.3 either up or down in the isogenic SALL4 expression cell lines compared to empty vector control, with Student’ s two-tailed t-test p-value of less than 0.05.

L-lactate cellular measurements

The L-lactate Assay kit (Abeam) was used to measure cellular lactate levels. 2.2 x 10⁶ cells were washed in ice-cold PBS twice, then lysed in 220 pL of assay buffer to achieve a concentration of 10,000 cells per pL. Lysates were then spun down at 13,000 rpm for 5 mins at 4°C to pellet insoluble debris. Soluble fractions were then filtered through >30 kDa centrifugal filter units (Amicon), spun at 14,000 rpm for 20 mins at 4°C, to remove endogenous lactate dehydrogenase subunits (35 kDa) from the lysates. The assay was then performed according to the manufacturer’s protocol with 50 pL of lysate (500,000 cells) per well in a 96-well plate, and the inclusion of L-lactate standards to plot a standard curve for lactate quantification. Qxygen consumption rate measurements

Cells were harvested and plated in the Seahorse XFe96 96-well miniplates (Agilent) coated with collagen. Cell numbers plated were 15,000 for SNU-387, SNU-387 Empty Vector, Tg:SALL4A and Tg:SALL4B cell lines, 25,000 for SNU-398 and SNU-398 sh-scr cell lines, 35,000 for the SNU-398 shS ALL4- 1 knockdown cell line, and 40,000 for the SNU-398 shS ALL4-2 knockdown cell line. After overnight incubation, cells were washed and media was replaced with the recommended Seahorse Mitostress DMEM media and placed in a C02-free 37°C incubator for 1 hr. Basal oxygen consumption was then measured by the Seahorse XFe96 Analyzer (Agilent) according to the recommended protocol. The Glycolysis Stress Test was also performed on the isogenic SALL4 expressing cell lines, prepared as described above, according to the manufacturer’s recommended protocol. Cells were also subjected to the CyQUANT DNA quantification assay (Thermo Fisher Scientific) to measure DNA content, serving as a basis to normalize oxygen consumption rates with respect to cell number.

EXAMPLE 1

An endogenous-isogenic chemical genetic screening platform identifies SALL4-selective compounds

The SALL4-dependent chemical-genetic screening platform consists of a pair of endogenous HCC cell lines and a trio of isogenic cell lines (Fig. 1A). For the endogenous pair, SNU-398 expresses high levels of SALL4 protein, and its survival is dependent on SALL4 expression. The endogenous control SNU-387 cell line has undetectable SALL4 RNA (Fig. 6A) and protein. The isogenic trio consists of lentiviral-mediated insertions into the SNU-387 SALL4 undetectable line, in which the cells are transduced with either an empty vector control, or a SALL4A or SALL4B expressing construct (Fig. 1A). The SALL4 expressing isogenic lines demonstrate SALL4 isoform- specific mRNA and protein expression (Fig. 6B, 6C and 6D) and become sensitive to SALL4 knockdown (Fig. 6D and 6E). SALL4 isoform expression in these isogenic cells does not alter their growth and proliferation rates (Fig. 6F and 6G).

The five endogenous and isogenic cell lines were screened with 1,597 pharmacologically active small molecules from the Selleck Anti-cancer and LOPAC1280 libraries, and 21,575 diverse natural product extracts of plant, fungal, and actinobacteria origin from the A*STAR Bioinformatics Institute collection. Each natural product extract contains varying numbers of compounds, allowing multiplexing to achieve a screen with hundreds of thousands to millions of compounds efficiently. Cell viability was assessed after 72 hrs of compound or extract incubation (Fig. 1A). Extracts and compounds that reduced cell viability of the SALL4^hl cell lines (SNU- 398, SNU-387 Tg:SALL4A and Tg:SALL4B) by more than 1.5-fold but had minimal effect on SALL4¹⁰ (SNU-387, and SNU-387 Empty Vector) cell viability were identified as hits. The controls for the screen were proteasome inhibitor Bortezomib, which significantly reduced cell viability of all cell lines, and the sole hit from the small molecule library screen, PI- 103, which selectively targets the SALL4^hl cells (Fig. 7A). The Z-factor of the screen was between 0.70 and 0.86.

Three categories of hits were obtained from the screen: compounds/extracts that selectively targeted endogenous SALL4^hl SNU-398 over SALL4¹⁰ control SNU-387 (117 hits), compounds/extracts that selectively targeted Tg:SALL4A cells over Empty Vector control (420 hits), and compounds/extracts that selectively targeted Tg. SALLAB cells over control (960 hits) (Fig. IB). Each category gave at least 100 hits but taken together, the overlapping results gave only 17 hits (1 small molecule and 16 natural product extract hits). The combined screening methodology can therefore yield a small number of hits that conform to stringent SALL4- specificity requirements, decreasing the time and cost for further validation and work-up of hits.

Since each natural product extract that was screened is a mixture of a varied number of compounds, the specific active components responsible for the SALL4^hl response were determined. 31 natural product extract hits from the Tg:SALL4A-SNU-398 overlap (3 hits), Tg:SALL4B-SNU-398 overlap (12 hits), and all three cell line overlap (16 hits) were retested in the screening assay, and only 18 were reproducible (Fig. 1C). These 18 hits were then validated with dose response curves, where only 12 hits from the all three cell line overlap category were validated (Fig. 1C). No hits from the Tg:SALL4A-SNU-398 or Tg:SALL4B-SNU-398 categories passed through this validation step. Next, the 12 validated hit extracts were fractionated into 38 fractions each. Fractions were then screened to identify 9 discrete fractions that were selective for SALL4-high cells, and positive fractions were subjected to Q-TOF mass spectrometry and nuclear magnetic resonance analysis to identify active components (Fig. 1C).

EXAMPLE 2

Oxidative phosphorylation inhibitors target SALL4-dependent cell viability The screen identified one small molecule hit, PI- 103, and 4 natural compound analogues of Oligomycin, Efrapeptin, Antimycin, and Leucinostatin as being selective for SALL4^hl cells (Fig. 2A and 7A), with a hit rate of 0.02%. Oligomycin and Leucinostatin are known inhibitors of the Fo ATP synthase subunit, Efrapeptin inhibits the Fi ATP synthase subunit, and Antimycin targets cytochrome c reductase in Complex III of oxidative phosphoylation (Fig. 2B). PI- 103 has been shown to induce mitochondrial apoptosis in acute myeloid leukemia cells. Since the CellTiter- Glo reagent used for the screen quantifies ATP levels as a measure of cell viability, and the hits target oxidative phosphorylation and the mitochondria, which is a major source of cellular ATP, the hits were further validated with the CyQUANT DNA dye as an alternative measure of cell viability. The dose response curves for the 5 hits using either CellTiter-Glo or CyQUANT were highly comparable (Fig. 7B and 7C). Various analogues of Oligomycin and Efrapeptin were also tested in the cell-based assay (Table 1A). The 4 natural compounds and their analogues demonstrated potent IC50 values in the 0.1 to 10 nM range for the endogenous SALL4^hl SNU- 398 line and partial cell viability decreases in the SALL4^hl isogenic lines, with selectivity ratios ranging from 200 to 20,000 fold compared to the IC50 values in the SALL4¹⁰ control cells (Fig. 1A and 6C, Table 1A). In SALL4-high cells, Oligomycin A seems to induce cell death through apoptosis, as suggested by the presence of cleaved caspase-3 with Oligomycin treatment in a dose response manner (Fig. 7D).

Oligomycin A suppresses SALL4-dependent tumorigenesis

Oligomycin A was selected for downstream tumor-suppression and mechanistic studies since it had the most potent SALL4^hl cell IC50 of 0.5 nM and the highest selectivity of 20,000 fold over the SALL4¹⁰ cells. Oligomycin A is also readily available commercially. To determine if Oligomycin A could selectively target other SALL4^hl cell lines, dose response cell viability experiments was performed on a panel of HCC cell lines. This panel includes two patient-derived primary cell lines, HCC9.2 and HCC26.1, from two Singapore HCC cases, and an immortalized normal liver cell line THLE-3 (Fig. 3A and 8A). Oligomycin A was also tested in a pair of non small cell lung cancer (NSCLC) cell lines, in which the SALL4^hl H661 line was previously shown to be dependent on SALL4 expression, while the SALL4¹⁰ H1299 line was not (Fig. 8B and 8C, Table IB). The data suggests that Oligomycin A is potent and selective against SALL4^hl expressing HCC and NSCLC cell lines (Fig. 3A and 8A-C, Table 1A and B).

To test the in vivo efficacy of Oligomycin A in suppressing HCC tumors, a SALL4-high mouse xenograft model of SALL4-dependent SNU-398 cells and a SALL4-low patient-derived xenograft model of a tumor named PDX1 were utilized. In the SALL4-high model, Oligomycin A was able to suppress tumor size to a similar degree to the standard-of-care drug in HCC, Sorafenib, but at a 200 times lower dose of 0.1 mg/kg compared to 20 mg/kg for Sorafenib (Fig. 3B, 3C and 8D). The PDX1 tumors, which showed very low SALL4 protein levels (Fig. 8E), did not respond to Oligomycin treatment (Fig. 3D, 3E and 8F). Mouse weight was not significantly affected by Oligomycin treatment in both models, suggesting that the drug was not toxic to the mice at this therapeutic dose (Fig. 8G).

To examine a potential correlation of oxidative phosphorylation inhibition in patients, a HCC patient dataset that was previously published for SALL4 expression was re-examined. The first- line treatment for Type II diabetes is the biguanide drug metformin, which has recently been shown to inhibit oxidative phosphorylation. It was previously observed that 60% of HCC patient tumors had detectable levels of SALL4, but when patients with and without diabetes were stratified, a significant difference (Fig. 8H) was noticed. Non-diabetic patients showed the same trend of 60% SALL4 positivity as all patients combined, however, the trend was reversed in diabetic patients with only 40% having SALL4 positive tumors (Fig. 8H). Patient information on the type of diabetes and metformin use is unavailable so more clinical work is needed to validate this correlation. Phenformin, an analogue of metformin with known oxidative phosphorylation inhibition activity, was tested in the SALL4 isogenic cell lines. Partial sensitivity to phenformin in the SALL4-expressing cells compared to the parental SALL4 low line was observed, but the effect was not as prominent as that of Oligomycin A (Fig. 81). The lower effectiveness of phenformin is expected since it is a less potent inhibitor of oxidative phosphorylation (mM IC50) compared to Oligomycin A (nM IC50). The data suggests the possibility that oxidative phosphorylation inhibition by metformin treatment in diabetic patients suppresses SALL4-positive tumorigenesis.

EXAMPLE 3

Oncogenic SALL4 binds oxidative phosphorylation genes and predominantly upregulates them

Since the hits from the screen predominantly target oxidative phosphorylation, previous SALL4 and acetylated H3K27 chromatin immunoprecipication sequencing (ChIP-seq) data in the SNU- 398 cells were examined. It was found that SALL4 binds up to 45% of mitochondrial genes, as defined by the MitoCarta 2.0 gene list, and gene ontology analysis revealed that a significant number of these genes are involved in oxidative phosphorylation (Fig. 4A, Table 2). Gene meta analysis of SALL4 and H3K27ac occupancy at these mitochondrial genes revealed that SALL4 binds predominantly at the promoter region, between the H3K27ac double peaks (Fig. 4B and 4C).

To assess gene expression changes caused by SALL4 activity, RNA-seq was performed on the isogenic SALL4 expressing cells and SNU-398 SALL4-high cells with SALL4 knockdown (Fig. 9A). It was observed that a number of oxidative phosphorylation and other mitochondrial genes with SALL4-bound promoters show increased mRNA expression with SALL4 expression, particularly with the SALL4B isoform (Fig. 4D). In addition, SALL4 knockdown seems to downregulate the expression of these genes (Fig. 9B). The observed RNA-seq expression patterns of some of these genes were validated by qRT-PCR (Fig. 9C and 9D). Gene Set Enrichment Analysis (GSEA) of the RNA-seq data revealed significant enrichment of oxidative phosphorylation genes in the SNU-398 control compared to SALL4 knockdown, and in the SALL4B expressing isogenic cell line compared to empty vector control (Fig. 9E). This suggests that the binding of SALL4 to oxidative phosphorylation and other mitochondrial gene promoters predominantly activates their transcription. Genes that are not bound by SALL4 such as SUMOl are unaffected (Fig. 4C, 4D and 9B). Western blots of SALL4-bound oxidative phosphorylation genes ATP5D, ATP5E, ATP5G2, and NDUFA3, and other SALL4-bound mitochondrial genes ARG2, MRPL24, and SLC25A23, show similar trends in gene expression data, in which SALL4 expression (predominantly SALL4B ) upregulates their protein levels while SALL4 knockdown downregulates these levels (Fig. 4E, 4F, 9F and 9G).

SALL4 expression functionally increases oxidative phosphorylation

Since SALL4 expression in the HCC cell lines enhances oxidative phosphorylation gene mRNA and protein expression, the inventors examined if these changes would result in functional alterations in oxidative phosphorylation. The oxygen consumption rate (OCR) of the SALL4^hl and SALL4¹⁰ cells used in the screen were first measured, since oxidative phosphorylation requires oxygen. It was observed that the OCR is significantly increased in the SNU-398 SALL4^hl line and by expressing either SALL4A or SALL4B in the isogenic lines (Fig. 5A). The opposite occurs with SALL4 knockdown in SNU-398 cells, in which OCR decreases proportionally with decreasing SALL4 protein levels, as shSALL4-2 reduces SALL4 protein level to a greater degree than shSALL4-l (Fig. 5B and 9G). This suggests that SALL4 expression increases oxidative phosphorylation-dependent OCR. To assess mitochondrial localization and the mitochondrial membrane potential gradient generated by oxidative phosphorylation, the inventors performed immunofluorescence imaging of the SALL4 endogenous and isogenic cell lines with oxidative phosphorylation membrane protein Cytochrome c and MitoTracker dye, a dye which localizes to the mitochondrial membrane in a membrane potential-dependent manner (Fig. 5C). Quantification of the fluorescence signals per cell revealed that Cytochrome c is significantly upregulated in the SALL4A expressing cells (Fig. 5D). In addition, the MitoTracker signal is significantly increased in the SNU-398 and both SALL4A and SALL4B expressing cells (Fig. 5E). These results suggest that SALL4 expression increases oxidative phosphorylation-dependent mitochondrial membrane potential.

Since oxidative phosphorylation seems to be functionally increased by SALL4 expression, the levels of oxidative phosphorylation-related metabolites were analyzed. ATP levels normalized to DNA content in the SALL4 expressing cells were first measured (using CellTiter-Glo and CyQUANT reagents) and it was found that ATP levels are significantly increased in both the SALL4A and SALL4B expressing lines (Fig. 5F). Metabolite profiling was also performed on the SALL4 expressing lines through Metabolite Set Enrichment Analysis (MSEA). It was observed that electron transport chain (oxidative phosphorylation) and malate- aspartate shuttle metabolites are significantly altered in both SALL4A and SALL4B expression (Fig. 10A and 10B). The malate-aspartate shuttle facilitates the transfer of electrons from membrane impermeable NADH generated during glycolysis in the cytosol to mitochondrial oxidative phosphorylation. NADH levels are significantly lower in the SALL4 expressing lines while NAD+ levels are significantly higher, implying that there is an increased conversion of NADH into NAD+ by oxidative phosphorylation Complex I (Fig. 5G). Malate-aspartate shuttle metabolites are also significantly increased, suggesting an increase in the transfer of electrons (NADH) generated in glycolysis to oxidative phosphorylation (Fig. IOC). The metabolite profiling data implies that SALL4 expression increases the utilization of oxidative phosphorylation-related metabolites in order to generate more ATP.

Many cancers demonstrate the Warburg effect, where glycolysis is upregulated by the PI3K/mTOR signalling pathway. The small molecule SALL4-selective hit from the screen, PI- 103, is a pan PI3K inhibitor (Fig 7A). The effects of SALL4 expression on glycolysis in the oxidative phosphorylation-dependent model were therefore examined. From the metabolite profiling data, glycolytic metabolites are primarily downregulated with SALL4 expression (Fig. 10D). The levels of L-lactate, the end product of anaerobic respiration, were unchanged with SALL4 expression (Fig. 10E). Further, the extracellular acidification rate (ECAR) of the SALL4 isogenic cell lines (which measures lactate being secreted into the extracellular environment) was measured, and a slight decrease in the ECAR was observed with SALL4 expression (Fig. 10F). In the glycolysis stress test, a marked decrease in glycolytic rate and a slight decrease in glycolytic capacity in the SALL4 expressing cells (Fig. 10G) were observed.

Interestingly, the top altered metabolic pathway due to SALL4 expression was the urea cycle (Fig. 10A and 10B). Significant upregulation of urea cycle metabolites, particularly in the SALL4B expressing cells, was observed in the metabolite profiling data (Fig. 11 A). When the ChIP-seq data for urea cycle genes was examined, only SALL4 binding at the promoter region of ARG2 (Fig. 11B) was observed. This suggests a possible coupling of oxidative phosphorylation and the urea cycle through ARG2 regulation by SALL4. However, since SALL4 binds only one gene in the urea cycle, it is unlikely that the urea cycle plays a direct role in SALL4-dependent cancer.

Mitochondrial DNA (mtDNA) copy number was also examined through qRT-PCR analysis with mtDNA gene-specific primers and it was found that the examined mtDNA regions are significantly amplified in SNU-398 SALL4^hl cells and SALL4 expressing isogenic lines (Fig. 11D). This suggests that SALL4 expression promotes an increase in mtDNA copy number in relation to increased oxidative phosphorylation functionality in the mitochondria.

EXAMPLE 4

Conclusions

A combined chemical-genetic screening to discover oncogenic transcription factor vulnerabilities as precision medicine

The chemical genetic screening platform with endogenous and isogenic SALL4 expressing HCC cell lines allows for the efficient and stringent identification of a small number of hits that target both the endogenous and isogenic SALL4^hl lines, increasing the likelihood that these hits are specifically affecting SALL4-related biology. The endogenous pair gives biological relevance while the isogenic trio controls for genetic background. The combination endogenous-isogenic screen is therefore able to identify compounds that target SALL4-specific biology in a biologically relevant fashion. The 4 natural compound hits identified target different oxidative phosphorylation components and by doing so, they potently and selectively target SALL4 expressing cells in both HCC and NSCLC systems. It was demonstrated that ATP synthase inhibitor Oligomycin A effectively targets SALL4^hl cells in a panel of HCC cell lines and can suppress tumors in vivo to a similar degree as the current standard-of-care drug Sorafenib. This suggests that the system can identify tool compounds that are specific to transcription factor cancer biology efficiently and effectively.

A previously unknown metabolic role of SALL4 in tumorigenesis

The screening results and subsequent investigation into the altered processes in SALL4- dependent tumorigenesis reveals a previously unknown metabolic reprogramming function of SALL4. It was demonstrated that SALL4 binds a significant number of oxidative phosphorylation and other mitochondrial genes at their promoters and predominantly upregulates their mRNA expression. This gene expression upregulation ultimately leads to increased protein levels of these genes. SALL4 expression also leads to a functional increase in oxidative phosphorylation, with increased cellular OCR, mitochondrial membrane potential, oxidative phosphorylation-related metabolites and mtDNA copy number. The work proposes that SALL4 expression in cancer confers a dependency on oxidative phosphorylation through direct gene expression regulation, although the underlying preference for this metabolic reprogramming in tumorigenesis is still unclear.

SALL4 as a biomarker for oxidative phosphorylation precision medicine in cancer

The study shows that SALL4 can be used as a companion biomarker to select cancer patients who are sensitive to oxidative phosphorylation inhibitors in the clinic. Mechanistically, a direct link between SALL4 upregulation and an increase in oxidative phosphorylation is proposed, where SALL4 binds and transcriptionally activates oxidative phosphorylation genes during tumorigenesis. Tumors that express significant levels of SALL4 are more sensitive to oxidative phosphorylation inhibition at very low doses, as demonstrated both in vitro and in vivo. A larger therapeutic window for clinical oxidative phosphorylation inhibitors is therefore possible in patients harboring SALL4-expressing tumors. Targeting SALL4 -dependent cancer with oxidative phosphorylation inhibitors could lead to an effective suppression of tumorigenesis with minimal toxicity.

The study demonstrates that a SALL4 biomarker can be used in conjunction with Oligomycin, a highly potent oxidative phosphorylation inhibitor that has not yet been tested extensively in clinical trials. The LD33 (lethal dose that kills 33%) of Oligomycin in rats is 0.5 mg/kg (1 mg/kg in mice), while 100% of rats survived with 0.1 mg/kg of drug (0.2 mg/kg in mice). The study doses mice at the sub-lethal dose of 0.1 mg/kg Oligomycin, which is 10 times less than the LD33, and significant and selective tumor size suppression in SALL4-high tumors with low toxicity was observed.

Table 1. OXPHOS inhibitors are potent and selective against SALL4-expressing cancer cells. (A) Summary of ICso and selectivity values for OXPHOS inhibitors tested in the SALL4 endogenous HCC cell lines used in the screen. (B) Summary of ICso and selectivity values for OXPHOS inhibitors tested in the SALL4 endogenous NSCLC cell line pair in Fig. 8C.

Table 1A: HCC dose response

Table IB: NSCLC dose response

Table 2 SALL4 binds a significant number of mitochondrial genes. (A) List of mitochondrial genes bound by SALL4 from previously published SNU-398 ChIP-seq experiments.

Claims

1. A method of treating a Sal-like protein 4 (SALL4) expressing cancer in a subject, the method comprising administering an inhibitor of mitochondrial oxidative phosphorylation (OXPHOS) for a sufficient time and under conditions to treat the subject of the SALL4 expressing cancer.

2. The method of claim 1, wherein the inhibitor of mitochondrial oxidative phosphorylation is selected from the group consisting of a an F0 ATP synthase subunit inhibitor, an Fi ATP synthase subunit inhibitor, a cytochrome c reductase inhibitor, a NADFPubiquinone oxidoreductase inhibitor and a PI3K/mTOR inhibitor.

3. The method of claim 2, wherein the inhibitor of mitochondrial oxidative phosphorylation is selected from the group consisting of Efrapeptin, Oligomycin, Antimycin, Leucinostatin, IACS-010759, PI- 103 and analogues or derivatives thereof.

4. The method of claim 1, wherein the SALL4 expressing cancer is a SALL4 over expressing cancer.

5. The method of claim 1, wherein the cancer is liver cancer or lung cancer.

6. A method of inhibiting proliferation of a SALL4 expressing cancer cell, the method comprising contacting the cancer cell with an inhibitor of mitochondrial oxidative phosphorylation for a sufficient time and under conditions to inhibit proliferation of the SALL4 expressing cancer cell.

7. An inhibitor of mitochondrial oxidative phosphorylation for use in treating a SALL4 expressing cancer in a subject.

8. The inhibitor of mitochondrial oxidative phosphorylation of claim 7, wherein the inhibitor is selected from the group consisting of a an F0 ATP synthase subunit inhibitor, an Fi ATP synthase subunit inhibitor, a cytochrome c reductase inhibitor, a NADH: ubiquinone oxidoreductase inhibitor and a PI3K/mTOR inhibitor.

9. The inhibitor of mitochondrial oxidative phosphorylation of claim 8, wherein the inhibitor is selected from the group consisting of Efrapeptin, Oligomycin, Antimycin, Leucinostatin, IACS-010759, and PI- 103 and analogues or derivatives thereof.

10. The inhibitor of mitochondrial oxidative phosphorylation of claim 7, wherein the SALL4 expressing cancer is a SALL4 over-expressing cancer.

11. The inhibitor of mitochondrial oxidative phosphorylation of claim 7, wherein the cancer is liver cancer or lung cancer.

12. Use of an inhibitor of mitochondrial oxidative phosphorylation in the manufacture of a medicament for treating a SALL4 expressing cancer in a subject.

13. The use of claim 12, wherein the inhibitor is selected from the group consisting of a an F0 ATP synthase subunit inhibitor, an Fi ATP synthase subunit inhibitor, a cytochrome c reductase inhibitor, a NADH: ubiquinone oxidoreductase inhibitor and a PBK/mTOR inhibitor.

14. The use of claim 13, wherein the inhibitor is selected from the group consisting of Efrapeptin, Oligomycin, Antimycin, Feucinostatin, IACS-010759 and PI- 103 and analogues or derivatives thereof.

15. The use of claim 12, wherein the SAFF4 expressing cancer is a SAFF4 over-expressing cancer.

16. The use of claim 12, wherein the cancer is liver cancer or lung cancer.

17. A method of detecting and treating a SAFF4 expressing cancer in a subject, the method comprising the steps of:

a) detecting SAFF4 expression in a sample obtained from the subject, wherein an increased level of SAFF4 expression as compared to a reference indicates the presence of a SAFF4 expressing cancer in the subject; and

b) administering an inhibitor of mitochondrial oxidative phosphorylation to the subject found to have a SAFF4 expressing cancer.

18. A method of treating a SAFF4 expressing cancer in a subject, the method comprising the steps of: a) detecting SALL4 expression in a sample obtained from the subject, wherein an increased level of SALL4 expression as compared to a reference indicates the presence of a SALL4 expressing cancer in the subject; and