WO2020233655A1

WO2020233655A1 - Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use

Info

Publication number: WO2020233655A1
Application number: PCT/CN2020/091489
Authority: WO
Inventors: 张鸿雁; 高山; 康代武; 田宝磊
Original assignee: 苏州瑞博生物技术股份有限公司
Priority date: 2019-05-22
Filing date: 2020-05-21
Publication date: 2020-11-26
Also published as: CN113286888B; CA3141372A1; CN117701564A; US20230313195A1; EP3974530A4; EP3974530A1; AU2020280439A1; CN113286888A; KR20220011656A; JP2022533841A; TW202111118A

Abstract

An siRNA which inhibits proprotein convertase subtilisin/kexin type 9 (PCSK9) gene expression, a pharmaceutical composition containing the siRNA, and a conjugate. Each nucleotide in the siRNA is independently a modified or unmodified nucleotide. The siRNA contains a sense strand and an antisense strand. The sense strand contains nucleotide sequence I, nucleotide sequence I having the same length as the nucleotide sequence shown in SEQ ID NO: 1, with no more than three nucleotide differences. The antisense strand contains nucleotide sequence II, nucleotide sequence II having the same length as the nucleotide sequence shown in SEQ ID NO: 2, with no more than three nucleotide differences. The siRNA, the pharmaceutical composition thereof and the conjugate can effectively treat and/or prevent hypercholesterolemia.

Description

Nucleic acid, pharmaceutical composition and conjugate, preparation method and application

Technical field

The present disclosure relates to a nucleic acid, a pharmaceutical composition and an siRNA conjugate capable of inhibiting the expression of the proprotein convertase subtilisin/kexin type 9 (PCSK9) gene. The present disclosure also relates to the preparation method and application of the nucleic acid, the pharmaceutical composition and the siRNA conjugate.

Background technique

Dyslipidemia, especially the persistently high low-density lipoprotein cholesterol (LDL-c), is an important risk factor that induces and promotes the occurrence and development of atherosclerosis. It is closely related to ischemic cardiovascular and cerebrovascular diseases and seriously threatens human health. . The existing drugs for treating dyslipidemia mainly include statins, cholesterol absorption inhibitors, resins, probucol, fibrates, niacin and its derivatives. The application of lipid-lowering drugs to lower plasma cholesterol levels can reduce the risk of cardiovascular and cerebrovascular diseases, but a considerable proportion of patients still do not reach the ideal blood lipid level.

Studies have shown that the proprotein convertase subtilisin/kexin type 9 (PCSK9) gene plays an important role in lipid metabolism, especially cholesterol metabolism. By inhibiting PCSK9 gene expression, plasma cholesterol levels can be effectively reduced. Small interfering RNA (siRNA) can be based on the mechanism of RNA interference (RNAi) to inhibit or block the expression of the target gene of interest in a sequence-specific manner, thereby achieving the purpose of treating diseases. If the expression of PCSK9 gene can be inhibited from the mRNA level, it will undoubtedly be the most ideal treatment.

The key to developing siRNA drugs that inhibit PCSK9 gene expression and treat hypercholesterolemia is to find suitable siRNA and its modification as well as an effective delivery system.

Summary of the invention

The inventor of the present disclosure unexpectedly discovered that the following siRNA conjugates provided in the present disclosure can specifically inhibit the expression of PCSK9 gene, and specifically target the liver, inhibit the expression of PCSK9 gene in the liver, and realize the treatment or prevention of high cholesterol Blood disease. In addition, the inventors have also invented siRNA and pharmaceutical compositions with higher activity.

In some embodiments, the present disclosure provides a siRNA conjugate having a structure as shown in formula (308):

Wherein: n1 is an integer selected from 1-3, n3 is an integer selected from 0-4; m1, m2 or m3 are independently an integer selected from 2-10; R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ or R ₁₅ are each independently H, or are selected from the group consisting of C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl, and C ₁ -C ₁₀ alkoxy;

R ₃ is a group represented by the formula A59:

Wherein, E ₁ is OH, SH or BH ₂ ;

Nu is siRNA, the siRNA contains a sense strand and an antisense strand, each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleotide sequence I , The antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, the nucleotide sequence I and the The nucleotide sequence II is selected from the following group i)-vi):

i) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length, and have no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 2 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-AAGCAAGCAGACAUUUAUZ ₁ -3' (SEQ ID NO:1);

5'-Z ₂ AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 2),

Wherein, Z ₁ is C, Z ₂ is G, the nucleotide sequence I contains a nucleotide Z ₃ whose position corresponds to Z ₁ , and the nucleotide sequence II contains a nucleoside whose position corresponds to Z ₂ Acid Z ₄ , where Z ₄ is the first nucleotide at the 5'end of the antisense strand;

ii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 62 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-UUUGUAGCAUUUUUAUUAZ ₅ -3' (SEQ ID NO: 61);

5'-Z ₆ UAAUAAAAAUGCUACAAA-3' (SEQ ID NO: 62),

Wherein, Z ₅ is A, Z ₆ is U, the nucleotide sequence I contains a nucleotide Z ₇ whose position corresponds to Z ₅ , and the nucleotide sequence II contains a nucleoside whose position corresponds to Z ₆ Acid Z ₈ , said Z ₈ being the first nucleotide at the 5'end of the antisense strand;

iii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 are the same in length and have no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 122 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-GCCUGGAGUUUAUUCGGAZ ₉ -3' (SEQ ID NO: 121);

5'-Z ₁₀ UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 122),

Wherein, Z ₉ is A, Z ₁₀ is U, the nucleotide sequence I contains the nucleotide Z ₁₁ whose position corresponds to Z ₉ and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₁₀ Acid Z ₁₂ , where Z ₁₂ is the first nucleotide at the 5'end of the antisense strand;

iv) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 182 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-CUGUUUUGCUUUUGUAACZ ₁₃ -3' (SEQ ID NO: 181);

5'-Z ₁₄ GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 182),

Wherein, Z ₁₃ is U, Z ₁₄ is A, the nucleotide sequence I contains the nucleotide Z ₁₅ whose position corresponds to Z ₁₃ and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₁₄ Acid Z ₁₆ , where Z ₁₆ is the first nucleotide at the 5'end of the antisense strand;

v) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 242 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-GGUUUUGUAGCAUUUUUAZ ₁₇ -3' (SEQ ID NO: 241);

5'-Z ₁₈ UAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242),

Wherein, Z ₁₇ is U, Z ₁₈ is A, the nucleotide sequence I contains the nucleotide Z ₁₉ whose position corresponds to Z ₁₇ and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₁₈ Acid Z ₂₀ , said Z ₂₀ being the first nucleotide at the 5'end of the antisense strand; and,

vi) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 302 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-GUGACUUUUUAAAAUAAAZ ₂₁ -3' (SEQ ID NO: 301);

5'-Z ₂₂ UUUAUUUUAAAAAGUCAC-3' (SEQ ID NO: 302),

Wherein, Z ₂₁ is A, Z ₂₂ is U, the nucleotide sequence I contains the nucleotide Z ₂₃ whose position corresponds to Z ₂₁ , and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₂₂ Acid Z ₂₄ , said Z ₂₄ being the first nucleotide at the 5'end of the antisense strand;

R ₂ is a linear alkylene group with a length of 1-20 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more selected from the group consisting of: C (O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C _3- C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene; and wherein R ₂ may optionally have any one or more substituents in the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ -C ₁₀ alkylphenyl,- C ₁ -C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-SH, -SC ₁ -C ₁₀ haloalkyl, halogen substituent, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl -NH ₂ , -N (C ₁ -C ₁₀ alkyl) (C _1- C ₁₀ alkyl), -NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl phenyl), NH (C ₁ -C ₁₀ alkyl benzene) Group), cyano, nitro, -CO ₂ H, -C(O)O (C ₁ -C ₁₀ alkyl), -CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl) , -CONH (C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC(O) (C ₁ -C ₁₀ alkyl), -NHC(O) (phenyl), -N(C ₁ -C ₁₀ Alkyl) C (O) (C ₁ -C ₁₀ alkyl), -N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), -C (O) C ₁ -C ₁₀ alkyl, -C(O)C ₁ -C ₁₀ alkylphenyl, -C(O)C ₁ -C ₁₀ haloalkyl, -OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ Alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , -SO ₂ NH (C ₁ -C ₁₀ alkyl), -SO ₂ NH ( _{_{phenyl), - NHSO 2 (C 1}} -C 10 alkyl), - NHSO ₂ (phenyl), and -NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

Each L _{1 is} independently a linear alkylene group with a length of 1 to 70 carbon atoms, wherein one or more carbon atoms are optionally selected from any one or more of the following groups Replacement: C(O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene , C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene; and wherein, L ₁ may optionally have any one or more substituents in the group consisting of the following groups: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ -C ₁₀ alkyl Phenyl, -C ₁ -C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkane Group -SH, -SC ₁ -C ₁₀ haloalkyl, halogen substituent, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl -NH ₂ , -N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl phenyl), NH (C ₁ -C ₁₀ alkyl phenyl), cyano, nitro, -CO ₂ H, -C (O) O (C ₁ -C ₁₀ alkyl), -CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -CONH (C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC(O) (C ₁ -C ₁₀ alkyl), -NHC(O)(phenyl), -N(C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), -N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), -C (O) C ₁ -C ₁₀ alkyl, -C(O)C ₁ -C ₁₀ alkylphenyl, -C(O)C ₁ -C ₁₀ haloalkyl, -OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ ( C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , -SO ₂ NH (C ₁ -C ₁₀ alkyl), -SO ₂ NH _{_{(phenyl), - NHSO 2 (C 1}} -C 10 alkyl), - NHSO ₂ (phenyl), and -NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

Represents the site where the group is covalently attached; M ₁ represents the targeting group.

In some embodiments, the present disclosure provides an siRNA capable of inhibiting PCSK9 gene expression. The siRNA contains a sense strand and an antisense strand, and each nucleotide in the sense strand and the antisense strand is independently It is a fluorinated modified nucleotide or a non-fluorinated modified nucleotide; the sense strand contains a nucleotide sequence I, the antisense strand contains a nucleotide sequence II, and the nucleotide sequence I And the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, and the fluoro-modified nucleotides are located in the nucleotide sequence I and the nucleotide sequence II, and follow the 5'end to 3 The direction of the end, in the sense strand, the nucleotides at positions 7, 8, and 9 of the nucleotide sequence I are fluorinated modified nucleotides, and the nucleosides at the remaining positions in the sense strand Acid is a non-fluorinated modified nucleotide; in the direction from the 5'end to the 3'end, in the antisense strand, the nucleosides at

positions

2, 6, 14, and 16 of the nucleotide sequence II The acid is a fluorinated modified nucleotide, the nucleotides at the remaining positions in the antisense strand are non-fluorinated modified nucleotides, and the nucleotide sequence I and the nucleotide sequence II are selected From one of the above i)-vi).

In some embodiments, the present disclosure provides a pharmaceutical composition containing the siRNA of the present disclosure and a pharmaceutically acceptable carrier.

In some embodiments, the present disclosure provides an siRNA conjugate containing the siRNA provided in the present disclosure and a conjugating group conjugated to the siRNA.

In some embodiments, the present disclosure provides that the siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present disclosure are used in the preparation of drugs for the treatment and/or prevention of diseases or physiological conditions caused by abnormal expression of PCSK9 gene the use of.

In some embodiments, the present disclosure provides a method for treating and/or preventing diseases or physiological conditions caused by abnormal expression of the PCSK9 gene, the method comprising applying an effective amount of the siRNA and/or pharmaceutical composition of the present disclosure and/or Or the siRNA conjugate is administered to a subject in need.

In some embodiments, the present disclosure provides a method for inhibiting PCSK9 gene expression in liver cells, the method comprising combining an effective amount of the siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present disclosure with the liver. Cell contact.

In some embodiments, the present disclosure provides a kit that contains the siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present disclosure.

Beneficial effect

The siRNA, pharmaceutical composition and siRNA conjugate provided in the present disclosure have good stability, high PCSK9 mRNA inhibitory activity, low off-target effect and toxicity, and/or can significantly treat or prevent the abnormal expression of PCSK9 gene. The disease or physiological condition of the patient, for example, hypercholesterolemia.

In some embodiments, the siRNA, pharmaceutical composition or siRNA conjugate provided in the present disclosure shows excellent target mRNA inhibitory activity in in vitro cell experiments. In some embodiments, the siRNA, pharmaceutical composition, or siRNA conjugate provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% in liver cells. Or 95% target mRNA inhibition rate.

In some embodiments, the siRNA, pharmaceutical composition, or siRNA conjugate provided in the present disclosure may have higher stability and/or higher activity in vivo. In some embodiments, the siRNA, pharmaceutical composition or siRNA conjugate provided in the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% in vivo. % Inhibition rate of target gene expression. In some embodiments, the siRNA, pharmaceutical composition or siRNA conjugate provided in the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% in vivo. % PCSK9 gene expression inhibition rate. In some embodiments, the siRNA, pharmaceutical composition or siRNA conjugate provided in the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% in vivo. % Inhibition rate of PCSK9 gene expression in the liver. In some embodiments, the siRNA, pharmaceutical composition or siRNA conjugate provided in the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% in vivo. % Inhibition rate of PCSK9 gene expression in liver in animal models. In some embodiments, the siRNA, pharmaceutical composition or siRNA conjugate provided in the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% in vivo. Inhibition rate of PCSK9 gene expression in the liver in% of human subjects. In some embodiments, the siRNA, pharmaceutical composition or siRNA conjugate provided in the present disclosure does not show significant off-target effects. Off-target effects may be, for example, suppression of normal expression of genes other than target genes. It is believed that if the binding/inhibition of off-target gene expression is less than 50%, 40%, 30%, 20%, or 10% compared to the target gene effect, the off-target effect is not significant.

In some embodiments, the present disclosure provides siRNA exhibited high inhibitory activity psiCHECK system, the target sequence between the IC _{50 0.0194-0.0561nM.} In some embodiments, the siRNA conjugate provided in the present disclosure is injected subcutaneously into a single injection of cynomolgus monkeys, at a dose of 9 mg/kg, relative to the 7th day before administration, and the NHP liver tissue PCSK9 on the 15th day after administration. The inhibition rate of mRNA is 56-81%. In some embodiments, the siRNA conjugate provided in the present disclosure inhibits PCSK9 protein expression in serum more significantly, and the inhibition rate of PCSK9 protein expression in serum can reach more than 90% on the 14th day after administration. In some embodiments, the siRNA conjugate provided in the present disclosure can significantly inhibit serum LDL-c and CHO levels, especially during the 14th day to the 29th day after administration, the inhibition rate of LDL-c can be as high as 30% Above, even as high as 64%; it also has a higher inhibition rate for CHO, even as high as 35%. In some embodiments, a single administration of the siRNA conjugate provided in the present disclosure at a dose of 9 mg/kg can maintain an LDL-c inhibition rate higher than 50% for 11 weeks. No obvious toxicity was found in rats and mice. In summary, the siRNA conjugate provided by the present disclosure has a fast onset of action, a long time of action, significant inhibition of target mRNA expression, can effectively reduce the content of PCSK9 protein in serum, has a strong inhibitory effect on LDL-c and CHO in serum, and has a biological Safety performance is good.

This shows that the siRNA, pharmaceutical composition and siRNA conjugate provided in the present disclosure can inhibit the expression of PCSK9 gene, effectively treat and/or prevent diseases or physiological conditions caused by abnormal expression of PCSK9 gene, and have good application prospects.

Other features and advantages of the present disclosure will be described in detail in the following specific embodiments.

Description of the drawings

Figures 1A-1F are the dose-effect curves fitted according to the relative residual activity of the reporter gene Renilla in the psiCHECK system after transfection of different siRNAs (siRNA 1-6).

Figure 2 is a graph of normalized PCSK9 protein levels in serum at different time points after a single subcutaneous injection of 9 mg/kg of conjugate 1, 4 or 7 in cynomolgus monkeys.

Figure 3 is a graph showing normalized LDL-c levels in serum at different time points after a single subcutaneous injection of 9 mg/kg of conjugate 4 or 7 in cynomolgus monkeys.

Figure 4 is a graph of normalized CHO levels in serum at different time points after a single subcutaneous injection of 9 mg/kg of conjugate 4 or 7 in cynomolgus monkeys.

Detailed ways

The specific embodiments of the present disclosure will be described in detail below. It should be understood that the specific embodiments described here are only used to illustrate and explain the present disclosure, and are not used to limit the present disclosure.

In this disclosure, PCSK9 mRNA refers to mRNA with the sequence shown in Genbank registration number NM_174936.3. Further, unless otherwise stated, the term "target gene" used in the present disclosure refers to a gene capable of transcribing the aforementioned PCSK9 mRNA, and the term "target mRNA" refers to the aforementioned PCSK9 mRNA.

definition

In the above and below, unless otherwise specified, the capital letters C, G, U, A, T represent the base composition of nucleotides; the lowercase letter m represents that the adjacent nucleotide to the left of the letter m is a Oxy-modified nucleotides; lowercase letter f indicates that the adjacent nucleotide to the left of the letter f is a fluoro-modified nucleotide; lowercase letter s indicates the two adjacent nucleotides to the left and right of the letter s Between them is the phosphorothioate group connection; P1 indicates that the adjacent nucleotide to the right of P1 is a 5'-phosphate nucleotide or a nucleotide modified by a 5'-phosphate analogue, and the letter combination VP represents the letter The adjacent nucleotide on the right side of the combination VP is a nucleotide modified by vinyl phosphate, and the letter combination Ps indicates that the adjacent nucleotide on the right side of the letter combination Ps is a nucleotide modified by phosphorothioate. The capital letter P indicates that the nucleotide adjacent to the right side of the letter P is a 5'-phosphate nucleotide.

In the above and below, the "fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2'position of the ribose group of the nucleotide is replaced by fluorine, and the "non-fluoro-modified nucleotide" refers to Nucleotides or nucleotide analogs formed by substituting a non-fluorine group for the hydroxyl group at the 2'position of the ribose group of a nucleotide. "Nucleotide analogue" refers to a nucleic acid that can replace nucleotides, but has a structure different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides or thymus The group of pyrimidine deoxyribonucleotides. Such as heteronucleotide, bridged nucleotide (BNA) or acyclic nucleotide. The "methoxy-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribose group with a methoxy group.

In the context of this article, the expressions "complementary" or "reverse complement" can be used interchangeably, and have the meaning well known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, the bases of one strand are connected to the other strand. The bases on are paired in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base Cytosine (G) matches. Each base pair includes a purine and a pyrimidine. When adenine on one chain is always paired with thymine (or uracil) on the other chain, and guanine is always paired with cytosine, the two chains are considered to be complementary to each other, and from their complementary chain The sequence of the chain can be inferred from the sequence. Correspondingly, "mismatch" in the art means that in a double-stranded nucleic acid, bases at corresponding positions are not paired in a complementary manner.

In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" "Means that there is no more than one base mismatch between two nucleotide sequences; "complete reverse complement" means that there is no base mismatch between two nucleotide sequences.

In the above and below, the "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the base type of the nucleotide at the same position has changed compared with the latter. For example, when one nucleotide base in the latter is A, when the corresponding nucleotide base at the same position in the former is U, C, G, or T, it is regarded as one of the two nucleotide sequences There is a nucleotide difference at this position. In some embodiments, when an abasic nucleotide or its equivalent is substituted for the nucleotide at the original position, it can also be considered that there is a nucleotide difference at that position.

In the above and below, especially when describing the preparation method of the siRNA, pharmaceutical composition or siRNA conjugate of the present disclosure, unless otherwise specified, the nucleoside monomer refers to the siRNA to be prepared Or the type and sequence of nucleotides in siRNA conjugates, modified or unmodified nucleoside phosphoramidite monomers used in phosphoramidite solid phase synthesis (unmodified or modified RNA phosphoramidites, sometimes RNA phosphoramidites are also called Nucleoside phosphoramidites) . Phosphoramidite solid phase synthesis is a method used in RNA synthesis well known to those skilled in the art. The nucleoside monomers used in the present disclosure are all commercially available.

In the context of the present disclosure, unless otherwise specified, "conjugate" means that two or more chemical moieties each having a specific function are connected to each other in a covalent manner; correspondingly, "conjugate" is Refers to the compound formed by covalent linkage between the various chemical parts. Further, "siRNA conjugate" refers to a compound formed by covalently linking one or more chemical moieties with specific functions to siRNA. Hereinafter, sometimes the siRNA conjugate of the present disclosure is also referred to simply as "conjugate". An siRNA conjugate should be understood as a general term for multiple siRNA conjugates or an siRNA conjugate represented by a certain chemical formula according to the context. In the context of the present disclosure, "conjugated molecule" should be understood as a specific compound that can be conjugated to siRNA through a reaction, and finally form the siRNA conjugate of the present disclosure.

As used herein, "optional" or "optionally" means that the event or condition described thereafter can occur or not occur, and the description includes the situation where the event or situation occurs and the situation where it does not occur. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" defined below. Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically impractical, and/or inherently unstable .

As used herein, "alkyl" refers to straight and branched chains having a specified number of carbon atoms, the number is usually 1 to 20 carbon atoms, such as 1 to 10 carbon atoms, such as 1 to 8 Or 1 to 6 carbon atoms. For example, C ₁ -C ₆ alkyl groups include straight and branched chain alkyl groups of 1 to 6 carbon atoms. When referring to an alkyl residue having a specific number of carbons, it is intended to cover all branched and straight chain forms having that number of carbons; therefore, for example, "butyl" means including n-butyl, sec-butyl , Isobutyl and tert-butyl; "propyl" includes n-propyl and isopropyl. Alkylene is a subset of alkyl and refers to residues that are the same as alkyl but have two points of attachment.

As used herein, "alkenyl" refers to an unsaturated branched or unbranched alkyl group having at least one carbon-carbon double bond, which is obtained from adjacent carbon atoms of the parent alkyl group. Obtained by removing one molecule of hydrogen. The group can be in the cis or trans configuration of the double bond. Typical alkenyl groups include but are not limited to: vinyl; propenyl, such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl Group), prop-2-en-2-yl; butenyl, such as but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-ene-1- But-2-en-1-yl, but-2-en-2-yl, but-1,3-dien-1-yl, but-1,3-dien-2-yl, etc. In certain embodiments, alkenyl groups have 2 to 20 carbon atoms, while in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a subset of alkenyl and refers to the same residue as alkenyl but with two points of attachment.

As used herein, "alkynyl" refers to an unsaturated branched or unbranched alkyl group having at least one carbon-carbon triple bond, which is obtained from adjacent carbon atoms of the parent alkyl group. Obtained by removing two molecules of hydrogen. Typical alkynyl groups include but are not limited to: ethynyl; propynyl, such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyl, such as but-1-yn- 1-yl, but-1-yn-3-yl, but-3-yn-1-yl, etc. In certain embodiments, the alkynyl group has 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkynylene is a subset of alkynyl and refers to residues that are the same as alkynyl but have two points of attachment.

As used herein, "alkoxy" refers to an alkyl group with a specified number of carbon atoms connected through an oxygen bridge, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, S-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methyl Pentyloxy and so on. Alkoxy groups generally have 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms connected by oxygen bridges.

As used herein, "aryl" refers to a group derived from an aromatic monocyclic or polycyclic hydrocarbon ring system by removing hydrogen atoms from ring carbon atoms. The aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen atoms and 6 to 18 carbon atoms, wherein at least one ring in the ring system is completely unsaturated, that is, contains a ring according to Hückel's theory, Delocalized (4n+2)π-electron system. Aryl groups include, but are not limited to, phenyl, fluorenyl, and naphthyl groups. Arylene is a subset of aryl and refers to residues that are the same as aryl but have two points of attachment.

As used herein, "halogen substituent" or "halogen" refers to fluoro, chloro, bromo or iodo, and the term "halogen" includes fluoro, chloro, bromo or iodo.

As used herein, "haloalkyl" refers to an alkyl group as defined above in which the specified number of carbon atoms is replaced by one or more halogen atoms up to the maximum allowable number. Examples of haloalkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, or pentafluoroethyl.

"Heterocyclyl" refers to a stable 3- to 18-membered non-aromatic cyclic group containing 2-12 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen or sulfur. Unless otherwise specified in the specification, heterocyclic groups are monocyclic, bicyclic, tricyclic, or tetracyclic ring systems, and may include fused or bridged ring systems. The heteroatoms in the heterocyclic group may be optionally oxidized. One or more nitrogen atoms (if present) are optionally quaternized. The heterocyclic group is partially saturated or fully saturated. The heterocyclic group can be attached to the rest of the molecule through any ring atom. Examples of such heterocyclic groups include, but are not limited to: dioxanyl, thienyl[1,3]dithianyl (thienyl[1,3]dithianyl), decahydroisoquinolinyl, imidazolinyl, imidazolidine Group, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxapiperazinyl, 2-oxapiperidinyl, 2-oxa Pyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidinone, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuranyl, trithianyl (trithianyl) ), tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl and 1,1-dioxothio Morpholinyl (1,1-dioxo-thiomorpholinyl).

"Heteroaryl" refers to a group derived from a 3- to 18-membered aromatic ring radical, containing 2 to 17 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, a heteroaryl group can be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, wherein at least one ring in the ring system is fully unsaturated, that is, contains a cyclic delocalization according to Hückel's theory (4n +2) π-electron system. Heteroaryl groups include fused or bridged ring systems. The heteroatoms in the heteroaryl group are optionally oxidized. One or more nitrogen atoms (if present) are optionally quaternized. The heteroaryl group is attached to the rest of the molecule through any ring atom. Examples of heteroaryl groups include, but are not limited to: azepinyl, acridinyl, benzimidazolyl, benzindolyl, 1,3-benzodiaxazolyl, benzofuranyl, benzene Oxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl (benzo[b][1,4]dioxepinyl), benzo[ b][1,4]oxazinyl (benzo[b][1,4]oxazinyl), 1,4-benzodioxanyl (1,4-benzodioxanyl), benzonaphthofuranyl, benzo Oxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranone, benzofuranyl, benzofuranone , Benzothienyl, benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazolyl, pyridyl Cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5,6- Dihydrobenzo[h]quinazolinyl (5,6-dihydrobenzo[h]quinazolinyl), 5,6-dihydrobenzo[h]cinnolinyl (5,6dihydrobenzo[h]cinnolinyl), 6,7 -Dihydro-5H-benzo[6,7]cycloheptano[1,2-c]pyridazinyl, dibenzofuranyl, dibenzothienyl, furanyl, furanonyl, furo[ 3,2-c]pyridyl, 5,6,7,8,9,10-hexahydrocyclooctano[d]pyrimidinyl, 5,6,7,8,9,10-hexahydrocyclooctane And[d]pyridazinyl, 5,6,7,8,9,10-hexahydrocyclooctano[d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indolyl, Isoindolyl, indoline, isoindoline, isoquinolinyl, indolizinyl, isoxazolyl, 5,8-methanol-5,6,7,8- Tetrahydroquinazolinyl (5,8-methano-5,6,7,8-tetrahydroquinazolinyl), naphthyridinyl, 1,6-naphthyridinonyl, oxadiazole Group, 2-oxoazepinyl (2-oxoazepinyl), oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[ H)quinazolinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl , Pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyridine Iridinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, tetrahydroquinolinyl, 5 ,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9 -Tetrahydro-5H-cycloheptano[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, Thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3 -c] pyridyl (thieno[2,3-c]pridinyl) and thiophenyl/thienyl.

Various hydroxyl protecting groups can be used in this disclosure. Generally speaking, the protecting group makes the chemical functionality insensitive to specific reaction conditions, and can be added to and removed from the functional group in the molecule without substantially damaging the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d, John Wiley & Sons, New York, 1991, for reference The above-mentioned documents are incorporated into this article in their entirety. In some embodiments, the protecting group is stable under basic conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthene-9-yl (Pixyl) or 9-(p-methoxyphenyl)xanthene-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxy Trityl) or TMTr (4,4',4"-trimethoxytrityl).

The term "subject", as used herein, refers to any animal, such as a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (for example, rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, or any kind of poultry .

As used herein, "treatment" refers to a method of obtaining beneficial or desired results, including but not limited to therapeutic benefits. "Therapeutic benefit" means eradicating or improving the underlying barriers being treated. In addition, therapeutic benefits are obtained by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be afflicted by the underlying disorder.

As used herein, "prevention" refers to methods of obtaining beneficial or desired results, including but not limited to preventive benefits. In order to obtain "preventive benefits", siRNA conjugates or pharmaceutical compositions can be administered to subjects who are at risk of suffering from a specific disease, or to subjects who report one or more physiological symptoms of the disease, even if the disease is possible The diagnosis has not yet been made.

In one aspect, the present disclosure provides six siRNAs that can inhibit PCSK9 gene expression.

The siRNA of the present disclosure contains a nucleotide group as a basic structural unit, and those skilled in the art know that the nucleotide group contains a phosphate group, a ribose group and a base, which will not be repeated here.

The siRNA of the present disclosure contains a sense strand and an antisense strand, the length of the sense strand and the antisense strand are the same or different, the length of the sense strand is 19-23 nucleotides, and the length of the antisense strand is 19-26 Nucleotides. In this way, the length ratio of the siRNA sense strand and antisense strand provided by the present disclosure can be 19/19, 19/20, 19/21, 19/22, 19/23, 19/24, 19/25, 19/26, 20/20, 20/21, 20/22, 20/23, 20/24, 20/25, 20/26, 21/20, 21/21, 21/22, 21/23, 21/24, 21/ 25, 21/26, 22/20, 22/21, 22/22, 22/23, 22/24, 22/25, 22/26, 23/20, 23/21, 23/22, 23/23, 23/24, 23/25 or 23/26. In some embodiments, the length ratio of the siRNA sense strand and antisense strand is 19/21, 21/23, or 23/25.

The first siRNA

According to the present disclosure, the siRNA may be the first siRNA.

The first siRNA contains a sense strand and an antisense strand, each nucleotide in the first siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleoside Acid sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, wherein the nucleotide sequence Sequence I is the same length as the nucleotide sequence shown in SEQ ID NO: 1 and has no more than 3 nucleotide differences, and the nucleotide sequence II is the same as the nucleotide sequence shown in SEQ ID NO: 2 The length is equal, and no more than 3 nucleotide differences:

5'-AAGCAAGCAGACAUUUAUZ ₁ -3' (SEQ ID NO:1);

5'-Z ₂ AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 2),

Wherein, Z ₁ is C, Z ₂ is G, the nucleotide sequence I contains a nucleotide Z ₃ whose position corresponds to Z ₁ , and the nucleotide sequence II contains a nucleoside whose position corresponds to Z ₂ Acid Z ₄ , the Z ₄ is the first nucleotide at the 5'end of the antisense strand.

In the above and below, "positional correspondence" refers to the same position in the nucleotide sequence from the same end of the nucleotide sequence. For example, the first nucleotide at the 3'end of the nucleotide sequence I is the nucleotide whose position corresponds to the first nucleotide at the 3'end of SEQ ID NO:1.

In some embodiments, the sense strand only includes nucleotide sequence I, and the antisense strand only includes nucleotide sequence II.

In some embodiments, there is no more than one nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1, and/or the nucleotide sequence II and SEQ ID NO:1 ID NO: No more than one nucleotide difference between the nucleotide sequences shown in 2.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 includes the difference at position Z ₄ , and Z _{4 is} selected from A, U or C. In some embodiments, the nucleotide difference is a difference at the Z ₄ position, and Z _{4 is} selected from A, U, or C. In some embodiments, Z ₃ is a nucleotide that is complementary to Z ₄ . The siRNAs with the above-mentioned nucleotide differences have higher target mRNA inhibition ability of the siRNA, and these siRNAs containing the nucleotide differences are also within the protection scope of the present disclosure.

In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, substantially reverse complementary or completely reverse complementary; the substantially reverse complement refers to two nuclei There are no more than 3 base mismatches between the nucleotide sequences; the substantially reverse complementation refers to the presence of no more than 1 base mismatch between two nucleotide sequences; complete reverse complementarity It means that there is no base mismatch between two nucleotide sequences.

In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 4:

5'-AAGCAAGCAGACAUUUAUZ ₃ -3' (SEQ ID NO: 3);

5'-Z ₄ AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 4),

Wherein, Z ₄ is the first nucleotide at the 5'end of the antisense strand, Z _{3 is} selected from A, U, G or C, and Z ₄ is a nucleotide complementary to Z ₃ ; in some embodiments Among them, Z ₃ is C and Z ₄ is G.

In some embodiments, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV. The length of the nucleotide sequence III and the nucleotide sequence IV are each 1-4 cores. Nucleotide; the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the nucleotide sequence III is connected to 5 of the nucleotide sequence I 'End, the nucleotide sequence IV is connected to the 3'end of the nucleotide sequence II. In some embodiments, the nucleotide sequence IV is substantially reverse-complementary or completely reverse-complementary to the second nucleotide sequence, and the second nucleotide sequence refers to the sequence in the target mRNA with the SEQ ID NO: 1 represents a nucleotide sequence that is adjacent to the 5'end of the nucleotide sequence and has the same length as the nucleotide sequence IV.

In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV are both 1 nucleotide, the base of the nucleotide sequence III is C, and the base of the nucleotide sequence IV is G ; At this time, the length ratio of the sense strand and the antisense strand is 20/20; or, the length of the nucleotide sequence III and IV are both 2 nucleotides, according to the direction from the 5'end to the 3'end, the nucleoside The base composition of acid sequence III is CC, and the base composition of nucleotide sequence IV is GG; at this time, the length ratio of the sense strand and the antisense strand is 21/21; or, the length of nucleotide sequences III and IV Both are 3 nucleotides. According to the direction from the 5'end to the 3'end, the base composition of nucleotide sequence III is CCC, and the base composition of nucleotide sequence IV is GGG; at this time, the sense strand and the reverse The length ratio of the sense strand is 22/22; alternatively, the lengths of nucleotide sequences III and IV are both 4 nucleotides, according to the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is ACCC, the base composition of nucleotide sequence IV is GGGU; at this time, the length ratio of the sense strand and the antisense strand is 23/23. In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, in the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is CC , The base composition of nucleotide sequence IV is GG; at this time, the length ratio of the sense strand and the antisense strand is 21/21.

In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary, therefore, given the base of the nucleotide sequence III, the base of the nucleotide sequence IV is also determined.

Second siRNA

According to the present disclosure, the siRNA may be a second siRNA.

The second siRNA contains a sense strand and an antisense strand, each nucleotide in the second siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleoside Acid sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, wherein the nucleotide sequence Sequence I is the same length as the nucleotide sequence shown in SEQ ID NO: 61 and has no more than 3 nucleotide differences, and the nucleotide sequence II is the same as the nucleotide sequence shown in SEQ ID NO: 62 The length is equal, and no more than 3 nucleotide differences:

5'-UUUGUAGCAUUUUUAUUAZ ₅ -3' (SEQ ID NO: 61);

5'-Z ₆ UAAUAAAAAUGCUACAAA-3' (SEQ ID NO: 62),

Wherein, Z ₅ is A, Z ₆ is U, the nucleotide sequence I contains a nucleotide Z ₇ whose position corresponds to Z ₅ , and the nucleotide sequence II contains a nucleoside whose position corresponds to Z ₆ Acid Z ₈ , the Z ₈ is the first nucleotide at the 5'end of the antisense strand.

In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61, and/or the nucleotide sequence II and SEQ ID NO: No more than one nucleotide difference between the nucleotide sequences shown in 62.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 includes the difference at the Z ₈ position, and Z _{8 is} selected from A, C or G. In some embodiments, the nucleotide difference is a difference at the Z ₈ position, and Z _{8 is} selected from A, C, or G. In some embodiments, Z ₇ is a nucleotide that is complementary to Z ₈ . The siRNAs with the above-mentioned nucleotide differences have higher target mRNA inhibition ability of the siRNA, and these siRNAs containing the nucleotide differences are also within the protection scope of the present disclosure.

In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, substantially reverse complementary or completely reverse complementary.

In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 63, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 64:

5'-UUUGUAGCAUUUUUAUUAZ ₇ -3' (SEQ ID NO: 63);

5'-Z ₈ UAAUAAAAAUGCUACAAA-3' (SEQ ID NO: 64),

Wherein, Z ₈ is the first nucleotide at the 5'end of the antisense strand, Z _{7 is} selected from A, U, G, or C, and Z ₈ is a nucleotide complementary to Z ₇ ; in some embodiments Among them, Z ₇ is A and Z ₈ is U.

In some embodiments, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV. The length of the nucleotide sequence III and the nucleotide sequence IV are each 1-4 cores. Nucleotide; the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the nucleotide sequence III is connected to 5 of the nucleotide sequence I 'End, the nucleotide sequence IV is connected to the 3'end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, The second nucleotide sequence refers to a nucleotide sequence that is adjacent to the 5'end of the nucleotide sequence represented by SEQ ID NO: 61 in the target mRNA and has the same length as the nucleotide sequence IV .

In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 1 nucleotide, the base of the nucleotide sequence III is U, and the base of the nucleotide sequence IV is A ; At this time, the length ratio of the sense strand and the antisense strand is 20/20; or, the length of the nucleotide sequence III and IV are both 2 nucleotides, according to the direction from the 5'end to the 3'end, the nucleoside The base composition of acid sequence III is GU, and the base composition of nucleotide sequence IV is AC; at this time, the length ratio of the sense strand and the antisense strand is 21/21; or, the length of the nucleotide sequences III and IV Both are 3 nucleotides. According to the direction from the 5'end to the 3'end, the base composition of nucleotide sequence III is GGU, and the base composition of nucleotide sequence IV is ACC; at this time, the sense strand and the reverse The length ratio of the sense strand is 22/22; alternatively, the lengths of nucleotide sequences III and IV are both 4 nucleotides, according to the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is GGGU, the base composition of nucleotide sequence IV is ACCC; at this time, the length ratio of the sense strand and the antisense strand is 23/23. In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, in the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is GU , The base composition of nucleotide sequence IV is AC; at this time, the length ratio of the sense strand and the antisense strand is 21/21.

The third siRNA

According to the present disclosure, the siRNA may be a third siRNA.

The third siRNA contains a sense strand and an antisense strand, each nucleotide in the third siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleoside Acid sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, wherein the nucleotide sequence Sequence I and the nucleotide sequence shown in SEQ ID NO: 121 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as the nucleotide sequence shown in SEQ ID NO: 122 The length is equal, and no more than 3 nucleotide differences:

5'-GCCUGGAGUUUAUUCGGAZ ₉ -3' (SEQ ID NO: 121);

5'-Z ₁₀ UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 122),

Wherein, Z ₉ is A, Z ₁₀ is U, the nucleotide sequence I contains the nucleotide Z ₁₁ whose position corresponds to Z ₉ and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₁₀ Acid Z ₁₂ , the Z ₁₂ is the first nucleotide at the 5'end of the antisense strand.

In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121, and/or the nucleotide sequence II and SEQ ID NO: 122 has no more than 1 nucleotide difference between the nucleotide sequences shown.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 includes the difference at position Z ₁₂ , and Z _{12 is} selected from A, C or G. In some embodiments, the nucleotide difference is a difference at the Z ₁₂ position, and Z _{12 is} selected from A, C, or G. In some embodiments, Z ₁₁ is a nucleotide that is complementary to Z ₁₂ . The siRNAs with the above-mentioned nucleotide differences have higher target mRNA inhibition ability of the siRNA, and these siRNAs containing the nucleotide differences are also within the protection scope of the present disclosure.

In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 124:

5'-GCCUGGAGUUUAUUCGGAZ ₁₁ -3' (SEQ ID NO: 123);

5'-Z ₁₂ UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 124),

Wherein, Z ₁₂ is the first nucleotide at the 5'end of the antisense strand, Z _{11 is} selected from A, U, G, or C, and Z ₁₂ is a nucleotide complementary to Z ₁₁ ; in some embodiments Among them, Z ₁₁ is A and Z ₁₂ is U.

In some embodiments, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV. The length of the nucleotide sequence III and the nucleotide sequence IV are each 1-4 cores. Nucleotide; the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the nucleotide sequence III is connected to 5 of the nucleotide sequence I 'End, the nucleotide sequence IV is connected to the 3'end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, The second nucleotide sequence refers to a nucleotide sequence that is adjacent to the 5'end of the nucleotide sequence represented by SEQ ID NO: 121 in the target mRNA and has the same length as the nucleotide sequence IV .

In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 1 nucleotide, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C ; At this time, the length ratio of the sense strand and the antisense strand is 20/20; or, the length of the nucleotide sequence III and IV are both 2 nucleotides, according to the direction from the 5'end to the 3'end, the nucleoside The base composition of acid sequence III is AG, and the base composition of nucleotide sequence IV is CU; at this time, the length ratio of the sense strand and the antisense strand is 21/21; or, the length of the nucleotide sequences III and IV Both are 3 nucleotides. According to the direction from the 5'end to the 3'end, the base composition of nucleotide sequence III is UAG, and the base composition of nucleotide sequence IV is CUA; at this time, the sense strand and the reverse The length ratio of the sense strand is 22/22; alternatively, the lengths of nucleotide sequences III and IV are both 4 nucleotides, according to the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is AUAG, the base composition of nucleotide sequence IV is CUAU; at this time, the length ratio of the sense strand and the antisense strand is 23/23. In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, according to the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is AG , The base composition of nucleotide sequence IV is CU; at this time, the length ratio of the sense strand and the antisense strand is 21/21.

Fourth siRNA

According to the present disclosure, the siRNA may be the fourth siRNA.

The fourth siRNA contains a sense strand and an antisense strand, and each nucleotide in the fourth siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleoside Acid sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, wherein the nucleotide sequence Sequence I is the same length as the nucleotide sequence shown in SEQ ID NO: 181 and has no more than 3 nucleotide differences, and the nucleotide sequence II is the same as the nucleotide sequence shown in SEQ ID NO: 182 The length is equal, and no more than 3 nucleotide differences:

5'-CUGUUUUGCUUUUGUAACZ ₁₃ -3' (SEQ ID NO: 181);

5'-Z ₁₄ GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 182),

Wherein, Z ₁₃ is U, Z ₁₄ is A, the nucleotide sequence I contains the nucleotide Z ₁₅ whose position corresponds to Z ₁₃ and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₁₄ Acid Z ₁₆ , the Z ₁₆ is the first nucleotide at the 5'end of the antisense strand.

In some embodiments, there is no more than one nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181, and/or the nucleotide sequence II and SEQ ID NO: There is no more than one nucleotide difference between the nucleotide sequences shown in 182.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182 includes the difference at position Z ₁₆ , and Z _{16 is} selected from U, C or G. In some embodiments, the nucleotide difference is a difference at the Z ₁₆ position, and Z _{16 is} selected from U, C, or G. In some embodiments, Z ₁₅ is a nucleotide that is complementary to Z ₁₆ . The siRNAs with the above-mentioned nucleotide differences have higher target mRNA inhibition ability of the siRNA, and these siRNAs containing the nucleotide differences are also within the protection scope of the present disclosure.

In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 184:

5'-CUGUUUUGCUUUUGUAACZ ₁₅ -3' (SEQ ID NO: 183);

5'-Z ₁₆ GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 184),

Wherein, Z ₁₆ is the first nucleotide at the 5'end of the antisense strand, Z _{15 is} selected from A, U, G or C, and Z ₁₆ is a nucleotide complementary to Z ₁₅ ; in some embodiments Among them, Z ₁₅ is U and Z ₁₆ is A.

In some embodiments, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV. The length of the nucleotide sequence III and the nucleotide sequence IV are each 1-4 cores. Nucleotide; the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the nucleotide sequence III is connected to 5 of the nucleotide sequence I 'End, the nucleotide sequence IV is connected to the 3'end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, This second nucleotide sequence refers to a nucleotide sequence that is adjacent to the 5'end of the nucleotide sequence represented by SEQ ID NO: 181 in the target mRNA and has the same length as the nucleotide sequence IV .

In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV are both 1 nucleotide, the base of the nucleotide sequence III is C, and the base of the nucleotide sequence IV is G ; At this time, the length ratio of the sense strand and the antisense strand is 20/20; or, the length of the nucleotide sequence III and IV are both 2 nucleotides, according to the direction from the 5'end to the 3'end, the nucleoside The base composition of acid sequence III is AC, and the base composition of nucleotide sequence IV is GU; at this time, the length ratio of the sense strand and the antisense strand is 21/21; or, the length of the nucleotide sequences III and IV Both are 3 nucleotides. According to the direction from the 5'end to the 3'end, the base composition of nucleotide sequence III is GAC, and the base composition of nucleotide sequence IV is GUC; at this time, the sense strand and the reverse The length ratio of the sense strand is 22/22; alternatively, the lengths of nucleotide sequences III and IV are both 4 nucleotides, according to the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is AGAC, the base composition of nucleotide sequence IV is GUCU; at this time, the length ratio of the sense strand and the antisense strand is 23/23. In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, according to the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is AC , The base composition of nucleotide sequence IV is GU; at this time, the length ratio of the sense strand and the antisense strand is 21/21.

The fifth siRNA

According to the present disclosure, the siRNA may be the fifth siRNA.

The fifth siRNA contains a sense strand and an antisense strand, each nucleotide in the fifth siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleoside Acid sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, wherein the nucleotide sequence Sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as the nucleotide sequence shown in SEQ ID NO: 242 The length is equal, and no more than 3 nucleotide differences:

5'-GGUUUUGUAGCAUUUUUAZ ₁₇ -3' (SEQ ID NO: 241);

5'-Z ₁₈ UAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242),

Wherein, Z ₁₇ is U, Z ₁₈ is A, the nucleotide sequence I contains the nucleotide Z ₁₉ whose position corresponds to Z ₁₇ and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₁₈ Acid Z ₂₀ , the Z ₂₀ is the first nucleotide at the 5'end of the antisense strand.

In some embodiments, there is no more than one nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241, and/or the nucleotide sequence II and SEQ ID NO: 242 shows no more than one nucleotide difference between the nucleotide sequences.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 242 includes the difference at position Z ₂₀ , and Z _{20 is} selected from U, C or G. In some embodiments, the difference is a difference between the nucleotide at position ₂₀ Z, Z ₂₀ is selected from U, C or G. In some embodiments, Z ₁₉ is a nucleotide that is complementary to Z ₂₀ . The siRNAs with the above-mentioned nucleotide differences have higher target mRNA inhibition ability of the siRNA, and these siRNAs containing the nucleotide differences are also within the protection scope of the present disclosure.

In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 243, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244:

5'-GGUUUUGUAGCAUUUUUAZ ₁₉ -3' (SEQ ID NO: 243);

5'-Z ₂₀ UAAAAAUGCUACAAAACC-3' (SEQ ID NO: 244),

Wherein, Z ₂₀ is the first nucleotide at the 5'end of the antisense strand, Z _{19 is} selected from A, U, G or C, and Z ₂₀ is a nucleotide complementary to Z ₁₉ ; in some embodiments Among them, Z ₁₉ is U and Z ₂₀ is A.

In some embodiments, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV. The length of the nucleotide sequence III and the nucleotide sequence IV are each 1-4 cores. Nucleotide; the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the nucleotide sequence III is connected to 5 of the nucleotide sequence I 'End, the nucleotide sequence IV is connected to the 3'end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, The second nucleotide sequence refers to a nucleotide sequence that is adjacent to the 5'end of the nucleotide sequence represented by SEQ ID NO: 241 and has the same length as the nucleotide sequence IV in the target mRNA .

In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 1 nucleotide, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C ; At this time, the length ratio of the sense strand and the antisense strand is 20/20; or, the length of the nucleotide sequence III and IV are both 2 nucleotides, according to the direction from the 5'end to the 3'end, the nucleoside The base composition of acid sequence III is UG, and the base composition of nucleotide sequence IV is CA; at this time, the length ratio of the sense strand and the antisense strand is 21/21; or, the length of the nucleotide sequences III and IV Both are 3 nucleotides. According to the direction from the 5'end to the 3'end, the base composition of nucleotide sequence III is CUG, and the base composition of nucleotide sequence IV is CAG; at this time, the sense strand and the reverse The length ratio of the sense strand is 22/22; alternatively, the lengths of nucleotide sequences III and IV are both 4 nucleotides, according to the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is UCUG, the base composition of nucleotide sequence IV is CAGA; at this time, the length ratio of the sense strand and the antisense strand is 23/23. In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, in the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is UG , The base composition of nucleotide sequence IV is CA; at this time, the length ratio of the sense strand and the antisense strand is 21/21.

Sixth siRNA

According to the present disclosure, the siRNA may be a sixth siRNA.

The sixth siRNA contains a sense strand and an antisense strand, each nucleotide in the sixth siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleoside Acid sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, wherein the nucleotide sequence Sequence I is the same length as the nucleotide sequence shown in SEQ ID NO: 301 and has no more than 3 nucleotide differences, and the nucleotide sequence II is the same as the nucleotide sequence shown in SEQ ID NO: 302 The length is equal, and no more than 3 nucleotide differences:

5'-GUGACUUUUUAAAAUAAAZ ₂₁ -3' (SEQ ID NO: 301);

5'-Z ₂₂ UUUAUUUUAAAAAGUCAC-3' (SEQ ID NO: 302),

Wherein, Z ₂₁ is A, Z ₂₂ is U, the nucleotide sequence I contains the nucleotide Z ₂₃ whose position corresponds to Z ₂₁ , and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₂₂ Acid Z ₂₄ , the Z ₂₄ is the first nucleotide at the 5'end of the antisense strand.

In some embodiments, there is no more than one nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301, and/or the nucleotide sequence II and SEQ ID NO: 302 shows no more than one nucleotide difference between the nucleotide sequences.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 302 includes the difference at position Z ₂₄ , and Z _{24 is} selected from A, C or G. In some embodiments, the difference is a difference between the nucleotide at position ₂₄ Z, Z ₂₄ is selected from A, C or G. In some embodiments, Z ₂₃ is a nucleotide complementary to Z ₂₄ . The siRNAs with the above-mentioned nucleotide differences have higher target mRNA inhibition ability of the siRNA, and these siRNAs containing the nucleotide differences are also within the protection scope of the present disclosure.

In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 304:

5'-GUGACUUUUUAAAAUAAAZ ₂₃ -3' (SEQ ID NO: 303);

5'-Z ₂₄ UUUAUUUUAAAAAGUCAC-3' (SEQ ID NO: 304),

Wherein, Z ₂₄ is the first nucleotide at the 5'end of the antisense strand, Z _{23 is} selected from A, U, G, or C, and Z ₂₄ is a nucleotide complementary to Z ₂₃ ; in some embodiments Among them, Z ₂₃ is A and Z ₂₄ is U.

In some embodiments, the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV. The length of the nucleotide sequence III and the nucleotide sequence IV are each 1-4 cores. Nucleotide; the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the nucleotide sequence III is connected to 5 of the nucleotide sequence I 'End, the nucleotide sequence IV is connected to the 3'end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to the second nucleotide sequence, This second nucleotide sequence refers to a nucleotide sequence that is adjacent to the 5'end of the nucleotide sequence represented by SEQ ID NO: 301 in the target mRNA and has the same length as the nucleotide sequence IV .

In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 1 nucleotide, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C ; At this time, the length ratio of the sense strand and the antisense strand is 20/20; or, the length of the nucleotide sequence III and IV are both 2 nucleotides, according to the direction from the 5'end to the 3'end, The base composition of acid sequence III is UG, and the base composition of nucleotide sequence IV is CA; at this time, the length ratio of the sense strand and the antisense strand is 21/21; or, the length of the nucleotide sequences III and IV Both are 3 nucleotides. According to the direction from the 5'end to the 3'end, the base composition of nucleotide sequence III is AUG, and the base composition of nucleotide sequence IV is CAU; at this time, the sense strand and the reverse The length ratio of the sense strand is 22/22; alternatively, the lengths of nucleotide sequences III and IV are both 4 nucleotides, according to the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is UAUG, the base composition of nucleotide sequence IV is CAUA; at this time, the length ratio of the sense strand and the antisense strand is 23/23. In some embodiments, the length of the nucleotide sequence III and the nucleotide sequence IV is 2 nucleotides, in the direction from the 5'end to the 3'end, the base composition of the nucleotide sequence III is UG , The base composition of nucleotide sequence IV is CA; at this time, the length ratio of the sense strand and the antisense strand is 21/21.

Overhanging ends and modifications of siRNA

In the following, the description of nucleotide sequence V, nucleic acid sequence, nucleotide modification in siRNA, and modification sequence is applicable to any one of the above-mentioned first siRNA to sixth siRNA. That is, if there is no specific indication, the following description of siRNA should be regarded as describing the first siRNA, the second siRNA, the third siRNA, the fourth siRNA, the fifth siRNA and the sixth siRNA one by one. . For example, if no specific siRNA is specified, "the siRNA also contains a nucleotide sequence V" means "the first siRNA, the second siRNA, the third siRNA, the fourth siRNA, the fifth siRNA Or the sixth siRNA also contains the nucleotide sequence V".

In some embodiments, the length of the sense strand and the antisense strand are different, and the antisense strand also contains a nucleotide sequence V. The length of the nucleotide sequence V is 1 to 3 nucleotides. The 3'end of the antisense strand constitutes the 3'overhang of the antisense strand. Thus, the length ratio of the siRNA sense strand and antisense strand provided by the present disclosure can be 19/20, 19/21, 19/22, 20/21, 20/22, 20/23, 21/22, 21/23 , 21/24, 22/23, 22/24, 22/25, 23/24, 23/25 or 23/26. In some embodiments, the length of the nucleotide sequence V is 2 nucleotides. Therefore, the length ratio of the siRNA sense strand and antisense strand provided by the present disclosure may be 19/21, 21/23, or 23. /25.

Each nucleotide in the nucleotide sequence V can be any nucleotide. In order to facilitate synthesis and save synthesis cost, the nucleotide sequence V is two consecutive thymine deoxyribonucleotides ( dTdT) or two consecutive uracil ribonucleotides (UU); or, in order to increase the affinity of the siRNA antisense strand with the target mRNA, the nucleotide sequence V is complementary to the nucleotide at the corresponding position of the target mRNA. Therefore, in some embodiments, the ratio of the length of the sense strand and the antisense strand of the siRNA of the present disclosure is 19/21 or 21/23. At this time, the siRNA of the present disclosure has better mRNA silencing activity.

The nucleotide at the corresponding position of the target mRNA refers to the nucleotide or nucleotide sequence adjacent to the third nucleotide sequence of the target mRNA at the 5'end. Acid sequence II is substantially reverse complementary or completely reverse complementary, or the nucleotide sequence that is substantially reverse complementary or completely reverse complementary to the nucleotide sequence composed of nucleotide sequence II and nucleotide sequence IV .

In some embodiments, for the first siRNA, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 6 Nucleotide sequence:

5'-AAGCAAGCAGACAUUUAUZ ₃ -3' (SEQ ID NO: 5);

5'-Z ₄ AUAAAUGUCUGCUUGCUUGG-3' (SEQ ID NO: 6);

Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 8:

5'-CCAAGCAAGCAGACAUUUAUZ ₃ -3' (SEQ ID NO: 7);

5'-Z ₄ AUAAAUGUCUGCUUGCUUGGGU-3' (SEQ ID NO: 8);

Wherein, Z ₄ is the first nucleotide at the 5'end of the antisense strand, Z _{3 is} selected from A, U, G or C, and Z ₄ is a nucleotide complementary to Z ₃ .

In some embodiments, for the second siRNA, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 65, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 66 Nucleotide sequence:

5'-UUUGUAGCAUUUUUAUUAZ ₇ -3' (SEQ ID NO: 65);

5'-Z ₈ UAAUAAAAAUGCUACAAAAC-3' (SEQ ID NO: 66),

Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 67, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 68:

5'-GUUUUGUAGCAUUUUUAUUAZ ₇ -3' (SEQ ID NO: 67);

5'-Z ₈ UAAUAAAAAUGCUACAAAACCC-3' (SEQ ID NO: 68),

Wherein, Z ₈ is the first nucleotide at the 5'end of the antisense strand, Z _{7 is} selected from A, U, G or C, and Z ₈ is a nucleotide complementary to Z ₇ .

In some embodiments, for the third siRNA, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 125, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 126. The nucleotide sequence shown:

5'-GCCUGGAGUUUAUUCGGAZ ₁₁ -3' (SEQ ID NO: 125);

5'-Z ₁₂ UCCGAAUAAACUCCAGGCCU-3' (SEQ ID NO: 126),

Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 127, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 128:

5'-AGGCCUGGAGUUUAUUCGGAZ ₁₁ -3' (SEQ ID NO: 127);

5'-Z ₁₂ UCCGAAUAAACUCCAGGCCUAU-3' (SEQ ID NO: 128),

Wherein, Z ₁₂ is the first nucleotide at the 5'end of the antisense strand, Z _{11 is} selected from A, U, G, or C, and Z ₁₂ is a nucleotide complementary to Z ₁₁ .

In some embodiments, for the fourth siRNA, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 185, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 186. The nucleotide sequence shown:

5'-CUGUUUUGCUUUUGUAACZ ₁₅ -3' (SEQ ID NO: 185);

5'-Z ₁₆ GUUACAAAAGCAAAACAGGU-3' (SEQ ID NO: 186),

Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 187, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 188:

5'-ACCUGUUUUGCUUUUGUAACZ ₁₅ -3' (SEQ ID NO: 187);

5'-Z ₁₆ GUUACAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 188),

Wherein, Z ₁₆ is the first nucleotide at the 5'end of the antisense strand, Z _{15 is} selected from A, U, G, or C, and Z ₁₆ is a nucleotide complementary to Z ₁₅ .

In some embodiments, for the fifth siRNA, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 245, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 246. The nucleotide sequence shown:

5'-GGUUUUGUAGCAUUUUUAZ ₁₉ -3' (SEQ ID NO: 245);

5'-Z ₂₀ UAAAAAUGCUACAAAACCCA-3' (SEQ ID NO: 246),

Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 247, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 248:

5'-UGGGUUUUGUAGCAUUUUUAZ ₁₉ -3' (SEQ ID NO: 247);

5'-Z ₂₀ UAAAAAUGCUACAAAACCCAGA-3' (SEQ ID NO: 248),

Wherein, Z ₂₀ is the first nucleotide at the 5'end of the antisense strand, Z _{19 is} selected from A, U, G or C, and Z ₂₀ is a nucleotide complementary to Z ₁₉ .

In some embodiments, for the sixth siRNA, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 305, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 306. The nucleotide sequence shown:

5'-GUGACUUUUUAAAAUAAAZ ₂₃ -3' (SEQ ID NO: 305);

5'-Z ₂₄ UUUAUUUUAAAAAGUCACCA-3' (SEQ ID NO: 306),

Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 307, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 308:

5'-UGGUGACUUUUUAAAAUAAAZ ₂₃ -3' (SEQ ID NO: 307);

5'-Z ₂₄ UUUAUUUUAAAAAGUCACCAUA-3' (SEQ ID NO: 308),

Wherein, Z ₂₄ is the first nucleotide at the 5'end of the antisense strand, Z _{23 is} selected from A, U, G or C, and Z ₂₄ is a nucleotide complementary to Z ₂₃ .

In some embodiments, the siRNA described in the present disclosure is siPCSKa1, siPCSKa2, siPCSKb1, siPCSKb2, siPCSKc1, siPCSKc2, siPCSKd1, siPCSKd2, siPCSKe1, siPCSKe2, siPCSKf1, or siPCSKf2 listed in Tables 1a-1f.

As mentioned above, the nucleotides in the siRNA of the present disclosure are each independently a modified or unmodified nucleotide. In some embodiments, the nucleotides in the siRNA of the present disclosure are unmodified nucleotides; in some embodiments, some or all of the nucleotides in the siRNA of the present disclosure are modified nucleotides. These modifications on the nucleoside group will not cause the siRNA of the present disclosure to significantly weaken or lose the function of inhibiting PCSK9 gene expression.

In some embodiments, the siRNA of the present disclosure contains at least one modified nucleotide. In the context of the present disclosure, the term "modified nucleotides" used refers to nucleotides or nucleotide analogs formed by replacing the 2'hydroxyl group of the ribose group of nucleotides with other groups, or having Nucleotides of modified bases. The modified nucleotides will not cause the siRNA to significantly weaken or lose the function of inhibiting gene expression. For example, one can select the modified nucleotides disclosed in J.K. Watts, G.F. Deleavey, and M.J. Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20):842-55.

In some embodiments, at least one nucleotide in the sense strand or the antisense strand of the siRNA provided in the present disclosure is a modified nucleotide, and/or at least one phosphate group is a phosphate with a modified group In other words, at least a part of the phosphate group and/or ribose group in the phosphate-sugar backbone of at least one single chain in the sense strand and the antisense strand is a phosphate group with a modification group and/ Or a ribose group with a modified group.

In some embodiments, all nucleotides in the sense strand and/or the antisense strand are modified nucleotides. In some embodiments, each nucleotide in the sense strand and the antisense strand of the siRNA provided in the present disclosure is independently a fluorinated modified nucleotide or a non-fluorinated modified nucleotide.

The inventors of the present disclosure surprisingly found that the siRNA described in the present disclosure achieved a high balance of plasma stability and gene silencing efficiency in animal experiments.

In some embodiments, the fluoro-modified nucleotides are located in the nucleotide sequence I and the nucleotide sequence II, and, in the direction from the 5'end to the 3'end, the nucleotide sequence I At least the 7th, 8th and 9th nucleotides are fluorinated modified nucleotides; according to the direction from the 5'end to the 3'end, at least the 2, 6, 14, 16th positions in the nucleotide sequence II The nucleotides are fluoro-modified nucleotides.

In some embodiments, the fluoro-modified nucleotides are located in the nucleotide sequence I and the nucleotide sequence II, and there are no more than 5 fluoro-modified nucleotides in the nucleotide sequence I, In addition, according to the direction from the 5'end to the 3'end, the nucleotides at positions 7, 8, and 9 of the nucleotide sequence I are fluorinated modified nucleotides; the fluorine in the nucleotide sequence II There are no more than 7 modified nucleotides, and the nucleotides at

positions

2, 6, 14, and 16 of the nucleotide sequence II are fluorinated modified nucleotides.

In some embodiments, according to the direction from the 5'end to the 3'end, in the sense strand, the nucleus at positions 7, 8, 9 or 5, 7, 8, and 9 of the nucleotide sequence I Glycolic acid is a fluorinated modified nucleotide, and the nucleotides in the remaining positions in the sense strand are non-fluorinated modified nucleotides; in the direction from the 5'end to the 3'end, in the antisense strand The nucleotides at

positions

2, 6, 14, 16 or 2, 6, 8, 9, 14, and 16 of the nucleotide sequence II are fluorinated modified nucleotides, and the antisense strand The nucleotides at the remaining positions are non-fluorinated modified nucleotides.

In the context of the present disclosure, "fluoromodified nucleotides" refer to nucleotides in which the hydroxyl group at the 2'position of the ribose group of the nucleotide is substituted with fluorine, and has a structure represented by the following formula (7). "Non-fluorinated modified nucleotides" refer to nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2'position of the ribose group of the nucleotide with a non-fluorine group. In some embodiments, each non-fluorinated modified nucleotide is independently selected from among nucleotides or nucleotide analogs formed by the substitution of a non-fluorinated group for the hydroxyl group at the 2'position of the ribose group of the nucleotide. One kind.

The nucleotides formed by replacing the hydroxyl group at the 2'position of these ribose groups with non-fluorine groups are well known to those skilled in the art, and these nucleotides can be selected from 2'-alkoxy modified nucleotides, 2'- Substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'- One of substituted amino-modified nucleotides and 2'-deoxynucleotides.

In some embodiments, the 2'-alkoxy modified nucleotides are 2'-methoxy (2'-OMe) modified nucleotides, as shown in formula (8). In some embodiments, the 2'-substituted alkoxy-modified nucleotides can be, for example, 2'-O-methoxyethyl (2'-MOE) modified nucleotides, such as formula (9 ) Shown. In some embodiments, the 2'-amino (2'-NH ₂ ) modified nucleotide is represented by formula (10). In some embodiments, the 2'-deoxynucleotide (DNA) is represented by formula (11):

Nucleotide analogs refer to nucleotides that can replace nucleotides in nucleic acids, but the structure is different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides or thymine deoxynucleotides The group of ribonucleotides. In some embodiments, the nucleotide analogs can be isonucleotides, bridged nucleotides, or acyclic nucleotides.

Bridged Nucleic Acid (BNA) refers to nucleotides that are constrained or inaccessible. BNA can contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C3'-endosugar condensed bridge structure. The bridge is usually incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide. In some embodiments, BNA may be LNA, ENA, cET BNA, etc., where LNA is shown in formula (12), ENA is shown in formula (13), and cET BNA is shown in formula (14):

Acyclic nucleotides are a type of nucleotides formed by opening the sugar ring of nucleotides. In some embodiments, acyclic nucleotides can be unlocked nucleic acids (UNA) or glycerol nucleic acids (GNA), wherein UNA is represented by formula (15) and GNA is represented by formula (16):

In the above formula (15) and formula (16), R is selected from H, OH or alkoxy (O-alkyl).

Isonucleotide refers to a compound formed by changing the position of the base in the nucleotide on the ribose ring. In some embodiments, the heteronucleotide may be a compound formed by moving a base from the 1'-position of the ribose ring to the 2'-position or the 3'-position, as shown in formula (17) or (18).

In the compounds of formula (17) to formula (18) above, Base represents a base, such as A, U, G, C or T; R is selected from H, OH, F or the non-fluorine group as described above.

In some embodiments, the nucleotide analog is selected from one of heteronucleotides, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluorinated modified nucleotide is a methoxy-modified nucleotide. In the above and below, the methoxy-modified nucleotide refers to the 2'of the ribose group. -Nucleotides formed by the substitution of a hydroxy group with a methoxy group.

In the above and below, "fluoro-modified nucleotides", "2'-fluoro-modified nucleotides", "nucleotides in which the 2'-hydroxyl group of the ribose group is substituted with fluorine" and "having 2 '-Fluoro-ribose-based nucleotides" have the same meaning, and both refer to the compound having the structure shown in formula (7) formed by replacing the 2'-hydroxyl group of the nucleotide with fluorine; "Methoxy modified core Nucleotides", "2'-methoxy-modified nucleotides", "nucleotides in which the 2'-hydroxyl group of the ribose group is substituted by a methoxy group" and "nuclei with 2'-methoxyribose groups The meaning of "nucleotide" has the same meaning, and both refer to the compound having the structure shown in formula (8) formed by replacing the 2'-hydroxyl group of the nucleotide ribose group with a methoxy group.

In some embodiments, the siRNA of the present disclosure is an siRNA with the following modifications: in the direction from the 5'end to the 3'end, in the sense strand, positions 7, 8, and 9 of the nucleotide sequence I Or the nucleotides at positions 5, 7, 8, and 9 are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides; in the antisense strand Wherein, the nucleotides at

positions

2, 6, 14, 16 or 2, 6, 8, 9, 14, and 16 of the nucleotide sequence II are fluoro-modified nucleotides, and the antisense The nucleotides at the remaining positions in the chain are methoxy modified nucleotides.

In some embodiments, the siRNA of the present disclosure is an siRNA with the following modifications: in the direction from the 5'end to the 3'end, the siRNA is at positions 5, 7, 8 and 9 of nucleotide sequence I in the sense strand The nucleotides are fluoro-modified nucleotides, the nucleotides in the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides, and, in the direction from the 5'end to the 3'end, the siRNA The nucleotides at

positions

2, 6, 8, 9, 14 and 16 of nucleotide sequence II in the antisense strand are fluorinated modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of siRNA are methoxy groups Modified nucleotides;

Or, according to the direction from the 5'end to the 3'end, the 5th, 7th, 8th and 9th nucleotides of the nucleotide sequence I in the sense strand of the siRNA are fluorinated modified nucleotides, and the sense The nucleotides at the remaining positions of the chain are methoxy-modified nucleotides, and in the direction from the 5'end to the 3'end, the second, sixth, and 14th nucleotide sequence II in the antisense strand of the siRNA And the nucleotides at position 16 are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of siRNA are methoxy-modified nucleotides;

Or, according to the direction from the 5'end to the 3'end, the nucleotides at positions 7, 8 and 9 of nucleotide sequence I in the sense strand of the siRNA are fluorinated modified nucleotides, and the sense strand of the siRNA The nucleotides at the remaining positions are methoxy-modified nucleotides, and in the direction from the 5'end to the 3'end, the second, sixth, 14th, and 16th nucleotide sequence II in the antisense strand of the siRNA The nucleotides at the position are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides.

In some embodiments, the siRNA provided in the present disclosure is siPCSKa1-M1, siPCSKa1-M2, siPCSKa1-M3, siPCSKa2-M1, siPCSKa2-M2, siPCSKa2-M3, siPCSKb1-M1, siPCSKb1- M2, siPCSKb1-M3, siPCSKb2-M1, siPCSKb2-M2, siPCSKb2-M3, siPCSKc1-M1, siPCSKc1-M2, siPCSKc1-M3, siPCSKc2-M1, siPCSKc2-M2, siPCSKc2-M3, siPCSKd1-M1, siPCSKd1-M2 siPCSKd1-M3, siPCSKd2-M1, siPCSKd2-M2, siPCSKd2-M3, siPCSKe1-M1, siPCSKe1-M2, siPCSKe1-M3, siPCSKe2-M1, siPCSKe2-M2, siPCSKe2-M3, siPCSKf1-M1, siPCSKf1-M2, siPCSKf1- Any one of M3, siPCSKf2-M1, siPCSKf2-M2, or siPCSKf2-M3.

The modified siRNA is not only low in cost, but also makes the ribonuclease in the blood difficult to cut the nucleic acid, thereby increasing the stability of the nucleic acid and making the nucleic acid more resistant to nuclease hydrolysis. At the same time, the above-mentioned modified siRNA also has a higher activity of inhibiting target mRNA.

In some embodiments, at least a part of the phosphate groups in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand of the siRNA provided in the present disclosure is a phosphate group with a modification group. In some embodiments, the phosphate ester group with a modification group is a phosphorothioate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate ester group with a sulfur atom; in some embodiments, the The phosphate group with a modified group is a phosphorothioate group with a structure shown in formula (1):

This modification can stabilize the double-stranded structure of the siRNA and maintain the high specificity and affinity of base pairing.

In some embodiments, in the siRNA provided by the present disclosure, the phosphorothioate group linkage exists in at least one of the following positions: the first and second cores of either end of the sense strand or the antisense strand Between nucleotides; between the second and third nucleotides at either end of the sense strand or the antisense strand; or any combination of the above. In some embodiments, the phosphorothioate group linkages are present at all the above positions except the 5'end of the sense chain. In some embodiments, the phosphorothioate group linkages are present at all the above positions except the 3'end of the sense chain. In some embodiments, the phosphorothioate group linkage is present in at least one of the following positions:

Between the first nucleotide and the second nucleotide of the 5'end of the sense strand;

Between the second nucleotide and the third nucleotide of the 5'end of the sense strand;

Between the first nucleotide and the second nucleotide of the 3'end of the sense strand;

Between the second nucleotide and the third nucleotide of the 3'end of the sense strand;

Between the first nucleotide and the second nucleotide of the 5'end of the antisense strand;

Between the second nucleotide and the third nucleotide of the 5'end of the antisense strand;

Between the first nucleotide and the second nucleotide of the 3'end of the antisense strand; and

Between the second nucleotide and the third nucleotide of the 3'end of the antisense strand.

In some embodiments, the siRNA provided in the present disclosure is siPCSKa1-M1S, siPCSKa1-M2S, siPCSKa1-M3S, siPCSKa2-M1S, siPCSKa2-M2S, siPCSKa2-M3S, siPCSKb1-M1S, siPCSKb1- listed in Tables 1a-1f. M2S, siPCSKb1-M3S, siPCSKb2-M1S, siPCSKb2-M2S, siPCSKb2-M3S, siPCSKc1-M1S, siPCSKc1-M2S, siPCSKc1-M3S, siPCSKc2-M1S, siPCSKc2-M2S, siPCSKc2-M3SK1-M1S, siPCSK siPCSKd1-M3S, siPCSKd2-M1S, siPCSKd2-M2S, siPCSKd2-M3S, siPCSKe1-M1S, siPCSKe1-M2S, siPCSKe1-M3S, siPCSKe2-M1S, siPCSKe2-M2S, siPCSKe2-M3S, siPCSK1S, siPCSKfSKfSK1-M3S Any one of M3S, siPCSKf2-M1S, siPCSKf2-M2S or siPCSKf2-M3S.

In some embodiments, the 5'terminal nucleotide of the siRNA antisense strand is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide.

The commonly used 5'-phosphate nucleotides or 5'-phosphate analog modified nucleotides are well known to those skilled in the art, for example, 5'-phosphate nucleotides may have the following structure:

For another example, Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48 discloses the following 4 kinds of 5'-phosphate analog modified nucleosides acid:

Wherein, R is selected from H, OH, methoxy, fluorine; Base represents a base, selected from A, U, C, G or T.

In some embodiments, the 5'-phosphate nucleotides are 5'-phosphate-containing nucleotides represented by formula (2), and the 5'-phosphate analog modified nucleotides are those containing vinyl phosphate (5 '-(E)-vinylphosphonate, E-VP) modified nucleotides, as shown in formula (3), or phosphorothioate modified nucleotides, as shown in formula (5).

In some embodiments, the siRNA provided in the present disclosure is siPCSKa1-M1P1, siPCSKa1-M2P1, siPCSKa1-M3P1, siPCSKa2-M1P1, siPCSKa2-M2P1, siPCSKa2-M3P1, siPCSKb1-M1P1, siPCSKb1- M2P1, siPCSKb1-M3P1, siPCSKb2-M1P1, siPCSKb2-M2P1, siPCSKb2-M3P1, siPCSKc1-M1P1, siPCSKc1-M2P1, siPCSKc1-M3P1, siPCSKc2-M1P1, siPCSKc2-M2P1, siPCSKc2-d1-M2P1, siPCSKc2-d1-M2P1, siPCSKc1-M3P1 siPCSKd1-M3P1, siPCSKd2-M1P1, siPCSKd2-M2P1, siPCSKd2-M3P1, siPCSKe1-M1P1, siPCSKe1-M2P1, siPCSKe1-M3P1, siPCSKe2-M1P1, siPCSKe2-M2P1, siPCSKe2-M3P1, siPCSKfSK1 M3P1, siPCSKf2-M1P1, siPCSKf2-M2P1, siPCSKf2-M3P1, siPCSKa1-M1SP1, siPCSKa1-M2SP1, siPCSKa1-M3SP1, siPCSKa2-M1SP1, siPCSKa2-M2SP1, siPCSKa2-M3SP1, siPCSKb1-M1SP1, siPCSK1 siPCSKb2-M1SP1, siPCSKb2-M2SP1, siPCSKb2-M3SP1, siPCSKc1-M1SP1, siPCSKc1-M2SP1, siPCSKc1-M3SP1, siPCSKc2-M1SP1, siPCSKc2-M2SP1, siPCSKc2-M3SP1, siPCSKd1-M1SP1, siPCSKd1-M1SP1, siPCSKd1-M1SP1 M1SP1, siPCSKd2-M2SP1, siPCSKd2-M3SP1, siPCSKe1-M1SP1, siPCSKe1-M2SP1, siPCSKe1-M3SP1, siPCSKe2-M1SP1, siPCSKe2-M2SP1, siPCSKe2-M3SP1, siPCSKf1-M1SP1 Any one of siPCSKf1-M2SP1, siPCSKf1-M3SP1, siPCSKf2-M1SP1, siPCSKf2-M2SP1, siPCSKf2-M3SP1.

Seventh siRNA

According to the present disclosure, the siRNA may be a seventh siRNA.

The seventh siRNA contains a sense strand and an antisense strand, each nucleotide in the seventh siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleoside Acid sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, wherein the nucleotide sequence Sequence I is the same length as the nucleotide sequence shown in SEQ ID NO: 399 and has no more than 3 nucleotide differences, and the nucleotide sequence II is the same as the nucleotide sequence shown in SEQ ID NO: 400 The length is equal, and no more than 3 nucleotide differences:

5'-AGACCUGUUUUGCUUUUGZ ₂₅ -3' (SEQ ID NO: 399);

5'-Z ₂₆ CAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 400),

Wherein, Z ₂₅ is U, Z ₂₆ is A, the nucleotide sequence I contains the nucleotide Z ₂₇ whose position corresponds to Z ₂₅ , and the nucleotide sequence II contains the nucleoside whose position corresponds to Z ₂₆ Acid Z ₂₈ , the Z ₂₈ is the first nucleotide at the 5'end of the antisense strand.

In some embodiments, there is no more than one nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399, and/or the nucleotide sequence II and SEQ ID NO: No more than 1 nucleotide difference between the nucleotide sequences shown in 400.

In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 400 includes the difference at position Z ₂₈ , and Z _{28 is} selected from G, U or C. In some embodiments, the nucleotide difference as a difference at a position of Z _28, Z ₂₈ is selected from G, U or C. In some embodiments, Z ₂₇ is a nucleotide that is complementary to Z ₂₈ .

In some embodiments, the nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399 includes the ninth nucleus from the 5'end of the nucleotide sequence I The difference of glycidyl acid Z, and Z is dT.

In some embodiments, the nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399 includes the difference at position Z ₂₇ , and Z _{27 is} selected from A, G or C.

In some embodiments, there are 2 nucleotide differences between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399, and the nucleotide sequence I and the nucleotide sequence Sequence II is fully reverse complementary, wherein the two nucleotide differences are the difference at positions Z and Z ₂₇ , and Z is dT, and Z _{27 is} selected from A, G, or C.

The siRNAs with the above-mentioned nucleotide differences have higher target mRNA inhibition ability of the siRNA, and these siRNAs containing the nucleotide differences are also within the protection scope of the present disclosure.

In some embodiments, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 401, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 402:

5'-AGACCUGUdTUUGCUUUUGZ ₂₇ -3' (SEQ ID NO: 401);

5'-Z ₂₈ CAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 402),

Wherein, dT is a thymine deoxynucleotide, the Z ₂₈ is the first nucleotide at the 5'end of the antisense strand, Z _{27 is} selected from A, U, G or C, and Z ₂₈ is complementary to Z ₂₇ In some embodiments, Z ₂₇ is U and Z ₂₈ is A.

In some embodiments, for the seventh siRNA, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 403, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 404. Nucleotide sequence:

5'-AGACCUGUdTUUGCUUUUGZ ₂₇ -3' (SEQ ID NO: 403);

5'-Z ₂₈ CAAAAGCAAAACAGGUCUAG-3' (SEQ ID NO: 404);

Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 405, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 406:

5'-CUAGACCUGUdTUUGCUUUUGZ ₂₇ -3' (SEQ ID NO: 405);

5'-Z ₂₈ CAAAAGCAAAACAGGUCUAGAA-3' (SEQ ID NO: 406);

In some embodiments, the siRNA described in the present disclosure is siPCSKg3 or siPCSKg4 listed in Table 1g.

In some embodiments, among the above-mentioned siRNAs with nucleotide differences at positions Z and/or Z ₂₇ , at least part of the nucleotides are modified nucleotides, and the modified nucleotides are fluoro-modified nucleosides. Acid or non-fluorinated modified nucleotides, the fluorinated modified nucleotides are located in the nucleotide sequence I and the nucleotide sequence II, and, in the direction from the 5'end to the 3'end, the nuclear At least the nucleotides at

positions

2, 6, 14, and 16 in the nucleotide sequence II are fluorinated modified nucleotides.

In some embodiments, the siRNA provided in the present disclosure is siPCSKg3-M4, siPCSKg4-M5, siPCSKg3-M4S, siPCSKg4-M5S, siPCSKg3-M4P1, siPCSKg4-M5P1, siPCSKg3-M4SP1, or siPCSKg4-M5SP1 listed in Table 1g. Any kind of.

The inventors of the present disclosure unexpectedly discovered that the siRNA provided by the present disclosure not only has significantly enhanced plasma and lysosome stability, but also has higher target mRNA inhibitory activity.

The siRNA provided in the present disclosure can be obtained by conventional siRNA preparation methods in the art (for example, solid-phase synthesis and liquid-phase synthesis). Among them, solid phase synthesis already has commercial customized services. The modified nucleotide groups can be introduced into the siRNA described in the present disclosure by using nucleoside monomers with corresponding modifications, the method for preparing nucleoside monomers with corresponding modifications and the introduction of modified nucleotide groups The siRNA method is also well known to those skilled in the art.

Pharmaceutical composition

The present disclosure provides a pharmaceutical composition containing the siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier may be a carrier conventionally used in the field of siRNA administration, such as but not limited to magnetic nanoparticles (magnetic nanoparticles, such as nanoparticles based on Fe ₃ O ₄ or Fe ₂ O ₃ ), carbon nanotubes ( carbon nanotubes), mesoporous silicon, calcium phosphate nanoparticles (calcium phosphate nanoparticles), polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, polylysine Acid (poly(L-lysine), PLL), chitosan (chitosan), 1,2-dioleoyl-3-trimethylammonium-propane (1,2-dioleoyl-3-trimethylammonium-propane, DOTAP), poly D Type or L type lactic acid/glycolic acid copolymer (poly(D&L-lactic/glycolic acid) copolymer, PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA) and poly( One or more of poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and their derivatives.

In the pharmaceutical composition, there is no special requirement for the content of siRNA and pharmaceutically acceptable carrier, and may be the conventional content of each component. In some embodiments, the weight ratio of siRNA to the pharmaceutically acceptable carrier may be 1:(1-500), and in some embodiments, the weight ratio may be 1:(1-50).

In some embodiments, the pharmaceutical composition may also contain other pharmaceutically acceptable auxiliary materials, which may be one or more of various formulations or compounds conventionally used in the art. For example, the pharmaceutically acceptable other auxiliary materials may include at least one of a pH buffer, a protective agent, and an osmotic pressure regulator.

The pH buffer can be a tris hydrochloride buffer with a pH of 7.5-8.5 and/or a phosphate buffer with a pH of 5.5-8.5, for example, it can be a phosphate with a pH of 5.5-8.5 Buffer.

The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. Based on the total weight of the pharmaceutical composition, the content of the protective agent may be 0.01-30% by weight.

The osmotic pressure regulator may be sodium chloride and/or potassium chloride. The content of the osmotic pressure regulator is such that the osmotic pressure of the pharmaceutical composition is 200-700 millosmole per kilogram (mOsm/kg). According to the required osmotic pressure, those skilled in the art can easily determine the content of the osmotic pressure regulator.

In some embodiments, the pharmaceutical composition may be a liquid preparation, such as an injection, or a lyophilized powder injection, which is mixed with liquid excipients during administration to prepare a liquid preparation. The liquid formulation can be, but not limited to, administered by subcutaneous, intramuscular or intravenous injection, and can also be, but not limited to, administered to the lungs by spraying, or administered to other organs and tissues (such as liver) by spraying through the lungs. In some embodiments, the pharmaceutical composition is for intravenous administration.

In some embodiments, the pharmaceutical composition may be in the form of a liposome formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation contains an amine-containing transfection compound (hereinafter may also be referred to as an organic amine), auxiliary lipids and/or PEGylation Lipid. Wherein, the organic amine, auxiliary lipid and pegylated lipid may be selected from the amine-containing transfection compound described in CN103380113A (incorporated in its entirety by reference) or its pharmaceutically acceptable One or more of the accepted salt or derivative, auxiliary lipid, and pegylated lipid.

In some embodiments, the organic amine may be a compound represented by formula (201) described in CN103380113A or a pharmaceutically acceptable salt thereof:

among them:

Each X ₁₀₁ or X _{102 is} independently O, S, NA or CA, where A is hydrogen or a C1-C20 hydrocarbon chain;

Each Y ₁₀₁ or Z _{101 is} independently C=O, C=S, S=O, CH-OH or SO ₂ ;

Each R ₁₀₁ , R ₁₀₂ , R ₁₀₃ , R ₁₀₄ , R ₁₀₅ , R ₁₀₆ or R _{107 is} independently hydrogen, cyclic or acyclic, substituted or unsubstituted, branched or straight chain lipid Group group, cyclic or acyclic, substituted or unsubstituted, branched or straight chain heteroaliphatic group, substituted or unsubstituted, branched or straight chain acyl group, substituted Or unsubstituted, branched or straight chain aryl, substituted or unsubstituted, branched or straight chain heteroaryl;

x is an integer of 1-10;

n is an integer of 1-3, m is an integer of 0-20, and p is 0 or 1; where, if m=p=0, R ₁₀₂ is hydrogen;

And, if at least one of n or m is 2, then R ₁₀₃ and the nitrogen in formula (201) form a structure as shown in formula (202) or formula (203):

Wherein, g, e, or f are each independently an integer from 1 to 6, "HCC" represents a hydrocarbon chain, and each *N represents a nitrogen atom in formula (201).

In some embodiments, R ₁₀₃ is a polyamine. In other embodiments, R ₁₀₃ is a ketal. In some embodiments, each of R ₁₀₁ and R ₁₀₂ in formula (201) is independently any substituted or unsubstituted, branched or straight chain alkyl or alkenyl group. The radical or alkenyl group has 3 to about 20 carbon atoms, such as 8 to about 18 carbon atoms, and 0 to 4 double bonds, such as 0 to 2 double bonds.

In some embodiments, if each of n and m independently has a value of 1 or 3, then R ₁₀₃ can be any of the following formulas (204)-(213):

Among them, in formulas (204)-(213), g, e and f are each independently an integer from 1 to 6, each "HCC" represents a hydrocarbon chain, and each * shows R ₁₀₃ and the formula (201) The possible connection points of the nitrogen atom in where each H at any * position can be replaced to achieve the connection with the nitrogen atom in formula (201).

Among them, the compound represented by formula (201) can be prepared according to the description in CN103380113A.

In some embodiments, the organic amine is an organic amine represented by formula (214) and/or an organic amine represented by formula (215):

The auxiliary lipid is cholesterol, cholesterol analogues and/or cholesterol derivatives;

The pegylated lipid is 1,2-dipalmitamide-sn-glycerol-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.

In some embodiments, in the pharmaceutical composition, the molar ratio between the organic amine, the auxiliary lipid and the pegylated lipid is (19.7-80): (19.7-80 ): (0.3-50), for example (50-70): (20-40): (3-20).

In some embodiments, the particles of the pharmaceutical composition formed by the siRNA of the present disclosure and the above-mentioned amine-containing transfection reagent have an average diameter of about 30 nm to about 200 nm, usually about 40 nm to about 135 nm, and more generally, the liposome The average diameter of the particles is about 50 nm to about 120 nm, about 50 nm to about 100 nm, about 60 nm to about 90 nm, or about 70 nm to about 90 nm, for example, the average diameter of the liposome particles is about 30, 40, 50, 60, 70 , 75, 80, 85, 90, 100, 110, 120, 130, 140, 150 or 160nm.

In some embodiments, in the pharmaceutical composition formed by the siRNA of the present disclosure and the above-mentioned amine-containing transfection reagent, the weight of the siRNA and all lipids (such as organic amines, auxiliary lipids and/or PEGylated lipids) The ratio (weight/weight ratio) is from about 1:1 to about 1:50, from about 1:1 to about 1:30, from about 1:3 to about 1:20, from about 1:4 to about 1: 18. From about 1:5 to about 1:17, from about 1:5 to about 1:15, from about 1:5 to about 1:12, from about 1:6 to about 1:12 or from about 1: In the range of 6 to about 1:10, for example, the weight ratio of the siRNA of the present disclosure to all lipids is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1 :11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, or 1:18.

In some embodiments, each component of the pharmaceutical composition may exist independently when sold, and may exist in the form of a liquid formulation when used. In some embodiments, the pharmaceutical composition formed by the siRNA provided in the present disclosure and the above-mentioned pharmaceutically acceptable carrier can be prepared according to various known methods, except that the siRNA provided in the present disclosure can replace the existing siRNA; in some In the embodiment, it can be prepared as follows:

The organic amine, auxiliary lipid and PEGylated lipid are suspended in alcohol according to the above molar ratio and mixed to obtain a lipid solution; the amount of alcohol is such that the total mass concentration of the resulting lipid solution is 2-25 mg/mL, For example, it can be 8-18 mg/mL. The alcohol is selected from pharmaceutically acceptable alcohols, such as alcohols that are liquid near room temperature, for example, ethanol, propylene glycol, benzyl alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 300, and polyethylene glycol 400 One or more of, for example, ethanol.

The siRNA provided in the present disclosure is dissolved in a buffered salt solution to obtain an aqueous siRNA solution. The concentration of the buffer salt solution is 0.05-0.5M, such as 0.1-0.2M, adjust the pH of the buffer salt solution to 4.0-5.5, such as 5.0-5.2, and the amount of the buffer salt solution is such that the concentration of siRNA does not exceed 0.6 mg /mL, for example, 0.2-0.4 mg/mL. The buffer salt is selected from one or more of soluble acetate and soluble citrate, for example, sodium acetate and/or potassium acetate.

The lipid solution and the siRNA aqueous solution are mixed, and the mixed product is incubated at 40-60°C for at least 2 minutes, for example, for 5-30 minutes, to obtain an incubated liposome preparation. The volume ratio of lipid solution and siRNA aqueous solution is 1: (2-5).

The incubated liposome preparation is concentrated or diluted to remove impurities and sterilize to obtain the pharmaceutical composition provided by the present disclosure. Its physical and chemical parameters are pH 6.5-8, encapsulation rate not less than 80%, and particle size 40-200nm, polydispersity index is not higher than 0.30, osmotic pressure is 250-400mOsm/kg; for example, the physical and chemical parameters can be pH 7.2-7.6, encapsulation rate is not less than 90%, particle size is 60-100nm, more The dispersion index is not higher than 0.20, and the osmotic pressure is 300-400mOsm/kg.

Wherein, concentration or dilution can be performed before, after or at the same time as removing impurities. Various existing methods can be used to remove impurities, such as a tangential flow system, a hollow fiber column, ultrafiltration under 100K Da conditions, and the ultrafiltration exchange solution is phosphate buffered saline (PBS) with pH 7.4. The method of sterilization can adopt various existing methods, for example, it can be filtered and sterilized on a 0.22 μm filter.

siRNA conjugate

The present disclosure provides an siRNA conjugate containing the above-mentioned siRNA and a conjugating group conjugated to the siRNA.

Generally, the conjugating group includes at least one pharmaceutically acceptable targeting group and an optional linker, and the siRNA, the linker and the targeting group are connected in sequence. In some embodiments, the targeting groups are 1-6. In some embodiments, there are 2-4 targeting groups. The siRNA molecule can be non-covalently or covalently conjugated to the conjugating group, for example can be covalently conjugated to the conjugating group. The conjugation site of the siRNA and the conjugating group can be at the 3'end or 5'end of the siRNA sense strand, or at the 5'end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments, the conjugation site of the siRNA and the conjugating group is at the 3'end of the sense strand of the siRNA.

In some embodiments, the conjugating group may be attached to the phosphate group, the 2'-position hydroxyl group or the base of the nucleotide. In some embodiments, the conjugating group can also be connected to the 3'-position hydroxyl group, in which case the nucleotides are connected by 2'-5' phosphodiester bond. When the conjugating group is attached to the end of the siRNA chain, the conjugating group is usually attached to the phosphate group of the nucleotide; when the conjugating group is attached to the internal sequence of the siRNA, the conjugating group is Usually attached to the ribose ring or base. Various connection methods can refer to the literature: Muthiah Manoharan et al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silence in vivo in hepatocytes. ACS Chemical biology, 2015, 10(5)

In some embodiments, the siRNA and the conjugating group may be connected by acid-labile or reducible chemical bonds. Under the acidic environment of cell endosomes, these chemical bonds can be degraded, so that the siRNA becomes a free state. For non-degradable conjugation methods, the conjugating group can be attached to the sense strand of the siRNA to minimize the effect of conjugation on the activity of the siRNA.

In some embodiments, the pharmaceutically acceptable targeting group may be a ligand commonly used in the field of siRNA administration, such as various ligands described in WO2009082607A2, the entire disclosure of which is incorporated by reference This article.

In some embodiments, the pharmaceutically acceptable targeting group may be selected from one or more of the following targeting molecules or ligands formed by their derivatives: lipophilic molecules, such as cholesterol, bile acids, Vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; sugars, such as lactose, polylactose, and mannose Sugar, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); receptor ligands expressed by hepatic parenchymal cells, such as asialoglycoprotein, asialosugar residues, lipoproteins (such as high density Lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitter (such as adrenaline), growth factor, transferrin, etc.

In some embodiments, each of the ligands is independently selected from a ligand capable of binding to cell surface receptors. In some embodiments, at least one ligand is a ligand capable of binding to receptors on the surface of liver cells. In some embodiments, at least one ligand is a ligand capable of binding to a mammalian cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to human liver cell surface receptors. In some embodiments, at least one ligand is a ligand capable of binding to the liver surface asialoglycoprotein receptor (ASGPR). The types of these ligands are well-known to those skilled in the art, and their role is generally to bind to specific receptors on the surface of target cells and mediate the delivery of siRNA linked to the ligand to target cells.

In some embodiments, the pharmaceutically acceptable targeting group may be any ligand that binds to the asialoglycoprotein receptor (ASGPR) on the surface of mammalian liver cells. In some embodiments, each ligand is independently an asialoglycoprotein, such as asialoorosomucoid (ASOR) or asialofetuin (ASF). In some embodiments, the ligand is a sugar or a sugar derivative.

In some embodiments, at least one ligand is a sugar. In some embodiments, each ligand is a sugar. In some embodiments, at least one ligand is a monosaccharide, polysaccharide, modified monosaccharide, modified polysaccharide, or sugar derivative. In some embodiments, at least one of the ligands may be a monosaccharide, disaccharide, or trisaccharide. In some embodiments, at least one ligand is a modified sugar. In some embodiments, each ligand is a modified sugar. In some embodiments, each ligand is independently selected from polysaccharides, modified polysaccharides, monosaccharides, modified monosaccharides, polysaccharide derivatives, or monosaccharide derivatives. In some embodiments, each or at least one ligand is selected from the group consisting of the following sugars: glucose and its derivatives, mannan and its derivatives, galactose and its derivatives, xylose and its derivatives Food, ribose and its derivatives, fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives, and sialic acid.

In some embodiments, each of the ligands may be independently selected from D-mannanose, L-mannanose, D-arabinose, D-xylofuranose, L-xylofuranose, D- Glucose, L-glucose, D-galactose, L-galactose, α-D-mannanose, β-D-mannanose, α-D-mannanose, β-D-mannanose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-frutofuranose, α-D-fructose pyranose, α-D-pyrano Galactopyrose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-tris Fluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl ]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-carboxamido-2,3-di-O -Methyl-D-mannanose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3,4-Tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-pyran half Lactose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyrano-heptanoside ethyl ester, 2,5-anhydro-D-A Loose nitrile, ribose, D-ribose, D-4-thioribose, L-ribose or L-4-thioribose. For other options of the ligand, see, for example, the description of CN105378082A, the entire disclosure of which is incorporated herein by reference.

In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate may be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule may be monovalent , Second price, three price, four price. It should be understood that the monovalent, bivalent, trivalent, and tetravalent mentioned herein refer to the siRNA molecule and the conjugation group containing galactose or N-acetylgalactosamine as the targeting group to form siRNA conjugates. After compounding, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3 or 1:4. In some embodiments, the pharmaceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, when the siRNA described in the present disclosure is conjugated with a N-acetylgalactosamine-containing conjugating group, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, when the siRNA described in the present disclosure is conjugated with a N-acetylgalactosamine-containing conjugating group, the N-acetylgalactosamine molecule is trivalent.

The targeting group can be connected to the siRNA molecule via a suitable linker, and those skilled in the art can select a suitable linker according to the specific type of the targeting group. For the types of linkers, targeting groups, and connection methods with siRNA, please refer to the disclosure of WO2015006740A2, and the entire content is incorporated herein by reference.

In some embodiments, when the targeting group is N-acetylgalactosamine, a suitable linker may have a structure as shown in formula (301):

among them,

k is an integer of 1-3;

L ^A having the formula (302) contains an amide bond-like portion of the structure shown, each of the L ^A at its two ends respectively of said group and the targeting moieties via ether linkages L ^C phase connection:

L ^B having the formula (303) comprises a pyrrolidine N- acyl chain portion shown structure, the linear portion having a carbonyl group at one end thereof and connected with the L ^C moiety through an amide bond, at the other end It has an oxygen group and is connected to the siRNA through a phosphate bond:

L ^C based aminomethane, two monovalent 2-4 aminomethane or tris (hydroxymethyl) aminomethane linking group, via an oxygen atom of the L ^C L ^A portion of each of the phases by ether linkages connection, and connected by an amide bond via a nitrogen atom and L ^B of the portion.

In some embodiments, when n=3 and L ^C is a tris-based tetravalent linking group, it is connected by -(L ^A ) ₃ tris-L ^B -as a linker The structure of the siRNA conjugate formed by N-acetylgalactosamine molecule and siRNA molecule is shown in the following formula (304):

In the formula, the double helix structure represents siRNA.

Similarly, the conjugation site of the siRNA and the conjugating group can be at the 3'end or 5'end of the siRNA sense strand, or at the 5'end of the antisense strand, or in the internal sequence of the siRNA.

In some embodiments, the present disclosure of the siRNA sense strand 3 'end by the linker - (L ^A) ₃ Tris -L ^B - with three N- acetylgalactosamine (GalNAc) Covalent Conjugation to obtain an siRNA conjugate with a molar ratio of siRNA molecules to GalNAc molecules of 1:3, which may also be referred to as (GalNAc) ₃ -siRNA hereinafter, and its structure is shown in the following formula (305):

Wherein, the double helix structure represents the siRNA, and the linker is connected to the 3'end of the sense strand of the siRNA.

In some embodiments, when the targeting group is N-acetylgalactosamine, a suitable linker may have a structure as shown in formula (306):

among them,

l is an integer from 0-3;

^* Indicates the point on the linker connected to the targeting group through an ether bond;

^# Indicates the site on the linker that is connected to the siRNA via a phosphate bond.

In some embodiments, when l=2, the siRNA conjugate has a structure as shown in formula (307):

The above-mentioned conjugate can be synthesized by a method that has been described in detail in the prior art. For example, WO2015006740A2 describes in detail the preparation methods of various conjugates. The siRNA conjugate of the present disclosure is obtained by a method well known to those skilled in the art. For example, WO2014025805A1 describes the preparation method of the structure represented by formula (305), Rajeev et al. described the preparation method of the structure represented by formula (307) in ChemBioChem2015, 16, 903-908.

In some embodiments, the siRNA conjugate has a structure as shown in formula (308):

among them:

n1 is an integer selected from 1-3, n3 is an integer selected from 0-4;

Each m1, m2 or m3 is independently an integer selected from 2-10;

R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ or R ₁₅ are each independently H, or are selected from the group consisting of C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkane Group and C ₁ -C ₁₀ alkoxy;

R ₃ is a group represented by the formula A59:

Among them, E ₁ is OH, SH or BH ₂ , and Nu is the siRNA of the disclosure;

Each L _{1 is} independently a linear alkylene group with a length of 1 to 70 carbon atoms, wherein one or more carbon atoms are optionally selected from any one or more of the following groups Replacement: C(O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene , C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene; and wherein, L ₁ may optionally have any one or more substituents in the group consisting of the following groups: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ -C ₁₀ alkyl Phenyl, -C ₁ -C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkane Group -SH, -SC ₁ -C ₁₀ haloalkyl, halogen substituent, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl -NH ₂ , -N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl phenyl), NH (C ₁ -C ₁₀ alkyl phenyl), cyano, nitro, -CO ₂ H, -C (O) O (C ₁ -C ₁₀ alkyl), -CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -CONH (C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC(O) (C ₁ -C ₁₀ alkyl), -NHC(O)(phenyl), -N(C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), -N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), -C (O) C ₁ -C ₁₀ alkyl, -C(O)C ₁ -C ₁₀ alkylphenyl, -C(O)C ₁ -C ₁₀ haloalkyl, -OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , -SO ₂ NH (C ₁ -C ₁₀ alkyl),- SO ₂ NH _{_{(phenyl), - NHSO 2 (C 1}} -C 10 alkyl), - NHSO ₂ (phenyl), and -NHSO ₂ (C ₁ -C ₁₀ haloalkyl).

In some embodiments, L ₁ may be selected from the group consisting of A1-A26 groups or any combination thereof, wherein the structure and definition of A1-A26 are as follows:

Wherein, each j1 is independently an integer of 1-20; each j2 is independently an integer of 1-20;

Each R'is independently C ₁ -C ₁₀ alkyl;

Each Ra is independently selected from the group consisting of groups represented by formulas (A27)-(A45) or any combination thereof:

Each Rb is independently C ₁ -C ₁₀ alkyl;

Represents the point at which the group is covalently attached.

The skilled person will understand that although L ₁ is defined as a linear alkylene group for convenience, it may not be a linear group or have a different name, such as an amine or alkenyl group due to the above substitutions and/or substitutions. For the purposes of this disclosure, the length of L ₁ is the number of atoms in the chain connecting the two connection points. For this purpose, a ring (such as a heterocyclylene or heteroarylene group) obtained by replacing the carbon atom of the linear alkylene group is counted as one atom.

M ₁ represents a targeting group, and its definition and selectable range are the same as the above-mentioned targeting group. In some embodiments, each M _{1 is} independently selected from one of the ligands having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells.

When M ₁ is a ligand that has affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, in some embodiments, n1 may be an integer of 1-3, and n3 may be an integer of 0-4 , To ensure that the number of M ₁ targeting groups in the conjugate is at least 2; in some embodiments, n1+n3≥2, so that the number of M ₁ targeting groups is at least 3, thereby This makes it easier for the M ₁ targeting group to bind to the asialoglycoprotein receptor on the liver surface, thereby promoting the conjugate to enter the cell through endocytosis. Experiments have shown that when the number of M ₁ targeting groups is greater than 3, the ease of binding of M ₁ targeting groups to the asialoglycoprotein receptor on the liver surface does not increase significantly. Therefore, from the ease of synthesis, Considering multiple aspects such as structure/process cost and delivery efficiency, in some embodiments, n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=2-3.

In some embodiments, each of m1, m2, or m3 are each independently an integer selected from 2 to 10, M ₁ may be a plurality of spaces between the position for the targeting group M ₁ and the surface of liver targeting group In order to make the siRNA conjugates provided in the present disclosure simpler, easier to synthesize and/or reduce cost by the binding of asialoglycoprotein receptors, in some embodiments, each m1, m2, or m3 is independently An integer of 2-5. In some embodiments, m1=m2=m3.

Those skilled in the art can understand that when R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ or R ₁₅ are each independently selected from H, C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl, and C _{One of the 1-} C ₁₀ alkoxy groups will not change the properties of the siRNA conjugate of the present disclosure, and can achieve the purpose of the present disclosure. In some embodiments, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ or R ₁₅ are each independently selected from H, methyl, or ethyl. In some embodiments, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are all H.

R ₃ is a group represented by the formula A59, wherein E ₁ is OH, SH or BH _2. Based on the consideration of the availability of raw materials for preparation, in some embodiments, E ₁ is OH or SH.

The choice of R ₂ is to realize the connection with the N atom on the nitrogen-containing skeleton and A59. In the context of the present disclosure, "nitrogen-containing skeleton" refers to a chain structure in which carbon atoms to which R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are connected and N atoms are connected to each other. Therefore, R ₂ may be any linking group capable of linking the A59 group to the N atom on the nitrogen-containing skeleton in an appropriate manner. In some embodiments, in the case of preparing the siRNA conjugate represented by formula (308) by a solid-phase synthesis process, the R ₂ group needs to also contain a connection site connected to the N atom on the nitrogen-containing backbone And the connection site to the P atom in R ₃ . In some embodiments, the site connected to the N atom on the nitrogen-containing skeleton in R ₂ forms an amide bond with the N atom, and the site connected to the P atom on R ₃ forms a phosphate bond with the P atom ; In some embodiments, R ₂ can be B5, B6, B5' or B6':

among them,

Represents the site where the groups are covalently bonded.

The value range of q ₂ can be an integer of 1-10. In some embodiments, q ₂ is an integer of 1-5.

The role of L ₁ is to connect the M ₁ targeting group to the N on the nitrogen-containing backbone to provide the liver targeting function for the siRNA conjugate represented by formula (308). In some embodiments, L _{1 is} selected from one or more linked combinations of groups of formula A1-A26. In some embodiments, L _{1 is} selected from a connection combination of one or more of A1, A4, A5, A6, A8, A10, A11, and A13. In some embodiments, L _{1 is} selected from a connection combination of at least two of A1, A4, A8, A10, and A11. In some embodiments, L _{1 is} selected from a connection combination of at least two of A1, A8, and A10.

In some embodiments, the length of L ₁ can be 3-25 atoms, 3-20 atoms, 4-15 atoms, or 5-12 atoms. In some embodiments, the length of L ₁ is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 atom.

In some embodiments, j1 is an integer of 2-10, and in some embodiments, j1 is an integer of 3-5. In some embodiments, j2 is an integer from 2-10, and in some embodiments, j2 is an integer from 3-5. R'is a C ₁ -C ₄ alkyl group, and in some embodiments, R'is one of methyl, ethyl, and isopropyl. Ra is one of A27, A28, A29, A30, and A31. In some embodiments, Ra is A27 or A28. Rb is a C ₁ -C ₅ alkyl group. In some embodiments, Rb is one of methyl, ethyl, isopropyl and butyl. In some embodiments, each of j1, j2, R', Ra, Rb is selected in formula A1-A26, so that the M ₁ targeting group is connected to the N atom on the nitrogen-containing backbone, and the M ₁ target The spatial position between the orientation groups is more suitable for the M ₁ targeting group to bind to the asialoglycoprotein receptor on the liver surface.

In some embodiments, the conjugate has the formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412 ), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422):

In some embodiments, the P atom in formula A59 can be attached to any possible position in the siRNA sequence. For example, the P atom in formula A59 can be attached to any nucleotide in the sense strand or antisense strand of the siRNA; In some embodiments, the P atom in formula A59 is connected to any nucleotide in the sense strand of the siRNA. In some embodiments, the P atom in formula A59 is connected to the end of the siRNA sense strand or antisense strand; in some embodiments, the P atom in formula A59 is connected to the end of the siRNA sense strand. The end refers to the first 4 nucleotides from one end of the sense strand or the antisense strand. In some embodiments, the P atom in formula A59 is connected to the end of the siRNA sense strand or antisense strand; in some embodiments, the P atom in formula A59 is connected to the 3'end of the siRNA sense strand. In the case of being connected to the above position of the sense strand of siRNA, after the siRNA conjugate represented by formula (308) enters the cell, when unwinding, a separate siRNA antisense strand can be released to block PCSK9 mRNA translation The protein process inhibits PCSK9 gene expression.

In some embodiments, P in formula A59 can be attached to any possible position on the nucleotide in the siRNA, for example, the 5'position of the nucleotide, the 2'position of the nucleotide, the 3'of the nucleotide Position or nucleotide base. In some embodiments, the P atom in formula A59 can be connected to the 2', 3'or 5'position of the nucleotide in the siRNA by forming a phosphodiester bond. In some embodiments, the P atom in formula A59 is connected to the oxygen atom formed after the 3'hydroxyl group of the 3'terminal nucleotide of the siRNA sense strand is dehydrogenated (at this time, the P atom in A59 can also be regarded as siRNA The P atom in the phosphate group contained in A59), or the P atom in formula A59 is connected to the nucleotide by substituting the hydrogen in the 2'-hydroxyl group of one nucleotide in the sense strand of siRNA, or the P in formula A59 The atom is connected to the nucleotide by replacing the hydrogen in the 5'hydroxyl group of the 5'terminal nucleotide of the siRNA sense strand.

The inventors of the present disclosure unexpectedly discovered that the siRNA conjugate of the present disclosure has significantly improved plasma stability and low off-target effects, while also exhibiting higher PCSK9 mRNA silencing activity, and also has higher blood lipid suppression effect. In some embodiments, the siRNA of the present disclosure may be one of the siRNAs shown in Tables 1a-1g. The conjugates containing these siRNAs showed higher PCSK9 mRNA silencing activity.

Table 1a The first siRNA sequence of the present disclosure

Table 1b The second siRNA sequence of the present disclosure

Table 1c The third siRNA sequence of the present disclosure

Table 1d The fourth siRNA sequence of the present disclosure

Table 1e The fifth siRNA sequence of the present disclosure

Table 1f The sixth siRNA sequence of the present disclosure

Table 1g The seventh siRNA sequence of the present disclosure

In the siRNA or siRNA conjugate of the present disclosure, each adjacent nucleotide is connected by a phosphodiester bond or a phosphorothioate bond, and the phosphodiester bond or phosphorothioate bond is not bridged The oxygen atom or sulfur atom has a negative charge, it can exist in the form of a hydroxyl group or a mercapto group, and the hydrogen ion in the hydroxyl group or mercapto group can also be partially or completely replaced by a cation. The cation may be any cation, such as one of metal cation, ammonium ion NH ₄ ⁺ , and organic ammonium cation. In consideration of improving solubility, in one embodiment, the cation is selected from one or more of alkali metal ions, ammonium cations formed by tertiary amines, and quaternary ammonium cations. The alkali metal ion may be K ⁺ and/or Na ⁺ , and the cation formed by the tertiary amine may be an ammonium ion formed by triethylamine and/or an ammonium ion formed by N,N-diisopropylethylamine. Therefore, the siRNA or siRNA conjugate described in the present disclosure may exist at least partially in the form of a salt. In one mode, the non-bridging oxygen atom or sulfur atom in the phosphodiester bond or phosphorothioate bond is at least partially combined with sodium ions, and the siRNA or siRNA conjugate described in the present disclosure is sodium salt or partial sodium salt. The form exists.

It is clear to those skilled in the art that modified nucleotide groups can be introduced into the siRNA described in the present disclosure by using nucleoside monomers with corresponding modifications. The method of preparing nucleoside monomers with corresponding modifications and the method of introducing modified nucleotide groups into siRNA are also well known to those skilled in the art. All modified nucleoside monomers are commercially available or prepared by known methods.

Preparation of siRNA conjugate represented by formula (308)

Any reasonable synthetic route can be used to prepare the siRNA conjugate represented by formula (308).

In some embodiments, the siRNA conjugate represented by formula (308) can be prepared by the following method, which includes under the conditions of phosphoramidite solid-phase synthesis, according to the nucleotides of the sense strand and antisense strand of the siRNA, respectively. Type and order, according to the direction of 3'to 5', connect the nucleoside monomers in turn. The connection of each nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or vulcanization; isolate the sense strand of siRNA And the antisense strand, annealing, wherein the siRNA is the above-mentioned siRNA of the present disclosure;

In addition, the method also includes contacting the compound represented by formula (321) with a nucleoside monomer or a nucleotide sequence linked to a solid support in the presence of coupling reaction conditions and a coupling reagent, so that the formula (321) The compound shown in) is linked to the nucleotide sequence through a coupling reaction. Hereinafter, the compound represented by formula (321) is also referred to as a conjugate molecule.

among them:

R ₄ is a group capable of binding to the siRNA represented by Nu in the compound represented by formula (308). In some embodiments, R ₄ is a group capable of covalently bonding to the siRNA represented by Nu. In some embodiments, R ₄ is a group capable of being conjugated to any functional group of siRNA represented by Nu through a phosphodiester bond through a reaction;

Each S _{1 is} independently a group formed by replacing all active hydroxyl groups in M ₁ with YCOO- groups, wherein each Y is independently selected from methyl, trifluoromethyl, difluoromethyl, and monofluoromethyl One of phenyl group, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl; in some embodiments , Y is methyl.

The definitions and selectable ranges of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , and M ₁ are as described above.

The choice of R ₄ is to realize the connection with the N atom on the nitrogen-containing backbone and to provide a suitable reaction site for the synthesis of the siRNA conjugate represented by formula (308). In some embodiments, R ₄ includes an R ₂ linking group or a protected R ₂ linking group, and a functional group that can react with siRNA to form the structure shown in A59.

In some embodiments, R ₄ includes a first functional group that can form a phosphite with a group on the siRNA or nucleoside monomer represented by Nu and a second functional group that can react with a hydroxyl group or an amino group to form a covalent bond, or contains The solid phase carrier connected by the covalent bond. In some embodiments, the first functional group is phosphoramidite, hydroxyl or protected hydroxyl. In some embodiments, the second functional group is phosphoramidite, carboxyl or carboxylate. In some embodiments, the second functional group is a solid support connected to other parts of the molecule via a covalent bond, and the covalent bond is formed by a hydroxyl group or an amino group. In some embodiments, the solid support is connected via a phosphate bond, a carboxylate bond, or an amide bond. In some embodiments, the solid phase carrier is a resin.

In some embodiments, the first functional group contains a hydroxyl group, -OR _k, or a group represented by formula (C3); the second functional group contains formula (C1), (C2), (C3), (C1' ) Or (C3'):

In the formula, q ₁ is an integer from ₁ to 4, X is O or NH, M ⁺ is a cation, R _k is a hydroxyl protecting group, SPS is a solid phase carrier,

Represents the point at which the group is covalently attached.

In some embodiments, the first functional group contains a phosphoramidite group, as shown in formula (C3), the phosphoramidite group can be combined with a hydroxyl group at any position on the nucleotide, such as the 2'hydroxyl group or The 3'hydroxyl group undergoes a coupling reaction to form a phosphite, which is oxidized or vulcanized to form a phosphodiester bond or a phosphorothioate bond represented by formula A59, and the conjugation molecule is conjugated to the siRNA. At this time, even if the second functional group does not exist, the compound of formula (321) can be conjugated to nucleotides without affecting the obtaining of the siRNA conjugate represented by formula (308). In this case, after obtaining the sense strand or antisense strand of the siRNA by methods such as phosphoramidite solid phase synthesis, the compound of formula (321) is reacted with the hydroxyl group on the terminal nucleotide in the nucleotide sequence, and then During the oxidation or vulcanization process, a phosphodiester linkage or phosphorothioate linkage is formed, and the compound of formula (321) is conjugated to siRNA.

In some embodiments, the first functional group contains a protected hydroxyl group. In some embodiments, the second functional group includes a group that can react with a solid-phase support, and the reaction provides a conjugate molecule including the solid-phase support. In some embodiments, the second functional group contains a carboxyl group, a carboxylate or phosphoramidite, as shown in formula (C1), (C2) or (C3), when the second functional group contains a carboxyl group or a carboxylate At this time, the compound of formula (321) undergoes an esterification reaction or amidation reaction with a solid support, such as a hydroxyl group or an amino group on the resin, to form a conjugated molecule containing the solid support connected via a carboxylate bond. When the second functional group contains a phosphoramidite functional group, the compound of formula (321) undergoes a coupling reaction with a general solid-phase carrier, such as a hydroxyl group on a resin, and is oxidized to form a solid-phase carrier-containing compound connected via a phosphodiester bond Conjugation molecule. Subsequently, starting from the product after connecting the solid phase carrier, the nucleoside monomers are sequentially connected according to the phosphoramidite solid phase synthesis method to obtain the sense strand or the antisense strand of the siRNA with the conjugation group attached. In the process of phosphoramidite solid-phase synthesis, the first functional group is deprotected and then coupled with the phosphoramidite group on the nucleoside monomer under coupling reaction conditions.

In some embodiments, the first functional group contains a hydroxyl group or a protected hydroxyl group; the second functional group contains a solid-phase carrier connected via a carboxylate bond or a solid-phase carrier connected via an amide bond, or a phosphate bond The connected solid phase carrier is represented by formula (C1') or (C3'). At this time, starting with the compound of formula (321) instead of the solid phase carrier, nucleoside monomers are sequentially connected according to the phosphoramidite solid phase synthesis method to obtain the sense strand or antisense strand of the siRNA with the conjugation group attached.

In some embodiments, the carboxylate may be expressed as -COO ^- M ⁺ , where M ⁺ is a cation, for example, one selected from the group consisting of metal cations, ammonium cations NH ₄ ⁺ , and organic ammonium cations. In one embodiment, the metal ion is selected from one of alkali metal ions, such as K ⁺ or Na ⁺ . In order to improve the solubility and make the reaction proceed smoothly, in some embodiments, the organic ammonium ion is an ammonium cation formed by a tertiary amine or a quaternary ammonium cation, such as an ammonium ion formed by triethylamine or N,N-diamine Ammonium ion formed by isopropylethylamine. In some embodiments, the carboxylate is triethylamine carboxylate or N,N-diisopropylethylamine carboxylate.

In some embodiments, R ₄ contains a structure represented by formula (B9), (B10), (B9'), (B10'), (B11), (B12), (B11') or (B12'):

Wherein, q ₁ is an integer of 1-4, q ₂ is an integer of 1-10, X is O or NH, M ⁺ is a cation, R _k is a hydroxyl protecting group, and SPS is a solid phase carrier,

Represents the point at which the group is covalently attached. In some embodiments, q ₁ is 1 or 2. In some embodiments, q ₂ is an integer of 1-5. In some embodiments, R ₄ contains a structure represented by formula (B9) or (B10). In some embodiments, R ₄ contains a structure represented by formula (B11) or (B12).

In some embodiments, R _k is Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-bismethoxytrityl), TMTr (4 ,4',4"-trimethoxytrityl). In some embodiments, R _k may be DMTr, that is, 4,4'-bismethoxytrityl ( 4,4'-dimethoxytrityl).

The definition of L ₁ is as described above.

In some embodiments, L ₁ is used to connect the M ₁ targeting group to the N atom on the nitrogen-containing backbone, thereby providing the liver targeting function for the siRNA conjugate represented by formula (308). In some embodiments, L ₁ comprises any one of A1-A26 or a combination thereof.

According to the above description, those skilled in the art can easily understand that, compared with the phosphoramidite solid-phase synthesis method known in the art, the first functional group and the optional second functional group can be used to connect the conjugated molecule. The siRNA conjugate represented by formula (308) to any possible position of the nucleotide sequence, for example, the conjugate molecule is connected to the end of the nucleotide sequence, and the conjugate molecule is connected to the end of the nucleotide sequence. Correspondingly, unless otherwise stated, in the following descriptions related to the preparation of conjugates and/or conjugated molecules, when referring to "deprotection", "coupling", "cap", "oxidation", "vulcanization", etc. During the reaction, it should be understood that the reaction conditions and reagents involved in the phosphoramidite nucleic acid solid-phase synthesis method known in the art are also applicable to these reactions. Exemplary reaction conditions and reagents will be described in detail later.

In some embodiments, each S _{1 is} independently M ₁ . In some embodiments, each S _{1 is} independently a group formed by protecting at least one active hydroxyl group in M ₁ by a hydroxyl protecting group. In some embodiments, each S _{1 is} independently a group formed by protecting all active hydroxyl groups present in M ₁ by a hydroxyl protecting group. In some embodiments, any hydroxyl protecting group known to those skilled in the art can be used to protect the active hydroxyl group in M ₁ . In some embodiments, the protected hydroxyl group can be represented by the formula YCOO-, wherein each Y is independently selected from the group consisting of C ₁ -C ₁₀ alkyl and C ₆ -C ₁₀ aryl, and the C _{The 1-} C ₁₀ alkyl group and the C ₆ -C ₁₀ aryl group are optionally substituted with one or more substituents selected from the group consisting of halogen and C ₁ -C ₆ alkyl. In some embodiments, each Y is independently selected from the group consisting of: methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl , Monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and C ₁ -C ₆ alkyl phenyl.

In some embodiments, each S _{1 is} independently selected from the group consisting of formula A46-A54:

In some embodiments, S ₁ is formula A49 or A50.

In some embodiments, each Y is independently selected from methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, normal One of propyl, isopropyl, phenyl, halophenyl, and alkylphenyl; in some embodiments, Y is methyl.

As mentioned above, the preparation method of the siRNA conjugate represented by formula (308) also includes the following steps: synthesizing another strand of siRNA (for example, when the above step synthesizes the siRNA sense strand to which the conjugate molecule is connected, also Including the synthesis of the antisense strand of siRNA according to the solid-phase synthesis method, and vice versa), separation of the sense strand and antisense strand, and annealing. Specifically, in the separation step, the solid-phase carrier connected to the nucleotide sequence and/or the conjugate molecule is cleaved, and the necessary protective group is removed (at this time, each S in the compound of formula (321) ₁ group is converted into the corresponding M ₁ targeting group) to obtain the siRNA sense strand (or antisense strand) and the corresponding antisense strand (or sense strand) connected with the conjugate molecule, and the sense strand and antisense strand are annealed A double-stranded RNA structure is formed, and the siRNA conjugate represented by formula (308) is obtained.

In some embodiments, the preparation method of the siRNA conjugate represented by formula (308) includes the following steps: in the presence of coupling reaction conditions and coupling reagents, the compound represented by formula (321) is combined with the sense strand or reverse The first nucleoside monomer at the 3'end of the sense strand is contacted to connect the compound represented by formula (321) to the first nucleotide in the sequence. Under the conditions of phosphoramidite solid-phase synthesis, according to the desired sense Chain or antisense strand nucleotide type and sequence, nucleoside monomers are sequentially connected in the 3'to 5'direction to synthesize the sense strand or antisense strand of siRNA; wherein, the compound of formula (321) is contained in R ₄ The first functional group and the second functional group, the first functional group contains a protected hydroxyl group, and the second functional group has a structure as shown in formula (C1') or (C3'). Before connecting with the first nucleoside monomer, the formula (321) The compound is deprotected; the connection of each nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization; the sense or antisense strand of the nucleic acid with the conjugation group is obtained; Under the conditions of phosphoramidite solid-phase synthesis, nucleoside monomers are sequentially connected in a 3'to 5'direction according to the type and sequence of the antisense strand or sense strand nucleotides to synthesize the antisense strand or sense strand of the nucleic acid; The connection of each nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or vulcanization; removing the protective group and cutting with the solid phase carrier, separating and purifying to obtain the sense strand and antisense strand, and annealing.

In some embodiments, the preparation method of the siRNA conjugate represented by formula (308) includes the following steps: according to the nucleotide type and sequence of the sense strand or the antisense strand in the double-stranded siRNA, in accordance with 3'to 5' The nucleoside monomers are connected in order to synthesize the sense strand and the antisense strand. The connection of each nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or vulcanization to obtain a solid-phase carrier. The sense strand and the antisense strand attached to the solid phase carrier; in the presence of coupling reaction conditions and coupling reagents, the compound represented by formula (321) and the sense strand attached to the solid phase carrier or connected to the solid phase The antisense strand on the carrier is contacted to connect the compound of formula (321) to the sense strand or the antisense strand, wherein the compound of formula (321) is a formula in which R ₄ contains the first functional group and the first functional group is a phosphoramidite group (321) compound; remove the protective group and cut with the solid phase carrier, separate and purify separately, obtain the sense strand or antisense strand of siRNA, and anneal, wherein the sense strand or antisense strand of the siRNA is connected with a conjugating group group.

In some embodiments, the P atom in formula A59 is connected to the 3'end of the sense strand in the siRNA, and the preparation method of the siRNA conjugate represented by formula (308) includes:

(1) Removal of the compound of formula (321) (wherein, the compound of formula (321) is that R ₄ contains a first functional group and a second functional group, the first functional group contains a protected hydroxyl group OR _k , and the second functional group has the formula (C1 ') or (C3') the hydroxyl protecting group R _k in the compound of the structure shown in (C3'); in the presence of coupling reaction conditions and coupling reagents, the product obtained by deprotection is contacted with the nucleoside monomer to obtain the A nucleoside monomer connected to a solid phase carrier;

(2) Starting from the nucleoside monomer connected to the solid-phase carrier by the conjugation molecule, synthesize the sense strand of siRNA by phosphoramidite solid-phase synthesis in the 3'-5' direction;

(3) Synthesize the antisense strand of siRNA by solid phase synthesis of phosphoramidite;

(4) The sense strand and antisense strand of the siRNA are separated and annealed to obtain the siRNA conjugate represented by formula (308).

Wherein, in step (1), the method for removing the protective group R _k in the compound of formula (321) includes contacting the compound of formula (321) with a deprotection reagent under deprotection conditions. The deprotection conditions include a temperature of 0-50°C, in some embodiments 15-35°C, a reaction time of 30-300 seconds, and in some embodiments 50-150 seconds, the deprotection reagent may be selected from trifluoroacetic acid One or more of trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, in some embodiments, dichloroacetic acid. The molar ratio of the deprotection reagent to the compound of formula (321) is 10:1 to 1000:1, in some embodiments 50:1 to 500:1.

The coupling reaction conditions and coupling reagents can use any conditions and reagents suitable for the aforementioned coupling reaction. In some embodiments, the same conditions and reagents as the coupling reaction in the solid phase synthesis method used can be used.

In some embodiments, the conditions of the coupling reaction include a reaction temperature of 0-50°C, and in some embodiments, 15-35°C. The molar ratio of the compound of formula (321) to the nucleoside monomer is 1:1-1:50, and in some embodiments is 1:2-1:5; the molar ratio of the compound of formula (321) and the coupling reagent can be 1:1-1:50, in some embodiments 1:3-1:10, and the reaction time is 200-3000 seconds, and in some embodiments 500-1500 seconds. The coupling reagent is selected from one or more of 1H-tetrazole, 5-ethylthio 1H-tetrazole, 5-benzylthio 1H-tetrazole, in some embodiments 5-ethylsulfide Base 1H-tetrazolium. The coupling reaction may be carried out in an organic solvent, and the organic solvent is selected from one or more of anhydrous acetonitrile, anhydrous DMF, and anhydrous methylene chloride, and in some embodiments is anhydrous acetonitrile. Relative to the compound of formula (321), the amount of the organic solvent is 3-50 L/mol, and in some embodiments, 5-20 L/mol.

In step (2), by the method of phosphoramidite nucleic acid solid-phase synthesis, using the nucleoside monomers prepared by the above steps and connected to the solid-phase carrier by the conjugate molecule, siRNA is synthesized according to the 3'-5' direction The sense strand SS of the conjugate. At this time, the conjugating group is attached to the 3'end of the resulting sense chain.

Other conditions for the solid-phase synthesis described in steps (2) and (3) include deprotection conditions of nucleoside monomers, types and amounts of deprotection reagents, coupling reaction conditions, types and amounts of coupling reagents, and capping reaction conditions. The conditions, the type and amount of the capping reagent, the oxidation reaction conditions, the type and amount of the oxidizing reagent, the vulcanization reaction conditions, and the type and amount of the vulcanizing reagent adopt various reagents, amounts and conditions conventionally used in the art.

For example, in some embodiments, the solid-phase synthesis in steps (2) and (3) may use the following conditions:

The deprotection conditions of the nucleoside monomer include a temperature of 0-50°C, in some embodiments 15-35°C, a reaction time of 30-300 seconds, and in some embodiments 50-150 seconds, the deprotection reagent can be selected One or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, monochloroacetic acid, and in some embodiments is dichloroacetic acid. The molar ratio of the deprotection reagent to the 4,4'-dimethoxytrityl protecting group on the solid support can be 2:1-100:1, and in some embodiments, 3:1-50:1 .

The coupling reaction conditions include a temperature of 0-50°C, in some embodiments 15-35°C, and the molar ratio of the nucleic acid sequence linked to the solid support to the nucleoside monomer can be 1:1-1:50. In some embodiments, it is 1:5-1:15; the molar ratio of the nucleic acid sequence connected to the solid-phase carrier and the coupling reagent is 1:1-1:100, and in some embodiments, it is 1:50-1:80 The reaction time and the choice of coupling reagents are the same as above.

The capping reaction conditions include a temperature of 0-50°C, 15-35°C in some embodiments, a reaction time of 5-500 seconds, and 10-100 seconds in some embodiments, and the selection of the capping reagent is the same as described above. The molar ratio of the total amount of capping reagent to the nucleic acid sequence linked on the solid phase carrier is 1:100-100:1, and in some embodiments, 1:10-10:1. In the case where the capping reagent uses equimolar amounts of acetic anhydride and N-methylimidazole, the molar ratio of acetic anhydride, N-methylimidazole and the nucleic acid sequence linked to the solid-phase carrier can be 1:1:10-10: 10:1, and in some embodiments 1:1:2-2:2:1.

The oxidation reaction conditions include a temperature of 0-50°C, in some embodiments 15-35°C, a reaction time of 1-100 seconds, and in some embodiments 5-50 seconds, the oxidizing reagent is iodine in some embodiments (In some embodiments, it is provided in the form of iodine water). The molar ratio of the oxidizing reagent to the nucleic acid sequence connected to the solid support in the coupling step can be 1:1-100:1, and in some embodiments, 5:1-50:1. In some embodiments, the oxidation reaction is performed in a mixed solvent of tetrahydrofuran:water:pyridine=3:1:1-1:1:3. The vulcanization reaction conditions include a temperature of 0-50°C, in some embodiments 15-35°C, a reaction time of 50-2000 seconds, and in some embodiments 100-1000 seconds, the vulcanization reagent is hydrogenation in some embodiments. Xanthan. The molar ratio of the vulcanizing reagent to the nucleic acid sequence linked to the solid support in the coupling step is 10:1 to 1000:1, and in some embodiments, 10:1 to 500:1. In some embodiments, the sulfurization reaction is carried out in a mixed solvent of acetonitrile:pyridine=1:3-3:1.

After all nucleoside monomers are connected and before annealing, the method also includes separating the sense strand and antisense strand of the siRNA. The separation method is well known to those skilled in the art, and generally includes cutting the synthesized nucleotide sequence from the solid support, removing the protective groups on the base, phosphate and ligand, purification and desalting .

Cleaving the synthesized nucleotide sequence from the solid support and removing the protective groups on the base, phosphate and ligand can be carried out according to the conventional cutting and deprotection methods in siRNA synthesis. For example, the obtained nucleotide sequence connected with the solid phase carrier is contacted with concentrated ammonia; in the process of deprotection, the protecting group YCOO- of the A46-A54 group is converted into a hydroxyl group, and the S ₁ group is converted into the corresponding The M ₁ group produces the siRNA conjugate represented by formula (308). Wherein, the concentrated ammonia water can be 25-30% by weight ammonia water, and the amount of concentrated ammonia water can be 0.2ml/μmol-0.8ml/μmol compared with the target siRNA sequence.

When there is at least one 2'-TBDMS protection on the synthesized nucleotide sequence, the method further includes contacting the nucleotide sequence removed from the solid phase carrier with triethylamine trihydrofluoride to remove the 2'-TBDMS protection. At this time, the corresponding nucleotide in the obtained target siRNA sequence has a free 2'-hydroxyl group. Compared with the target siRNA sequence, the dosage of pure triethylamine trihydrofluoride can be 0.4ml/μmol-1.0ml/μmol. In this way, the siRNA conjugate represented by formula (308) can be obtained.

Methods of purification and desalination are well known to those skilled in the art. For example, a preparative ion chromatography purification column can be used to complete the purification of nucleic acid through gradient elution of NaBr or NaCl; after the product is collected and combined, a reverse phase chromatography purification column can be used for desalting.

In the siRNA conjugate represented by formula (308) thus obtained, the non-bridging oxygen atom or sulfur atom in the phosphodiester bond or phosphorothioate bond between the nucleotides is basically bonded to the sodium ion, and the formula ( The siRNA conjugate shown in 308) basically exists in the form of sodium salt. A well-known ion exchange method can be used to replace the sodium ions with hydrogen ions and/or other cations to obtain other forms of siRNA conjugates represented by formula (308). The cation is as described above.

During the synthesis process, the purity and molecular weight of the nucleic acid sequence can be tested at any time to better control the synthesis quality. Such detection methods are well known to those skilled in the art. For example, the purity of nucleic acid can be detected by ion exchange chromatography, and the molecular weight can be determined by liquid mass spectrometry (LC-MS).

The annealing method is also well known to those skilled in the art. For example, the synthesized sense strand (SS chain) and antisense strand (AS chain) can be simply mixed in an equimolar ratio, heated to 70-95°C in water for injection, and then cooled at room temperature to form a double bond through hydrogen bonding. Chain structure. In this way, the siRNA conjugate represented by formula (308) can be obtained.

After the conjugate is obtained, in some embodiments, the synthesized siRNA conjugate represented by formula (308) can be characterized by methods such as liquid-mass spectrometry chromatography, etc., by means of molecular weight detection. It is determined that the synthesized siRNA conjugate is the siRNA conjugate represented by formula (308) designed for the target, and the sequence of the synthesized siRNA is the sequence of the desired siRNA, for example, one of the sequences listed in Tables 1a-1g One.

The compound represented by formula (321) can be obtained by the following preparation method: the method includes combining the compound represented by formula (313) with a cyclic compound in an organic solvent, under esterification reaction conditions, and in the presence of a base and an esterification catalyst. Contact with acid anhydride, ion exchange, and separation to obtain the compound represented by formula (321):

Wherein, the definitions and selectable ranges of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , and S ₁ are as described above;

R ₆ is a group providing R ₄ in formula (321); in some embodiments, R ₆ has the structure shown in formula (A61):

Among them, R _i is any group that can be connected to the N atom on the nitrogen-containing skeleton, connected to R _k O and connected to a free hydroxyl group, and R _k is a hydroxyl protecting group. At this time, what is obtained is that R ₄ contains a first functional group and a second functional group as a hydroxyl protecting group, and the second functional group contains a compound of formula (321) having a structure represented by formula (C1) or (C2).

The esterification reaction conditions include a reaction temperature of 0-100°C and a reaction time of 8-48 hours. In some embodiments, the esterification reaction conditions are a reaction temperature of 10-40°C and a reaction time of 20-30. hour.

In some embodiments, the organic solvent includes epoxy-based solvents, ether-based solvents, halogenated alkane-based solvents, dimethylsulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine One or more of. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran, the ether solvent is diethyl ether and/or methyl tert-butyl ether, and the halogenated alkane solvent is dichloromethane, trihydrofuran One or more of methyl chloride and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. Relative to the compound represented by formula (313), the amount of the organic solvent is 3-50 L/mol, and in some embodiments, 5-20 L/mol.

In some embodiments, the cyclic anhydride is one of succinic anhydride, glutaric anhydride, adipic anhydride, or pimelic anhydride, and in some embodiments, succinic anhydride. The molar ratio of the cyclic acid anhydride to the compound represented by formula (313) is 1:1-10:1, and in some embodiments, 2:1-5:1.

The esterification catalyst may be any catalyst that catalyzes the esterification reaction, for example, the catalyst may be 4-dimethylaminopyridine. The molar ratio of the catalyst to the compound represented by formula (313) is 1:1-10:1, and in some embodiments, 2:1-5:1.

In some embodiments, the base may be any inorganic base, organic base or a combination thereof. Considering solubility and product stability, the base may be, for example, a tertiary amine. In some embodiments, the tertiary amine is triethylamine or N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound represented by formula (313) is 1:1-20:1, and in some embodiments, 3:1-10:1.

The ion exchange effect is to convert the compound of formula (321) into the desired form of carboxylic acid or carboxylate. The method of ion exchange is well known to those skilled in the art. Suitable ion exchange solutions and exchange conditions can be used to obtain The conjugate molecule of M ⁺ cation will not be detailed here. In some embodiments, the ion exchange reaction is performed using a triethylamine phosphate solution, and the concentration of the triethylamine phosphate solution is 0.2-0.8M. In some embodiments, the triethylamine phosphate solution The concentration of the triethylamine phosphate solution is 0.4-0.6M, relative to the compound of formula (313), the amount of the triethylamine phosphate solution is 3-6L/mol, in a further embodiment 4-5L/mol.

Any suitable separation method can be used to separate the compound of formula (321) from the reaction mixture. In some embodiments, the solvent can be removed by evaporation, and then the compound of formula (321) can be separated by chromatographic methods. For example, the following two chromatographic conditions can be used for separation: (1) normal phase purification silica gel: 200-300 mesh silica gel filler, Use dichloromethane containing 1wt‰ of triethylamine: methanol = 100:18-100:20 gradient elution; or (2) reverse phase purification: C18, C8 reverse phase packing, use methanol: acetonitrile = 0.1:1-1 :0.1 gradient elution. In some embodiments, the solvent can be directly removed to obtain a crude product of the compound of formula (321), which can be directly used in subsequent reactions.

In some embodiments, the preparation method of the compound of formula (321) further comprises under the conditions of the condensation reaction, in an organic solvent, in the presence of a condensation agent, a condensation catalyst and a tertiary amine, the product obtained by the above ion exchange reaction It is further contacted with a solid phase carrier containing an amino group or a hydroxyl group. At this time, what is obtained is that R ₄ contains a first functional group and a second functional group, the first functional group contains a hydroxyl protecting group, and the second functional group contains a compound of formula (321) having a structure represented by formula (C1′).

The solid-phase carrier is one of the carriers used in solid-phase synthesis of siRNA, some of which are well known to those skilled in the art. For example, the solid phase carrier may be selected from solid phase carriers containing active hydroxyl groups or amino functional groups. In some embodiments, the solid phase carrier is an amino resin or a hydroxyl resin. In some embodiments, the amino or hydroxyl resin has the following parameters: a particle size of 100-400 mesh, and a surface amino or hydroxyl loading of 0.2-0.5 mmol/g. The dosage ratio of the compound represented by the formula (321) to the solid phase carrier is 10-400 μmol compound per gram of solid phase carrier (μmol/g). In some embodiments, the dosage ratio of the compound represented by formula (321) to the solid phase carrier is 50-200 μmol/g.

The organic solvent may be any suitable solvent or mixed solvent known to those skilled in the art. In some embodiments, the organic solvent is acetonitrile, epoxy solvents, ether solvents, haloalkane solvents, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropyl. One or more of ethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran, the ether solvent is diethyl ether and/or methyl tert-butyl ether, and the halogenated alkane solvent is dichloromethane, trihydrofuran One or more of methyl chloride and 1,2-dichloroethane. In some embodiments, the organic solvent is acetonitrile. Relative to the compound of formula (321), the amount of the organic solvent is 20-200 L/mol, and in some embodiments, 50-100 L/mol.

In some embodiments, the condensing agent may be benzotriazol-1-yl-oxytripyrrolidino phosphonium hexafluorophosphate (PyBop), 3- Diethoxyphosphoryl-1,2,3-benzotriazin-4(3H)-one (3-(Diethoxyphosphoryloxy)-1,2,3-benzotriazin-4(3H)-one, DEPBT) and/or O- O-benzotriazol-1-yl-tetramethyluronium hexafluorophosphate (O-benzotriazol-1-yl-tetramethyluronium hexafluorophosphate), in some embodiments, the condensing agent is O-benzotriazol-tetramethyl Urea hexafluorophosphate. The molar ratio of the condensing agent to the compound represented by formula (321) is 1:1-20:1, and in other embodiments is 1:1-5:1.

In some embodiments, the tertiary amine is triethylamine and/or N,N-diisopropylethylamine, in some embodiments it is N,N-diisopropylethylamine; the tertiary The molar ratio of amine to the compound represented by formula (321) is 1:1-20:1, and in some embodiments, 1:1-5:1.

In some embodiments, the method for preparing the compound of formula (321) may also include contacting the obtained condensation product with a capping reagent and an acylation catalyst in an organic solvent under capping reaction conditions to obtain the formula (321) Compound. The function of the capping reaction is to remove any reactive functional groups that have not yet been completely reacted, so as to avoid unnecessary by-products in subsequent reactions. The conditions of the capping reaction include a reaction temperature of 0-50°C, in some embodiments 15-35°C, and a reaction time of 1-10h, and in some embodiments 3-6h. The capping reagent can be the capping reagent used in siRNA solid-phase synthesis, and the capping reagent used in siRNA solid-phase synthesis is well known to those skilled in the art.

In some embodiments, the capping reagent consists of capping reagent 1 (cap1) and capping reagent 2 (cap2), wherein capping reagent 1 is N-methylimidazole, and in some embodiments, it is Pyridine/acetonitrile is provided as a mixed solution, wherein the volume ratio of pyridine to acetonitrile is 1:10-1:1, in some embodiments, 1:3-1:1, and the total volume of pyridine and acetonitrile is compared with N-methyl The volume ratio of imidazole is 1:1-10:1, and in some embodiments, 3:1-7:1. The capping reagent 2 is acetic anhydride. In some embodiments, the capping reagent 2 is provided in the form of a solution of acetic anhydride in acetonitrile, wherein the volume ratio of acetic anhydride and acetonitrile is 1:1-1:10, and in a further embodiment is 1:2-1 :6.

In some embodiments, the ratio of the volume of the pyridine/acetonitrile mixed solution of N-methylimidazole to the mass of the compound of formula (321) is 5ml/g-50ml/g, and in some embodiments 15ml/g- 30ml/g. The ratio of the volume of the acetonitrile solution of acetic anhydride to the mass of the compound of formula (321) is 0.5ml/g-10ml/g, and in some embodiments is 1ml/g-5ml/g.

In some embodiments, the capping reagent uses equimolar amounts of acetic anhydride and N-methylimidazole. In some embodiments, the organic solvent is acetonitrile, epoxy solvents, ether solvents, haloalkane solvents, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropyl. One or more of ethylamine. In some embodiments, the organic solvent is acetonitrile. Relative to the compound of formula (321), the amount of the organic solvent is 10-50 L/mol, and in some embodiments, 5-30 L/mol.

In some embodiments, the acylation catalyst may be selected from any catalyst that can be used for esterification condensation or amidation condensation, such as basic heterocyclic compounds. In some embodiments, the acylation catalyst is 4-dimethylaminopyridine. The mass ratio of the catalyst to the compound represented by formula (321) is 0.001:1 to 1:1, in some embodiments 0.01:1 to 0.1:1.

In some embodiments, any suitable separation method may be used to separate the compound of formula (321) from the reaction mixture. In some embodiments, the compound of formula (321) can be obtained by fully washing with an organic solvent and filtering to remove unreacted reactants, excess capping reagents and other impurities. The organic solvent is selected from acetonitrile and dichloromethane. , Methanol, in some embodiments acetonitrile.

In some embodiments, the preparation method of the conjugate molecule represented by formula (321) includes combining the compound represented by formula (313) with phosphorous in an organic solvent, under coupling reaction conditions, and in the presence of a coupling reagent. The diamide is contacted and separated to obtain the compound represented by formula (321). At this time, what is obtained is that R ₄ contains a first functional group and a second functional group, the first functional group contains a hydroxyl protecting group, and the second functional group contains a compound of formula (321) having a structure represented by formula (C3).

In some embodiments, the coupling reaction conditions include that the temperature can be 0-50°C, for example 15-35°C, and the molar ratio of the compound of formula (313) to the phosphoramidite can be 1:1-1:50, For example, it is 1:5-1:15; the molar ratio of formula (313) compound and coupling reagent can be 1:1-1:100, for example, 1:50-1:80; reaction time can be 200-3000 seconds , For example, 500-1500 seconds. The phosphoramidite may be, for example, bis(diisopropylamino)(2-cyanoethoxy)phosphine, which is commercially available or synthesized according to a method known in the art. The coupling reagent is selected from one or more of 1H-tetrazole, 5-ethylthio 1H-tetrazole, 5-benzylthio 1H-tetrazole, for example 5-ethylthio 1H-tetrazole Azole. The coupling reaction can be carried out in an organic solvent, and the organic solvent is selected from one or more of anhydrous acetonitrile, anhydrous DMF, and anhydrous methylene chloride, for example, anhydrous acetonitrile. In some embodiments, relative to the compound of formula (313), the amount of the organic solvent is 3-50 L/mol, for example, 5-20 L/mol. By carrying out this coupling reaction, the hydroxyl group in the compound of formula (313) reacts with the phosphoramidite to form a phosphoramidite group. In some embodiments, the solvent can be directly removed to obtain a crude product of the compound of formula (321), which can be directly used in subsequent reactions.

In some embodiments, the preparation method of the compound of formula (321) further includes the following steps: under coupling reaction conditions, in an organic solvent, and in the presence of a coupling reagent, the separated product is further combined with a hydroxyl-containing product. The solid support is brought into contact. Subsequently, after capping reaction and oxidation reaction, the compound of formula (321) is isolated. In this case, obtained is R ₄ contains a first functional group and a second functional group, the first functional group containing a hydroxyl protective group, the second functional group having a compound of the formula (C3 ') of formula (321) structure shown in FIG.

In some embodiments, the solid phase carrier is a solid phase carrier known in the art that can be used for nucleic acid solid phase synthesis, for example, it may be a commercially available general solid phase carrier after deprotection reaction (

UnyLinker ^TM 300 Oligonucleotide Synthesis Support, Kinovate Life Sciences company, structure shown in formula B80):

The deprotection reaction is well known to those skilled in the art. In some embodiments, the deprotection conditions include a temperature of 0-50°C, such as 15-35°C, and a reaction time of 30-300 seconds, such as 50-150 seconds. The deprotection reagent can be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid. In some embodiments, the deprotection reagent is dichloroacetic acid. The molar ratio of the deprotection reagent to the -DMTr (4,4'-dimethoxytrityl) protecting group on the stationary phase is 2:1-100:1, for example, 3:1-50:1. By performing the deprotection, a reactive free hydroxyl group is obtained on the surface of the solid support, which facilitates subsequent coupling reactions.

The coupling reaction conditions and the selection of coupling reagents can be as described above. Through the coupling reaction, the free hydroxyl group formed in the deprotection reaction reacts with the phosphoramidite group to form a phosphite linkage.

In some embodiments, the capping reaction conditions include a temperature of 0-50°C, such as 15-35°C, and a reaction time of 5-500 seconds, such as 10-100 seconds, and the capping reaction is performed in the presence of a capping reagent. The selection and amount of capping reagent can be as described above.

The oxidation reaction conditions include a temperature of 0-50°C, such as 15-35°C, a reaction time of 1-100 seconds, such as 5-50 seconds, and an oxidizing reagent such as iodine (in some embodiments, iodine Provided in the form of water). In some embodiments, the molar ratio of the oxidizing reagent to the nucleic acid sequence linked to the solid phase carrier is 1:1-100:1, for example, it may be 5:1-50:1. In some embodiments, the oxidation reaction is performed in a mixed solvent of tetrahydrofuran:water:pyridine=3:1:1-1:1:3.

In some embodiments, R ₆ is one of the groups of formula B7 or B8,

The definition of q _2, R _k is as mentioned above,

At this time, the compound represented by formula (313) can be obtained by the following preparation method: in an organic solvent, under amidation reaction conditions, and in the presence of a condensing agent and tertiary amine for amidation reaction, the formula (314) The compound is contacted with the compound represented by formula (A-1) or the compound represented by formula (A-2), and then separated:

Among them, n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , S ₁ , q ₂ and R _k are each defined and selectable ranges as As mentioned earlier.

The amidation reaction conditions may include a reaction temperature of 0-100°C and a reaction time of 1-48 hours. In some embodiments, the amidation reaction conditions may include a reaction temperature of 10-40°C and a reaction time of 2- 16 hours.

In some embodiments, the organic solvent is alcohol solvent, epoxy solvent, ether solvent, halogenated alkane solvent, dimethyl sulfoxide, N,N-dimethylformamide and N,N-diiso One or more of propylethylamine. The alcohol solvent is one or more of methanol, ethanol, and propanol in some embodiments, and ethanol in some embodiments. The epoxy solvent is dioxane and/or tetrahydrofuran in some embodiments. The ether solvent is diethyl ether and/or methyl tert-butyl ether in some embodiments. The halogenated alkane solvent is one or more of dichloromethane, chloroform and 1,2-dichloroethane in some embodiments. In some embodiments, the organic solvent is dichloromethane. Relative to the compound of formula (314), the amount of the organic solvent is 3-50 L/mol, and in a further embodiment, 3-20 L/mol.

In some embodiments, the amidation reaction condensing agent is benzotriazol-1-yl-oxytripyrrolidinylphosphonium hexafluorophosphate, 3-diethoxyphosphoryl-1,2, 3-Benzazole 4(3H)-one, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, 2-ethoxy-1-ethoxy Carbonyl-1,2-dihydroquinoline (EEDQ) or O-benzotriazole-tetramethylurea hexafluorophosphate, in a further embodiment 3-diethoxyphosphoryl- 1,2,3-Benzazole 4(3H)-one. The molar ratio of the amidation reaction condensing agent to the compound represented by formula (314) may be 1:1-10:1, and in some embodiments, 2.5:1-5:1.

In some embodiments, the tertiary amine is triethylamine or N,N-diisopropylethylamine, and in a further embodiment is N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound represented by formula (314) is 3:1-20:1, and in some embodiments, 5:1-10:1.

In some embodiments, the compounds of formula (A-1) and formula (A-2) can be prepared in any suitable manner. For example, when R _k is a DMTr group, the compound of formula (A-1) can be prepared by reacting calcium glycerate with DMTrCl; similarly, 3-amino-1,2-propanediol can be contacted with cyclic anhydride first, and then The compound of formula (A-2) is prepared by reacting with DMTrCl. The cyclic anhydride may be a cyclic anhydride having 4-13 carbon atoms, and in some embodiments, 4-8. It is easily understood by those skilled in the art that the selection of the cyclic anhydride corresponds to different values of q ₂ in the compound (A-2). For example, when the cyclic anhydride is succinic anhydride, q ₂ = 1, When the cyclic anhydride is glutaric anhydride, q ₂ =2, and so on.

In some variations, the compound of formula (313) can also be prepared by sequentially reacting the compound represented by formula (314) with the cyclic anhydride, 3-amino-1,2-propanediol and DMTrCl. It is easily understood by those skilled in the art that these modifications will not affect the structure and function of the compound of formula (313), and these modifications are easily realized by those skilled in the art on the basis of the above methods.

Similar to the above, any suitable separation method can be used to separate the compound of formula (313) from the reaction mixture. In some embodiments, the solvent can be removed by evaporation, and then the compound of formula (313) can be separated by chromatographic methods. For example, the following two chromatographic conditions can be used for separation: (1) Normal phase purified silica gel: 200-300 mesh silica gel filler, Use petroleum ether: ethyl acetate: dichloromethane: N, N-dimethylformamide=1:1:1:0.5-1:1:1:1:0.6 gradient elution; and (2) reverse phase purification: C18 , C8 reverse phase packing, using methanol: acetonitrile = 0.1:1-1:0.1 gradient elution. In some embodiments, the solvent can be directly removed to obtain a crude product of the compound of formula (313), which can be directly used in subsequent reactions.

In some embodiments, the compound represented by formula (314) can be obtained by the following preparation method: the method includes in an organic solvent, in the presence of a condensing agent for amidation reaction and a tertiary amine, under condensation reaction conditions, the formula ( The compound represented by 320) is contacted with the compound represented by formula (316) and then separated:

Wherein, n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , and R _{15 have} the same definitions and selectable ranges as described above.

The compound of formula (316) can be prepared by, for example, the compounds disclosed in J. Am. Chem. Soc. 2014, 136, 16958-16961, or the compound of formula (316) can be prepared by a person skilled in the art by various methods, for example, Certain compounds of formula (316) were prepared with reference to the method disclosed in Example 1 of US Patent No. 8,106,022 B2, and the entire contents of the above documents are incorporated herein by reference in their entirety.

In some embodiments, the condensation reaction conditions include a reaction temperature of 0-100°C and a reaction time of 0.1-24 hours, and in some embodiments, a reaction temperature of 10-40°C and a reaction time of 0.5-16 hours.

Taking into account the structure of the compound of formula (314) as the desired product, the molar ratio of the compound represented by formula (316) to the compound represented by formula (320) should be determined based on the sum of n1 and n3 in formula (320). In some embodiments, for example, when n1+n3=3, in order to ensure that the reaction is complete and not excessive, the molar ratio of the compound represented by formula (316) to the compound represented by formula (320) may be 3:1- 3.5:1, in some embodiments 3.01:1-3.15:1.

In some embodiments, the organic solvent is acetonitrile, epoxy solvents, ether solvents, haloalkane solvents, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropyl. One or more of ethylamine, the epoxy solvent is dioxane and/or tetrahydrofuran in some embodiments, and the ether solvent is diethyl ether and/or methyl tert-butyl in some embodiments In some embodiments, the halogenated alkane solvent is one or more of dichloromethane, chloroform and 1,2-dichloroethane. In some embodiments, the organic solvent is two Methyl chloride. Relative to the compound of formula (320), the amount of the organic solvent is 3-50 L/mol, and in some embodiments, 5-20 L/mol.

In some embodiments, the amidation reaction condensing agent is benzotriazol-1-yl-oxytripyrrolidinylphosphonium hexafluorophosphate, 3-diethoxyphosphoryl-1,2, 3-Benzazole 4(3H)-one (DEPBT), O-benzotriazole-tetramethylurea hexafluorophosphate/ester, 4-(4,6-dimethoxytriazin-2-yl) ) One or more of 4-methylmorpholine hydrochloride or 1-hydroxybenzotriazole, in a further embodiment, benzotriazol-1-yl-oxytripyrrolidinyl phosphonium A mixture of hexafluorophosphate and 1-hydroxybenzotriazole, wherein benzotriazol-1-yl-oxytripyrrolidinyl phosphonium hexafluorophosphate and 1-hydroxybenzotriazole are etc. Molar amount. The molar ratio of the total amidation reaction condensing agent to the compound represented by formula (316) may be 1:1-3:1, and in some embodiments, 1.05:1-1.5:1.

The tertiary amine can be N-methylmorpholine, triethylamine, or N,N-diisopropylethylamine, and in some embodiments, it is N-methylmorpholine; the tertiary amine has the same formula ( The molar ratio of the compound shown in 316) may be 2:1-10:1, and in some embodiments, 2:1-5:1.

Similar to the above, any suitable separation method can be used to separate the compound of formula (314) from the reaction mixture. In some embodiments, the solvent can be removed by evaporation, and then the compound of formula (314) can be separated by chromatography. For example, the following two chromatographic conditions can be used for separation: (1) Normal phase purification silica gel: 200-300 mesh silica gel filler, using Dichloromethane: methanol = 100:5-100:7 gradient elution; and (2) reverse phase purification: C18, C8 reverse phase packing, using methanol: acetonitrile = 0.1:1 to 1:0.1 gradient elution. In some embodiments, the solvent can be directly removed to obtain a crude product of the compound of formula (314), which can be directly used in subsequent reactions.

The compound of formula (320) is commercially available or can be obtained by a person skilled in the art using known methods. For example, when m1=m2=m3=3, n1=1, n3=2, and each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , and R ₁₅ is H, the compound of formula (320) can Commercially purchased from Alfa Aesar.

The siRNA conjugate of the present disclosure can also be used in combination with other pharmaceutically acceptable excipients, which can be one or more of various formulations or compounds conventionally used in the art. For details, please refer to the above about the present disclosure. Description of the pharmaceutical composition.

Application of siRNA, pharmaceutical composition and conjugate of the present disclosure

In some embodiments, the present disclosure provides a method for preventing and/or treating diseases or physiological conditions caused by abnormal expression of the PCSK9 gene, the method comprising applying an effective amount of the siRNA and/or pharmaceutical composition of the present disclosure and/or Or the siRNA conjugate is administered to a subject in need.

By administering the siRNA active ingredients of the present disclosure to subjects in need, the purpose of preventing and/or treating diseases or physiological conditions caused by the abnormal expression of the PCSK9 gene can be achieved through the mechanism of RNA interference. Therefore, the siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present disclosure can be used to prevent and/or treat diseases or physiological conditions caused by the abnormal expression of the PCSK9 gene, or to prepare for the prevention and/or treatment of Drugs for diseases or physiological conditions caused by abnormal expression of PCSK9 gene.

In some embodiments, the disease or physiological condition caused by the abnormal expression of the PCSK9 gene refers to hypercholesterolemia, and cardiovascular diseases such as atherosclerosis, coronary heart disease, and hypertension caused thereby.

The term "administration/administration" as used herein refers to a method or approach that allows the siRNA, pharmaceutical composition and/or siRNA conjugate of the present disclosure to be at least partially positioned at a desired site to produce a desired effect. The siRNA, pharmaceutical composition, and/or siRNA conjugate of the present disclosure are placed in a subject. The routes of administration suitable for the methods of the present disclosure include local administration and systemic administration. Generally speaking, local administration results in the delivery of more siRNA conjugates to a specific site compared to the subject's systemic circulation; while systemic administration results in the delivery of the siRNA, pharmaceutical composition and/or siRNA conjugate of the present disclosure Basic systemic circulation to the subject. Considering that the present disclosure can provide a means to prevent and/or treat hypercholesterolemia, in some embodiments, an administration method capable of delivering drugs to the liver is adopted.

The subject can be administered to the subject by any suitable route known in the art, including but not limited to: oral or parenteral routes, such as intravenous administration, intramuscular administration, subcutaneous administration, and transdermal administration. Medicine, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration and topical administration (including buccal administration and sublingual administration). The frequency of administration can be one or more times per day, every week, every two weeks, every three weeks, every month, every two months, every three months, every six months, or every year.

The dosage of the siRNA, pharmaceutical composition or siRNA conjugate described in the present disclosure can be a conventional dosage in the art, and the dosage can be determined according to various parameters, especially the age, weight and sex of the subject. Toxicity and efficacy can be measured in cell culture or laboratory animals through standard pharmaceutical procedures, such as measuring LD ₅₀ (lethal dose that kills 50% of the population), ED ₅₀ (in quantitative response, the dose that can cause 50% of the maximum response intensity, In the qualitative response, it refers to the dose that can cause a positive response in 50% of the subjects) or IC ₅₀ (the concentration of inhibitor/drug when the quantitative response is inhibited by half). The range of human doses can be derived based on data obtained from cell culture analysis and animal studies.

When administering the siRNA, pharmaceutical composition and/or siRNA conjugate described in the present disclosure, for example, for male or female cynomolgus monkeys aged 3-5 years and weighing 2-6 kg, the amount of siRNA is calculated as: ( i) For siRNA conjugates, the amount of siRNA can be 0.001-100 mg/kg body weight, in some embodiments 0.01-50 mg/kg body weight, in some embodiments 0.05-20 mg/kg body weight, and in other embodiments In some embodiments, it is 0.1-15 mg/kg body weight, and in other embodiments, it is 0.1-10 mg/kg body weight; (ii) For a pharmaceutical composition formed by siRNA and a pharmaceutically acceptable carrier, the amount of siRNA may be 0.001-50 mg/kg The body weight is 0.01-10 mg/kg body weight in some embodiments, 0.05-5 mg/kg body weight in some embodiments, and 0.1-3 mg/kg body weight in some embodiments.

In some embodiments, the present disclosure provides a method for inhibiting PCSK9 gene expression in liver cells, the method comprising combining an effective amount of the siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present disclosure with the liver. Cell contact, the siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present disclosure are introduced into the hepatocytes, and the purpose of inhibiting PCSK9 gene expression in the hepatocytes is achieved through the mechanism of RNA interference. The liver cells may be selected from liver cancer cell lines such as SMMC-7721, HepG2, Huh7, or isolated primary liver cells. In some embodiments, the cell is a HepG2 liver cancer cell.

Using the method provided in the present disclosure to inhibit PCSK9 gene expression in cells, the amount of siRNA in the provided modified siRNA, pharmaceutical composition and/or siRNA conjugate is generally such an amount that it is sufficient to reduce the expression of the target gene, and This results in an extracellular concentration of 1 pM to 1 μM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM, or 0.05 nM to about 5 nM at the surface of the target cell. The amount required to achieve this local concentration will vary with various factors, including the delivery method, the delivery site, the number of cell layers between the delivery site and the target cell or tissue, the delivery route (local or systemic), etc. . The concentration at the delivery site can be significantly higher than the concentration at the surface of the target cell or tissue.

Reagent test kit

The present disclosure provides a kit comprising an effective amount of at least one of the modified siRNA, pharmaceutical composition and siRNA conjugate of the present disclosure.

In some embodiments, the kits described herein can provide modified siRNA in one container. In some embodiments, the kits described herein may include a container that provides pharmaceutically acceptable excipients. In some embodiments, the kit may also contain other ingredients, such as stabilizers or preservatives. In some embodiments, the kits described herein may contain at least one other therapeutic agent in a container other than the container that provides the modified siRNA described herein. In some embodiments, the kit may include instructions for mixing the modified siRNA with pharmaceutically acceptable carriers and/or excipients or other ingredients (if any).

In the kit of the present disclosure, the modified siRNA and a pharmaceutically acceptable carrier and/or adjuvant, and the modified siRNA, pharmaceutical composition and/or siRNA conjugate and/or conjugate, and/ Or pharmaceutically acceptable excipients can be provided in any form, such as liquid form, dried form or lyophilized form. In some embodiments, the modified siRNA and pharmaceutically acceptable carriers and/or adjuvants and the pharmaceutical composition and/or conjugate and optional pharmaceutically acceptable adjuvants are substantially pure and/or Sterile. In some embodiments, sterile water can be provided in the kit of the present disclosure.

The following examples will further illustrate the present disclosure, but the present disclosure is not limited in any way.

Example

Unless otherwise specified, the reagents and media used in the following examples are all commercially available products, and the nucleic acid electrophoresis, real-time PCR and other operations used are described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)) Method to proceed.

When transfecting cells with siRNA, siRNA conjugate or siRNA and siRNA conjugate for PCSK9 gene synthesized in the present disclosure, Lipofectamine ^TM 2000 (Invitrogen) is used as the transfection reagent, and the specific operation refers to the instructions provided by the manufacturer .

Unless otherwise stated, the reagent ratios provided below are calculated by volume ratio (v/v).

The experimental data are

(Mean±standard error) means that the data analysis uses Graphpad prism 6.0 statistical analysis software. Use One-way ANOVA for analysis, and use Tukey as the analysis method to compare between groups to determine whether the differences between groups are significant. If there is no significant difference under the One-way ANOVA method, use T-test when the overall P<0.05 Two-tailed detection was performed, and when p<0.05, there was a significant difference between the two groups.

Preparation Example 1 Preparation of Conjugate 1

In this preparation example, the conjugate 1 shown in Table 3 was synthesized, and its number was L10-siPCSKa1M1S. The siRNA conjugated in this conjugate has the sense strand and antisense strand sequences corresponding to conjugate 1 in Table 3.

(1-1) Synthesis of L-10 compound

The L-10 compound was synthesized according to the following method:

(1-1-1) Synthesis of conjugated terminal GAL-5

(1-1-1a) Synthesis of GAL-2

Dissolve 100.0g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS number: 1772-03-8, purchased from Ningbo Hongxiang Biochemical Company, 463.8mmol) in 1000ml of anhydrous pyridine, under ice water bath 540ml of acetic anhydride (purchased from Enox Company, 5565.6mmol) was added, and the reaction was stirred at room temperature for 1.5 hours. The reaction solution was poured into 10L ice water, filtered under reduced pressure, and the filter cake was washed with 2L ice water, and acetonitrile/toluene mixed solvent (volume ratio acetonitrile:toluene=1:1) was added to completely dissolve, the solvent was evaporated to dryness, and white The solid product GAL-2 130.0g.

(1-1-1b) Synthesis of GAL-3

Dissolve the GAL-2 (35.1g, 90.0mmol) obtained in step (1-1-1a) in 213ml of anhydrous 1,2-dichloroethane, add 24.0g of trichloroethane in an ice water bath and under nitrogen protection. Trimethylsilyl fluoromethanesulfonate (TMSOTf, CAS number: 27607-77-8, purchased from Macleans, 108.0 mmol), react at room temperature overnight.

Add 400ml of dichloromethane to the reaction solution to dilute, filter with diatomaceous earth, add 1L of saturated sodium bicarbonate aqueous solution, stir evenly, separate the organic phase, and extract the aqueous phase with dichloroethane twice, 300ml each time, and combine The organic phase was washed with 300 ml of saturated sodium bicarbonate aqueous solution and 300 ml of saturated brine respectively, the organic phase was separated, dried with anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure to obtain 26.9 g of light yellow viscous sugar thin product GAL-3.

(1-1-1c) Synthesis of GAL-4

The GAL-3 (26.9g, 81.7mmol) obtained in step (1-1-1b) was dissolved in 136ml of anhydrous 1,2-dichloroethane, and the dried

30g molecular sieve powder, then add 9.0g 5-hexen-1-ol (CAS number: 821-41-0, purchased from Adamas-beta company, 89.9mmol), stir at room temperature for 30 minutes, add under ice bath and nitrogen protection 9.08g TMSOTf (40.9mmol), stirred and reacted overnight at room temperature. Filter to remove

Molecular sieve powder, the filtrate is diluted with 300ml dichloromethane, filtered with diatomaceous earth, and then 500ml saturated sodium bicarbonate aqueous solution is added and stirred for 10 minutes to wash, separate the organic phase, the aqueous phase is extracted once with 300ml dichloroethane, and the organic phases are combined They were washed with 300ml saturated sodium bicarbonate aqueous solution and 300ml saturated brine respectively, the organic phase was separated, dried with anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure to obtain 41.3g of yellow sugar thin product GAL-4, which was carried out directly without purification. One-step oxidation reaction.

(1-1-1d) Synthesis of GAL-5

GAL-4 (14.9g, 34.7mmol,) obtained according to the method described in step (1-1-1c) was dissolved in a mixed solvent of 77ml dichloromethane and 77ml acetonitrile, and 103ml deionized water and 29.7g were added respectively Sodium periodate (CAS number: 7790-28-5, purchased from Aladdin Company, 138.8mmol), stirred under ice water bath for 10 minutes, adding ruthenium trichloride (CAS number: 14898-67-0, purchased from An Nai Kyrgyzstan, 238mg, 1.145mmol), react at room temperature overnight. The reaction solution was diluted with 300 ml of water and stirred, and saturated sodium bicarbonate was added to adjust the pH to about 7.5. The organic phase was separated and discarded. The aqueous phase was extracted with dichloromethane three times with 200 ml each time and the organic phase was discarded. Adjust the pH of the aqueous phase to about 3 with citric acid solid, extract three times with 200ml of dichloromethane, combine the organic phases, dry with anhydrous sodium sulfate, and evaporate the solvent under reduced pressure to obtain 6.85g of white foamy solid product GAL-5 . ¹ H NMR(400MHz,DMSO)δ12.01(br,1H), 7.83(d,J=9.2Hz,1H), 5.21(d,J=3.2Hz,1H), 4.96(dd,J=11.2,3.2 Hz,1H), 4.49(d,J=8.4Hz,1H), 4.07–3.95(m,3H), 3.92–3.85(m,1H), 3.74–3.67(m,1H), 3.48–3.39(m, 1H), 2.20 (t, J = 6.8Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.90 (s, 3H), 1.77 (s, 3H), 1.55-1.45 (m, 4H) ).

(1-1-2) Synthesis of L-8:

J-0 (9.886g, 52.5mmol, commercially available from Alfa Esha) and GAL-5 (72.819g, 162.75mmol) obtained in step (1-1-1), obtained by combining multiple batches of products ) Was dissolved in 525ml of dichloromethane, and diisopropylethylamine (DIEA, 44.782g, 346.50mmol), benzotriazol-1-yl-oxytripyrrolidinyl phosphonium hexafluorophosphate (PyBOP, 90.158g, 173.25mmol) and hydroxybenzotriazole (HOBt, 23.410g, 173.25mmol), react at room temperature for 4h, add 20ml saturated sodium bicarbonate and 200ml saturated brine for washing, and extract the aqueous phase twice with dichloromethane , 100ml each time, combine the organic phases, dry with anhydrous sodium sulfate, filter and evaporate the solvent under reduced pressure to obtain a crude product. Purification uses 200-300 mesh normal phase silica gel, neutralizes the acidity of silica gel with 10wt% triethylamine, equilibrates the column with 1wt‰ triethylamine, and eluates with a gradient of dichloromethane:methanol=100:25-100:40, and collects the product wash The liquid was removed, and the solvent was evaporated under reduced pressure to obtain 38.8 g of pure product L-8. ¹ H NMR(400MHz,DMSO)δ7.84(d,J=9.0Hz,3H), 7.27–7.23(m,1H), 7.13–7.18(m,1H), 5.22(d,J=3.1Hz,3H ), 4.97 (dd, J = 11.3, 3.1 Hz, 3H), 4.48 (d, J = 8.4 Hz, 3H), 4.09-3.98 (m, 9H), 3.88 (dd, J = 19.3, 9.3 Hz, 3H) ,3.75–3.66(m,3H), 3.44–3.38(m,3H), 3.17–3.30(m,4H), 3.10–2.97(m,4H), 2.35–2.20(m,6H), 2.15–2.08( m,9H),2.07–1.98(m,13H),1.94–1.87(m,9H),1.81–1.74(m,9H),1.65–1.42(m,18H).MS m/z: C ₈₅ H ₁₁₉ N ₇ O ₃₀ , [M+H] ⁺ , theory: 1477.59, actual measurement: 1477.23.

(1-1-3a) Synthesis of A-1

Dissolve DMTrCl (4,4'-bismethoxytrityl chloride, 101.65g, 300mmol) in 1000ml of anhydrous pyridine, add DL-calcium glycerate hydrate (28.63g, 100mmol), and react at 45℃ After 20h, the reaction solution was filtered, the filter cake was rinsed with 200ml DCM, the filtrate was concentrated to dryness under reduced pressure, the residue was redissolved with 500ml dichloromethane, and washed with 0.5M triethylamine phosphate (pH=7-8) twice. 200ml each time, the aqueous phase was extracted twice with dichloromethane, 200ml each time, the organic phases were combined, dried with anhydrous sodium sulfate, filtered, and the solvent was evaporated under reduced pressure. Purified by 200-300 mesh normal phase silica gel column and purified with petroleum ether : Ethyl acetate: dichloromethane: methanol=1:1:1:0.35-1:1:1:0.55 gradient elution, collect the product eluent, evaporate the solvent under reduced pressure, and re-dissolve in 600ml dichloromethane to Wash with 200ml 0.5M triethylamine phosphate once, extract the aqueous phase with 200ml dichloromethane once, combine the organic phases, dry with anhydrous sodium sulfate, filter, evaporate the solvent under reduced pressure, vacuum oil pump overnight under reduced pressure to obtain white The solid product A-1 50.7g. ¹ H NMR(400MHz,DMSO-d6)δ7.46(ddd,J=6.5,2.3,1.1Hz,1H), 7.40–7.28(m,7H), 6.89–6.81(m,4H), 4.84(d, J = 5.0Hz, 1H), 4.36–4.24 (m, 1H), 4.29 (s, 6H), 3.92 (dd, J = 12.4, 7.0 Hz, 1H), 3.67 (dd, J = 12.3, 7.0 Hz, 1H ),2.52(q,J=6.3Hz,6H),1.03(t,J=6.3Hz,9H).MS m/z: C ₂₄ H ₂₃ O ₆ , [MH] ^- , theory: 407.15, actual measurement: 406.92 .

(1-1-3b) Synthesis of L-7:

The L-8 (40g, 27.09mmol, obtained by combining multiple batches) obtained in step (1-1-2) and A-1 (41.418g, 81.27) obtained in step (1-1-3a) mmol), dissolve in 271ml of dichloromethane, add 3-diethoxyphosphoryl-1,2,3-benzoxazole 4(3H)-one (DEPBT) (24.318g, 81.37mmol), then add diiso Propylethylamine (21.007g, 162.54mmol), stirred for 1.5h at 25℃, washed the organic phase with 800ml saturated sodium bicarbonate, and extracted the aqueous phase with dichloromethane 3 times, each time with 50ml, washed with 150ml saturated brine The organic phase and the aqueous phase were extracted once with 50 ml of dichloromethane. The organic phases were combined and dried over anhydrous sodium sulfate. After filtration, the solvent was evaporated under reduced pressure, and the vacuum oil pump was foamed and dried overnight to obtain a crude product. Use 2kg 200-300 mesh normal phase silica gel for column purification, neutralize the silica gel acidity with 200ml triethylamine, equilibrate the column with petroleum ether containing 1wt% triethylamine, and use petroleum ether: ethyl acetate: dichloromethane: N, N -Dimethylformamide=1:1:1:0.5-1:1:1:0.6 gradient elution, collect the product eluent, evaporate the solvent under reduced pressure to obtain 40.4g of pure product L-7. ¹ H NMR (400MHz, DMSO) δ 7.90--7.78 (m, 4H), 7.75 - 7.64 (m, 1H), 7.38 - 7.18 (m, 9H), 6.91 - 6.83 (m, 4H), 5.25 - 5.10 ( m, 4H), 4.97 (dd, J = 11.2, 3.2 Hz, 3H), 4.48–4.30 (m, 4H), 4.02 (s, 9H), 3.93–3.84 (m, 3H), 3.76–3.66 (m, 9H), 3.45–3.35(m, 3H), 3.24–2.98(m, 10H), 2.30–2.20(m, 2H), 2.11–1.88(m, 31H), 1.80–1.40(m, 28H).MS m /z: C ₉₀ H ₁₂₈ N ₇ O ₃₅ , [M-DMTr] ⁺ , theory: 1564.65, actual measurement: 1564.88.

(1-1-4) Synthesis of L-9:

The L-7 (40g, 21.4247mmol) obtained in step (1-1-3b), succinic anhydride (4.288g, 42.8494mmol) and 4-dimethylaminopyridine (DMAP, 5.235g, 42.8494mmol) were mixed and dissolved Add diisopropylethylamine (DIEA, 13.845g, 107.1235mmol) to 215ml of dichloromethane, stir for 24h at 25°C, wash the reaction solution with 800ml of 0.5M triethylamine phosphate, and extract the aqueous phase with dichloromethane. 5ml each time, combine the organic phases and evaporate to dryness under reduced pressure to obtain a crude product. For column purification, use 1kg 200-300 mesh normal phase silica gel, neutralize the silica gel acidity with 1wt% triethylamine, equilibrate the column with dichloromethane, and use dichloromethane containing 1wt‰ triethylamine: methanol=100:18-100: 20 gradient elution, collecting the product eluate, evaporating the solvent under reduced pressure to obtain 31.0 g of pure L-9 conjugated molecule. ¹ H NMR(400MHz,DMSO)δ8.58(d,J=4.2Hz,1H),7.94-7.82(m,3H),7.41-7.29(m,5H),7.22(d,J=8.1Hz,5H ), 6.89 (d, J = 8.3 Hz, 4H), 5.49-5.37 (m, 1H), 5.21 (d, J = 3.0 Hz, 3H), 4.97 (d, J = 11.1 Hz, 3H), 4.49 (d ,J=8.2Hz,3H),4.02(s,9H),3.88(dd,J=19.4,9.4Hz,3H),3.77–3.65(m,9H),3.50–3.39(m,6H),3.11– 2.90(m,5H), 2.61-2.54(m,4H), 2.47-2.41(m,2H), 2.26-2.17(m,2H), 2.15-1.95(m,22H), 1.92-1.84(m,9H) ),1.80–1.70(m,10H),1.65–1.35(m,17H),1.31–1.19(m,4H),0.96(t,J=7.1Hz,9H).MS m/z: C ₉₄ H ₁₃₂ N ₇ O ₃₈ , [M-DMTr] ⁺ , theory: 1664.72, actual measurement: 1665.03.

(1-1-5) Synthesis of L-10 compound:

In this step, the L-10 compound is prepared by attaching the L-9 conjugated molecule to the solid support.

The L-9 conjugate molecule (22.751g, 11mmol) obtained in step (1-1-4), O-benzotriazole-tetramethylurea hexafluorophosphate (HBTU, 6.257g, 16.5 mmol) and diisopropylethylamine (DIEA, 2.842g, 22mmol), dissolve in 900ml acetonitrile, stir at room temperature for 5 minutes, add aminomethyl resin (88g, 100-200 mesh, amino loading 400μmol) to the reaction solution /g, purchased from Nankai Hecheng Company), shaker reaction was carried out at 25°C, rotating speed 150 rpm, and filtered after 18 hours of reaction. The filter cake was rinsed with DCM twice, 300ml each time, and acetonitrile rinsed 3 times, each 300ml each time, vacuum oil pump drying for 18h, and then add the raw materials (CapA, CapB, 4-dimethylaminopyridine (DMAP) and acetonitrile) according to the feeding ratio shown in Table 2 for capping reaction. Placed on a shaker at 25°C, rotating speed 150 rpm, reacting for 5 hours, the reaction solution is filtered, the filter cake is rinsed with acetonitrile 3 times, 300 ml each time, the solvent is evaporated under reduced pressure to dryness, and the vacuum oil pump is dried overnight under reduced pressure to obtain The L-10 compound (ie, the L-9 conjugated molecule connected to the solid support) was 102 g, and the loading was 90.8 μmol/g.

Table 2 Feeding ratio of cap reaction

原料raw material	用量Dosage	规格specification	批号batch number	生产厂家Manufacturer
CapACapA	1980ml1980ml	————	————	————
CapBCapB	220ml220ml	————	————	————
DMAPDMAP	1.100g1.100g	分析纯Analytically pure	I1422139I1422139	AladdinAladdin
乙腈Acetonitrile	220ml220ml	光谱纯Spectral purity	O15161001O15161001	上海星可Shanghai Xingke

Wherein, CapA and CapB are capping reagent solutions, CapA is a pyridine/acetonitrile mixed solution of 20% by volume N-methylimidazole, and the volume ratio of pyridine to acetonitrile is 3:5; CapB is a solution of 20% by volume of acetic anhydride in acetonitrile.

(1-2) Synthesis of the sense chain of conjugate 1

Through the solid-phase phosphoramidite method, the L-10 compound prepared by the above steps was used to initiate the cycle, and the nucleoside monomers were connected one by one from the 3'-5' direction according to the sequence of the sense strand nucleotides, and the siRNA in Table 3 was synthesized Sense strand of Conjugate 1. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or vulcanization. Among them, when two nucleotides are connected by phosphate ester, when the next nucleoside monomer is connected, there are four steps of deprotection, coupling, capping, and oxidation. When two nucleotides are connected by phosphorothioate, when the next nucleoside monomer is connected, there are four steps of protection, coupling, capping and vulcanization. The synthesis conditions are given as follows:

The nucleoside monomer is provided in 0.1M acetonitrile solution. The conditions of the deprotection reaction in each step are the same, that is, the temperature is 25°C, the reaction time is 70 seconds, and the deprotection reagent is dichloroacetic acid in dichloromethane (3% v/v), the molar ratio of dichloroacetic acid to the 4,4'-dimethoxytrityl protecting group on the solid support is 5:1.

The conditions of each step of the coupling reaction are the same, including the temperature of 25°C, the molar ratio of the nucleic acid sequence connected to the solid-phase carrier to the nucleoside monomer is 1:10, the molar ratio of the nucleic acid sequence connected to the solid-phase carrier and the coupling reagent The ratio is 1:65, the reaction time is 600 seconds, and the coupling reagent is a 0.5 M acetonitrile solution of 5-(Ethylthio)-1H-tetrazole (ETT).

The capping conditions for each step are the same, including a temperature of 25°C and a reaction time of 15 seconds. The capping reagent solution is a mixed solution of CapA and CapB with a molar ratio of 1:1, and the molar ratio of the capping reagent to the nucleic acid sequence connected to the solid phase carrier is acetic anhydride: N-methylimidazole: the nucleic acid sequence connected to the solid phase carrier =1:1:1.

The oxidation reaction conditions for each step are the same, including a temperature of 25°C, a reaction time of 15 seconds, and an oxidizing reagent of 0.05M iodine water. The molar ratio of iodine to the nucleic acid sequence connected to the solid phase carrier in the coupling step is 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran:water:pyridine=3:1:1.

The conditions of each step of the vulcanization reaction are the same, including the temperature of 25°C, the reaction time of 300 seconds, and the vulcanizing reagent is hydroxanthin. The molar ratio of the vulcanizing reagent to the nucleic acid sequence connected to the solid support in the coupling step is 120:1. The reaction was carried out in a mixed solvent of acetonitrile:pyridine=1:1.

After the connection of the last nucleoside monomer is completed, the nucleic acid sequence connected on the solid phase carrier is cut, deprotected, purified, and desalted in sequence, and then lyophilized to obtain the sense strand, where,

The cutting and deprotection conditions are as follows: add the synthesized nucleotide sequence linked to the carrier into 25wt% ammonia water, the amount of ammonia water is 0.5ml/μmol, react at 55℃ for 16h, filter to remove the remaining carrier, and remove the supernatant. Concentrate to dryness in vacuo.

Purification and desalting conditions are as follows: using a preparative ion chromatography purification column (Source 15Q), through NaCl gradient elution, to achieve nucleic acid purification. Specifically: eluent A: 20mM sodium phosphate (pH 8.1), solvent is water/acetonitrile = 9:1 (volume ratio); eluent B: 1.5M sodium chloride, 20mM sodium phosphate (pH 8.1) , The solvent is water/acetonitrile=9:1 (volume ratio); elution gradient: eluent A: eluent B=100:0-50:50 gradient elution. After collecting the product eluates, they are combined and desalted using a reversed-phase chromatography purification column. The specific conditions include using a Sephadex G25 (Sephadex G25) as the filler and eluting with deionized water.

The detection method is as follows: ion exchange chromatography (IEX-HPLC) is used to detect the purity of the above-mentioned sense chain, and liquid mass spectrometry (LC-MS) is used to analyze the molecular weight. The measured value is consistent with the theoretical value, indicating that the synthesized 3'end is the sense strand SS conjugated with an L-9 conjugate molecule.

(1-3) Synthesis of antisense strand of Conjugate 1

Through the solid-phase phosphoramidite method, the universal solid-phase carrier (UnyLinker ^TM loaded

Solid Supports, Kinovate Life Sciences, Inc.) initiated the cycle to synthesize the antisense strand of Conjugate 1 in Table 3. The deprotection, coupling, capping, oxidation or vulcanization reaction conditions, cleavage and deprotection, purification and desalting conditions in the solid-phase synthesis method are the same as the synthetic sense strand. Then lyophilized to obtain the antisense strand. The purity of the antisense strand was detected by ion exchange chromatography (IEX-HPLC), and the molecular weight was analyzed by liquid mass spectrometry (LC-MS). As a result, the measured value agrees with the theoretical value, indicating that the synthesized antisense strand AS has the target sequence.

(1-4) Synthesis of Conjugate 1

For Conjugate 1, the sense strand and antisense strand were separately dissolved in water for injection to obtain a 40 mg/mL solution, mixed in an equimolar ratio, heated at 50°C for 15 min, and cooled at room temperature to obtain the annealed product, which was freeze-dried , Get lyophilized powder. Use ultrapure water (Milli-Q ultrapure water meter, resistivity 18.2MΩ*cm(25℃)) to dilute the conjugate to a concentration of 0.2mg/mL, then use liquid mass spectrometry (LC-MS, Liquid Chromatography-Mass Spectrometry, purchased from Waters, Model: LCT Premier) for molecular weight detection. The measured value is consistent with the theoretical value, indicating that the synthesized siRNA conjugate 1 is a target designed double-stranded nucleic acid sequence with an L-9 conjugate molecule. Its structure is shown in formula (403), and the conjugated siRNA sequence is shown in Table 3 and corresponds to the sequence of conjugate 1 (also known as L10-siPCSKa1M1S).

Preparation Example 2 Preparation of Conjugate 2-7

Using the same method as Preparation Example 1, the conjugates 2-7 shown in Table 3 were synthesized, and molecular weight detection was performed. The difference is that the sense strand and antisense strand sequences used in the synthesis are respectively shown in Table 3. The sequence shown corresponds to the sense strand and antisense strand of the siRNA conjugated in Conjugate 2, Conjugate 3, Conjugate 4, Conjugate 5, Conjugate 6, or Conjugate 7. Thus, conjugates 2-7 were obtained respectively.

Table 3 lists the conjugate number and siRNA sequence composition.

Table 3 siRNA conjugates

Preparation Example 3 Synthesis of siRNA sequence

The siRNA 1 shown in Table 4 was synthesized using the same method as Preparation Example 1, except that:

1) For the sense chain, the universal solid phase carrier (UnyLinker ^TM loaded

Solid Supports, Kinovate Life Sciences Corporation) initial cycle;

2) For the antisense strand, the sequence of siRNA 1 is compared with the sequence of the siRNA antisense strand conjugated in Conjugate 1. The antisense strand of siRNA 1 has a 5'at the first nucleotide at the 5'-end -Phosphoric acid. Therefore, in the process of preparing the antisense chain according to the solid-phase phosphoramidite method, after connecting the last nucleoside monomer of the antisense chain, the CPR-I monomer is deprotected, coupled, capped, and oxidized. (Suzhou Gima, Cat#13-2601-XX) is connected to the 5'end of the antisense strand to form a 5'-phosphate modification.

In this connection, the deprotection, coupling, capping, oxidation reaction conditions, cleavage and deprotection, purification and desalting conditions used are the same as the synthetic sense strand.

Using the same method as preparing siRNA 1 to prepare siRNA 2, the difference is that the nucleic acid sequences of the siRNA sense strand and antisense strand used in the synthesis are the sense strand and antisense strand corresponding to siRNA 2 as shown in Table 4 Sequence to get siRNA2.

Using the same method as preparing siRNA 1 to prepare siRNA 3-6, the difference is that the nucleic acid sequences of the siRNA sense strand and antisense strand used in the synthesis are corresponding to siRNA 3, siRNA 4, siRNA as shown in Table 4 5 or siRNA 6 sense strand and antisense strand sequence, wherein the first nucleotide of the 5'-end of the antisense strand of these siRNAs has a 5'-phosphorothioate modification. Therefore, when the CPR-I monomer is connected, the vulcanization reaction conditions are used instead of the above oxidation reaction conditions to prepare an antisense chain with 5'-phosphorothioate modification. Thus, siRNA 3, siRNA 4, siRNA 5 or siRNA 6 are obtained respectively.

Table 4 lists the siRNA number and siRNA sequence composition.

Table 4 siRNA sequence

Experimental example 1 Inhibition activity and off-target effect detection of siRNA in psiCHECK system in vitro

In this experimental example, the expression of each antisense strand of siRNA 1-6 in the in vitro psiCHECK system was detected to inhibit its expression in the target plasmid, and the expression of each siRNA sense strand, antisense strand seed region or sense strand seed region of its off-target plasmid was inhibited. To evaluate the on-target activity and off-target effect of the siRNA of the present disclosure.

According to Kumico Ui-Tei et.al., Functional dissection of siRNA sequence by systematic DNA Substitution: modified siRNA with a DNA seeded arm is a powerful tool for mammalian gene silence with significantly reduced off-target, effect. ), the method described in 2136-2151, construct a detection plasmid, co-transfect the detection plasmid and the siRNA to be tested into HEK293A cells, and reflect the on-target activity of the siRNA through the expression level of the dual luciferase reporter gene Off-target effect. Specific steps are as follows:

[1] Construction of detection plasmid

Four types of detection plasmids were constructed using psiCHECK ^TM -2 (Promega ^TM ) plasmids, where GSCM means the target plasmid, PSCM, GSSM, PSSM means off-target plasmid:

(1) GSCM is used to detect the on-target activity of the siRNA antisense strand. GSCM contains a target sequence that contains a region that is completely complementary to the sequence of the siRNA antisense strand to be tested. Among them, siRNA 1, 2, 4, 5 The target sequence in GSCM corresponding to 6 is shown in SEQ ID NO: 373:

The target sequence in GSCM corresponding to siRNA 3 is shown in SEQ ID NO: 374:

(2) PSCM, used to detect the off-target effect of the sense strand, contains a target sequence that is exactly the same as the sequence of the antisense strand of the siRNA to be tested. The target sequence in the PSCM corresponding to each siRNA is shown in Table 5a:

Table 5a Target sequence in PSCM corresponding to siRNA

siRNAsiRNA	PSCM目标序列(序列方向5'-3')PSCM target sequence (sequence direction 5'-3')	SEQ ID NOSEQ ID NO
siRNA 1siRNA 1	GATAAATGTCTGCTTGCTTGGGATAAATGTCTGCTTGCTTGG	375375

siRNA 2 siRNA 2	TTAATAAAAATGCTACAAAACTTAATAAAAATGCTACAAAAC	376376
siRNA 3siRNA 3	TTCCGAATAAACTCCAGGCCTTTCCGAATAAACTCCAGGCCT	377377
siRNA 4 siRNA 4	AGTTACAAAAGCAAAACAGGTAGTTACAAAAGCAAAACAGGT	378378
siRNA 5siRNA 5	ATAAAAATGCTACAAAACCCAATAAAAATGCTACAAAACCCA	379379
siRNA 6siRNA 6	TTTTATTTTAAAAAGTCACCATTTTATTTTAAAAAGTCACCA	380380

(3) GSSM is used to detect the off-target effect of the seed region of the antisense strand. The target sequence in GSSM corresponding to each siRNA is shown in Table 5b:

Table 5b Target sequence in GSSM corresponding to siRNA

siRNAsiRNA	GSSM目标序列(序列方向5'-3')GSSM target sequence (sequence direction 5'-3')	SEQ ID NOSEQ ID NO
siRNA 1siRNA 1	AACCTACCTACTCCATTTATCAACCTACCTACTCCATTTATC	381381
siRNA 2 siRNA 2	TGGGGTGCTACGGTTTATTAATGGGGTGCTACGGTTTATTAA	382382
siRNA 3siRNA 3	CTTAAGTTCTGGGATTCGGAACTTAAGTTCTGGGATTCGGAA	383383
siRNA 4 siRNA 4	CAAGTGGGGTAGGTTGTAACTCAAGTGGGGTAGGTTGTAACT	384384
siRNA 5siRNA 5	GTTTGGGGTGCTAATTTTTATGTTTGGGGTGCTAATTTTTAT	385385
siRNA 6siRNA 6	GTTGTCAGGGGGCAAATAAAAGTTGTCAGGGGGCAAATAAAA	386386

(4) PSSM is used to detect the off-target effect of the seed region of the sense strand. The target sequence in PSSM corresponding to each siRNA is shown in Table 5c:

Table 5c Target sequence in PSSM corresponding to siRNA

siRNAsiRNA	PSSM目标序列(序列方向5'-3')PSSM target sequence (sequence direction 5'-3')	SEQ ID NOSEQ ID NO
siRNA 1siRNA 1	TCGCCCGTGAGGCTTGCTTTTTCGCCCGTGAGGCTTGCTTTT	387387
siRNA 2 siRNA 2	GGCCGCCCCCGGCTACAAACAGGCCGCCCCCGGCTACAAACA	388388
siRNA 3siRNA 3	GGAATCCGCCCCTCCAGGCAGGGAATCCGCCCCTCCAGGCAG	389389
siRNA 4 siRNA 4	CTGGCACCCCTCAAAACAGTGCTGGCACCCCTCAAAACAGTG	390390
siRNA 5siRNA 5	CGCCCCCGTAGACAAAACCACCGCCCCCGTAGACAAAACCAC	391391
siRNA 6siRNA 6	GGGGCGGGGCCAAAGTCACACGGGGCGGGGCCAAAGTCACAC	392392

A single copy of the above target sequence was cloned into the Xho I/Not I site of the psiCHECK ^TM -2 plasmid.

[2] Cell culture and transfection

(1) Co-transfection of GSCM and siRNA1.

Use H-DMEM complete medium (HyClone) containing 10% fetal bovine serum (FBS, HyClone) and 0.2% by volume of penicillin double antibody (Penicillin-Streptomycin, HyClone) at 37° C. Culture HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) in an incubator with 5% CO ₂ /95% air.

Inoculate HEK293A cells in a 96-well plate at 8×10 ³ cells/well. When the cell growth density reaches 70-80% after 16 hours, exhaust the H-DMEM complete medium in the culture wells and add 80μl Opti-MEM to each well. Ji (GIBCO company) continues to cultivate for 1.5h.

Dilute the GSCM detection plasmid with DEPC water to 200ng/μl of detection plasmid working solution; use DEPC water to configure siRNA1 to 1000nM, 333nM, 111nM, 37.0nM, 12.3nM, 4.12nM, 1.37nM, 0.46nM, 0.15 There are 11 siRNA working solutions of different concentrations in nM, 0.05nM and 0.017nM.

Prepare A1-A11 solutions respectively, each A1-A11 solution contains 1μl of the above 11 concentrations of siRNA working solution, 0.05μl of detection plasmid working solution (containing 10ng of detection plasmid) and 10μl of Opti-MEM medium.

Prepare B solution, each B solution contains 0.2μl Lipofectamine ^TM 2000 and 10μl Opti-MEM medium.

Prepare C solution, each C solution contains 0.05μl of detection plasmid working solution (containing 10ng of detection plasmid) and 10μl Opti-MEM medium.

Mix one part B solution with one part A1-A11 solution and one part C respectively, and incubate at room temperature for 20 minutes to obtain 12 transfection complexes X1-X12. Three copies of each transfection complex are prepared.

In the culture wells, add transfection complex X1-X11, mix evenly, add 20μl/well, and add 3 transfection complexes with the same siRNA concentration to three different culture wells to obtain the final siRNA concentration. Co-transfection mixtures of 10nM, 3.33nM, 1.11nM, 0.37nM, 0.123nM, 0.0412nM, 0.0137nM, 0.0046nM, 0.0015nM, 0.0005nM and 0.00017nM were recorded as test groups 1-11.

In the other three culture wells, the transfection complex X12 was added to obtain a transfection mixture without siRNA. The added amount was 20 μl/well, which was recorded as the control group.

The co-transfection mixture containing siRNA and the transfection mixture without siRNA were transfected in the culture wells for 4 hours, and each well was supplemented with 100 μl H-DMEM complete medium containing 20% FBS. Place the 96-well plate in a CO ₂ incubator and continue culturing for 24 hours.

(2) Co-transfection of other siRNA and plasmids.

GSCM and siRNA 2-6 were co-transfected using the same method as the co-transfection of GSCM and siRNA 1, except that siRNA 2-6 was used in turn instead of siRNA1.

PSCM and siRNA 1-6 were co-transfected in the same way as GSCM and siRNA 1-6, except that PSCM was used instead of GSCM.

GSSM and siRNA 1-6 were co-transfected using the same method as GSCM and siRNA 1-6, except that GSSM was used instead of GSCM.

PSSM and siRNA 1-6 were co-transfected using the same method as GSCM and siRNA 1-6, except that PSSM was used instead of GSCM.

[3] Detection

Aspirate the medium in the culture wells and add 150μl of

Luciferase reagent and H-DMEM mixed solution (volume ratio 1:1), mix well, incubate at room temperature for 10 minutes, transfer 120μl of the mixed solution to a 96-well microplate, use Synergy II multi-function microplate reader (BioTek) to read Take the Firefly chemiluminescence value (Fir) from each well of the microtiter plate; then add 60μl to each well of the microtiter plate

Stop&

Mix the reagents thoroughly and incubate at room temperature for 10 minutes. Use a microplate reader to read the Renilla chemiluminescence value (Ren) in each well of the microplate according to the arrangement of reading Fir.

Calculate the luminescence ratio of each well of the ELISA plate Ratio=Ren/Fir, the luminescence ratio Ratio (test) or Ratio (control) of each test group or control group is the average of the ratio of the three culture wells; take the luminescence ratio of the control group as the benchmark , Normalize the luminescence ratio of each test group to obtain the ratio R of Ratio (test)/Rati (control), which represents the expression level of the Renilla reporter gene, that is, the relative residual activity. The inhibition rate of siRNA was (1-R)×100%.

According to the relative residual activity of the reporter gene Renilla in the psiCHECK system after transfection of different siRNAs (siRNA 1, siRNA 2, siRNA 3, siRNA 4, siRNA 5 or siRNA 6), use the nonlinear regression analysis function of Graphpad 5.0 software to simulate Combining log (inhibitor) vs. response—Variable slope (four parameters) dose-response curves, Figures 1A-1F show the dose-response curves of siRNA 1-6 in turn. The logarithmic value (lg nM) of the siRNA concentration is taken as the abscissa, and the relative residual activity (%) of Renilla is taken as the ordinate. Each dot represents the relative value of Renilla in the 3 culture wells of the test group relative to the control group. Average value of residual activity.

According to the function corresponding to the fitted dose-effect curve, calculate the IC ₅₀ value of the tested siRNA targeting GSCM. The function is as follows:

Where:

Y is the ratio R, the relative residual activity of Renilla,

X is the logarithm of the transfection siRNA concentration,

Bot is the Y value at the bottom of the steady-state period,

Top is the Y value at the top of the steady-state period,

X'is the corresponding X value when Y is halfway from the bottom to the top, and HillSlope is the slope of the curve at X'.

From the dose-effect curve and the corresponding function, determine the corresponding X ₅₀ value when Y = 50%, calculate the IC ₅₀ value of each siRNA = 10^X ₅₀ (nM), the IC ₅₀ value and R ² value are summarized in Table 6.

Table 6 IC ₅₀ and R ² values of siRNA to GSCM

It can be seen from Table 6 and Figures 1A-1F that the siRNA provided by the present disclosure has a higher inhibitory activity in HEK293A cells in vitro, with an IC ₅₀ between 0.0194-0.0561 nM.

Using the same method described above, the dose-response curves of siRNA 1-6 to their respective PSCM, GSSM, and PSSM were obtained sequentially, except that PSCM, GSSM, and PSSM were used instead of GSCM. The results show that each siRNA has no inhibitory effect on its corresponding off-target plasmids PSCM, GSSM and PSSM at various concentrations.

The above results indicate that the siRNA of the present disclosure has good targeting specificity, and there is no obvious off-target effect in the sense strand, antisense strand seed region, and sense strand seed region.

Experimental Example 2 Evaluation of the efficacy of siRNA conjugates in non-human primates (NHP)

Divide 3-4 years old general-grade cynomolgus monkeys (weight 2.4-3.1kg) into 2 groups according to their body weight. Each group consists of 4 cynomolgus monkeys with half male and female. Each group of cynomolgus monkeys were injected subcutaneously with conjugate 4 or 5.

Divide 4-5 years old general-grade cynomolgus monkeys (weight 4.0-5.5kg) into 3 groups according to their body weights, each group has 3, all males, and each group of cynomolgus monkeys were injected subcutaneously with conjugate 1, respectively. 2 or 7.

Each conjugate was prepared into a solution of 9 mg/ml (based on siRNA, the same below) with sterile sodium chloride injection, the administration volume of each animal was 1 ml/kg, and the administration dose was 9 mg/kg. The n days before administration is defined as D-n, the day of administration is defined as D1, and the nth day after administration is defined as Dn.

(2-1) PCSK9 mRNA detection in liver tissue

Liver puncture was performed on the cynomolgus monkeys administered with Conjugate 1, Conjugate 2, Conjugate 4, Conjugate 5, or Conjugate 7 on D-7 and D15, and the liver was collected each time The tissue is about 2×2×8mm ³ , stored in a 1.5mL sterile EP tube containing 1ml RNAlater preservation solution (Sigma Aldrich), placed in a refrigerator at 4°C for 24h, and then transferred to -80°C for storage.

Subsequently, the liver tissue was homogenized with a tissue homogenizer, and then Trizol (Thermo Fisher) was used to extract the total RNA from the liver tissue according to the operation steps of total RNA extraction in the manual.

For the total RNA extracted from the liver tissue of each animal, 1 μg total RNA was used as the template for reverse transcription, and the reverse transcription kit Goldenstar ^TM RT6 cDNA Synthesis Kit (purchased from Beijing Kinco Xinye Biotechnology Co., Ltd., catalog number TSK301M) The reagent provided by ), among which Goldenstar ^TM Oligo (dT) _{17 is selected} as the primer, and 20 μl of the reverse transcription reaction system is configured according to the reverse transcription operation steps in the kit manual, and the total RNA of each liver is reversely transcribed. The conditions for reverse transcription are: incubate each reverse transcription reaction system at 50°C for 50 minutes, then incubate at 85°C for 5 minutes, and finally incubate at 4°C for 30 seconds. After the reaction is over, add 80μl of DEPC water to each reverse transcription reaction system to obtain Solution containing cDNA.

For each reverse transcription reaction system, take 5μl of the above-mentioned cDNA-containing solution as the qPCR template, and use

SYBR qPCR SuperMix Plus kit (purchased from Nearshore Protein Technology Co., Ltd., catalog number E096-01B) provides reagents with 20μl qPCR reaction system, among which, the PCR primer sequences used to amplify the target gene PCSK9 and the internal reference gene GAPDH are shown in Table 7 As shown, the final concentration of each primer is 0.25 μM. Place each qPCR reaction system on the ABI StepOnePlus Real-Time PCR machine, and use the three-step method for amplification. The amplification program is 95°C pre-denaturation for 10 minutes, then 95°C denaturation for 30s, 60°C annealing for 30s, and 72°C extension for 30s. After repeating the above-mentioned denaturation, annealing, and extension process 40 times, a product W containing the amplified target gene PCSK9 and the internal reference gene GAPDH was obtained. The product W was incubated at 95°C for 15s, 60°C for 1 min, and 95°C for 15s. The real-time fluorescent quantitative PCR instrument collected the melting curves of the target gene PCSK9 and the internal reference gene GAPDH in the product W to obtain the Ct value.

Table 7 Primer sequence

Using the comparative Ct (ΔΔCt) method, the relative quantitative calculation of the expression of the D15 and D-7 target genes PCSK9 was performed. The calculation method is as follows:

ΔCt (D15) = Ct (D15 target gene)-Ct (D15 internal reference gene)

ΔCt (D-7) = Ct (D-7 target gene)-Ct (D-7 internal reference gene)

ΔΔCt(D15)=ΔCt(D15)-ΔCt(D-7 average)

ΔΔCt(D-7)=ΔCt(D-7)-ΔCt(D-7 average)

Wherein, ΔCt (D-7 average) is the arithmetic mean of ΔCt (D-7) of each animal before administration. Thus, each animal corresponds to a ΔΔCt (D15) and ΔΔCt (D-7).

Using the D-7 of an animal as a benchmark, normalize the expression level of D15 PCSK9 mRNA of this animal, and define the expression level of D-7PCSK9 mRNA as 100%.

The relative expression level of PCSK9 mRNA = 2^(-ΔΔCt(D15))×100%,

Inhibition rate of conjugate on PCSK9 mRNA=(1-2^(-ΔΔCt(D15)))×100%,

For the group administered with the same conjugate, the inhibition rate of the conjugate to PCSK9 mRNA was the arithmetic mean of the inhibition rate corresponding to each animal in this group.

Table 8 shows the inhibition rate of each conjugate on liver PCSK9 mRNA.

Table 8 Inhibition rate of conjugates on PCSK9 mRNA

缀合物Conjugate	编号Numbering	抑制率％Inhibition rate%
缀合物1Conjugate 1	L10-siPCSKa1M1SL10-siPCSKa1M1S	79±479±4
缀合物2 Conjugate 2	L10-siPCSKb1M1SL10-siPCSKb1M1S	68±1168±11
缀合物4 Conjugate 4	L10-siPCSKd1M1SL10-siPCSKd1M1S	81±681±6
缀合物5Conjugate 5	L10-siPCSKe1M1SL10-siPCSKe1M1S	65±1865±18
缀合物7Conjugate 7	L10-siPCSKg4M5SL10-siPCSKg4M5S	56±2256±22

It can be seen from Table 8 that a single administration of 9mg/kg, compared to the 7th day before administration and the 15th day after administration, the inhibition rate of siRNA conjugate on PCSK9 mRNA is higher than 56%. The inhibitory rates of compound 1 and conjugate 4 on PCSK9 mRNA in NHP liver tissue were as high as 79% and 81%, respectively.

(2-2) Detection of PCSK9 protein content in serum

For the NHP administered with Conjugate 4, venous blood was collected on D-15, D-9, and D1 before administration, and venous blood was collected on D3, D8, D14, D22, and D29 after administration. Blood was collected once a week and continued for 18 weeks until D127.

For the NHP administered with conjugate 1 or 7, venous blood was collected on D-14, D-7, and D1 before administration, and venous blood was collected on D4, D8, D15, D22, and D29 after administration. After that, blood was collected once a week for 12 weeks until D85.

The blood samples were collected to separate serum at room temperature.

(2-2-1) Detection of PCSK9 protein content in cynomolgus monkey serum administered with Conjugate 4

Select the serum of D-9, D8, D14, D85, D92, D99, D106 and D120 after administration of conjugate 4, and use the Calibrator Diluent in the Human Proprotein Convertase 9/PCSK9 Quantikine ELISA Kit (R&DSystems, USA, DPC900) RD5P (1:5 dilution) reagent, dilute the serum obtained at each time point by 25 times, and use the automatic microplate reader (SYNERGY ^TM MX, Biotek) to detect each diluted serum at 450 nm according to the operating steps of the kit instructions The absorbance value. According to each dilution concentration of the standard in the kit and its corresponding absorbance value, use the linear regression function of Graphpad 5.0 software to establish a standard curve, and obtain the corresponding linear equation: Y=aX+b, where a is the slope of the fitted straight line, b Is the corresponding Y value (intercept) when X=0. The measured absorbance value of each diluted serum is brought into the above equation, and the PCSK9 protein content in the diluted serum can be calculated, and the PCSK9 protein content in the serum at each time point can be obtained according to the dilution factor.

Normalized PCSK9 protein level = (PCSK9 protein content after administration/PCSK9 protein content before administration)

Inhibition rate of PCSK9 protein expression=(1-PCSK9 protein content after administration/PCSK9 protein content before administration)×100%.

Among them, the PCSK9 protein content before administration is the PCSK9 protein content of D-9.

Taking pre-administration as the benchmark, normalize the PCSK9 protein content at each time point after administration; define the pre-administration PCSK9 protein level as 100%, which is represented by D0 in Figure 2; a single subcutaneous injection of 9 mg to cynomolgus monkeys After conjugate 4/kg, the normalized PCSK9 protein levels in serum at different time points are shown in Figure 2.

(2-2-2) Detection of PCSK9 protein content in cynomolgus monkey serum administered with conjugate 1 or 7

Using the same method as (2-2-1), the content of PCSK9 protein in the serum of cynomolgus monkeys administered with conjugate 1 or 7 was detected. The difference is that (1) the serum of D-14, D-7, D8, D15, D22, D29, D36, D43, D50, D57, D64, and D85 are selected; (2) the PCSK9 protein content before administration is D- The arithmetic mean of the two PCSK9 protein contents of 14 and D-7. After a single subcutaneous injection of 9 mg/kg of conjugate 1 or 7 in cynomolgus monkeys, the normalized PCSK9 protein levels in the serum at different time points are shown in Figure 2.

It can be seen from Figure 2 that on the 14th day after a single administration, the inhibitory rate of conjugate 4 on the expression of PCSK9 protein in NHP serum was higher than 90%. Until the 12th week after administration, the conjugate 4 had an effect on PCSK9 protein. The inhibition rate of expression is always maintained above 50%.

For Conjugate 7, on the 22nd day after a single administration, the inhibition rate of PCSK9 protein expression in NHP serum was 82%. Until the 9th week after administration, the inhibition rate of conjugate 7 on PCSK9 protein expression was always maintained at 66% or more.

For Conjugate 1, on the 15th day after a single administration, the inhibition rate of PCSK9 protein expression in NHP serum was 83%. Until the 7th week after administration, the inhibition rate of conjugate 7 on PCSK9 protein expression was maintained at 65% or more.

(2-3) Detection of blood lipids (LDL-c and CHO) in serum

(2-3-1) Detection of blood lipids (LDL-c and CHO) in the serum of cynomolgus monkeys administered with Conjugate 4

Select the serum obtained at each time point after the administration of conjugate 4 in (2-2), and use the LDL-C assay kit (DENUO CH7538, Shanghai Zhicheng Biotechnology Co., Ltd.) or CHOL assay kit (DENUO CH7532). , Shanghai Zhicheng Biological Technology Co., Ltd.), according to the operating method of its manual, detect the blood lipid (LDL-c or CHO) content in the serum at each time point on the automatic biochemical analyzer (Hitachi 7060).

Normalized blood lipid level=(blood lipid content after administration/blood lipid content before administration)×100%.

Inhibition rate of blood lipid = (1-blood lipid content after administration / blood lipid content before administration) × 100%.

Among them, the blood lipid content before administration is the arithmetic mean of the three blood lipids of D-15, D-9 and D1 before administration; blood lipid refers to LDL-c or CHO.

Taking pre-administration as a benchmark, normalize the blood lipid content at each time point after administration; define the pre-administration blood lipid level as 100%, which is represented by D0 in Figs. 3 and 4.

After a single subcutaneous injection of 9 mg/kg of conjugate 4 in cynomolgus monkeys, the normalized LDL-c levels and normalized CHO levels in the serum at different time points are shown in Figure 3 and Figure 4, respectively.

(2-3-2) Detection of blood lipids (LDL-c and CHO) in the serum of cynomolgus monkeys administered with Conjugate 7

Using the same method as (2-3-1), the blood lipid (LDL-c and CHO) content in the serum of cynomolgus monkeys administered with Conjugate 7 was detected. The difference is that (1) the serum obtained at each time point after administration of conjugate 7 in (2-2) is selected for blood lipid detection; (2) the blood lipid content before administration is D-14, D-7 before administration And D1 the arithmetic average of three blood lipids. After a single subcutaneous injection of 9 mg/kg of conjugate 7 in cynomolgus monkeys, the normalized LDL-c levels and normalized CHO levels in the serum at different time points are shown in Figure 3 and Figure 4, respectively.

It can be seen from Figure 3 that starting from the 14th day after a single administration, Conjugate 4 has a significant inhibitory effect on LDL-c, and on the 22nd day after administration, the inhibitory rate of Conjugate 4 on LDL-c is as high as 64 %; From the second week to the 11th week after administration, the inhibitory rate of conjugate 4 on LDL-c has always been maintained above 50%; during the observation period of up to 127 days, conjugate 4 was administered The serum LDL-c level of NHP is always lower than before administration.

For conjugate 7, the inhibition rate of LDL-c was 36% on the 22nd day after a single administration; from the second week to the fourth week after the administration, the inhibition rate of LDL-c was maintained at about 30%; During the observation period of up to 11 weeks, the serum LDL-c level of NHP administered with conjugate 7 was always lower than before administration.

It can be seen from Figure 4 that starting from the 14th day after a single administration, Conjugate 4 also has a significant inhibitory effect on CHO, and on the 22nd day after administration, the inhibitory rate of Conjugate 4 on CHO reached 38%; From the second week to the eighth week, the inhibition rate of Conjugate 4 on CHO was always maintained above 30%; during the observation period of 127 days, the serum CHO level of NHP administered to Conjugate 4 was always low Before administration.

For Conjugate 7, the inhibition rate of CHO was 38% on the 22nd day after a single administration; the inhibition rate of CHO was basically maintained above 30% from the 2nd week to the 8th week after administration; During the 11-week observation period, the serum CHO level of NHP administered with conjugate 7 was always lower than before administration.

(2-4) Blood routine and coagulation function test before and after liver puncture

Before and after liver puncture, the animals administered with conjugate 4 or 5 were subjected to intravenous blood sampling. The automatic five-category hematology analyzer (ADVIA 2120/ADVIA 2120i, Siemens, Germany) and the automatic blood coagulation analyzer (CA-7000/CS-2000i, Sysmex Corporation, Japan) were used to test blood routine and coagulation function. The results show that there is no significant difference in the effects of each conjugate on blood routine and coagulation function after administration compared to before administration, showing that the siRNA conjugate provided in the present disclosure has better biological safety.

Experimental example 3 Toxicity evaluation of siRNA conjugate in rats and mice

In this experimental example, by observing the clinical toxicity of rats or mice administered with conjugate 1, 4 or 7, respectively, the liver weight, blood routine, blood biochemistry, blood lipids and other indicators were detected, and gross anatomy and histopathological examinations were performed To evaluate the toxicity of the siRNA conjugates of the present disclosure in small animals.

(3-1) Rat toxicity evaluation

(3-1-1) Toxicity test in SD rats administered with conjugate 1 or 4

Select SPF SD rats aged 6-9 weeks and weighing 210-250g (purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd., production license number: SCXK (京) 2016-0011 or SCXK (京) 2016- 0006), all males were divided into 3 groups according to their body weights, 5 animals in each group, and conjugate 1, conjugate 4 or 1×PBS (pH 7.4) control were injected subcutaneously. The dose is calculated based on body weight, and each conjugate is prepared into a 60 mg/ml solution with 1×PBS (pH 7.4), the administration volume is 5 ml/kg, and the administration dose is 300 mg/kg.

After a single subcutaneous administration, test the following indicators:

(1) General status observation: 2 general status observations per day;

(2) Body weight: measure the body weight on D1 before administration, D3, D6, D10, D14 after administration and D15 on the anatomy day;

(3) Food intake: D2-3, D6-7, D12-13, measure food intake respectively;

(4) Hematology: 1.9ml blood was collected from the rat abdominal aorta on D15 before anatomy, of which 1.0ml blood sample was anticoagulated with EDTA-K2, and whole blood was directly injected to detect the following blood cytological indicators (including red blood cell count (RBC) ), white blood cell count (WBC), platelet count (PLT), hemoglobin (HGB), red blood cell volume (HCT), average red blood cell volume (MCV), average red blood cell hemoglobin (MCH), average red blood cell hemoglobin concentration (MCHC), reticulocyte Count (RET), reticulocyte percentage (RET%), neutrophil (NEU) count and percentage, lymphocyte (LYM) count and percentage, monocyte (MONO) count and percentage, eosinophil (EOS) ) Counts and percentages, and basophils (BASO) counts and percentages); the remaining 0.9mL blood sample is anticoagulated with sodium citrate and centrifuged at 1800×g at 15～25℃ for 10 minutes to separate the plasma. Detection of clotting time (prothrombin time (PT) and activated partial thrombin time (APTT));

(5) Blood biochemistry: 0.6ml of blood was collected from the jugular vein of the rat after administration on D2, and 3ml of blood was collected from the rat abdominal aorta before dissection on D15, none of which was anticoagulant. Centrifuge at 1800×g for 10 minutes at 15～25℃ for separation. Serum is tested for alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatine kinase (CK), lactate dehydrogenase (LDH), γ-gluten glutamyl transferase (GGT), urea (urea), creatinine (Crea), the sodium ion concentration (Na ^+), potassium ion concentration (K ^+), chloride ion (Cl ^-), glucose (GLU), total bilirubin (TBIL), total protein (TP), albumin (ALB) and white sphere ratio (A/G) blood biochemical indicators;

(6) Gross anatomy and histopathological examination: Animal anatomy on D15, weighing of various organs, and histopathological examination.

(3-1-2) Toxicity detection in SD rats administered with conjugate 7

The same method as (3-1-1) was used to detect the toxicity of SD rats administered with Conjugate 7, except that Conjugate 7 was used instead of Conjugate 4, and Conjugate 7 was treated with 1×PBS (pH 7.4) It is configured into 20mg/ml and 6mg/ml solutions, the administration volume is 5ml/kg, and the administration dose is 100mg/kg and 30mg/kg respectively. For index (5) blood biochemistry, blood was collected on D8 and D15 before dissection after administration.

The results showed that none of the conjugates showed obvious toxicity in rats.

(3-2) Evaluation of toxicity in mice

Select 5-6 weeks old SPF grade ICR mice (purchased from Sibefu (Beijing) Biotechnology Co., Ltd.), half male and half male, 10 mice in each group, subcutaneously injected conjugate 1, conjugate 4 or conjugate respectively Compound 7. The frequency of administration is once a week for 2 consecutive weeks, a total of 3 administrations, respectively on D1, D8 and D15. The dose is calculated based on body weight, and each conjugate is prepared into a 30 mg/ml solution with 1×PBS (pH 7.4), the administration volume is 10 ml/kg, and the administration dose is 300 mg/kg.

After 3 doses, test the following indicators:

(1) General status observation: 1 general status observation per day;

(2) Body weight: Measure body weight before administration on D1, D8, D15 and D16 on the day of anatomy;

(3) Food intake: measured once a week;

(4) Blood biochemistry: 1ml of blood was collected by eyeball removal on D16 on the day of anatomy, without anticoagulation. The serum was obtained by incubating at 37°C for 60 minutes, and then centrifuged at 4°C and 3000 rpm for 15 minutes. The blood biochemical indicators tested are the same.

(5) Gross anatomy and histopathological examination: Animal anatomy on D16, weighing of various organs, and histopathological examination.

The results showed that none of the conjugates showed obvious toxicity in mice.

The above results indicate that the conjugates of the present disclosure have better biological safety.

Some embodiments of the present disclosure are described in detail above. However, the present disclosure is not limited to the specific details in the above-mentioned embodiments. Within the scope of the technical concept of the present disclosure, various simple modifications can be made to the technical solutions of the present disclosure. These simple modifications All belong to the protection scope of the present disclosure.

In addition, it should be noted that the various specific technical features described in some of the above embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure has The combination method will not be explained separately.

In addition, various different embodiments of the present disclosure can also be combined arbitrarily, as long as they do not violate the idea of the present disclosure, they should also be regarded as the content disclosed in the present disclosure.

Claims

A siRNA conjugate, wherein the conjugate has a structure represented by formula (308):

among them,

n1 is an integer selected from 1-3, n3 is an integer selected from 0-4; each m1, m2, or m3 is each independently an integer selected from 2-10; R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently H, or selected from the group consisting of C 1 -C 10 alkyl, C 1 -C 10 haloalkyl, and C 1 -C 10 alkoxy;

R 3 is a group represented by the formula A59:

Among them, E 1 is OH, SH or BH 2 ,

Nu is siRNA, the siRNA contains a sense strand and an antisense strand, each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains a nucleotide sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, the nucleotide sequence I and the nucleotide sequence II The nucleotide sequence II is selected from a group of the following sequences i)-vi):

i) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length, and have no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 2 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-AAGCAAGCAGACAUUUAUZ 1 -3' (SEQ ID NO:1);

5'-Z 2 AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 2),

Wherein, Z 1 is C, Z 2 is G, the nucleotide sequence I contains a nucleotide Z 3 whose position corresponds to Z 1 , and the nucleotide sequence II contains a nucleoside whose position corresponds to Z 2 Acid Z 4 , where Z 4 is the first nucleotide at the 5'end of the antisense strand;

ii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 62 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-UUUGUAGCAUUUUUAUUAZ 5 -3' (SEQ ID NO: 61);

5'-Z 6 UAAUAAAAAUGCUACAAA-3' (SEQ ID NO: 62),

Wherein, Z 5 is A, Z 6 is U, the nucleotide sequence I contains a nucleotide Z 7 whose position corresponds to Z 5 , and the nucleotide sequence II contains a nucleoside whose position corresponds to Z 6 Acid Z 8 , said Z 8 being the first nucleotide at the 5'end of the antisense strand;

iii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 are the same in length and have no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 122 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-GCCUGGAGUUUAUUCGGAZ 9 -3' (SEQ ID NO: 121);

5'-Z 10 UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 122),

Wherein, Z 9 is A, Z 10 is U, the nucleotide sequence I contains the nucleotide Z 11 whose position corresponds to Z 9 and the nucleotide sequence II contains the nucleoside whose position corresponds to Z 10 Acid Z 12 , where Z 12 is the first nucleotide at the 5'end of the antisense strand;

iv) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 182 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-CUGUUUUGCUUUUGUAACZ 13 -3' (SEQ ID NO: 181);

5'-Z 14 GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 182),

Wherein, Z 13 is U, Z 14 is A, the nucleotide sequence I contains the nucleotide Z 15 whose position corresponds to Z 13 and the nucleotide sequence II contains the nucleoside whose position corresponds to Z 14 Acid Z 16 , where Z 16 is the first nucleotide at the 5'end of the antisense strand;

v) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 242 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-GGUUUUGUAGCAUUUUUAZ 17 -3' (SEQ ID NO: 241);

5'-Z 18 UAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242),

Wherein, Z 17 is U, Z 18 is A, the nucleotide sequence I contains the nucleotide Z 19 whose position corresponds to Z 17 and the nucleotide sequence II contains the nucleoside whose position corresponds to Z 18 Acid Z 20 , said Z 20 being the first nucleotide at the 5'end of the antisense strand; and

vi) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 302 The nucleotide sequences shown are equal in length and not more than 3 nucleotide differences:

5'-GUGACUUUUUAAAAUAAAZ 21 -3' (SEQ ID NO: 301);

5'-Z 22 UUUAUUUUAAAAAGUCAC-3' (SEQ ID NO: 302),

Wherein, Z 21 is A, Z 22 is U, the nucleotide sequence I contains the nucleotide Z 23 whose position corresponds to Z 21 , and the nucleotide sequence II contains the nucleoside whose position corresponds to Z 22 Acid Z 24 , said Z 24 being the first nucleotide at the 5'end of the antisense strand;

R 2 is a linear alkylene group with a length of 1-20 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more selected from the group consisting of: C (O), NH, O, S, CH=N, S(O) 2 , C 2 -C 10 alkenylene, C 2 -C 10 alkynylene, C 6 -C 10 arylene, C 3- C 18 heterocyclylene and C 5 -C 10 heteroarylene; and wherein R 2 may optionally have any one or more substituents in the group consisting of: C 1 -C 10 Alkyl, C 6 -C 10 aryl, C 5 -C 10 heteroaryl, C 1 -C 10 haloalkyl, -OC 1 -C 10 alkyl, -OC 1 -C 10 alkylphenyl, -C 1 -C 10 alkyl -OH, -OC 1 -C 10 haloalkyl, -SC 1 -C 10 alkyl, -SC 1 -C 10 alkylphenyl, -C 1 -C 10 alkyl -SH,- SC 1 -C 10 haloalkyl, halogen substituent, -OH, -SH, -NH 2 , -C 1 -C 10 alkyl -NH 2 , -N (C 1 -C 10 alkyl) (C 1 -C 10 alkyl), -NH (C 1 -C 10 alkyl), -N (C 1 -C 10 alkyl) (C 1 -C 10 alkyl phenyl), -NH (C 1 -C 10 alkyl) Phenyl), cyano, nitro, -CO 2 H, -C(O)O (C 1 -C 10 alkyl), -CON (C 1 -C 10 alkyl) (C 1 -C 10 alkyl) ), -CONH (C 1 -C 10 alkyl), -CONH 2 , -NHC(O) (C 1 -C 10 alkyl), -NHC(O) (phenyl), -N(C 1 -C 10 alkyl) C (O) (C 1 -C 10 alkyl), -N (C 1 -C 10 alkyl) C (O) (phenyl), -C (O) C 1 -C 10 alkyl , -C(O)C 1 -C 10 alkylphenyl, -C(O)C 1 -C 10 haloalkyl, -OC(O)C 1 -C 10 alkyl, -SO 2 (C 1 -C 10 alkyl), -SO 2 (phenyl), -SO 2 (C 1 -C 10 haloalkyl), -SO 2 NH 2 , -SO 2 NH (C 1 -C 10 alkyl), -SO 2 NH (phenyl), - NHSO 2 (C 1 -C 10 alkyl), - NHSO 2 (phenyl), and -NHSO 2 (C 1 -C 10 haloalkyl);

Each L 1 is independently a linear alkylene group with a length of 1 to 70 carbon atoms, wherein one or more carbon atoms are optionally selected from any one or more of the following groups Replaced by: C(O), NH, O, S, CH=N, S(O) 2 , C 2 -C 10 alkenylene, C 2 -C 10 alkynylene, C 6 -C 10 arylene Group, C 3 -C 18 heterocyclylene and C 5 -C 10 heteroarylene; and wherein, L 1 may optionally have any one or more substituents in the group consisting of the following groups ：C 1 -C 10 alkyl, C 6 -C 10 aryl, C 5 -C 10 heteroaryl, C 1 -C 10 haloalkyl, -OC 1 -C 10 alkyl, -OC 1 -C 10 alkane Alkyl phenyl, -C 1 -C 10 alkyl-OH, -OC 1 -C 10 haloalkyl, -SC 1 -C 10 alkyl, -SC 1 -C 10 alkyl phenyl, -C 1 -C 10 Alkyl -SH, -SC 1 -C 10 haloalkyl, halogen substituent, -OH, -SH, -NH 2 , -C 1 -C 10 alkyl -NH 2 , -N(C 1 -C 10 alkyl ) (C 1 -C 10 alkyl), -NH (C 1 -C 10 alkyl), -N (C 1 -C 10 alkyl) (C 1 -C 10 alkyl phenyl), -NH (C 1 -C 10 alkyl phenyl), cyano, nitro, -CO 2 H, -C(O)O (C 1 -C 10 alkyl), -CON (C 1 -C 10 alkyl) (C 1 -C 10 alkyl), -CONH (C 1 -C 10 alkyl), -CONH 2 , -NHC(O) (C 1 -C 10 alkyl), -NHC(O)(phenyl),- N(C 1 -C 10 alkyl)C(O)(C 1 -C 10 alkyl), -N(C 1 -C 10 alkyl)C(O)(phenyl), -C(O)C 1 -C 10 alkyl, -C(O)C 1 -C 10 alkylphenyl, -C(O)C 1 -C 10 haloalkyl, -OC(O)C 1 -C 10 alkyl, -SO 2 (C 1 -C 10 alkyl), -SO 2 (phenyl), -SO 2 (C 1 -C 10 haloalkyl), -SO 2 NH 2 , -SO 2 NH (C 1 -C 10 alkyl) ), - SO 2 NH (phenyl), - NHSO 2 (C 1 -C 10 alkyl), - NHSO 2 (phenyl), and -NHSO 2 (C 1 -C 10 haloalkyl);

Represents the site where the group is covalently attached; M 1 represents the targeting group.
The siRNA conjugate of claim 1, wherein each L 1 is independently selected from the group consisting of (A1)-(A26) groups and any combination thereof:

Wherein, each j1 is independently an integer of 1-20; each j2 is independently an integer of 1-20;

Each R'is independently C 1 -C 10 alkyl;

Each Ra is independently selected from the group consisting of groups represented by formulas (A27)-(A45) or any combination thereof:

Each Rb is independently C 1 -C 10 alkyl;

Or L 1 is selected from a connection combination of one or more of A1, A4, A5, A6, A8, A10, A11, and A13;

Or L 1 is selected from the connection combination of at least two of A1, A4, A8, A10 and A11;

Or, L 1 is selected from a connection combination of at least two of A1, A8, and A10;

Or, the length of L 1 is 3-25 atoms;

Or, the length of L 1 is 4-15 atoms;

Represents the point at which the group is covalently attached.
The siRNA conjugate according to claim 2, wherein j1 is an integer of 2-10, j2 is an integer of 2-10, R'is a C 1 -C 4 alkyl group, and Ra is A27, A28, A29, A30 And one of A31, Rb is C 1 -C 5 alkyl;

Or j1 is an integer of 3-5, j2 is an integer of 3-5, R'is one of methyl, ethyl and isopropyl, and Ra is a group represented by formula (A27) or formula (A28) In the shown group, Rb is one of methyl, ethyl, isopropyl and butyl.
The siRNA conjugate according to any one of claims 1-3, wherein n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=2-3.
The siRNA conjugate according to any one of claims 1 to 4, wherein each m1, m2 or m3 is each independently an integer of 2-5, and/or m1=m2=m3.
The siRNA conjugate according to any one of claims 1-5, wherein each of the targeting groups is independently a ligand that has affinity with the asialoglycoprotein receptor on the surface of mammalian liver cells. body;

Alternatively, each of the targeting groups is independently asialoglycoprotein or sugar;

Alternatively, each of the targeting groups is independently selected from D-mannanose, L-mannanose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L -Glucose, D-galactose, L-galactose, α-D-mannanose, β-D-mannanose, α-D-mannanose, β-D-mannanose, α-D -Glucopyranose, β-D-glucopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-frutofuranose, α-D-fructose pyranose, α-D-galactopyranose , Β-D-galactopyranose, α-D-galactofuranose, β-D-galactosamine, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetyl half Lactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2 -Deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-carboxamido-2,3-di-O-methyl -D-mannanose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3 ,4-Tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranoside, 3 ,4,6,7-Tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoheptanoside ethyl ester, 2,5-anhydro-D-allosenitrile , Ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose;

Alternatively, at least one or each of the targeting groups is galactose or N-acetylgalactosamine.
The siRNA conjugate of any one of claims 1-6, wherein R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are independently H, methyl or ethyl;

Or R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are all H.
The siRNA conjugate according to any one of claims 1-7, wherein R 2 contains both a connection site connected to N on the nitrogen-containing backbone and a connection site connected to the P atom in R 3 ；

Or the site on R 2 connected to the N on the nitrogen-containing skeleton forms an amide bond with N, and the site connected to the P atom in R 3 forms a phosphate bond with P;

Or R 2 is selected from the group represented by formula (B5), (B6), (B5') or (B6'),

among them,
Indicates the site where the group is covalently connected;

The value range of q 2 can be an integer of 1-10.
The siRNA conjugate of any one of claims 1-8, wherein the conjugate has the formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421 ) Or (422):
The siRNA conjugate according to any one of claims 1-9, wherein the P atom in formula A59 is connected to the end of the siRNA sense strand or antisense strand, and the end refers to the sense strand or antisense strand. The first 4 nucleotides from one end of the sense strand;

Or the P atom in formula A59 is connected to the end of the siRNA sense strand or antisense strand; or the P atom in formula A59 is connected to the 3'end of the siRNA sense strand;

Or the P atom in formula A59 is connected to the 2'position, 3'position or 5'position of the nucleotide in the siRNA through a phosphodiester bond.
The siRNA conjugate according to claim 1, wherein i) there is no more than one nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1, and/ Or there is no more than one nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2; or ii), the nucleotide sequence I and SEQ ID NO: 61 There is no more than 1 nucleotide difference between the nucleotide sequences shown, and/or no more than 1 nucleus between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 Nucleotide difference; or iii) no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121, and/or the nucleotide sequence II There is no more than one nucleotide difference between the nucleotide sequence shown in SEQ ID NO: 122; or, iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 There is no more than 1 nucleotide difference between them, and/or no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182; or, v) There is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241, and/or the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 242 There is no more than 1 nucleotide difference between the nucleotide sequences of, or vi) no more than 1 nucleotide between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 Difference, and/or no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:302.
The siRNA conjugate according to claim 1 or 11, wherein i) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 includes the position Z 4 And Z 4 is selected from A, U or C; or ii) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 includes the Z 8 position Difference, and Z 8 is selected from A, C or G; or iii) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 includes the difference at position Z 12 , And Z 12 is selected from A, C or G; or iv) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182 includes the difference at the Z 16 position, And Z 16 is selected from U, C or G; or v) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 242 includes the difference at the Z 20 position, and Z 20 is selected from U, C or G; or vi) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 302 includes the difference at position Z 24 , and Z 24 is selected from A, C or G.
The siRNA conjugate of claim 12, wherein Z 3 is a nucleotide complementary to Z 4 ; or Z 7 is a nucleotide complementary to Z 8 ; or Z 11 is a nucleus complementary to Z 12 Or Z 15 is a nucleotide complementary to Z 16 ; or Z 19 is a nucleotide complementary to Z 20 ; or Z 23 is a nucleotide complementary to Z 24 .
The siRNA conjugate according to any one of claims 1-13, wherein the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, substantially reverse complementary or completely reverse Complementarity; the substantially reverse complementation refers to the presence of no more than 3 base mismatches between the two nucleotide sequences; the substantially reverse complementarity refers to the presence of no more than 3 base mismatches between the two nucleotide sequences More than 1 base mismatch; complete reverse complementation means that there is no mismatch between two nucleotide sequences.
The siRNA conjugate according to any one of claims 11-14, wherein the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV and a nucleotide sequence III And the length of the nucleotide sequence IV are each independently 1-4 nucleotides, the nucleotide sequence III is connected to the 5'end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the nucleotide sequence At the 3'end of II, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complement refers to two nucleotide sequences There is no more than one base mismatch between them; complete reverse complementation means that there is no mismatch between two nucleotide sequences.
The siRNA conjugate of claim 15, wherein:

i) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 4; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is C; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is CC; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is CCC; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, according to the direction from the 5'end to the 3'end, the nucleotide sequence The base composition of sequence III is ACCC; or

ii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 63, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 64; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is U; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is GU; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is GGU; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotides The base composition of sequence III is GGGU; or

iii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 124; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is G; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is AG; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is UAG; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotides The base composition of sequence III is AUAG; or

iv) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 184; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is C; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is AC; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, according to the 5'end to the 3'end In the direction of the nucleotide sequence III, the base composition of the nucleotide sequence III is GAC; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotides The base composition of sequence III is AGAC; or

v) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 243, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is G; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is UG; or, the length of the nucleotide sequence III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is CUG; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotide The base composition of sequence III is UCUG; or

vi) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 304; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is G; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is UG; or, the length of the nucleotide sequence III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is AUG; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotide sequence The base composition of sequence III is UAUG.
The siRNA conjugate of claim 16, wherein the nucleotide sequences III and IV are completely reverse complementary.
The siRNA conjugate according to any one of claims 1-17, wherein the antisense strand further contains a nucleotide sequence V, and the length of the nucleotide sequence V is 1 to 3 nucleotides. At the 3'end of the antisense strand, constitute the 3'hanging end of the antisense strand; or the length of the nucleotide sequence V is 2 nucleotides; or the nucleotide sequence V is continuous Two thymine deoxyribonucleotides or two consecutive uracil ribonucleotides; or the nucleotide sequence V is complementary to the nucleotide at the corresponding position of the target mRNA.
The siRNA conjugate of any one of claims 1-18, wherein:

The sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 6; or the sense strand of the siRNA contains The nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 8;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 65, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 66; or the sense strand of the siRNA contains The nucleotide sequence shown in SEQ ID NO: 67, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 68;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 125, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 126; or the sense of the siRNA The strand contains the nucleotide sequence shown in SEQ ID NO: 127, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 128;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 185, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 186; or the sense strand of the siRNA contains The nucleotide sequence shown in SEQ ID NO: 187, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 188;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 245, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 246; or the sense of the siRNA The chain contains the nucleotide sequence shown in SEQ ID NO: 247, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 248;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:305, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:306; or the sense of the siRNA The strand contains the nucleotide sequence shown in SEQ ID NO: 307, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 308.
The siRNA conjugate according to any one of claims 11-19, wherein the siRNA has siPCSKa1, siPCSKa2, siPCSKb1, siPCSKb2, siPCSKc1, siPCSKc2, siPCSKd1, siPCSKd2, siPCSKe1, siPCSKe2, siPCSKf1 or siPCSKf2. Nucleotide sequence.
The siRNA conjugate according to any one of claims 1-20, wherein at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and/or at least one phosphate The ester group is a phosphate group having a modification group.
The siRNA conjugate of claim 21, wherein each nucleotide in the sense strand and the antisense strand is independently a fluorinated modified nucleotide or a non-fluorinated modified nucleotide ；

Or the fluoro-modified nucleotides are located in the nucleotide sequence I and the nucleotide sequence II, and, in the direction from the 5'end to the 3'end, the nucleotide sequence I is at least 7th and 8th The nucleotides at position 9 are fluorinated modified nucleotides; according to the direction from the 5'end to the 3'end, at least the nucleotides at positions 2, 6, 14, and 16 in the nucleotide sequence II are Fluorinated modified nucleotides;

Or according to the direction from the 5'end to the 3'end, in the sense strand, the nucleotides at positions 7, 8, 9 or 5, 7, 8, and 9 of the nucleotide sequence I are fluoro Modified nucleotides, the nucleotides at the remaining positions in the sense strand are non-fluorinated modified nucleotides; in the direction from the 5'end to the 3'end, in the antisense strand, the nucleoside The nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, and 16 of acid sequence II are fluoro-modified nucleotides, and the nucleosides at the remaining positions in the antisense strand Acids are non-fluorinated modified nucleotides.
The siRNA conjugate according to claim 21 or 22, wherein each non-fluorinated modified nucleotide is independently selected from the core formed by the substitution of a non-fluorinated group at the 2'-position hydroxyl group of the ribose group of the nucleotide One of nucleotide or nucleotide analogues;

Or the nucleotide formed by replacing the hydroxyl group at the 2'position of the ribose group of the nucleotide with a non-fluorine group is selected from the group consisting of 2'-alkoxy-modified nucleotides and 2'-substituted alkoxy-modified nucleosides Acid, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, One of 2'-deoxynucleotides; the nucleotide analog is selected from one of heteronucleotides, LNA, ENA, cET, UNA and GNA;

Or each non-fluorinated modified nucleotide is a methoxy modified nucleotide, and the methoxy modified nucleotide refers to a nucleoside formed by replacing the 2'-hydroxyl group of the ribose group with a methoxy group acid.
The siRNA conjugate according to any one of claims 21-23, wherein, in the direction from the 5'end to the 3'end, the 5th, 7th, 8th, and 8th of the nucleotide sequence I in the sense strand of the siRNA The nucleotides at position 9 are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the sense strand of the siRNA are methoxy-modified nucleotides, and in the direction from the 5'end to the 3'end, The nucleotides at positions 2, 6, 8, 9, 14 and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluorinated modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of siRNA are Methoxy modified nucleotides;

Or, according to the direction from the 5'end to the 3'end, the 5th, 7th, 8th and 9th nucleotides of the nucleotide sequence I in the sense strand of the siRNA are fluorinated modified nucleotides, and the sense The nucleotides at the remaining positions of the chain are methoxy-modified nucleotides, and in the direction from the 5'end to the 3'end, the second, sixth, and 14th nucleotide sequence II in the antisense strand of the siRNA The nucleotides at and 16 are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of siRNA are methoxy-modified nucleotides;

Or, according to the direction from the 5'end to the 3'end, the nucleotides at positions 7, 8 and 9 of nucleotide sequence I in the sense strand of the siRNA are fluorinated modified nucleotides, and the sense strand of the siRNA The nucleotides at the remaining positions are methoxy-modified nucleotides, and in the direction from the 5'end to the 3'end, the second, sixth, 14th, and 16th nucleotide sequence II in the antisense strand of the siRNA The nucleotides at the position are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides.
The siRNA conjugate according to any one of claims 1-24, wherein the siRNA is siPCSKa1-M1, siPCSKa2-M1, siPCSKa1-M2, siPCSKa2-M2, siPCSKa1-M3, siPCSKa2-M3, siPCSKb1- M1, siPCSKb2-M1, siPCSKb1-M2, siPCSKb2-M2, siPCSKb1-M3, siPCSKb2-M3, siPCSKc1-M1, siPCSKc2-M1, siPCSKc1-M2, siPCSKc2-M2, siPCSKc1-M3, siPCSKc2-M3, siPCSKd1-M1 siPCSKd2-M1, siPCSKd1-M2, siPCSKd2-M2, siPCSKd1-M3, siPCSKd2-M3, siPCSKe1-M1, siPCSKe2-M1, siPCSKe1-M2, siPCSKe2-M2, siPCSKe1-M3, siPCSKe2-M3, siPCSKf1-M1, siPCSKf2- Any one of M1, siPCSKf1-M2, siPCSKf2-M2, siPCSKf1-M3, or siPCSKf2-M3.
The siRNA conjugate according to claim 21, wherein the phosphate group having a modification group is a phosphorothioate formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom Ester group; or the phosphorothioate group having a modified group is a phosphorothioate group having the structure shown in formula (1):
The siRNA conjugate according to claim 26, wherein, in the siRNA, the phosphorothioate group linkage exists in at least one of the following positions:

Between the first nucleotide and the second nucleotide of the 5'end of the sense strand;

Between the second nucleotide and the third nucleotide of the 5'end of the sense strand;

Between the first nucleotide and the second nucleotide of the 3'end of the sense strand;

Between the second nucleotide and the third nucleotide of the 3'end of the sense strand;

Between the first nucleotide and the second nucleotide of the 5'end of the antisense strand;

Between the second nucleotide and the third nucleotide of the 5'end of the antisense strand;

Between the first nucleotide and the second nucleotide of the 3'end of the antisense strand; and

Between the second nucleotide and the third nucleotide of the 3'end of the antisense strand.
The siRNA conjugate according to any one of claims 1-27, wherein the siRNA is siPCSKa1-M1S, siPCSKa2-M1S, siPCSKa1-M2S, siPCSKa2-M2S, siPCSKa1-M3S, siPCSKa2-M3S, siPCSKb1- M1S, siPCSKb2-M1S, siPCSKb1-M2S, siPCSKb2-M2S, siPCSKb1-M3S, siPCSKb2-M3S, siPCSKc1-M1S, siPCSKc2-M1S, siPCSKc1-M2S, siPCSKc2-M2S, siPCSKc1-M3S, siPCSK1 siPCSKd2-M1S, siPCSKd1-M2S, siPCSKd2-M2S, siPCSKd1-M3S, siPCSKd2-M3S, siPCSKe1-M1S, siPCSKe2-M1S, siPCSKe1-M2S, siPCSKe2-M2S, siPCSKe1-M3S, siPCSK2, siPCf Any one of M1S, siPCSKf1-M2S, siPCSKf2-M2S, siPCSKf1-M3S or siPCSKf2-M3S.
The siRNA conjugate according to any one of claims 1-28, wherein the 5'terminal nucleotide of the siRNA antisense strand is modified with 5'-phosphate nucleotides or 5'-phosphate analogs Nucleotide

Or the 5'-phosphate nucleotides are nucleotides having the structure shown in formula (2), and the nucleotides modified by the 5'-phosphate analogues are selected from the group consisting of structures such as formula (3)-formula (6). ) In any one of the nucleotides,

Wherein, R is selected from H, OH, methoxy or fluorine; Base represents a base, selected from A, U, C, G or T.
The siRNA conjugate according to any one of claims 1-29, wherein the siRNA is siPCSKa1-M1P1, siPCSKa1-M2P1, siPCSKa1-M3P1, siPCSKa2-M1P1, siPCSKa2-M2P1, siPCSKa2-M3P1, siPCSKa1- M1SP1, siPCSKa1-M2SP1, siPCSKa1-M3SP1, siPCSKa2-M1SP1, siPCSKa2-M2SP1, siPCSKa2-M3SP1, siPCSKb1-M1P1, siPCSKb1-M2P1, siPCSKb1-M3P1, siPCSKb2-M1P1, siPCSKb2-M2P1, siPCSKb1 siPCSKb1-M2SP1, siPCSKb1-M3SP1, siPCSKb2-M1SP1, siPCSKb2-M2SP1, siPCSKb2-M3SP1, siPCSKc1-M1P1, siPCSKc1-M2P1, siPCSKc1-M3P1, siPCSKc2-M1P1, siPCSKc2-M2P1, siPCSKc2-M2P1 M2SP1, siPCSKc1-M3SP1, siPCSKc2-M1SP1, siPCSKc2-M2SP1, siPCSKc2-M3SP1, siPCSKd1-M1P1, siPCSKd1-M2P1, siPCSKd1-M3P1, siPCSKd2-M1P1, siPCSKd2-M2P1, siPCSKd2-M3SK1, siPCSKd1-M2P1 siPCSKd1-M3SP1, siPCSKd2-M1SP1, siPCSKd2-M2SP1, siPCSKd2-M3SP1, siPCSKe1-M1P1, siPCSKe1-M2P1, siPCSKe1-M3P1, siPCSKe2-M1P1, siPCSKe2-M2P1, siPCSKe2-M3e1-M2P1, siPCSKe2-M3e1-M2SP1 M3SP1, siPCSKe2-M1SP1, siPCSKe2-M2SP1, siPCSKe2-M3SP1, siPCSKf1-M1P1, siPCSKf1-M2P1, siPCSKf1-M3P1, siPCSKf2-M1P1, siPCSKf2-M2P1, siPCSKf2-M3P1, siPCSKf1 -Any one of M1SP1, siPCSKf1-M2SP1, siPCSKf1-M3SP1, siPCSKf2-M1SP1, siPCSKf2-M2SP1 or siPCSKf2-M3SP1.
A siRNA comprising a sense strand and an anti-sense strand, each nucleotide in the sense strand and the anti-sense strand is independently a fluorinated modified nucleotide or a non-fluorinated modified nucleoside Acid; the sense strand contains a nucleotide sequence I, the antisense strand contains a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double Chain region, the fluoro-modified nucleotides are located in nucleotide sequence I and nucleotide sequence II, and, in the direction from the 5'end to the 3'end, in the sense strand, the nucleoside The nucleotides at positions 7, 8, and 9 of acid sequence I are fluorinated modified nucleotides, and the nucleotides at the remaining positions in the sense strand are non-fluorinated modified nucleotides; according to the 5'end to In the direction of the 3'end, in the antisense strand, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are fluorinated modified nucleotides, and in the antisense strand The nucleotides at the remaining positions are non-fluorinated modified nucleotides, and,

i) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 2 The nucleotide sequences shown are equal in length and have no more than 3 nucleotide differences. The nucleotide sequence I includes the nucleotide Z 3 whose position corresponds to Z 1 , and the nucleotide sequence II The inclusion position corresponds to the nucleotide Z 4 of Z 2 , where Z 4 is the first nucleotide at the 5'end of the antisense strand; or,

ii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 62 The nucleotide sequences shown are equal in length and have no more than 3 nucleotide differences. The nucleotide sequence I includes the nucleotide Z 7 whose position corresponds to Z 5 , and the nucleotide sequence II The inclusion position corresponds to the nucleotide Z 8 of Z 6 , where Z 8 is the first nucleotide at the 5'end of the antisense strand; or,

iii) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 122 The nucleotide sequences shown are equal in length and have no more than 3 nucleotide differences. The nucleotide sequence I includes the nucleotide Z 11 whose position corresponds to Z 9 and the nucleotide sequence II includes a nucleotide position corresponding to the Z 12 Z 10, Z 12 is the antisense strand of the 5 'end of the first nucleotide; or

iv) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 are equal in length, and have no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 182 The nucleotide sequences shown are equal in length and have no more than 3 nucleotide differences. The nucleotide sequence I includes the nucleotide Z 15 whose position corresponds to Z 13 , and the nucleotide sequence II The inclusion position corresponds to the nucleotide Z 16 of Z 14 , where Z 16 is the first nucleotide at the 5'end of the antisense strand; or,

v) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 242 The nucleotide sequences shown are equal in length and have no more than 3 nucleotide differences. The nucleotide sequence I includes the nucleotide Z 19 at the position corresponding to Z 17 , and the nucleotide sequence II The inclusion position corresponds to the nucleotide Z 20 of Z 18 , said Z 20 being the first nucleotide at the 5'end of the antisense strand; or,

vi) The nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 have the same length and no more than 3 nucleotide differences, and the nucleotide sequence II is the same as SEQ ID NO: 302 The nucleotide sequences shown are equal in length and have no more than 3 nucleotide differences. The nucleotide sequence I includes the nucleotide Z 23 corresponding to the position Z 21 , and the nucleotide sequence II comprising a position corresponding to nucleotide Z 22 Z 24, Z 24 is the antisense strand of the 5 'end of the first nucleotide.
The siRNA of claim 31, wherein each non-fluorinated modified nucleotide is independently selected from nucleotides or nucleosides formed by substituting a non-fluorinated group at the 2'-position hydroxyl group of the ribose group of the nucleotide One of the acid analogs.
The siRNA according to claim 32, wherein the nucleotide formed by substituting the hydroxyl group at the 2'position of the ribose group of the nucleotide with a non-fluorine group is selected from the group consisting of 2'-alkoxy modified nucleotides, 2'- Substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'- One of substituted amino-modified nucleotides and 2'-deoxynucleotides; the nucleotide analog is selected from one of heteronucleotides, LNA, ENA, cET, UNA and GNA.
The siRNA according to any one of claims 31-33, wherein each non-fluorinated modified nucleotide is a methoxy modified nucleotide, and the methoxy modified nucleotide refers to ribose A nucleotide in which the 2'-hydroxy group of the group is replaced by a methoxy group.
The siRNA according to any one of claims 31-34, wherein i) there is no more than one nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 , And/or no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2; or ii), the nucleotide sequence I and SEQ ID There is no more than 1 nucleotide difference between the nucleotide sequence shown in NO: 61, and/or the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 are not more than 1 nucleotide difference; or, iii) no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121, and/or the nucleoside There is no more than one nucleotide difference between the acid sequence II and the nucleotide sequence shown in SEQ ID NO: 122; or, iv) the nucleotide sequence I and the nucleoside shown in SEQ ID NO: 181 No more than 1 nucleotide difference between the acid sequences, and/or no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182; or , V) There is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241, and/or the nucleotide sequence II and SEQ ID NO: There is no more than 1 nucleotide difference between the nucleotide sequence shown in 242; or vi) there is no more than 1 difference between the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 Nucleotide difference, and/or no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:302.
The siRNA according to any one of claims 31-35, wherein i) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 includes the Z 4 position And Z 4 is selected from A, U or C; or ii) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 includes the Z 8 position And Z 8 is selected from A, C or G; or iii) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 includes the Z 12 position Difference, and Z 12 is selected from A, C or G; or iv) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182 includes the difference at position Z 16 , And Z 16 is selected from U, C or G; or v) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 242 includes the difference at the Z 20 position, And Z 20 is selected from U, C or G; or vi) the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 302 includes the difference at the Z 24 position, and Z 24 is selected from A, C or G.
The siRNA of claim 36, wherein Z 3 is a nucleotide complementary to Z 4 ; or Z 7 is a nucleotide complementary to Z 8 ; or Z 11 is a nucleotide complementary to Z 12 ; Either Z 15 is a nucleotide complementary to Z 16 ; or Z 19 is a nucleotide complementary to Z 20 ; or Z 23 is a nucleotide complementary to Z 24 .
The siRNA according to any one of claims 31-37, wherein the nucleotide sequence I and the nucleotide sequence II are substantially reverse complementary, substantially reverse complementary or completely reverse complementary; The "substantially reverse complementarity" means that there are no more than 3 base mismatches between two nucleotide sequences; the "substantially reverse complementarity" refers to the presence of no more than 1 base mismatch between the two nucleotide sequences. A base mismatch; complete reverse complementation means that there is no mismatch between two nucleotide sequences.
The siRNA according to any one of claims 31-38, wherein the sense strand further contains a nucleotide sequence III, and the antisense strand further contains a nucleotide sequence IV, a nucleotide sequence III and a nucleoside The length of the acid sequence IV is each independently 1-4 nucleotides, the nucleotide sequence III is connected to the 5'end of the nucleotide sequence I, and the nucleotide sequence IV is connected to the 3 of the nucleotide sequence II. 'At the end, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary; the substantially reverse complement refers to the existence between two nucleotide sequences No more than 1 base mismatch; complete reverse complementation means that there is no mismatch between two nucleotide sequences.
The siRNA of any one of claims 31-39, wherein:

i) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 4; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is C; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is CC; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is CCC; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, according to the direction from the 5'end to the 3'end, the nucleotide sequence The base composition of sequence III is ACCC; or

ii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 63, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 64; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is U; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is GU; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is GGU; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotides The base composition of sequence III is GGGU; or

iii) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 123, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 124; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is G; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is AG; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is UAG; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotides The base composition of sequence III is AUAG; or

iv) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 183, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 184; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is C; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is AC; or, the lengths of the nucleotide sequences III and IV are both 3 nucleotides, according to the 5'end to the 3'end In the direction of the nucleotide sequence III, the base composition of the nucleotide sequence III is GAC; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotides The base composition of sequence III is AGAC; or

v) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 243, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 244; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is G; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is UG; or, the length of the nucleotide sequence III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is CUG; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotide The base composition of sequence III is UCUG; or

vi) The nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO: 303, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO: 304; and the nucleotide sequence The lengths of the sequences III and IV are both 1 nucleotide, and the base of the nucleotide sequence III is G; or the lengths of the nucleotide sequences III and IV are both 2 nucleotides, according to 5 From the'end to the 3'end, the base composition of the nucleotide sequence III is UG; or, the length of the nucleotide sequence III and IV are both 3 nucleotides, according to the 5'end to the 3'end The base composition of the nucleotide sequence III is AUG; or, the length of the nucleotide sequence III and IV are both 4 nucleotides, in the direction from the 5'end to the 3'end, the nucleotide sequence The base composition of sequence III is UAUG.
The siRNA of claim 40, wherein the nucleotide sequences III and IV are completely reverse complementary.
The siRNA according to any one of claims 31-41, wherein the antisense strand further contains a nucleotide sequence V, the length of the nucleotide sequence V is 1 to 3 nucleotides, and is connected to the The 3'end of the antisense strand constitutes the 3'hanging end of the antisense strand; or the length of the nucleotide sequence V is 2 nucleotides; or the nucleotide sequence V is two consecutive thymus Pyrimidine deoxyribonucleotides or two consecutive uracil ribonucleotides; or the nucleotide sequence V is complementary to the nucleotide at the corresponding position of the target mRNA.
The siRNA of any one of claims 31-42, wherein:

The sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 6; or the sense strand of the siRNA contains The nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 8;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 65, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 66; or the sense strand of the siRNA contains The nucleotide sequence shown in SEQ ID NO: 67, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 68;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 125, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 126; or the sense of the siRNA The strand contains the nucleotide sequence shown in SEQ ID NO: 127, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 128;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 185, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 186; or the sense strand of the siRNA contains The nucleotide sequence shown in SEQ ID NO: 187, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 188;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 245, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 246; or the sense of the siRNA The chain contains the nucleotide sequence shown in SEQ ID NO: 247, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 248;

Or the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:305, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:306; or the sense of the siRNA The strand contains the nucleotide sequence shown in SEQ ID NO: 307, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO: 308.
The siRNA according to any one of claims 31-43, wherein the siRNA has nucleotides represented by siPCSKa1, siPCSKa2, siPCSKb1, siPCSKb2, siPCSKc1, siPCSKc2, siPCSKd1, siPCSKd2, siPCSKe1, siPCSKe2, siPCSKf1, or siPCSKf2 sequence.
The siRNA according to any one of claims 31-44, wherein the siRNA is siPCSKa1-M1, siPCSKa2-M1, siPCSKb1-M1, siPCSKb2-M1, siPCSKc1-M1, siPCSKc2-M1, siPCSKd1-M1 , SiPCSKd2-M1, siPCSKe1-M1, siPCSKe2-M1, siPCSKf1-M1 or siPCSKf2-M1.
The siRNA according to any one of claims 31-45, wherein at least one phosphate group in the sense strand or the antisense strand is a phosphate group with a modification group.
The siRNA according to claim 46, wherein the phosphate group with a modification group is a phosphorothioate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom; Or the phosphate group with a modified group is a phosphorothioate group having a structure as shown in formula (1):
The siRNA according to claim 47, wherein in the siRNA, the phosphorothioate group linkage exists in at least one of the following positions:

Between the first nucleotide and the second nucleotide of the 5'end of the sense strand;

Between the second nucleotide and the third nucleotide of the 5'end of the sense strand;

Between the first nucleotide and the second nucleotide of the 3'end of the sense strand;

Between the second nucleotide and the third nucleotide of the 3'end of the sense strand;

Between the first nucleotide and the second nucleotide of the 5'end of the antisense strand;

Between the second nucleotide and the third nucleotide of the 5'end of the antisense strand;

Between the first nucleotide and the second nucleotide of the 3'end of the antisense strand; and

Between the second nucleotide and the third nucleotide of the 3'end of the antisense strand.
The siRNA of any one of claims 31-48, wherein the siRNA is siPCSKa1-M1S, siPCSKa2-M1S, siPCSKb1-M1S, siPCSKb2-M1S, siPCSKc1-M1S, siPCSKc2-M1S, siPCSKd1-M1S, siPCSKd2 -Any one of M1S, siPCSKe1-M1S, siPCSKe2-M1S, siPCSKf1-M1S or siPCSKf2-M1S.
The siRNA according to any one of claims 31-49, wherein the 5'terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide ；

Or the 5'-phosphate nucleotides are nucleotides having the structure shown in formula (2), and the nucleotides modified by the 5'-phosphate analogues are selected from the group consisting of structures such as formula (3)-formula (6). ) In any one of the nucleotides,

Wherein, R is selected from H, OH, methoxy or fluorine; Base represents a base, selected from A, U, C, G or T.
The siRNA according to any one of claims 31-50, wherein the siRNA is siPCSKa1-M1P1, siPCSKa2-M1P1, siPCSKa1-M1SP1, siPCSKa2-M1SP1, siPCSKb1-M1P1, siPCSKb2-M1P1, siPCSKb1-M1SP1, siPCSKb2 -M1SP1, siPCSKc1-M1P1, siPCSKc2-M1P1, siPCSKc1-M1SP1, siPCSKc2-M1SP1, siPCSKd1-M1P1, siPCSKd2-M1P1, siPCSKd1-M1SP1, siPCSKd2-M1SP1, siPCSKe1-M1P1, siPCSKe2-e1-M1P1, siPCSK1SP1 , Any one of siPCSKf1-M1P1, siPCSKf2-M1P1, siPCSKf1-M1SP1 or siPCSKf2-M1SP1.
The siRNA according to any one of claims 31-51, wherein the siRNA is any one of siPCSKa1-M1SP, siPCSKb1-M1SP, siPCSKc1-M1SP, siPCSKd1-M1SP, siPCSKe1-M1SP, or siPCSKf1-M1SP.
A pharmaceutical composition, characterized in that it contains the siRNA according to any one of claims 31-52 and a pharmaceutically acceptable carrier.
An siRNA conjugate containing the siRNA according to any one of claims 31-52 and a conjugate group conjugated to the siRNA.
The siRNA conjugate of any one of claims 1-30 and 54, the siRNA of any one of claims 31-52, and/or the pharmaceutical composition of claim 53 are prepared for treatment and / Or use in medicines for preventing diseases or physiological conditions caused by abnormal expression of PCSK9 gene.
A method for treating and/or preventing diseases or physiological conditions caused by abnormal expression of PCSK9 gene, wherein the method comprises adding an effective amount of the siRNA conjugate according to any one of claims 1-30 and 54, The siRNA according to any one of claims 31-52 and/or the pharmaceutical composition according to claim 53 is administered to a subject suffering from the disease or physiological condition.
A method for inhibiting PCSK9 gene expression in hepatocytes, the method comprising adding an effective amount of the siRNA conjugate of any one of claims 1-30 and 54 and the method of any one of claims 31-52 The siRNA and/or the pharmaceutical composition of claim 53 are contacted with the hepatocytes.
A kit, wherein the kit contains the siRNA conjugate according to any one of claims 1-30 and 54, the siRNA according to any one of claims 31-52 and/or the siRNA according to claim 53 The pharmaceutical composition.