WO2020214830A1 - Protein translational control - Google Patents
Protein translational control Download PDFInfo
- Publication number
- WO2020214830A1 WO2020214830A1 PCT/US2020/028546 US2020028546W WO2020214830A1 WO 2020214830 A1 WO2020214830 A1 WO 2020214830A1 US 2020028546 W US2020028546 W US 2020028546W WO 2020214830 A1 WO2020214830 A1 WO 2020214830A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- sequence
- polypeptide
- complex
- capped
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/317—Chemical structure of the backbone with an inverted bond, e.g. a cap structure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- RNA-targeting CRISPR-Cas applications provide tools to degrade RNA or modulate RNA structure but do not, on their own enhance gene expression or increase translational protein control.
- existing methods of enhancing and/or increasing gene expression, such as the delivery of messenger RNAs prove to be technically challenging. Indeed, there are few known or well characterized methods to increase mRNA translation.
- RNA molecules The vast majority of gene regulatory drugs have been designed to knockdown gene expression (i.e. siRNAs, miRNAs, anti-sense, etc.). Some methods exist to enhance gene expression, such as the delivery of mRNAs; however, therapeutic delivery of such large and charged RNA molecules is technically challenging, inefficient, and not particularly practical.
- Classical gene therapy approaches involve delivery' of a gene product as viral-encoded products (e.g. AAV or lentivirus-packaged products); however, these methods suffer from not being able to accurately reproduce the correct alternatively spliced isoforms in the correct ratios.
- gene delivery can exclude important non-coding regulator sequences.
- Other methods of regulating protein translation involve engineered RNA binding proteins which are not easily delivered to cells and can be highly immunogenic.
- engineered RNA binding proteins require extensive engineering for each target RNA sequence and certain of these possess limits to their applicability. More problematically, the act of expression of certain of these types of engineered RNA binding proteins, when combined with translation initiation factor functions in a fusion protein context, could disrupt the stoichiometry of translation machinery maintained by the cell.
- complexes comprising: a Cas polypeptide; and a capped-sgRNA comprising (i) an m7G cap or an analog thereof; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
- the RNA molecule is a messenger RNA (mRNA).
- the mRNA has an endogenous m7G cap.
- the target sequence is downstream of the endogenous m7G cap of the mRNA.
- the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is upstream of the start codon.
- the 5’ end of the target sequence is between 1 to 50 nucleotides upstream of the first nucleotide of the start codon.
- the 5’ end of the target sequence is between 1 to 15 nucleotides upstream of the first nucleotide of the start codon.
- the target sequence comprises the start codon.
- the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is downstream of the start codon. In some embodiments of any of the complexes described herein, the 5’ end of the target sequence is between 1 to 50 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the complexes described herein, 5’ end of the target sequence is between 1 to 15 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the complexes described herein, the 5’ end of the target sequence is between 1 to 5 nucleotides downstream of the last nucleotide of the start codon.
- the spacer is at least 80% complementary to the target sequence. In some embodiments of any of the complexes described herein, the spacer is at least 90% complementary to the target sequence. In some embodiments of any of the complexes described herein, the spacer comprises about 10 to about 40 nucleotides. In some embodiments of any of the complexes described herein, the spacer comprises about 15 to about 25 nucleotides. In some embodiments of any of the complexes described herein, the spacer comprises about 20 nucleotides. In some embodiments of any of the complexes described herein, the spacer is connected to the m7G cap or analog there of via a linker.
- the linker comprises about 5 to about 25 nucleotides. In some embodiments of any of the complexes described herein, the linker comprises about 8 to about 15 nucleotides. In some embodiments of any of the complexes described herein, the linker is not complementary to any sequence in the mRNA. In some embodiments of any of the complexes described herein, the linker is conjugated to the m7G cap or analog thereof via polyethylene glycol.
- the Cas polypeptide is a nuclease-deficient Cas (dCas) polypeptide, wherein the dCas comprises an inactivated target cleavage domain and a retained guide cleavage domain.
- the nuclease-deficient Cas polypeptide is a nuclease-deficient Cas 13 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d.
- the direct repeat is capable of binding to a nuclease-deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d.
- the nuclease-deficient Cas polypeptide is a nuclease-deficient Cas9 (dCas9) polypeptide.
- the direct repeat is capable of binding to a nuclease- deficient Cas9 (dCas9) polypeptide.
- nucleic acid comprising a sequence encoding the capped-sgRNA in any of the complexes described herein.
- nucleic acid further comprises a sequence encoding the Cas polypeptide in any of the complexes described herein.
- nucleic acids comprising a sequence encoding a capped-sgRNA, wherein the capped-sgRNA comprises: (i) an m7G cap or analog thereof; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to a Cas polypeptide.
- the RNA molecule is an mRNA.
- the mRNA has an endogenous m7G cap. .
- the target sequence is downstream of the endogenous m7G cap of the mRNA.
- the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is upstream of the start codon.
- the 5’ end of the target sequence is between 1 and 50 nucleotides upstream of the first nucleotide of the start codon.
- the 5’ end of the target sequence is between 1 to 15 nucleotides upstream of the first nucleotide of the start codon.
- the target sequence comprises the start codon. In some embodiments of any of the nucleic acids described herein, the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is downstream of the start codon. In some embodiments of any of the nucleic acids described herein, the 5’ end of the target sequence is between 1 to 50 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the nucleic acids described herein, the 5’ end of the target sequence is between 1 to 15 nucleotides downstream of the last nucleotide of the start codon.
- the 5’ end of the target sequence is between 1 to 5 nucleotides downstream of the last nucleotide of the start codon.
- the spacer is at least 80% complementary to the target sequence. In some embodiments of any of the nucleic acids described herein, the spacer is at least 90% complementary to the target sequence. In some embodiments of any of the nucleic acids described herein, the spacer comprises about 10 to about 40 nucleotides. In some embodiments of any of the nucleic acids described herein, the spacer comprises about 15 to about 25 nucleotides.
- the spacer comprises about 20 nucleotides. In some embodiments of any of the nucleic acids described herein, the spacer is connected to the m7G cap or analog thereof via a linker. In some embodiments of any of the nucleic acids described herein, the linker comprises about 5 to about 25 nucleotides. In some embodiments of any of the nucleic acids described herein, the linker comprises about 8 to about 20 nucleotides. In some embodiments of any of the nucleic acids described herein, the linker is not complementary to any sequence in the mRNA.
- the linker is conjugated to the m7G cap or analog thereof via polyethylene glycol.
- the nucleic acids further comprise a sequence encoding a RNase P processing site.
- the nucleics further comprise a poly-T sequence.
- the nucleic acids further comprise a poly-T sequence downstream of the sequence encoding a RNase P processing site.
- the nucleic acids further comprise a sequence encoding the Cas polypeptide.
- the Cas polypeptide is a nuclease-deficient Cas polypeptide. In some embodiments of any of the nucleic acids described herein, the nuclease-deficient Cas polypeptide is a nuclease-deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d.
- dCasl3 nuclease-deficient Casl3
- the direct repeat is capable of binding to a nuclease-deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d.
- the nuclease-deficient Cas polypeptide is a nuclease-deficient Cas9 (dCas9) polypeptide.
- the nucleic acids further comprise one or more RNA polymerase II promoters.
- the sequence encoding the capped-sgRNA and the sequence encoding the Cas polypeptide are expressed from the same promoter. In some embodiments of any of the nucleic acids described herein, the sequence encoding the capped- sgRNA and the sequence encoding the Cas polypeptide are expressed from different promoters. In some aspects, provided herein are vectors comprising the nucleic acids of any of the above embodiments. In some embodiments, the vector is an AAV vector. In some embodiments, provided herein are cells comprising the nucleic acid of any of the above embodiments.
- a nucleic acid comprising (a) a sequence encoding a Cas polypeptide; and (b) a sequence encoding a capped-sgRNA comprising (i) an m7G cap or analog thereof; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
- the Cas polypeptide is a nuclease-deficient Casl3 (dCasl3) polypeptide.
- the dCasl3 polypeptide is dCasl3b or dCasl3d.
- the dCasl3b comprises an inactivated target cleavage domain and a retained guide cleavage domain.
- the dCasl3d comprises an inactivated target cleavage domain and a retained guide cleavage domain.
- FIGS. 1A-1G show modulation of translation using dCas and capped-sgRNA.
- FIG. 1A shows exemplary constructs for generating dCas and Capped-sgRNA.
- FIG. IB shows an exemplary structure of unprocessed capped-sgRNA containing an RNase P processing site.
- FIG. 1C shows an exemplary chemical composition of a capped-sgRNA.
- FIG. ID shows capped-sgRNA processing by RNase P.
- FIG. IE shows a schematic of localized capped- sgRNA recmitment and binding of dCas to the capped-sgRNA.
- FIG. IF shows an exemplary two construct system for expressing dCas and capped-sgRNA.
- FIG. 1G shows the sgRNA targeting window in the target ATF4 ORF.
- FIG. 1H shows results of capped-sgRNA modulation on the translation of the target ATF4 ORF.
- FIG. II shows results of using the control uncapped-sgRNAs on the translation of the target ATF4 ORF.
- the term“comprising” is intended to mean that the compositions and methods include the recited elements, but do not exclude others.
- the transitional phrase“consisting essentially of (and grammatical variants) is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel charactenstic(s) of the recited embodiment.
- the term“consisting essentially of as used herein should not be interpreted as equivalent to“comprising.”
- Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions disclosed herein. Aspects defined by each of these transition terms are within the scope of the present disclosure.
- the term“functional” may be used to modify any molecule, biological, or cellular material to intend that it accomplishes a particular, specified effect.
- EIF4E Eukaryotic Initiation Factor 4E
- the 5’ m7G cap is an evolutionarily conserved modification of eukary otic mRNA, and serves as a unique molecular module that recruits cellular proteins and mediates cap-related biological functions such as pre-mRNA processing, nuclear export, and cap- dependent protein synthesis.
- compositions and methods for enhancing protein production by recruiting an m7G cap to an mRNA using a capped-sgRNA and a Cas polypeptide are provided herein.
- the bound pre-initiation complexes do not necessarily scan the 5’UTR unidirectionally 5’ to 3’.
- a complex comprising at least one Cas polypeptide or nucleic acid encoding the at least one Cas polypeptide, and at least one m7G capped single guide RNA (capped-sgRNA) or nucleic acid encoding the at least one capped- sgRNA.
- capped-sgRNA m7G capped single guide RNA
- the at least one capped-sgRNA is capable of targeting the at least one Cas polypeptide to a target sequence in an RNA molecule (e.g., an mRNA).
- the m7G cap of the sgRNA upon hybridization between the sgRNA and the target sequence, is brought closer to a desired start codon in the target mRNA as compared to the endogenous m7G cap of the target mRNA.
- Also provided are methods of regulating translation of an mRNA in a cell comprising contacting the cell with a nucleic acid comprising (a) a sequence encoding a at least one Cas polypeptide; and (b) a sequence encoding at least one capped-sgRNA comprising (i) an m7G cap; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
- a complex comprising a Cas polypeptide or nucleic acid encoding the Cas polypeptide, and an m7G capped single guide RNA (capped- sgRNA) or nucleic acid encoding the capped-sgRNA, where the capped-sgRNA is capable of targeting the Cas polypeptide to a target sequence in an RNA molecule (e.g., an mRNA).
- capped- sgRNA m7G capped single guide RNA
- the m7G cap of the sgRNA is brought closer to a desired start codon in the target mRNA as compared to the endogenous m7G cap of the target mRNA.
- Also provided are methods of regulating translation of an mRNA in a cell comprising contacting the cell with a nucleic acid comprising (a) a sequence encoding a Cas polypeptide; and (b) a sequence encoding a capped-sgRNA comprising (i) an m7G cap; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
- Each strand of DNA or RNA has a 5’ end and a 3’ end, corresponding to the carbon position on the deoxyribose (or ribose) ring.
- “Upstream” as described herein can mean toward the 5’ end of an RNA molecule and dow nstream as described herein can mean towards the 3’ end of an RNA molecule.
- A“start codon” as described herein can refer to the first codon of a messenger RNA transcript translated by a ribosome. The most common start codon is AUG. Alternative start codons from both prokaryotes and eukaryotes include, but not limited to, GUG, UUG, AUU, and CUG.
- cell may refer to either a prokaryotic or eukaryotic cell, optionally obtained from a subject or a commercially available source.
- nucleic acid sequences refers to a polynucleotide which is said to“encode” a polypeptide, an mRNA, or an effector RNA if, in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed and/or translated to produce the effector RNA, the mRNA, or an niRNA that can for the polypeptide and/or a fragment thereof.
- the antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
- expression refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample; further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample.
- target sequence can refer to a nucleic acid sequence present in an RNA molecule to which a spacer of a guide RNA (e.g, a capped-sgRNA as disclosed herein) can hybridize, provided sufficient conditions for hy bridization exist.
- Hybndization between the spacer and the target sequence can, for example, be based on Watson-Crick base pairing rules, which enables programmability in the spacer sequence.
- the spacer sequence can be designed, for instance, to hybridize with any target sequence.
- The“spacer” or“spacer sequence” is comprised within a single guide RNA can include a nucleotide sequence that is complementary to a specific sequence within a target RNA.
- Binding as used herein can refer to a non-covalent interaction between
- macromolecules e.g., between a protein and a nucleic acid. While m a state of non-covalent interaction, the macromolecules are said to be“associated” or“interacting” or“binding”
- Binding interactions are generally characterized by a dissociation constant (Kd) of less than 10 6 M, less than 10 7 M, less than 10 8 M, less than 10 9 M, less than 10 10 M, less than 10 11 M, less than 10 12 M, less than 10 13 M, less than 10 14 M, or less than 10 15 M.
- Kd is dependent on environmental conditions, e.g., pH and temperature, as is known by those in the art.“Affinity” can refer to the strength of binding, and increased binding affinity is correlated with a lower Kd.
- hybridizing can refer to the pairing of substantially complementary or complementary nucleic acid sequences within two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence joins with a partially, substantially or fully complementary sequence through base pairing to form a hybridization complex.
- two nucleic acid sequences or segments of sequences are“substantially complementary” if at least 80% of their individual bases are complementary to one another.
- Two nucleic acid sequences or segments of sequences are“partially complementary” if at least 50% of their individual bases are complementary to one another.
- “complementary” can mean that two nucleic acid sequences have at least 50% sequence identity.
- the two nucleic acid sequences have at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of sequence identity.
- “Complementary” also means that two nucleic acid sequences can hybridize under low, middle, and/or high stringency condition(s).
- substantially complementary means that two nucleic acid sequences have at least 90% sequence identity. Preferably, the two nucleic acid sequences have at least 95%, 96%, 97%, 98%, 99%, or 100% of sequence identity.“Substantially complementary can also mean that two nucleic acid sequences can hybridize under high stringency condition(s).
- Low stringency hybridization refers to conditions equivalent to hybridization in 10% formamide, 5x Denhardt’s solution, 6x SSPE, 0.2% SDS at 22°C, followed by washing in lx SSPE, 0.2% SDS, at 37°C.
- Denhardt ' s solution contains 1% Ficoll, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA).
- BSA bovine serum albumin
- 20x SSPE sodium chloride, sodium phosphate, ethylene diamide tetraacetic acid (EDTA) contains 3M sodium chloride, 0.2M sodium phosphate, and 0.025 M (EDTA).
- Other suitable moderate stringency and high stringency hybridization buffers and conditions are well known to those of skill in the art.
- “operably linked” refers to the situation in which part of a linear DNA sequence can influence the other parts of the same DNA molecule. For example, when a promoter controls the transcription of the coding sequence, it is operatively linked to the coding sequence.
- a“polypeptide” refers to, without limitation, proteins, fragments of proteins, and peptides, whether isolated from natural sources, produced by recombinant techniques, or chemically synthesized.
- a polypeptide may have one or more modifications, such as a post-translational modification (such as glycosylation, etc.) or any other modification (such as PEGylation, etc.).
- the polypeptide may contain one or more non- naturally-occurring amino acids (such as an amino acid with a side chain modification).
- Polypeptides described herein typically comprise at least about 10 amino acids.
- “contacting” a cell with a nucleic acid molecule can include allowing the nucleic acid molecule to be in sufficient proximity with the cell such that the nucleic acid molecule can be introduced into the cell.
- A“promoter” can be a region of DNA that leads to initiation of transcription of a gene.
- nuclease-deficient may refer to a polypeptide with reduced nuclease activity, reduced endo- or exo- DNAse activity or RNAse activity, reduced nickase activity, or reduced ability to cleave DNA and/or RNA.
- Reduced nuclease activity means a decline in nuclease, nickase, DNAse, or RNAse activity of at least about 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 35%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more or any value between any of the listed values.
- “reduced nuclease activity” may refer to a decline of at least about 1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70- fold, 80-fold, 90-fold, 100-fold, 500-fold, 1000-fold, 2000-fold or more or any value between any of the listed values.
- Nucleic acids may be naturally occurring nucleic acids such as DNA and RNA, or artificial nucleic acids including peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA), and threose nucleic acid (TNA). Nucleic acids disclosed herein can be single-stranded or double-stranded nucleic acids.
- PNA peptide nucleic acid
- LNA locked nucleic acid
- GNA glycol nucleic acid
- TAA threose nucleic acid
- the m7G cap is a guanine nucleotide methylated on the 7 position and can be linked to an RNA molecule (e.g., a sgRNA or an mRNA) via a 5’ to 5’ triphosphate linkage.
- capped RNA molecules e.g., capped-sgRNAs
- the m7G cap structure is added enzymatically to mRNA produced by RNA polymerase II.
- the adjacent nucleotides can be 2'-0-methylated to different extents.
- the m7G cap can be a m7GpppN, or Cap 0, an m7GpppNm, or Cap 1, and an m7GpppNmpNm, or Cap 2.
- Exemplary structures of Cap 0 and Cap 1, are shown below:
- the 5’ m7G cap is an evolutionarily conserved modification of eukaryotic mRNA, and serves as a unique molecular module that recruits cellular proteins and mediates cap- related biological functions such as pre-mRNA processing, nuclear export, and cap-dependent protein synthesis.
- the capped-sgRNA disclosed herein exploits these biological functions to recruit pre-initiation complexes for enhancement of protein translation.
- the capped-sgRNA disclosed herein includes a nucleic acid sequence which is transcribed by, e.g. an RNA polymerase II, and the sgRNA thereby becomes 5’ capped upon transcription with an m7G cap.
- the transcription of capped-sgRNA nucleic acid sequence is catalyzed by bacteriophage RNA polymerases, such as, without limitation, RNA polymerase T7, T3, and SP6.
- bacteriophage RNA polymerases such as, without limitation, RNA polymerase T7, T3, and SP6.
- m7G(5’)pppG cap analog is incorporated into the sgRNA and simulates the m7G cap structure.
- standard cap analogs are incorporated into the sgRNA in the forward (e.g., [m7G(5’)pppG(pN)]) or the reverse onentation (e.g., [G(5’)pppm7G(pN)]) resulting in two forms of isomeric RNAs.
- chemical modifications at either the 2’ or 3’ OH group results in the cap being incorporated solely in the forward orientation.
- the m7G cap is an anti-reverse cap analog (ARC A), wherein one of the 3’ OH groups (closer m7G) is eliminated from the cap analog and is substituted with -OCH 3 .
- This modification forces RNA polymerases to initiate transcription with the remaining -OH group in G and thus synthesize RNA transcripts capped exclusively in the correct orientation.
- An exemplary structure of ARCA (m7(3’-0-methyl)- G(5 : )ppp(5’)G) is shown below:
- Additional cap analogs contemplated herein also include unmethylated cap analogs (e.g., GpppG), trimethylated cap analogs (e.g., m 3 2.2.7 GP 3 G). and m 2 7,3' O GP 3 (2'OMe)ApG.
- unmethylated cap analogs e.g., GpppG
- trimethylated cap analogs e.g., m 3 2.2.7 GP 3 G
- m 2 7,3' O GP 3 (2'OMe)ApG e.g., 2,3' O GP 3 (2'OMe)ApG.
- the m7G cap disclosed herein includes chemical modifications relative to the naturally occurring m7G cap.
- chemical modifications that can reduce the sensitivity of the m7G cap to cellular decapping enzymes are useful for the capped-RNAs disclosed herein.
- Suitable chemical modifications include, without limitation, those with 1,2-dithiodiphosphate. See those described in e.g., Strenkowska et al., Nucleic Acids Res. 44(20):9578-9590 (2016), phosphate-modified cap analogues described in e.g., Walczak et al, Chem Sci.
- capped-sgRNAs nucleic acids comprising and/or encoding the capped-sgRNAs, and methods of using the same for regulating protein translation.
- the capped-sgRNA can include an m7G cap or an analog thereof, a spacer capable of specifically hybridizing with a target sequence in an RNA molecule, and a direct repeat capable of binding to a Cas polypeptide.
- the capped-sgRNA includes from 5’ to 3’, an m7G cap or an analog thereof, a spacer sequence, and a direct repeat sequence.
- the 5’ cap is linked to the spacer sequence via a linker.
- the capped-sgRNA is derived from an unprocessed capped-sgRNA that further includes a Ribonuclease P (RNase P) processing site, and a polyadenylated (poly -A) tail at the 3’ end.
- RNase P Ribonuclease P
- poly -A polyadenylated
- the spacer sequence and the scaffolding sequence or direct repeat sequence are not contiguous.
- a scaffold sequence comprises a direct repeat sequence.
- the capped-sgRNA sequence is synthetic or comprises non- naturally occurring nucleotides.
- a capped-guideRNA of the disclosure or a sequence encoding the guide RNA comprises or consists of modified or synthetic RNA nucleotides.
- modified RNA nucleotides include, but are not limited to, pseudouridine (Y), dihydrouridine (D), inosine (I), and 7-methylguanosine (m7G), hypoxanthine, xanthine, xanthosine, 7- methylguanine, 5, 6-Dihydrouracil, 5-methylcytosine, 5-methylcytidine, 5- hydropxymethylcytosine, isoguanine, and isocytosine.
- Capped-sgRNAs of the disclosure may bind modified RNA within a target sequence.
- capped-guide RNAs of the disclosure may bind modified RNA.
- RNA examples include, but are not limited to, 2 -0-Methylation (2’- OMe) (2 , -0-methylation occurs on the oxygen of the free T - OH of the ribose moiety), N6- methyladenosine (m6A), and 5-methylcytosine (m5C).
- a capped-guide RNA of the disclosure comprises at least one sequence encoding a non-coding C/D box small nucleolar RNA (snoRNA) sequence.
- the snoRNA sequence comprises at least one sequence that is complementary to the target RNA, wherein the target sequence of the RNA molecule comprises at least one 2’-OMe. In some embodiments, the snoRNA sequence comprises at least one sequence that is complementary to the target RNA, wherein the at least one sequence that is complementary to the target RNA comprises a box C motif (RETGAETGA) and a box D motif (CUGA).
- RETGAETGA box C motif
- CUGA box D motif
- a sequence encoding a capped-guide RNA of the disclosure comprises or consists essentially of a spacer sequence and a scaffold or direct repeat sequence, wherein the spacer and the scaffold or direct repeat are operably linked.
- the spacer and scaffold and/or direct repeat are separated by a linker sequence.
- the linker sequence may include or consist of 1, 2, 3, 4, 5, 6, 7, 8, 9,
- the linker sequence may include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15,
- nucleotides or any number of nucleotides in between.
- therapeutic or pharmaceutical compositions including the capped-sgRNAs or methods of gene therapy using the capped-sgRNAs of the disclosure do not include a PAMmer oligonucleotide.
- non-therapeutic or non-pharmaceutical compositions may include a PAMmer oligonucleotide.
- a guide RNA or a portion thereof includes a sequence complementary to a protospacer flanking sequence (PFS).
- the RNA binding protein may include a sequence isolated or derived from a Cas protein, such as, without limitation, a Cas9, Casl3b, or Casl3d protein. In some embodiments, including those wherein a guide RNA or a portion thereof includes a sequence complementary to a PFS, the RNA binding protein may include a sequence encoding a Cas protein, such as, without limitation, a Cas9, Cas 13b, or Casl3d protein, or an RNA-binding portion thereof. In some embodiments, the guide RNA or a portion thereof does not include a sequence complementary to a PFS.
- the capped-sgRNA disclosed herein comprises a“spacer” or“spacer sequence” that is complementary to a specific sequence within a target RNA.
- the spacer sequence can be designed to hybridize with any target sequence of interest.
- the spacer sequence comprised within the capped-sgRNA is about 10 to about 30 nucleotides (e.g., about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides). In another embodiment, the spacer sequence is about 15 to about 25 nucleotides (e.g., about 18 to about 22 nucleotides, or about 20 nucleotides). In another embodiment, the spacer sequence is at least 50% complementary, at least 60% complementary, or at least 70% complementary to a target sequence in an RNA molecule (e.g., an mRNA).
- an RNA molecule e.g., an mRNA
- the spacer sequence is at least 80% (e.g., at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to a target sequence in an RNA molecule (e.g., an mRNA).
- the spacer sequence is 100% complementar to the target sequence.
- Exemplary spacer sequences for the capped-sgRNAs disclosed herein are:
- CTCGCTGCTCAGGAAGCTCATTTCG (SEQ ID NO: 282)
- spacer sequences may comprise a CRISPR RNA (crRNA).
- spacer sequences of the disclosure comprise or consist of a sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence.
- the spacer sequence may guide one or more of a scaffold or direct repeat sequence and a Cas polypeptide or fusion protein to the RNA molecule.
- a spacer sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively (partially or substantially) to the target sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96,
- a spacer sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence has 100% identity the target sequence.
- a capped-guide RNA or a portion thereof comprises or consists of between 10 and 100 nucleotides, inclusive of the endpoints.
- a spacer sequence of the disclosure comprises or consists of between 10 and 30 nucleotides, inclusive of the endpoints.
- a spacer sequence of the disclosure comprises or consists of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
- the spacer sequence of the disclosure comprises or consists of 20 nucleotides.
- the spacer sequence of the disclosure comprises or consists of 21 nucleotides.
- a scaffold or direct repeat sequence of the disclosure comprises or consists of between 10 and 100 nucleotides, inclusive of the endpoints. In some embodiments, a scaffold or direct repeat sequence of the disclosure comprises or consists of 30, 35, 40, 45, 50, 55, 60, 65, 70, 76, 80, 87, 90, 95, 100, or any number of nucleotides in between. In some embodiments, the scaffold or direct repeat sequence of the disclosure comprises or consists of between 85 and 95 nucleotides, inclusive of the endpoints. In some embodiments, the scaffold or direct repeat sequence of the disclosure comprises or consists of 85 nucleotides. In some embodiments, the scaffold or direct repeat sequence of the disclosure comprises or consists of 90 nucleotides. In some embodiments, the scaffold or direct repeat sequence of the disclosure comprises or consists of 93 nucleotides.
- a capped-guide RNA or a portion thereof does not comprise a nuclear localization sequence (NLS).
- NLS nuclear localization sequence
- a capped-guide RNA, or a portion thereof does not comprise a sequence complementary to a protospacer adjacent motif (PAM).
- PAM protospacer adjacent motif
- therapeutic or pharmaceutical compositions of the disclosure do not include a PAMmer oligonucleotide.
- non-therapeutic or non-pharmaceutical compositions may include a PAMmer oligonucleotide.
- a guide RNA or a portion thereof includes a sequence complementary to a protospacer flanking sequence (PFS).
- PFS protospacer flanking sequence
- the RNA binding protein may include a sequence isolated or derived from a Cas protein, such as, without limitation, a Cas9, Casl3b, or Casl3d protein.
- the RNA binding protein may include a sequence encoding a Cas protein, such as, without limitation, a Cas9, Cas 13b, or Casl3d protein, or an RNA-binding portion thereof In some embodiments, the guide RNA or a portion thereof does not comprise a sequence complementary to a PFS.
- The“target sequence” can be a stretch of nucleic acid sequences or a sequence motif present in an RNA molecule (e.g., mRNA) of interest to which a spacer sequence of the capped-sgRNA hybridizes, provided sufficient conditions for hybridization exist.
- RNA molecule e.g., mRNA
- Hybridization between the spacer and the target sequence is, for example, based on Watson- Crick base pairing rules, which enables programmability of the spacer sequence.
- the mRNA including the target sequence additionally includes one or more start codons and/or an endogenous m7G cap.
- the target sequence is located downstream of an endogenous m7G cap, with its 5’ end located either upstream or downstream of a desired start codon. Any start codon in the target mRNA can be selected as the desired start codon.
- the m7G cap of the capped-sgRNA can be recruited to the vicinity of the desired start codon, and closer in proximity to the desired start codon than the endogenous m7G cap of the mRNA.
- the m7G cap of the bound capped-sgRNA recruits translation initiation factors (e g., EIF4E) and initiates protein translation from the desired start codon.
- translation initiation factors e g., EIF4E
- recruitment of the translation initiation factors occurs subsequent to the binding of the m7G cap of the capped- sgRNA.
- the target sequence includes the desired start codon of the target mRNA.
- the 5’ end of the target sequence can be upstream of the desired start codon and the 3’ end of the target sequence can be downstream of the desired start codon.
- the 5’ end of the target sequence is located between 1 and 50 nucleotides (e.g., about 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 nucleotides) upstream of the first nucleotide of the desired start codon (e.g., an“A”).
- nucleotides e.g., about 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10,
- the 5’ end of the target sequence is located between 1 and 50 nucleotides (e.g., about 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32,
- the target sequence does not overlap with the desired start codon.
- the location ranges of the target sequence between about 1 and 50 nucleotides upstream or downstream of the desired start codon accounts for the differing structural properties of the various Cas proteins capable of being used with the capped-sgRNAs disclosed herein.
- the target sequence is not required to be located between 1 and 50 nucleotides upstream or downstream from a desired start codon, rather the target sequence is located anywhere on the transcript. This is particularly relevant if the 5’UTR is large.
- the capped-sgRNA disclosed herein includes both a“spacer sequence” and a“direct repeat” (or“DR” or“direct repeat sequence” or“DR sequence”).
- DR is comprised within a scaffold sequence which is capable of binding to a corresponding (or cognate) Cas polypeptide.
- a DR is capable of binding to a corresponding (or cognate) Cas polypeptide.
- a direct repeat sequence disclosed herein is a repetitive sequence found within a CRISPR locus (naturally -occurring in a bacterial genome or plasmid). It is well known that one would be able to infer the DR sequence of a corresponding Cas protein if the sequence of the associated CRISPR locus is know n.
- a DR is a nucleic acid sequence that consists of two or more repeats of a specific sequence, i.e., nucleotide sequences present in multiple copies in the genome.
- a DR sequence may or may not have intervening nucleotides.
- a DR sequence disclosed herein includes about 10 to about 100 nucleotides (e.g.
- the DR sequence is orientated either 5’ or 3’ to a spacer within the sgRNA.
- the direct repeat sequence is located 5’ to the spacer.
- the DR sequence is located 3’ to the spacer.
- Exemplary direct repeat sequences for Casl3a are SEQ ID Nos 284-298.
- An exemplary Casl3b direct repeat sequence is:
- An exemplary scaffold sequence for Cas9 is:
- Scaffold/DR sequences of the disclosure bind the CRISPR Cas RNA-binding protein of the disclosure.
- Scaffold/DR sequences of the disclosure may include a trans acting RNA (tracrRNA).
- the scaffold/DR sequence guides a fusion protein to the RNA molecule.
- a scaffold/ DR sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively (partially or substantially) to the target sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96, 97%, 98%, 99%, or any percentage identity in between to the target sequence.
- a scaffold/ DR sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence has 100% identity the target sequence.
- scaffold/DR sequences of the disclosure comprise a secondary structure or a tertiary structure.
- Exemplary secondary structures include, but are not limited to, a helix, a stem loop, a bulge, a tetraloop and a pseudo not.
- Exemplary tertiary structures include, but are not limited to, an A-form of a helix, a B-form of a helix, and a Z-form of a helix.
- Exemplary tertiary structures include, but are not limited to, a twisted or helicized stem loop. Exemplary tertiary structures include, but are not limited to, a twisted or helicized pseudoknot.
- scaffold/DR sequences of the disclosure comprise at least one secondary structure or at least one tertiary structure. In some embodiments, scaffold/ DR sequences of the disclosure include one or more secondary structure(s) or one or more tertiary structure(s).
- the capped-sgRNA disclosed herein can include a“linker” or“linker sequence” between the m7G cap or analog thereof and the spacer and/or DR sequences.
- the linker sequence includes about 5 to about 25 nucleotides (e.g., about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides).
- the linker sequence is non-complementary to any sequence within the RNA molecule comprising the target sequence.
- linker sequences for such a linker include, without limitation: GTCAGATCG (SEQ ID NO: 306), GTCAGATCGCCT(SEQ ID NO: 307), GTCAGATCGCCTGGA(SEQ ID NO: 308), and GTCAGATCGCCTGGAATT(SEQ ID NO: 309). Any suitable linker sequences known in the art are also contemplated herein. In some embodiments, the linker sequence is modified to adjust the editing window.
- an unprocessed capped-sgRNA includes an RNase P processing site, which is downstream of the spacer and/or direct repeat and upstream of a poly-A tail. In this manner, an RNase P binds to the processing site and removes the downstream sequence (e.g., the poly-A tail) to generate a capped-sgRNA disclosed herein.
- Exemplary RNase P processing sites can be found at Esakova and Krasilnikov, RNA 16: 1725-1747, 2010 (e.g., See Figure 1 of Esakova and Krasilnikov), incorporated herein by reference in its entirety.
- the RNase P processing site is known to include elements recognizable by RNase P, such as those described in Kirsebom et al. Biochimie 89: 1183— 1194, 2007 and Lai et al. FEBS Lett 584: 287-296, 2010, both of which are incorporated herein by reference in their entirety.
- the RNase P processing site can include all or a portion of a bacterial (e.g., E.
- an RNase P processing site includes a tRNA-like small RNA (e.g., GenBank Accession No. FJ209302).
- FIG. IB An exemplary structure of an unprocessed capped-sgRNA is shown in FIG. IB.
- the unprocessed capped-sgRNA includes from 5’ to 3’: an m7G cap, a linker, a spacer, a direct repeat, an RNase P processing site, and a poly-A tail.
- the RNase P processing site and poly-A tail is removed upon RNase P processing, thereby generating the capped-sgRNA with the structure of FIG. 1C, wherein a is a guanosine or adenine, b’ is a spacer sequence and c’ is a direct repeat sequence.
- the capped-sgRNAs disclosed herein are capable of binding with their cognate or corresponding RNA-binding CRISPR/Cas polypeptides (e.g., via a direct repeat sequence in the capped-sgRNA).
- the capped-sgRNA includes a spacer sequence that confers target specificity to the Cas/sgRNA complex.
- CRISPR/Cas polypeptides are well known in the art and any particular Cas polypeptide can be adapted for use in the capped- sgRNA systems disclosed herein.
- the Cas polypeptides for use as disclosed herein have altered activity compared to its corresponding wild type Cas polypeptide.
- the Cas polypeptides are nuclease-deficient Cas (dCas) polypeptides.
- Nuclease-deficient Cas polypeptides have altered (e.g., diminished or abolished) nuclease activity without substantially diminished binding affinity to the sgRNA.
- These Cas polypeptides are useful, for example, in mediating the direct association between the capped-sgRNA and the target mRNA, and in protecting the 3’ end of the capped-sgRNA from degradation.
- the dCas for use with the capped-sgRNA disclosed herein is devoid of cleavage activity that is applicable to the target RNA.
- the dCas polypeptide for use with the capped-sgRNA disclosed herein retains cleavage activity that is applicable to the capped-sgRNA.
- the dCasl3 comprises an inactivated target cleavage domain and a retained or partially retained (i.e., activated or partially activated) guide cleavage domain.
- the Cas polypeptide is Casl3b. In another embodiment, the Cas polypeptide is dead or nuclease deficient Cas 13b (dCasl3b). In another embodiment, the dCasl3b comprises an inactivated target cleavage domain and a retained (i.e., activated) guide cleavage domain as exemplified in Figures IB and ID.
- the Cas polypeptide disclosed herein is a Type II CRISPR Cas protein. In some embodiments, the Type II CRISPR Cas protein includes a Cas9 protein. Exemplary Cas9 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, bacteria or archaea.
- Exemplary Cas9 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Streptococcus pyogenes , Haloferax mediteranii , Mycobacterium tuberculosis , Francisella tularensis subsp. novicida , Pasteurella multocida , Neisseria meningitidis , Campylobacter jejune , Streptococcus thermophilus , Campylobacter lari CF89-12, Mycoplasma gallisepticum str.
- F Nitratifractor salsuginis str.
- DSM 16511 Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria cinerea, a
- Gluconacetobacter diazotrophicus an Azospirillum B510, a Sphaerochaeta globus str.
- Mycoplasma mobile Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus johnsonii, Staphylococcus pseudintermedius, Filifactor alocis, Treponema denticola, Legionella pneumophila str. Paris, Suttere!la wadsworthensis, Corynebacter diphtherias, Streptococcus aureus, and Francisella novicida.
- the capped-sgRNA compositions or methods disclosed herein provide a Cas9 polypeptide.
- the Cas9 polypeptide lacks part or all of the nuclease domains (e.g., the RuvC and/or HNH domains) of a wild type Cas9 polypeptide, and therefore are nuclease-deficient. These truncated Cas9 polypeptides have a smaller size as compared to a wild type Cas9.
- the RuvC and HNH nuclease domains can also be inactivated, for example, as a result of point mutations within these domains.
- SpCas9 Streptococcus pyogenes Cas9
- An exemplary sequence of a nuclease-deficient SpCas9 is SEQ ID NO:
- the RuvC domain is distributed among 3 non-contiguous portions of the nuclease- deficient Cas9 primary structure (residues 1-60, 719-775, and 910-1099).
- the HNH domain is composed of residues 776-909.
- Some embodiments provide a Cas polypeptide that is a Cas9 polypeptide that lacks all or a part of (1) an HNH domain, (2) at least one RuvC nuclease domain, (3) a Cas9 polypeptide DNase active site, (4) a bba-metal fold comprising a Cas9 polypeptide active site, or (5) a Cas9 polypeptide that lacks all or part of one or more of the HNH domain, at least one RuvC nuclease domain, a Cas9 polypeptide DNase active site, and/or a bba-metal fold comprising a Cas9 polypeptide active site as compared to a corresponding wild type Cas9 polypeptide.
- the Cas9 polypeptides described herein can be archaeal or bacterial Cas9
- Exemplary Cas9 polypeptide include those derived from Haloferax mediteranii, Mycobacterium tuberculosis, Francisella tularensis subsp. novicida, Pasteurella multocida, Neisseria meningitidis, Campylobacter jejune, Streptococcus thermophilus LMD- 9 CRISPR 3, Campylobacter lari CF89-12, Mycoplasma gallisepticum sir. F, Nitratifr actor salsuginis str.
- DSM 1651 Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria cinerea, Gluconacetobacter diazotrophicus, Azospirillum B510, Sphaerochaeta globus str. Buddy, Flavobacterium columnare, Fluviicola taffensis, Bacteroides coprophilus,
- Mycoplasma mobile Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus johnsonii, Staphylococcus pseudintermedius, Filif actor alocis, Treponema denticola, Legionella pneumophila str. Paris, Sutterella wadsworthensis, Corynebacter diphtheriae, Streptococcus aureus , and Francisella novicida.
- any Cas polypeptides with altered nuclease activity as compared to a naturally occurring Cas polypeptide is contemplated herein. Additional types of nuclease-deficient Cas polypeptides are described in e.g., Brezgin et al. Int J Mol Sci 20(23):6041, 2019 and Xu and Lei, J Mol Biol 431 :34-47, 2019, incorporated by reference in its entirety.
- Exemplary Cas polypeptide sequences disclosed in the methods for translational enhancement WO2019/204828 are incorporated herein by reference in their entirety and can be used in conjunction with the corresponding capped-sgRNAs disclosed herein.
- the CRISPR Cas protein comprises a Type V CRISPR Cas protein.
- the Type V CRISPR Cas protein comprises a Cpfl protein.
- Exemplary Cpfl proteins of the disclosure may be isolated or derived from any species, including but not limited to, bacteria or archaea.
- Exemplary Cpfl proteins of the disclosure may be isolated or derived from any species, including but not limited to, Francisella tularensis subsp. novicida, Acidaminococcus sp. BV3L6 and
- Exemplary Cpfl proteins of the disclosure may be nuclease inactivated.
- the CRISPR Cas protein comprises a Type VI CRISPR Cas protein or portion thereof.
- the Type VI CRISPR Cas protein comprises a Casl3 protein or portion thereof.
- Exemplary Casl3 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, bacteria or archaea.
- Exemplary Cas 13 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Leptotrichia wadei, Listeria seeligeri serovar l/2b (strain ATCC 35967 / DSM 20751 / CLP 100100 / SLCC 3954), Lachnospiraceae bacterium, Clostridium aminophilum DSM 10710, Carnobacterium gallinarum DSM 4847, Paludibacter propionicigenes WB4, Listeria weihenstephanensis FSL R9-0317, Listeria
- Exemplary Cas 13 proteins of the disclosure may be DNA nuclease inactivated.
- Exemplary Cas 13 proteins of the disclosure include, but are not limited to, Casl3a, Casl3b, Casl3c, Casl3d, and orthologs thereof.
- Exemplary Cas 13b proteins of the disclosure include, but are not limited to, subtypes 1 and 2 referred to herein as Csx27 and Csx28, respectively.
- the sequence encoding the RNA binding protein comprises a sequence isolated or denved from a Casl3d protein or also called CasRx/Casl3d proteins.
- CasRX/Casl3d is an effector of the type VI-D CRISPR- Cas systems.
- the CasRX/Casl3d protein is an RNA-guided RNA endonuclease enzyme that can cut or bind RNA.
- the CasRX/Casl3d protein can include one or more higher eukaryotes and prokaryotes nucleotide-binding (HEPN) domains.
- HEPN prokaryotes nucleotide-binding
- the CasRX/Casl3d protein can include either a wild-type or mutated HEPN domain. In some embodiments, the CasRX/Casl3d protein includes a mutated HEPN domain that cannot cut RNA but can process guide RNA. In some embodiments, the CasRX/Casl3d protein does not require a protospacer flanking sequence. Also see WO Publication No. W02019/040664 & US2019/0062724, which is incorporated herein by reference in its entirety, for further examples and sequences of CasRX/Casl3d protein.
- the Cas polypeptide has a sequence that is at least 80% identical (e.g. at least 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, or 99% identical) to any of the Cas polypeptides (e.g., any of the wild type or nuclease-deficient Cas polypeptides) of the present disclosure.
- Exemplary Cas9 sequences include, but are not limited to:
- Nuclease deficient S. pyogenes Cas9 proteins may comprise a substitution of an Alanine (A) for an Aspartic Acid (D) at position 10 and an alanine (A) for a Histidine (H) at position 840.
- Exemplary nuclease deficient S. pyogenes Cas9 proteins of the disclosure may comprise or consist of the amino acid sequence (D10A and H840A bolded and underlined):
- Novicida Cpfl (FnCpfl) proteins of the disclosure may comprise or consist of the amino acid sequence:
- Exemplary wild type Lachnospiraceae bacterium sp. ND2006 Cpfl (LbCpfl) proteins of the disclosure may comprise or consist of the ammo acid sequence:
- Exemplary wild type Acidaminococcus sp. BV3L6 Cpfl (AsCpfl) proteins of the disclosure may comprise or consist of the amino acid sequence:
- the sequence encoding the RNA binding protein comprises a sequence isolated or derived from a CRISPR Cas protein or RNA-binding portion thereof.
- the CRISPR Cas protein comprises a Type VI CRISPR Cas protein.
- the Type VI CRISPR Cas protein comprises a Cas 13 protein.
- Exemplary Cas 13 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, bacteria or archaea.
- Exemplary Cas 13 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Leptotrichia wadei, Listeria seeligeri serovar l/2b (strain ATCC 35967 / DSM 20751 / CIP 100100 / SLCC 3954), Lachnospiraceae bacterium, Clostridium aminophilum DSM 10710, Carnobacterium gallinarum DSM 4847, Paludibacter propionicigenes WB4, Listeria weihenstephanensis FSL R9-0317, Listeria
- Exemplary Cas 13 proteins of the disclosure may be DNA nuclease inactivated.
- Exemplary Cas 13 proteins of the disclosure include, but are not limited to, Casl3a, Casl3b, Casl3c, Casl3d, and orthologs thereof.
- Exemplary Cas 13b proteins of the disclosure include, but are not limited to, subtypes 1 and 2 referred to herein as Csx27 and Csx28, respectively.
- Exemplary Casl3a proteins include, but are not limited to:
- Exemplary wild type Casl3a proteins of the disclosure may comprise or consist of the amino acid sequence:
- Exemplary Casl3b proteins include, but are not limited to:
- Exemplary wild type Bergeyella zoohelcum ATCC 43767 Casl3b (BzCasl3b) proteins of the disclosure may comprise or consist of the ammo acid sequence:
- nuclease deficient Casl3b (dCasl3b) nucleic acid sequence with C- terminal nuclear export sequence is:
- nuclease deficient Casl3b (dCasl3b) nucleic acid sequence with stop codon (making it an independent reading frame) is as follows:
- Exemplary wild type Casl3d proteins of the disclosure may comprise or consist of the amino acid sequences:
- compositions comprising a nucleic acid sequence encoding the capped-sgRNAs described herein, and vectors (e.g., expression vector(s)) comprising the nucleic acid sequences.
- vectors e.g., expression vector(s)
- nucleic acid sequences encoding the capped-sgRNAs are operably linked to one or more promoters.
- RNA polymerase II promoters include, without limitation, RNA polymerase II promoters such as, without limitation, CMV, PGK, and EFla promoters.
- the RNA polymerase II promoter is an RNA Pol II transcribed non-coding RNA.
- the sgRNA is transcribed by the RNAase polymerase II, acquires an m7G cap and becomes polyadenylated.
- Additional promoters suitable for driving expression of the capped-sgRNA are also contemplated, such as, without limitation, bacteriophage promoters (e.g., RNA polymerase T3, T7, and SP6), ubiquitous promoters, tissue-specific promoters, inducible promoters, and constitutive promoters.
- liver-specific promoters as described in
- IGF insulin-like growth factors
- vectors comprising the nucleic acids that encode the capped- sgRNA further include a sequence that encodes a Cas polypeptide (e.g., any of the Cas polypeptides described herein, such as, without limitation, a truncated nuclease-deficient Cas protein).
- a Cas polypeptide e.g., any of the Cas polypeptides described herein, such as, without limitation, a truncated nuclease-deficient Cas protein.
- the capped-sgRNA and the Cas transcript can be transcribed from the same promoter, or from different promoters.
- RNA polymerase II promoters e.g. CMV, PGK, and EF la promoters
- the Cas transcript is expressed from one promoter, such as a PGK promoter
- the capped-sgRNA is expressed from a different promoter, such as an EFla promoter.
- nucleic acids encoding the Cas polypeptides and vectors comprising the nucleic acids that encode the Cas polypeptides can be operably linked to one or more promoters. Suitable promoters include RNA polymerase II promoters (e.g., CMV, PGK, and EFla promoters), bacteriophage promoters (e.g., RNA polymerase T3, T7, and SP6), ubiquitous promoters, tissue-specific promoters, inducible promoters, and constitutive promoters.
- the Cas polypeptide can be associated with or include or be in operable linkage with a tag or detectable agent, such as a fluorescent agent, a fluorescent protein, an enzyme.
- a sequence encoding a capped-guide RNA of the disclosure includes a sequence encoding a promoter to drive expression of the guide RNA.
- a vector that includes a sequence encoding a capped-guide RNA of the disclosure includes a sequence encoding a promoter to drive expression of the guide RNA.
- a promoter driving expression of the guide RNA includes a sequence encoding a constitutive promoter, or an inducible promoter.
- a promoter to drive expression of the guide RNA includes a sequence encoding a hybrid or a recombinant promoter.
- a promoter to drive expression of the guide RNA is a promoter capable of expressing the guide RNA in a mammalian cell or a human cell. In some embodiments, a promoter to drive expression of the guide RNA is a promoter capable of expressing the guide RNA and restricting the guide RNA to the nucleus of the cell. In some embodiments, a promoter to drive expression of the guide is a human RNA polymerase promoter or a sequence isolated or derived from a human RNA polymerase promoter. In some embodiments, a promoter to drive expression of the guide RNA is a U6 promoter or a sequence isolated or derived from a U6 promoter.
- a promoter to drive expression of the guide RNA is a human tRNA promoter or a sequence isolated or derived from a human tRNA promoter. In some embodiments, a promoter to drive expression of the guide RNA is a human valine tRNA promoter or a sequence isolated or derived from a human valine tRNA promoter.
- a promoter to drive expression of the capped-guide RNA further includes a regulatory element.
- a vector that includes promoter to drive expression of the guide RNA further includes a regulatory element.
- a regulatory element enhances expression of the guide RNA.
- Exemplary regulatory elements include, but are not limited to, an enhancer element, an intron, an exon, or a combination thereof.
- the nucleic acid sequences encoding the Cas polypeptides are linked to one or more localization signals.
- Localization signals are amino acid sequences on a protein that tags the protein for transportation to a particular location in a cell.
- An exemplary localization signal is a nuclear localization signal (NLS), which is an amino acid sequence that tags a protein for import into the cell nucleus by nuclear transport.
- one or more localization signals is/are operably linked to the sequence encoding a Cas polypeptide.
- the localization signal is a nuclear localization signal (NLS).
- NLS is SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 477)) and nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 478)).
- Other NLSs are known in the art; see, e.g., Konermann et al., Cell 173:665-676, 2018; Cokol et ah, EMBO Rep. 1(5):411—415 (2000); Freitas and Cunha, Curr Genomics 10(8): 550-557 (2009), incorporated herein by reference in their entirety.
- additional NLSs are those that have K(K/R)X(K/R) as a putative consensus sequence (e.g., PAAKRVKLD (SEQ ID NO: 479)).
- additional NLSs include KRSWSMAF (SEQ ID NO: 480) and KRKYF (SEQ ID NO: 481).
- vectors comprising the nucleic acids that encode the Cas polypeptide further encode a capped-sgRNA (e.g., any of the capped-sgRNAs described herein).
- the localization signal is a nuclear export signal (NES). Incorporating an NES is particularly suited for altering molecular machinery in the cytoplasm.
- an NES is the HIV -REV NES or the PKI NES.
- the nucleic acids encoding the capped-sgRNA and/or the Cas polypeptide can be further operably linked to a sequence that encodes one or more reporter genes, or effector genes such as, without limitation, endonucleases that have nuclease activity.
- a nucleic acid sequence encodes a capped-sgRNA disclosed herein and a fusion protein that includes a dCas polypeptide and an endonuclease.
- Any suitable reporter genes are contemplated, including but not limited to, fluorescent reporters.
- any suitable endonucleases are contemplated for fusing with a Cas polypeptide, in particular a dCas polypeptide.
- Vectors contemplated for the present disclosure can include those that are suitable for expression in a selected host, whether prokaryotic or eukaryotic, for example, phage, plasmid, and viral vectors.
- Viral vectors may be either replication competent or replication defective retroviral vectors. Viral propagation generally will occur only in complementing host cells comprising replication defective vectors, for example, when using replication defective retroviral vectors in methods provided herein viral replication will not occur.
- Vectors may comprise kozak sequences (Lodish et al., Molecular Cell Biology, 4th ed., 1999) and may also contain the ATG start codon. Promoters that function in a eukaryotic host are from, without limitation, SV40, LTR, CMV, EF- 1 a, white cloud mountain minnow b-actin.
- a vector of the disclosure includes one or more of a sequence encoding at least one capped-guide RNA of the disclosure, one or more promoters to drive expression of the one or more guide RNAs and a sequence encoding a regulatory element.
- the vector further includes a sequence encoding a Cas polypeptide, a dCas polypeptide or a dCas-fusion protein.
- Copy number and positional effects are considered in designing transiently and stably expressed vectors.
- Copy number can be increased by, for example, dihydrofolate reductase amplification.
- Positional effects can be optimized by, for example, Chinese hamster elongation factor- 1 vector pDEF38 (CHEF1), ubiquitous chromatin opening elements (UCOE), scaffold/matrix-attached region of human (S/MAR), and artificial chromosome expression (ACE) vectors, as well as by using site-specific integration methods known in the art.
- the expression constructs containing the vector can further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation.
- the coding portion of the transcripts expressed by the constructs can include a translation initiating codon at the beginning and a termination codon (UAA, UGA, or UAG) appropriately positioned at the end of the polypeptide to be translated.
- exemplary vectors suitable for expressing Cas polypeptides and/or sgRNAs in bacteria include Piggy Bac transposon vectors, pTT vectors (e.g., from Biotechnology Research Institute (Montreal, Canada)), pQE70, pQE60, and pQE-9 (e.g.
- eukaryotic vectors include pWLNEO, pSV2CAT, pOG44, pXTl, and pSG available from Stratagene (La Jolla, CA); and pSVK3, pBPV, pMSG and pSVL, available from Pharmacia (Peapack, NJ).
- a pTT vector backbone can be used for expressing the Cas polypeptide and/or sgRNA (Durocher et a , Nucl. Acids Res. 30:E9 (2002)).
- the backbone of a pTT vector may be prepared by obtaining pIRESpuro/EGFP (pEGFP) and pSEAP basic vector(s), for example from Clontech (Palo Alto, CA), and pcDNA3.1 , pCDNA3.1 /Myc-(His)6 and pCEP4 vectors can be obtained from, for example, Invitrogen (Carlsbad, CA).
- the pTT5 backbone vector can generate a pTT5 -Gateway vector and be used to transiently express proteins in mammalian cells.
- the pTT5 vector can be derivatized to pTT5-A, pTT5-B, pTT5-D, pTT5-E, pTT5-H, and pTT5-I, for example.
- the pTT2 vector can generate constructs for stable expression in mammalian cell lines.
- a pTT vector can be prepared by deleting the hygromycin (Bsml and Sail excision followed by fill-in and ligation) and EBNA1 (Clal and Nsil excision followed by fill-in and ligation) expression cassettes.
- the ColEI origin Fspl-Sall fragment, including the 3' end of the b-lactamase open reading frame (ORF) can be replaced with a Fspl-Sall fragment from pcDNA3.1 containing the pMBI origin (and the same 3' end of b-lactamase ORF).
- a Myc- (His)6 C-terminal fusion tag can be added to SEAP (Hindlll-Hpal fragment from pSEAP- basic) following in-frame ligation in pcDNA3.1 /Myc-His digested with Hindlll and EcoPvV.
- Plasmids can subsequently be amplified in E. coli (DH5a) grown in LB medium and purified using MAXI prep columns (Qiagen, Mississauga, Ontario, Canada). To quantify, plasmids can be subsequently diluted in, for example, 50 mM Tris-HCl pH 7.4 and absorbencies can be measured at 260 nm and 280 nm. Plasmid preparations with A260/A280 ratios between about 1 .75 and about 2.00 are suitable for producing the Fc-fusion constructs.
- the expression vector pTT5 allows for extrachromosomal replication of the cDNA driven by a cytomegalovirus (CMV) promoter.
- CMV cytomegalovirus
- the plasmid vector pCDNA- pDEST40 is a Gateway -adapted vector which can utilize a CMV promoter for high-level expression.
- SuperGlo GFP variant (sgGFP) can be obtained from Q-Biogene (Carlsbad, CA).
- Preparing a pCEP5 vector can be accomplished by removing the CMV promoter and polyadenylation signal of pCEP4 by sequential digestion and self-ligation using Sail and Xbal enzymes resulting in plasmid pCEP4A.
- a Gblll fragment from pAdCMV5 Massie et al, J. Virol. 72:2289-2296 (1998)), encoding the CMV5-poly(A) expression cassette ligated in Bglll- linearized pCEP4A, resulting in the pCEP5 vector.
- Additional vectors include optimized for use in CHO-S or CHO-S-derived cells, such as pDEF38 (CHEF 1) and similar vectors (Running Deer et al., Biotechnol. Prog. 20:880-889 (2004)).
- the CHEF vectors contain DNA elements that lead to high and sustained expression in CHO cells and derivatives thereof. They may include, but are not limited to, elements that prevent the transcriptional silencing of transgenes.
- Vectors may include a selectable marker for propagation in a host.
- a selectable marker can allow the selection of transformed cells based on their ability to thrive in the presence or absence of a chemical or other agent that inhibits an essential cell function.
- Selectable markers confer a phenotype on a cell expressing the marker, so that the cell can be identified under appropriate conditions. Suitable markers include genes coding for proteins which confer drug resistance or sensitivity thereto, impart color to, or change the antigenic characteristics of those cells transfected with a molecule encoding the selectable marker, when the cells are grown in an appropriate selective medium.
- Suitable selectable markers include dihydro folate reductase or G41 8 for neomycin resistance in eukaryotic cell culture; and tetracycline, kanamycin, or ampicillin resistance genes for culturing in E. coli and other bacteria.
- Suitable selectable markers also include cytotoxic markers and drug resistance markers, whereby cells are selected by their ability to grow on media containing one or more of the cytotoxins or drugs; auxotrophic markers, by which cells are selected for their ability to grow on defined media with or without particular nutrients or supplements, such as thymidine and hypoxanthine; metabolic markers for which cells are selected, for example, for ability to grow on defined media containing a defined substance, for example, an appropriate sugar as the sole carbon source; and markers which confer the ability of cells to form colored colonies on chromogenic substrates or cause cells to fluoresce.
- cytotoxic markers and drug resistance markers whereby cells are selected by their ability to grow on media containing one or more of the cytotoxins or drugs
- auxotrophic markers by which cells are selected for their ability to grow on defined media with or without particular nutrients or supplements, such as thymidine and hypoxanthine
- metabolic markers for which cells are selected, for example, for ability to grow on defined media containing a defined substance, for example, an appropriate sugar
- Retroviral vectors are contemplated herein.
- the ROSA geo retroviral vector which maps to mouse chromosome six, was constructed with the reporter gene in reverse orientation with respect to retroviral transcription, downstream of a splice acceptor sequence (U.S. Patent No. 6,461,864; Zambrowicz et al., Proc. Natl. Acad. Sci. 94:3789-3794 (1997)).
- ES embryonic stem
- ROSA26 ROSA geo26
- Adeno-associated viral vectors AAV vectors are contemplated herein.
- AAV adeno-associated virus
- AAV structural particle is composed of 60 protein molecules made up of VP1, VP2, and VP3. Each particle contains approximately 5 VP1 proteins, 5 VP2 proteins and 50 VP3 proteins ordered into an icosahedral structure.
- AAV is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle.
- AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo.
- AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther.
- AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression.
- AAV2, AAV5, AAV2/5, AAV2/8 and AAV2/7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al, Vision Research 2008, 48(3):377-385; Khani et al, Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3954-61; Allocca et al, J. Virol.
- the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in PCT/US2014/060163; for example, a virus particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT/US2014/060163, and a Cas sequence and capped-guide RNA sequence as described herein.
- the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44.
- the AAV incorporates inverted terminal repeats (ITRs) derived from the AAV2 serotype. Exemplary left and right ITRs are presented in Table 6 of WO 2018/026976 and are listed below:
- AAV2 ITRs AAV2 ITR sequences shown below are exemplary and are not intended to be limiting. Modifications of these sequences are known in the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure.
- Expression of the Cas polypeptide and/or sgRNA in the AAV vector can be driven by a promoter described herein or known in the art.
- AAV vectors capable of delivering ⁇ 4.5kb are used for packaging of the nucleic acids encoding capped-sgRNAs or Cas polypeptides.
- AAVs capable of packaging larger transgenes such as about 4.6kb, 4.7kb, 4.8kb, 4.9kb, 5.0kb, 5. lkb, 5.2kb, 5.3kb, 5.4kb, 5.5kb, 5.6kb, 5.7kb, 5.8kb, 5.9kb,
- a DNA insert comprising nucleic acids (optionally contained in a vector or vectors) encoding Cas9 polypeptides or sgRNAs can be operatively linked to an appropriate promoter, such as the phage lambda PL promoter; the E. coli lac, trp, phoA, and tac promoters; the SV40 early and late promoters; and promoters of retroviral LTRs.
- Suitable vectors and promoters also include the pCMV vector with an enhancer, pcDNA3.1 ; the pCMV vector with an enhancer and an intron, pCIneo; the pCMV vector with an enhancer, an intron, and a tripartate leader, pTT2, and CHEF1.
- the promoter sequences include at least the minimum number of bases or elements necessary to initiate transcription of a gene of interest at levels detectable above background. Within the promoter sequence may be a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. In alternative embodiments, eukaryotic promoters will often, but not always, contain“TATA” boxes and“CAT” boxes.
- constmcts can further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation.
- the coding portion of the transcripts expressed by the constructs can include a translation initiating codon at the beginning and a termination codon (UAA. LJGA. or UAG) appropriately positioned at the end of the polypeptide to be translated.
- the vector is or comprises an“RNA targeting system” comprising (a) nucleic acid sequence encoding an Cas polypeptide or dCas polypeptide or dCas polypeptide fusion protein; and (b) a capped- single guide RNA (capped-sgRNA) sequence comprising: an RNA sequence (or spacer sequence) that hybridizes to or binds to a target RNA sequence and an RNA sequence (direct repeat or scaffold sequence) capable of binding to or associating with the Cas polypeptide and wherein the RNA targeting system recognizes the target RNA and enhances translation of the target RNA.
- the nucleic acid sequence or vector is a single vector.
- Some embodiments disclosed herein provide cells comprising the nucleic acid or nucleic acids (e.g., vector or vectors) that encode Cas9 polypeptides or capped-sgRNAs.
- the cells transfected may be a prokaryotic cell, a eukaryotic cell, a yeast cell, an insect cell, an animal cell, a mammalian cell, a human cell, etc.
- the proteins expressed in mammalian cells have been glycosylated properly. Examples of useful mammalian host cell lines are HEK293, CHO, sp2/0, NSO, COS, BHK, and PerC6.
- the target mRNA is in a cell.
- the cell is a eukaryotic cell.
- the cell is a prokary otic cell.
- the cell is a mammalian cell.
- the cell is a bovine, murine, feline, equine, porcine, canine, simian, or human cell.
- the cell is a plant cell.
- the cell is in a subject or patient.
- the cell is in vivo, in vitro, ex vivo , or in situ.
- the composition comprises a vector comprising composition comprising the capped-guide RNA of the disclosure and/or a Cas polypeptide or dCas polypeptide.
- the vector is a viral vector for transducing a cell.
- the viral vector is an AAV vector.
- Transfection of animal cells typically involves opening transient pores or“holes” in the cell membrane, to allow the uptake of material.
- Transfection can be carried out using calcium phosphate, by electroporation, or by mixing a cationic lipid with the material to produce liposomes, which fuse with the cell membrane and deposit their cargo inside.
- Many materials have been used as carriers for transfection, which can be divided into three kinds: (cationic) polymers, liposomes, and nanoparticles.
- compositions for and methods of enhancing protein translation in a cell comprising introducing capped-sgRNAs (e.g., any of the capped-sgRNAs described herein) and Cas polypeptides (e.g., any of the Cas
- the methods of enhancing protein translation can include introducing or administering a nucleic acid or nucleic acids (e.g., vector or vectors) encoding the capped-sgRNA and the Cas polypeptides into a cell.
- a nucleic acid or nucleic acids e.g., vector or vectors
- a nucleic acid comprising (a) a sequence encoding a Cas polypeptide; and (b) a sequence encoding a capped-sgRNA comprising (i) an m7G cap; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
- Methods of measuring levels of protein translation are known in the art. Exemplary methods include, without limitation, western blot, mass spectrometry, antibody staining, and mean fluorescence intensity flow cytometry. In instances where a reporter construct is linked to the target mRNA, protein translation can also be measured based on the levels of the reporter molecule.
- enhancing translation or increasing or upregulating gene expression refers to an increase in the amount of peptide translated from the target mRNA as compared to a control.
- the control includes a level of peptide translated from the target mRNA in the absence of the capped-sgRNA compositions and methods.
- the control includes the level of the peptide translated from the target mRNA prior to addition of the compositions disclosed herein.
- translation is increased about 1.1 fold, about 1.2 fold, about 1.3 fold, about 1.4 fold, about 1.5 fold, about 1.6 fold, about 1.7 fold, about 1.8 fold, about 1.9 fold, about 2 fold, about 2.5 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 1000 fold, or about 10,000 fold relative to the control.
- the amount of peptide translated can be determined by any method known in the art.
- haploinsufficiency diseases or disorders include, without limitation, Autosomal dominant Retinitis Pigmentosa (RP11) caused by mutations in PRPF31, Autosomal dominant Retinitis Pigmentosa (RP31) caused by mutations in TOPORS, Frontotemporal dementia caused by mutations in GRN, DeVivo Syndrome (Glutl deficiency) caused by mutations in SLC2A1, Dravet syndrome caused by mutations in SCN1A, 1 q21.1 Deletion Syndrome, 5q-Syndrome in Myelodysplastic Syndrome (MDS), 22ql 1.2 Deletion Syndrome, CHARGE Syndrome, Cleidocrainial Dysostosis, Ehlers-Danlos Syndrome, Frontotemporal Dementia caused by mutations in
- methods of using the capped-sgRNA compositions disclosed herein for treating haploinsufficiency diseases or disorders such as, without limitation, those listed in the preceding paragraph, involving mutations which lead to introduction of a premature termination codon (PTC) resulting in degradation from mutant allele or loss of function of the protein (or less protein to be produced) are contemplated herein.
- PTC premature termination codon
- methods of translation enhancement using the capped-sgRNA compositions disclosed herein are useful for treating cancer.
- the methods can be used for upregulating protein expression of tumor suppressor genes (TSG) in tissue predisposed to cancer due to hereditary (or acquired) mutations of TSG.
- TSG tumor suppressor genes
- the methods can be used for upregulating protein expression from genes that would prevent cancer from metastasizing (ie angiogenesis genes).
- the methods can be used for upregulating protein expression from genes that would result in the cancer being more susceptible to follow-up treatments.
- the methods can be used for translational enhancement to prevent cancer evasion of the immune system.
- the“administration” of the compositions disclosed herein includes any route of introducing or delivering to a subject the agent to perform its intended function. Administration can be carried out by any suitable route, including orally, intranasally, intraocularly, ophthalmically, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), or topically.
- Administration includes self-administration and the administration by another.
- the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a capped-sgRNA composition(s) of the disclosure.
- methods for treating a disease or condition in a subject in need thereof comprising, consisting of, or consisting essentially of administering a nucleic acid sequence comprising/encoding (a) a capped- sgRNA disclosed herein; and (b) a dCas polypeptide, a vector comprising the nucleic acid sequence, or a viral particle comprising the vector to the subject, thereby enhancing translation of a target mRNA in the subject or patient.
- the target mRNA is involved in the etiology of a disease or condition in the subject.
- the subject or patient is an animal.
- the subject is a mammal.
- the mammal is a bovine, equine, porcine, canine, feline, simian, murine, or human.
- the subject is a human.
- a disease or disorder of the disclosure includes, but is not limited to, a genetic disease or disorder.
- the genetic disease or disorder is a single-gene disease or disorder.
- the single-gene disease or disorder is an autosomal dominant disease or disorder, an autosomal recessive disease or disorder, an X-chromosome linked (X-linked) disease or disorder, an X-linked dominant disease or disorder, an X-linked recessive disease or disorder, a Y -linked disease or disorder or a mitochondrial disease or disorder.
- the genetic disease or disorder is a multiple-gene disease or disorder.
- the genetic disease or disorder is a multiple-gene disease or disorder.
- the single-gene disease or disorder is an autosomal dominant disease or disorder including, but not limited to, Huntington's disease, neurofibromatosis type 1, neurofibromatosis type 2, Marfan syndrome, hereditary nonpolyposis colorectal cancer, hereditary multiple exostoses, Von Willebrand disease, and acute intermittent porphyria.
- the single-gene disease or disorder is an autosomal recessive disease or disorder including, but not limited to, Albinism, Medium-chain acyl-CoA dehydrogenase deficiency, cystic fibrosis, sickle-cell disease, Tay-Sachs disease, Niemann-Pick disease, spinal muscular atrophy, and Roberts syndrome.
- the single-gene disease or disorder is X-linked disease or disorder including, but not limited to, muscular dystrophy, Duchenne muscular dystrophy, Hemophilia, Adrenoleukodystrophy (ALD), Rett syndrome, and Hemophilia A.
- the single-gene disease or disorder is a mitochondrial disorder including, but not limited to, Leber’s hereditary optic neuropathy.
- a disease or disorder of the disclosure includes, but is not limited to, an immune disease or disorder.
- the immune disease or disorder is an immunodeficiency disease or disorder including, but not limited to, B-cell deficiency, T-cell deficiency, neutropenia, asplenia, complement deficiency, acquired immunodeficiency syndrome (AIDS) and immunodeficiency due to medical intervention (immunosuppression as an intended or adverse effect of a medical therapy).
- the immune disease or disorder is an autoimmune disease or disorder including, but not limited to, Achalasia, Addison’s disease, Adult Still's disease, Agammaglobulinemia, Alopecia areata, Amyloidosis, Anti- GBM/Anti-TBM nephritis, Antiphospholipid syndrome, Autoimmune angioedema, Autoimmune dysautonomia, Autoimmune encephalomyelitis, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune urticaria, Axonal & neuronal neuropathy (AMAN), Balo disease, Behcet’s disease, Benign mucosal pemphigoid, Bullous pemphigoid, Castleman disease (CD), Celiac disease, Cha
- Granulomatosis Cicatricial pemphigoid, Cogan’s syndrome, Cold agglutinin disease, Congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn’s disease, Dermatitis herpetiformis, Dermatomyositis, Devic’s disease (neuromyelitis optica), Discoid lupus, Dressier’ s syndrome, Endometriosis, Eosinophilic esophagitis (EoE), Eosinophilic fasciitis, Erythema nodosum, Essential mixed cryoglobulinemia, Evans syndrome,
- Fibromyalgia Fibrosing alveolitis
- Giant cell arteritis temporary arteritis
- Giant cell myocarditis Glomerulonephritis
- Goodpasture’s syndrome Granulomatosis with
- PNJJ hemoglobinuria
- Parry Romberg syndrome Pars planitis (peripheral uveitis)
- Parsonnage-Tumer syndrome Pemphigus
- Peripheral neuropathy Perivenous
- PA Pernicious anemia
- POEMS syndrome Polyarteritis nodosa
- Polyglandular syndromes type I, II, III Polymyalgia rheumatica
- Polymyositis
- Postmyocardial infarction syndrome Postpericardiotomy syndrome, Primary biliary cirrhosis, Primary sclerosing cholangitis, Progesterone dermatitis, Psoriasis, Psoriatic arthritis, Pure red cell aplasia (PRC A), Pyoderma gangrenosum, Raynaud’s phenomenon, Reactive Arthritis, Reflex sympathetic dystrophy, Relapsing polychondritis, Restless legs syndrome (RLS), Retroperitoneal fibrosis, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt syndrome, Scleritis, Scleroderma, Sjogren’s syndrome, Sperm & testicular autoimmunity, Stiff person syndrome (SPS), Subacute bacterial endocarditis (SBE), Susac’s syndrome, Sympathetic ophthalmia (SO), Takayasu’s arteritis, Temporal arteritis/Giant cell arteriti
- a disease or disorder of the disclosure includes, but is not limited to, an inflammatory disease or disorder.
- a disease or disorder of the disclosure includes, but is not limited to, a metabolic disease or disorder.
- a disease or disorder of the disclosure includes, but is not limited to, a degenerative or a progressive disease or disorder.
- the degenerative or a progressive disease or disorder includes, but is not limited to, amyotrophic lateral sclerosis (ALS), Huntington’s disease, Alzheimer’s disease, and aging.
- a disease or disorder of the disclosure includes, but is not limited to, an infectious disease or disorder. In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, a pediatric or a developmental disease or disorder.
- a disease or disorder of the disclosure includes, but is not limited to, a cardiovascular disease or disorder.
- a disease or disorder of the disclosure includes, but is not limited to, a proliferative disease or disorder.
- the proliferative disease or disorder is a cancer.
- the cancer includes, but is not limited to, Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML), Adrenocortical Carcinoma, AIDS-Related Cancers, Kaposi Sarcoma (Soft Tissue Sarcoma), AIDS-Related Lymphoma (Lymphoma), Primary CNS Lymphoma (Lymphoma), Anal Cancer, Appendix Cancer, Gastrointestinal Carcinoid Tumors, Astrocytomas, Atypical Teratoid/Rhabdoid Tumor, Central Nervous System (Brain Cancer), Basal Cell Carcinoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Ewing Sarcoma, Osteosarcoma, Malignant Fibrous His
- Retinoblastoma Fallopian Tube Cancer
- Fibrous Histiocytoma of Bone Malignant
- Osteosarcoma Gallbladder Cancer
- Gastric (Stomach) Cancer Gastrointestinal Carcinoid Tumor
- Gastrointestinal Stromal Tumors (GIST) Soft Tissue Sarcoma
- Gastrointestinal Stromal Tumors Germ Cell Tumors, Childhood Extracranial Germ Cell Tumors, Extragonadal Germ Cell Tumors, Ovarian Germ Cell Tumors, Testicular Cancer, Gestational Trophoblastic Disease, Hairy Cell Leukemia, Head and Neck Cancer, Heart Tumors, Hepatocellular (Liver) Cancer, Histiocytosis, Hodgkin Lymphoma, Hypopharyngeal Cancer (Head and Neck Cancer), Intraocular Melanoma, Islet Cell Tumors, Pancreatic Neuroendocrine Tumors, Kaposi Sarcoma (Soft Tissue Sarcoma), Kidney (Renal Cell) Cancer, Langerhans Cell Histiocytosis, Laryngeal Cancer (Head and Neck Cancer),
- a subject of the disclosure has been diagnosed with the disease or disorder. In some embodiments, the subject of the disclosure presents at least one sign or symptom of the disease or disorder. In some embodiments, the subject has a biomarker predictive of a risk of developing the disease or disorder. In some embodiments, the biomarker is a genetic mutation. In some embodiments of the methods of the disclosure, a subject of the disclosure is female. In some embodiments of the methods of the disclosure, a subject of the disclosure is male. In some embodiments, a subject of the disclosure has two XX or XY chromosomes. In some embodiments, a subject of the disclosure has two XX or XY chromosomes and a third chromosome, either an X or a Y.
- a subject of the disclosure is a neonate, an infant, a child, an adult, a senior adult, or an elderly adult. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,28, 29, 30 or 31 days old. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months old.
- a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or any number of years or partial years in between of age.
- a subject of the disclosure is a mammal. In some embodiments, a subject of the disclosure is a non-human mammal.
- a subject of the disclosure is a human.
- a therapeutically effective amount comprises a single dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises at least one dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises one or more dose(s) of a composition of the disclosure. In some embodiments of the methods of the disclosure, a therapeutically effective amount eliminates a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount reduces a severity of a sign or symptom of the disease or disorder.
- a therapeutically effective amount eliminates the disease or disorder.
- a therapeutically effective amount prevents an onset of a disease or disorder. In some embodiments, a therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, a therapeutically effective amount reduces the severity of a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount improves a prognosis for the subject.
- a composition of the disclosure is administered to the subject systemically. In some embodiments, the composition of the disclosure is administered to the subject by an intravenous route. In some
- composition of the disclosure is administered to the subject by an injection or an infusion.
- a composition of the disclosure is administered to the subject locally.
- the composition of the disclosure is administered to the subject by an intraosseous, intraocular,
- composition of the disclosure is administered directly to the cerebral spinal fluid of the central nervous system.
- the composition of the disclosure is administered directly to a tissue or fluid of the eye and does not have bioavailability outside of ocular structures. In some embodiments, the composition of the disclosure is administered to the subject by an injection or an infusion.
- a pharmaceutical composition comprising any one or more of the capped-sgRNAs and Cas or dCas polypeptide, or the nucleic acid sequences encoding the polypeptide, and a carrier.
- a composition can be one or more polynucleotides encoding a capped-guide nucleotide sequence-Cas polypeptide or fusion polypeptide.
- a composition can be any of the nucleic acids or proteins described herein.
- a composition can be any polynucleotide described herein.
- the carrier is a pharmaceutically acceptable carrier.
- the composition is a pharmaceutical composition comprising a capped-guide nucleotide sequence-Cas poly peptide or fusion polypeptide, and a pharmaceutically acceptable carrier.
- the composition or pharmaceutical composition further composes one or more gRNAs, capped-sgRNAs, crRNAs, and/or tracrRNAs.
- compositions disclosed herein may comprise a capped-guide nucleotide sequence-Cas polypeptide or fusion polypeptide or a nucleotide sequence encoding the same, optionally comprised in an AAV, which is optionally also immune orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.
- compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
- buffers such as neutral buffered saline, phosphate buffered saline and the like
- carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol
- proteins polypeptides or amino acids
- antioxidants e.g., antioxidants
- chelating agents such as EDTA or glutathione
- adjuvants e.g., aluminum hydroxide
- preservatives e.g., aluminum hydroxide
- a composition of the disclosure is administered to the subject locally.
- the composition of the disclosure is administered to the subject by an intraosseous, intraocular,
- composition of the disclosure is administered directly to the cerebral spinal fluid of the central nervous system.
- the composition of the disclosure is administered directly to a tissue or fluid of the eye and does not have bioavailability outside of ocular structures. In some embodiments, the composition of the disclosure is administered to the subject by an injection or an infusion.
- compositions disclosed herein are formulated as pharmaceutical compositions.
- pharmaceutical compositions for use as disclosed herein may include a protein(s) or a polynucleotide encoding the protein(s), optionally comprised in an AAV, which is optionally also immune orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.
- Such compositions may include buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol;
- proteins proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
- chelating agents such as EDTA or glutathione
- adjuvants e.g., aluminum hydroxide
- compositions of the disclosure may be formulated for oral, intravenous, topical, enteral, intraocular, and/or parenteral administration.
- intraocular intraocular
- compositions of the disclosure are formulated for intravenous administration.
- Example 1 Modulation of translation using dCas and capped-sgRNA
- Exemplaty constructs for generating nuclease dead Cas (dCasl3b) and m7G capped- sgRNA are show n in FIG. 1 A.
- dCas and capped-sgRNA were transcribed from either the same promoter (i), or independent promoters (ii) by RNA polymerase II.
- An exemplary structure for the unprocessed capped-sgRNA is shown in FIG. IB. From 5’ to 3’, the capped- sgRNA contains the m7G cap, a linker of variable length, a spacer, a direct repeat, an RNase P processing site such as a tRNA-like small RNA, and a poly -A tail.
- FIG. 1C An exemplary chemical composition of a capped-sgRNA is shown in FIG. 1C.
- Variants of the m7G cap include either guanosine or adenine for the second nucleotide of the di -nucleotide m7G cap (at the a’ position).
- FIG. ID shows RNase P processing to trim downstream sequences, including the poly-A tail, from the transcript.
- the capped-RNA complexed with dCas binds to a site on the target messenger RNA thereby bringing the m7G cap of the sgRNA to the vicinity of a desired start codon (FIG. IE).
- the first construct includes a dCasl3b gene driven by a PGK promoter, followed by a NLS-Turquoise reporter which is driven by an EF la promoter.
- the second construct includes a sequence encoding a capped sgRNA, a 5’UTR region of ATF4, and the ATF4 ORF linked to an NL-Citrine promoter. Both the sequence encoding a capped sgRNA and the ATF4 ORF are driven by a TRE promoter.
- the second construct further includes an rtTA-P2A-Puro construct linked to an NLS-Cherry reporter via an IRES sequence.
- the rtTA-P2A-Puro-IRES-NLS-Cherry portion is driven by the EF1 a promoter.
- a number of different types of capped sgRNAs (sg(l), sg(2), sg(3), sg(4), sg(5), sg(6)) were generated, each included a spacer that targets the ATF4 transcript at a different site.
- the sequences of the sgRNAs are listed in below. The target sequences were within the“sgRNA targeting window” as shown in FIG. 1G.
- Control capped-sgRNAs were also generated that do not target a sequence within the ATF4 transcript. These control capped-sgRNAs are referred to as non-targeting sgRNAs. Each capped-sgRNA was tested using dCas gradient in combination with a target ATF4 transcript gradient.
- the plots in FIG. 1H reflect log2 fold difference in Citrine/Cherry ratio between each capped sgRNA - sg (al), sg(a2), sg(a3), sg(a4), sg(a5) and sg(a6), and non-targeting sgRNAs.
- Uncapped-sgRNAs that correspond to each of the capped-sgRNA tested were subjected to the same gradient test. As shown in FIG. II, uncapped-sgRNAs were either ineffective in enhancing translation, or only minimally enhanced translation. These results showed that the localized recruitment of the 5’ m7G cap proximal to a start codon enabled an enhancement in translation.
- Embodiment 1 A capped single guide RNA (Capped-sgRNA) comprising from 5’ to 3’:
- RNase P Ribonuclease P
- Embodiment 2 The Capped-sgRNA of Embodiment 1, wherein the Cas protein is a nuclease dead Cas (dCas) protein.
- dCas nuclease dead Cas
- Embodiment 3 The Capped-sgRNA of Embodiment 1, wherein the m7G cap comprises one or more chemical modifications relative to the structure of a naturally occurring m7G cap.
- Embodiment 4 The Capped-sgRNA of Embodiment 1, wherein the linker comprises about 5 to about 25 nucleotides.
- Embodiment 5 The Capped-sgRNA of Embodiment 4, wherein the linker comprises about 8 to about 20 nucleotides.
- Embodiment 6 The Capped-sgRNA of Embodiment 1, wherein the linker is non complementary to any messenger RNA sequence.
- Embodiment 7 The Capped-sgRNA of Embodiment 1, wherein the linker comprises the sequence of GTC AGATCGCCTGGAATT.
- Embodiment 8 The Capped-sgRNA of Embodiment 1, wherein the target sequence is proximal to a target start codon of the messenger RNA relative to a 5 ni7G cap of the messenger RNA.
- Embodiment 9 The Capped-sgRNA of Embodiment 1, wherein the target sequence comprises the target start codon of the messenger RNA.
- Embodiment 10 The Capped-sgRNA of Embodiment 8, wherein the 5’ end of the target sequence is upstream to the target start codon of the messenger RNA.
- Embodiment 11 The Capped-sgRNA of Embodiment 8, wherein the 5’ end of the target sequence is dow nstream to the target start codon of the messenger RNA.
- Embodiment 12 The Capped-sgRNA of Embodiment 1, wherein the spacer is at least 80% complementary to the target sequence in the messenger RNA.
- Embodiment 13 The Capped-sgRNA of Embodiment 1, wherein the spacer is at least 90% complementary to the target sequence in the messenger RNA.
- Embodiment 14 The Capped-sgRNA of Embodiment 1, further comprising a polyadenylated tail.
- Embodiment 15 The Capped-sgRNA of Embodiment 1, having the structure:
- a’ is a guanosine or adenine
- b’ is the linker
- c’ is the spacer
- Embodiment 16 An expression vector encoding the Capped-sgRNA of Embodiment 1.
- Embodiment 17 The expression vector of Embodiment 16, further encodes a nuclease dead Cas9.
- Embodiment 18 A Capped-sgRNA generated by processing the Capped-sgRNA of Embodiment 1 using an RNase P.
- Embodiment 19 An expression vector comprising a nucleic acid sequence encoding:
- Capped-sgRNA a capped single guide RNA (Capped-sgRNA) comprising
- Embodiment 20 The expression vector of Embodiment 19, wherein the Capped-sgRNA further comprises a Ribonuclease P (RNase P) processing site.
- RNase P Ribonuclease P
- Embodiment 21 The expression vector of Embodiment 19, wherein the Capped-sgRNA further comprises a polyadenylated tail.
- Embodiment 22 The expression vector of Embodiment 19, wherein the dCas and the Capped-sgRNA are under the control of the same promoter.
- Embodiment 23 The expression vector of Embodiment 19, wherein the dCas and the Capped-sgRNA are under the control of different promoters.
- Embodiment 24 A method of enhancing protein translation comprising:
- dCas nuclease dead Cas
- Capped-sgRNA capped single guide RNA
- the direct repeat sequence is capable of binding to the dCas protein, and wherein the target sequence is proximal to a start codon of the messenger RNA relative to a 5’ m7G cap of the messenger RNA.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Provided herein are compositions and methods for regulating protein translation. The compositions include a Cas polypeptide and a capped-sgRNA that includes (i) an m7G cap or an analog thereof; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide. The disclosure further provides methods of regulating translation of an mRNA in a cell, the method comprising contacting the cell with a nucleic acid comprising (a) a sequence encoding a Cas polypeptide; and (b) a sequence encoding a capped-sgRNA comprising (i) an m7G cap or analog thereof; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
Description
PROTEIN TRANSLATIONAL CONTROL
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Patent Application Serial No. 62/834,582, filed April 16, 2019, which is incorporated herein by reference in its entirety.
STATEMENT OF GOVERNMENT SUPPORT
This invention was made with government support under EY029166 and NS 103172, awarded by the National Institutes of Health. The government has certain rights in the invention.
SEQUENCE LISTING
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on April 16, 2020, is named Sequence_Listing.txt.
BACKGROUND
Existing RNA-targeting CRISPR-Cas applications provide tools to degrade RNA or modulate RNA structure but do not, on their own enhance gene expression or increase translational protein control. Likewise, existing methods of enhancing and/or increasing gene expression, such as the delivery of messenger RNAs, prove to be technically challenging. Indeed, there are few known or well characterized methods to increase mRNA translation.
The vast majority of gene regulatory drugs have been designed to knockdown gene expression (i.e. siRNAs, miRNAs, anti-sense, etc.). Some methods exist to enhance gene expression, such as the delivery of mRNAs; however, therapeutic delivery of such large and charged RNA molecules is technically challenging, inefficient, and not particularly practical. Classical gene therapy approaches involve delivery' of a gene product as viral-encoded products (e.g. AAV or lentivirus-packaged products); however, these methods suffer from not being able to accurately reproduce the correct alternatively spliced isoforms in the correct ratios. In addition, gene delivery can exclude important non-coding regulator sequences. Other methods of regulating protein translation involve engineered RNA binding proteins which are not easily delivered to cells and can be highly immunogenic. Often, engineered RNA binding proteins require extensive engineering for each target RNA sequence and certain of these possess limits to their applicability. More problematically, the act of
expression of certain of these types of engineered RNA binding proteins, when combined with translation initiation factor functions in a fusion protein context, could disrupt the stoichiometry of translation machinery maintained by the cell.
As such, there is a need to provide compositions and methods for recruiting translational pre-initiation complexes in a manner which overcomes gene therapy barriers and protein engineering challenges, thereby controlling translation in cells and in gene therapy techniques.
SUMMARY
In one aspect, provided herein are complexes comprising: a Cas polypeptide; and a capped-sgRNA comprising (i) an m7G cap or an analog thereof; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide. In some embodiments of any of the complexes described herein, the RNA molecule is a messenger RNA (mRNA). In some embodiments of any of the complexes described herein, the mRNA has an endogenous m7G cap. In some embodiments of any of the complexes described herein, the target sequence is downstream of the endogenous m7G cap of the mRNA. In some embodiments of any of the complexes described herein, the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is upstream of the start codon. In some embodiments of any of the complexes described herein, the 5’ end of the target sequence is between 1 to 50 nucleotides upstream of the first nucleotide of the start codon. In some embodiments of any of the complexes described herein, the 5’ end of the target sequence is between 1 to 15 nucleotides upstream of the first nucleotide of the start codon. In some embodiments of any of the complexes described herein, the target sequence comprises the start codon. In some embodiments of any of the complexes described herein, the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is downstream of the start codon. In some embodiments of any of the complexes described herein, the 5’ end of the target sequence is between 1 to 50 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the complexes described herein, 5’ end of the target sequence is between 1 to 15 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the complexes described herein, the 5’ end of the target sequence is between 1 to 5 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the complexes described herein, the spacer is at least 80% complementary to the target sequence. In some embodiments of any of the complexes described herein, the spacer is at
least 90% complementary to the target sequence. In some embodiments of any of the complexes described herein, the spacer comprises about 10 to about 40 nucleotides. In some embodiments of any of the complexes described herein, the spacer comprises about 15 to about 25 nucleotides. In some embodiments of any of the complexes described herein, the spacer comprises about 20 nucleotides. In some embodiments of any of the complexes described herein, the spacer is connected to the m7G cap or analog there of via a linker. In some embodiments of any of the complexes described herein, the linker comprises about 5 to about 25 nucleotides. In some embodiments of any of the complexes described herein, the linker comprises about 8 to about 15 nucleotides. In some embodiments of any of the complexes described herein, the linker is not complementary to any sequence in the mRNA. In some embodiments of any of the complexes described herein, the linker is conjugated to the m7G cap or analog thereof via polyethylene glycol. In some embodiments of any of the complexes described herein, the Cas polypeptide is a nuclease-deficient Cas (dCas) polypeptide, wherein the dCas comprises an inactivated target cleavage domain and a retained guide cleavage domain. In some embodiments of any of the complexes described herein, the nuclease-deficient Cas polypeptide is a nuclease-deficient Cas 13 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d. In some embodiments of any of the complexes described herein, the direct repeat is capable of binding to a nuclease-deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d. In some embodiments of any of the complexes described herein, the nuclease-deficient Cas polypeptide is a nuclease-deficient Cas9 (dCas9) polypeptide. In some embodiments of any of the complexes described herein, the direct repeat is capable of binding to a nuclease- deficient Cas9 (dCas9) polypeptide. In some aspects, provided herein is a nucleic acid comprising a sequence encoding the capped-sgRNA in any of the complexes described herein. In some embodiments, the nucleic acid further comprises a sequence encoding the Cas polypeptide in any of the complexes described herein.
In another aspect, provided herein are nucleic acids comprising a sequence encoding a capped-sgRNA, wherein the capped-sgRNA comprises: (i) an m7G cap or analog thereof; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to a Cas polypeptide. In some embodiments of any of the nucleic acids described herein, the RNA molecule is an mRNA. In some embodiments of any of the nucleic acids described herein, the mRNA has an endogenous m7G cap. . In some embodiments of any of the nucleic acids described herein, the target sequence is downstream of the endogenous m7G cap of the mRNA. In some embodiments of any of the nucleic acids
described herein, the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is upstream of the start codon. In some embodiments of any of the nucleic acids described herein, the 5’ end of the target sequence is between 1 and 50 nucleotides upstream of the first nucleotide of the start codon. In some embodiments of any of the nucleic acids described herein, the 5’ end of the target sequence is between 1 to 15 nucleotides upstream of the first nucleotide of the start codon. In some embodiments of any of the nucleic acids described herein, the target sequence comprises the start codon. In some embodiments of any of the nucleic acids described herein, the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is downstream of the start codon. In some embodiments of any of the nucleic acids described herein, the 5’ end of the target sequence is between 1 to 50 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the nucleic acids described herein, the 5’ end of the target sequence is between 1 to 15 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the nucleic acids described herein, the 5’ end of the target sequence is between 1 to 5 nucleotides downstream of the last nucleotide of the start codon. In some embodiments of any of the nucleic acids described herein, the spacer is at least 80% complementary to the target sequence. In some embodiments of any of the nucleic acids described herein, the spacer is at least 90% complementary to the target sequence. In some embodiments of any of the nucleic acids described herein, the spacer comprises about 10 to about 40 nucleotides. In some embodiments of any of the nucleic acids described herein, the spacer comprises about 15 to about 25 nucleotides. In some embodiments of any of the nucleic acids described herein, the spacer comprises about 20 nucleotides. In some embodiments of any of the nucleic acids described herein, the spacer is connected to the m7G cap or analog thereof via a linker. In some embodiments of any of the nucleic acids described herein, the linker comprises about 5 to about 25 nucleotides. In some embodiments of any of the nucleic acids described herein, the linker comprises about 8 to about 20 nucleotides. In some embodiments of any of the nucleic acids described herein, the linker is not complementary to any sequence in the mRNA. In some embodiments of any of the nucleic acids described herein, the linker is conjugated to the m7G cap or analog thereof via polyethylene glycol. In some embodiments of any of the nucleic acids described herein, the nucleic acids further comprise a sequence encoding a RNase P processing site. In some embodiments of any of the nucleic acids described herein, the nucleics further comprise a poly-T sequence. In some embodiments of any of the nucleic acids described herein, the nucleic acids further comprise a poly-T sequence downstream of the sequence encoding a RNase P processing site. In some
embodiments of any of the nucleic acids described herein, the nucleic acids further comprise a sequence encoding the Cas polypeptide. In some embodiments of any of the nucleic acids described herein, the Cas polypeptide is a nuclease-deficient Cas polypeptide. In some embodiments of any of the nucleic acids described herein, the nuclease-deficient Cas polypeptide is a nuclease-deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d. In some embodiments of any of the nucleic acids described herein, the direct repeat is capable of binding to a nuclease-deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d. In some embodiments of any of the nucleic acids described herein, the nuclease-deficient Cas polypeptide is a nuclease-deficient Cas9 (dCas9) polypeptide. In some embodiments of any of the nucleic acids described herein, the nucleic acids further comprise one or more RNA polymerase II promoters. In some embodiments of any of the nucleic acids described herein, the sequence encoding the capped-sgRNA and the sequence encoding the Cas polypeptide are expressed from the same promoter. In some embodiments of any of the nucleic acids described herein, the sequence encoding the capped- sgRNA and the sequence encoding the Cas polypeptide are expressed from different promoters. In some aspects, provided herein are vectors comprising the nucleic acids of any of the above embodiments. In some embodiments, the vector is an AAV vector. In some embodiments, provided herein are cells comprising the nucleic acid of any of the above embodiments.
In another aspect, provided herein are methods of regulating translation of an mRNA in a cell, the method comprising contacting the cell with a nucleic acid comprising (a) a sequence encoding a Cas polypeptide; and (b) a sequence encoding a capped-sgRNA comprising (i) an m7G cap or analog thereof; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide. In some embodiments of any of the methods of regulating translation of an mRNA in a cell described herein, the Cas polypeptide is a nuclease-deficient Casl3 (dCasl3) polypeptide. In some embodiments of any of the methods of regulating translation of an mRNA in a cell described herein, the dCasl3 polypeptide is dCasl3b or dCasl3d. In some embodiments of any of the methods of regulating translation of an mRNA in a cell described herein, the dCasl3b comprises an inactivated target cleavage domain and a retained guide cleavage domain. In some embodiments of any of the methods of regulating translation of an mRNA in a cell described herein, the dCasl3d comprises an inactivated target cleavage domain and a retained guide cleavage domain.
INCORPORATION BY REFERENCE
All publications, patents, patent applications, and information available on the internet and mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, patent application, or item of information was specifically and individually indicated to be incorporated by reference. To the extent publications, patents, patent applications, and items of information incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.
DESCRIPTION OF THE DRAWINGS
A better understanding of the features and advantages can be obtained by reference to the following detailed description that sets forth illustrative embodiments and accompanying drawings (“Figure” and“Fig.” herein), of which:
FIGS. 1A-1G show modulation of translation using dCas and capped-sgRNA. FIG.
1A shows exemplary constructs for generating dCas and Capped-sgRNA. FIG. IB shows an exemplary structure of unprocessed capped-sgRNA containing an RNase P processing site. FIG. 1C shows an exemplary chemical composition of a capped-sgRNA. FIG. ID shows capped-sgRNA processing by RNase P. FIG. IE shows a schematic of localized capped- sgRNA recmitment and binding of dCas to the capped-sgRNA. FIG. IF shows an exemplary two construct system for expressing dCas and capped-sgRNA. FIG. 1G shows the sgRNA targeting window in the target ATF4 ORF. FIG. 1H shows results of capped-sgRNA modulation on the translation of the target ATF4 ORF. FIG. II shows results of using the control uncapped-sgRNAs on the translation of the target ATF4 ORF.
DETAILED DESCRIPTION
Embodiments according to the invention disclosed herein will be described more fully hereinafter. However, it should be understood that such embodiments are provided merely by way of example, and numerous variations, changes, and substitutions can occur to those skilled in the art without departing from the scope of this disclosure. It should also be understood that various alternatives to the specific embodiments described herein are also within the scope of this disclosure.
Where values are described in terms of ranges, it should be understood that the description includes the disclosure of all possible sub-ranges within such ranges, as well as
specific numerical values that fall within such ranges irrespective of whether a specific numerical value or specific sub-range is expressly stated. All numencal designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied ( + ) or ( - ) by increments of 1.0 or 0.1, as appropriate, or alternatively by a variation of +/- 15 %, or alternatively 10%, or alternatively 5%, or alternatively 2%. It is to be understood, although not always explicitly stated, that all numerical designations are preceded by the term“about”. It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the present application and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein. While not explicitly defined below, such terms should be interpreted according to their common meaning.
Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the disclosure also contemplates that in some embodiments, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination. Unless explicitly indicated otherwise, all specified embodiments, features, and terms intend to include both the recited embodiment, feature, or term and biological equivalents thereof.
As used in the description of the invention and the appended claims, the singular forms“a,”“an” and“the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.
The term“about,” as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of 20%, 10%, 5%, 1 %, 0.5%, or even 0.1 % of the specified amount.
The terms "acceptable. “effective,”“efficient” or“sufficient” when used to describe the selection of any components, ranges, dose forms, etc. disclosed herein intend that said component, range, dose form, etc. is suitable for the disclosed purpose.
Also as used herein,“and/'or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
As used herein, the term“comprising” is intended to mean that the compositions and methods include the recited elements, but do not exclude others. As used herein, the transitional phrase“consisting essentially of (and grammatical variants) is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel charactenstic(s) of the recited embodiment. Thus, the term“consisting essentially of as used herein should not be interpreted as equivalent to“comprising.” “Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions disclosed herein. Aspects defined by each of these transition terms are within the scope of the present disclosure.
As used herein, the term“functional” may be used to modify any molecule, biological, or cellular material to intend that it accomplishes a particular, specified effect.
TRANSLATIONAL ENHANCEMENT VIA M7G CAP RECRUITMENT
Translation initiation in mammalian cells starts w ith the binding of the 5’ methyl-7 guanosine (m7G) cap structure by Eukaryotic Initiation Factor 4E (EIF4E), which results in the nucleation of translational pre-initiation complexes on the adjacent 5’ untranslated region (5’UTR) of mRNA. The bound pre-initiation complexes then scan the 5’UTR
unidirectionally (5’ to 3’) for suitable start codons (e.g.,“AUG”) to pnme and initiate translation. The 5’ m7G cap is an evolutionarily conserved modification of eukary otic mRNA, and serves as a unique molecular module that recruits cellular proteins and mediates cap-related biological functions such as pre-mRNA processing, nuclear export, and cap- dependent protein synthesis.
Provided herein are compositions and methods for enhancing protein production by recruiting an m7G cap to an mRNA using a capped-sgRNA and a Cas polypeptide. In the compositions and methods provided herein, the bound pre-initiation complexes do not necessarily scan the 5’UTR unidirectionally 5’ to 3’.
In some aspects, provided herein is a complex comprising at least one Cas polypeptide or nucleic acid encoding the at least one Cas polypeptide, and at least one m7G
capped single guide RNA (capped-sgRNA) or nucleic acid encoding the at least one capped- sgRNA. where the at least one capped-sgRNA is capable of targeting the at least one Cas polypeptide to a target sequence in an RNA molecule (e.g., an mRNA). In some
embodiments, upon hybridization between the sgRNA and the target sequence, the m7G cap of the sgRNA is brought closer to a desired start codon in the target mRNA as compared to the endogenous m7G cap of the target mRNA. Also provided are methods of regulating translation of an mRNA in a cell, the method comprising contacting the cell with a nucleic acid comprising (a) a sequence encoding a at least one Cas polypeptide; and (b) a sequence encoding at least one capped-sgRNA comprising (i) an m7G cap; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
In some aspects, provided herein is a complex comprising a Cas polypeptide or nucleic acid encoding the Cas polypeptide, and an m7G capped single guide RNA (capped- sgRNA) or nucleic acid encoding the capped-sgRNA, where the capped-sgRNA is capable of targeting the Cas polypeptide to a target sequence in an RNA molecule (e.g., an mRNA). In some embodiments, upon hybridization between the sgRNA and the target sequence, the m7G cap of the sgRNA is brought closer to a desired start codon in the target mRNA as compared to the endogenous m7G cap of the target mRNA. Also provided are methods of regulating translation of an mRNA in a cell, the method comprising contacting the cell with a nucleic acid comprising (a) a sequence encoding a Cas polypeptide; and (b) a sequence encoding a capped-sgRNA comprising (i) an m7G cap; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
Each strand of DNA or RNA has a 5’ end and a 3’ end, corresponding to the carbon position on the deoxyribose (or ribose) ring.“Upstream” as described herein can mean toward the 5’ end of an RNA molecule and dow nstream as described herein can mean towards the 3’ end of an RNA molecule. A“start codon” as described herein can refer to the first codon of a messenger RNA transcript translated by a ribosome. The most common start codon is AUG. Alternative start codons from both prokaryotes and eukaryotes include, but not limited to, GUG, UUG, AUU, and CUG.
The term“cell” as used herein may refer to either a prokaryotic or eukaryotic cell, optionally obtained from a subject or a commercially available source.
The term“encode” as it is applied to nucleic acid sequences refers to a polynucleotide which is said to“encode” a polypeptide, an mRNA, or an effector RNA if, in its native state
or when manipulated by methods well known to those skilled in the art, can be transcribed and/or translated to produce the effector RNA, the mRNA, or an niRNA that can for the polypeptide and/or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
As used herein, the term“expression” or“gene expression” refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample; further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample.
The term“target sequence” can refer to a nucleic acid sequence present in an RNA molecule to which a spacer of a guide RNA (e.g, a capped-sgRNA as disclosed herein) can hybridize, provided sufficient conditions for hy bridization exist. Hybndization between the spacer and the target sequence can, for example, be based on Watson-Crick base pairing rules, which enables programmability in the spacer sequence. The spacer sequence can be designed, for instance, to hybridize with any target sequence.
The“spacer” or“spacer sequence” is comprised within a single guide RNA can include a nucleotide sequence that is complementary to a specific sequence within a target RNA.
“Binding” as used herein can refer to a non-covalent interaction between
macromolecules (e.g., between a protein and a nucleic acid). While m a state of non-covalent interaction, the macromolecules are said to be“associated” or“interacting” or“binding”
(e.g., when a molecule X is said to interact with a molecule Y, it means that the molecule X binds to molecule Y in a non-covalent manner). Binding interactions are generally characterized by a dissociation constant (Kd) of less than 10 6 M, less than 10 7 M, less than 10 8 M, less than 10 9 M, less than 10 10 M, less than 10 11 M, less than 10 12 M, less than 10 13 M, less than 10 14 M, or less than 10 15 M. Kd is dependent on environmental conditions, e.g., pH and temperature, as is known by those in the art.“Affinity” can refer to the strength of binding, and increased binding affinity is correlated with a lower Kd.
The terms“hybridizing” or“hybridize” can refer to the pairing of substantially complementary or complementary nucleic acid sequences within two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence joins with a partially, substantially or fully complementary sequence through base pairing to form a
hybridization complex. For purposes of hybndization, two nucleic acid sequences or segments of sequences are“substantially complementary” if at least 80% of their individual bases are complementary to one another. Two nucleic acid sequences or segments of sequences are“partially complementary” if at least 50% of their individual bases are complementary to one another.
As used herein,“complementary” can mean that two nucleic acid sequences have at least 50% sequence identity. Preferably, the two nucleic acid sequences have at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of sequence identity.
“Complementary” also means that two nucleic acid sequences can hybridize under low, middle, and/or high stringency condition(s).
As used herein,“substantially complementary” means that two nucleic acid sequences have at least 90% sequence identity. Preferably, the two nucleic acid sequences have at least 95%, 96%, 97%, 98%, 99%, or 100% of sequence identity.“Substantially complementary can also mean that two nucleic acid sequences can hybridize under high stringency condition(s).
Low stringency hybridization refers to conditions equivalent to hybridization in 10% formamide, 5x Denhardt’s solution, 6x SSPE, 0.2% SDS at 22°C, followed by washing in lx SSPE, 0.2% SDS, at 37°C. Denhardt's solution contains 1% Ficoll, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA). 20x SSPE (sodium chloride, sodium phosphate, ethylene diamide tetraacetic acid (EDTA)) contains 3M sodium chloride, 0.2M sodium phosphate, and 0.025 M (EDTA). Other suitable moderate stringency and high stringency hybridization buffers and conditions are well known to those of skill in the art.
As used herein,“operably linked” refers to the situation in which part of a linear DNA sequence can influence the other parts of the same DNA molecule. For example, when a promoter controls the transcription of the coding sequence, it is operatively linked to the coding sequence.
As used herein, a“polypeptide” refers to, without limitation, proteins, fragments of proteins, and peptides, whether isolated from natural sources, produced by recombinant techniques, or chemically synthesized. A polypeptide may have one or more modifications, such as a post-translational modification (such as glycosylation, etc.) or any other modification (such as PEGylation, etc.). The polypeptide may contain one or more non- naturally-occurring amino acids (such as an amino acid with a side chain modification). Polypeptides described herein typically comprise at least about 10 amino acids.
As used herein,“contacting” a cell with a nucleic acid molecule can include allowing the nucleic acid molecule to be in sufficient proximity with the cell such that the nucleic acid molecule can be introduced into the cell.
A“promoter” can be a region of DNA that leads to initiation of transcription of a gene.
As used herein,“nuclease-deficient” may refer to a polypeptide with reduced nuclease activity, reduced endo- or exo- DNAse activity or RNAse activity, reduced nickase activity, or reduced ability to cleave DNA and/or RNA.“Reduced nuclease activity means a decline in nuclease, nickase, DNAse, or RNAse activity of at least about 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 35%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more or any value between any of the listed values. Alternatively,“reduced nuclease activity” may refer to a decline of at least about 1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70- fold, 80-fold, 90-fold, 100-fold, 500-fold, 1000-fold, 2000-fold or more or any value between any of the listed values.
“Nucleic acids” may be naturally occurring nucleic acids such as DNA and RNA, or artificial nucleic acids including peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA), and threose nucleic acid (TNA). Nucleic acids disclosed herein can be single-stranded or double-stranded nucleic acids.
I. m7G cap
The m7G cap, or 7-methylguanosine cap, is a guanine nucleotide methylated on the 7 position and can be linked to an RNA molecule (e.g., a sgRNA or an mRNA) via a 5’ to 5’ triphosphate linkage. In one embodiment, capped RNA molecules (e.g., capped-sgRNAs) disclosed herein include a single methyl group on the terminal G residue at the N-7 position. In vivo, the m7G cap structure is added enzymatically to mRNA produced by RNA polymerase II. In one embodiment, the adjacent nucleotides can be 2'-0-methylated to different extents. For example, the m7G cap can be a m7GpppN, or Cap 0, an m7GpppNm, or Cap 1, and an m7GpppNmpNm, or Cap 2. Exemplary structures of Cap 0 and Cap 1, are shown below:
The 5’ m7G cap is an evolutionarily conserved modification of eukaryotic mRNA, and serves as a unique molecular module that recruits cellular proteins and mediates cap- related biological functions such as pre-mRNA processing, nuclear export, and cap-dependent protein synthesis. The capped-sgRNA disclosed herein exploits these biological functions to recruit pre-initiation complexes for enhancement of protein translation.
The capped-sgRNA disclosed herein includes a nucleic acid sequence which is transcribed by, e.g. an RNA polymerase II, and the sgRNA thereby becomes 5’ capped upon transcription with an m7G cap. The transcription of capped-sgRNA nucleic acid sequence is catalyzed by bacteriophage RNA polymerases, such as, without limitation, RNA polymerase T7, T3, and SP6. When bacteriophage RNA polymerases are used to generate the sgRNAs of the present disclosure, cap analogs initiate transcription. In one embodiment, the
m7G(5’)pppG cap analog is incorporated into the sgRNA and simulates the m7G cap structure. In another embodiment, standard cap analogs are incorporated into the sgRNA in the forward (e.g., [m7G(5’)pppG(pN)]) or the reverse onentation (e.g., [G(5’)pppm7G(pN)]) resulting in two forms of isomeric RNAs. In another embodiment, chemical modifications at either the 2’ or 3’ OH group results in the cap being incorporated solely in the forward orientation. In some embodiments, the m7G cap is an anti-reverse cap analog (ARC A), wherein one of the 3’ OH groups (closer m7G) is eliminated from the cap analog and is substituted with -OCH3. This modification forces RNA polymerases to initiate transcription with the remaining -OH group in G and thus synthesize RNA transcripts capped exclusively
in the correct orientation. An exemplary structure of ARCA (m7(3’-0-methyl)- G(5:)ppp(5’)G) is shown below:
Additional cap analogs contemplated herein also include unmethylated cap analogs (e.g., GpppG), trimethylated cap analogs (e.g., m3 2.2.7GP3G). and m2 7,3' OGP3(2'OMe)ApG.
In one embodiment, the m7G cap disclosed herein includes chemical modifications relative to the naturally occurring m7G cap. For example, chemical modifications that can reduce the sensitivity of the m7G cap to cellular decapping enzymes are useful for the capped-RNAs disclosed herein. Suitable chemical modifications include, without limitation, those with 1,2-dithiodiphosphate. See those described in e.g., Strenkowska et al., Nucleic Acids Res. 44(20):9578-9590 (2016), phosphate-modified cap analogues described in e.g., Walczak et al, Chem Sci. 8(l):260-267 (2017)), as well as those described in Basolo et al., Eur J Endocrinol., 145(5):599-604 (2001), and Borghardt et al., Can Respir J. 2018 Jun 19; 2018:2732017, all of which are incorporated herein by reference in their entirety.
II. Capped-sgRNA
Provided herein are capped-sgRNAs, nucleic acids comprising and/or encoding the capped-sgRNAs, and methods of using the same for regulating protein translation. The capped-sgRNA can include an m7G cap or an analog thereof, a spacer capable of specifically hybridizing with a target sequence in an RNA molecule, and a direct repeat capable of binding to a Cas polypeptide. In some embodiments, the capped-sgRNA includes from 5’ to 3’, an m7G cap or an analog thereof, a spacer sequence, and a direct repeat sequence. In one embodiment, the 5’ cap is linked to the spacer sequence via a linker. In one embodiment, the capped-sgRNA is derived from an unprocessed capped-sgRNA that further includes a Ribonuclease P (RNase P) processing site, and a polyadenylated (poly -A) tail at the 3’ end.
In some embodiments of the capped-sgRNAs disclosed herein, the spacer sequence and the scaffolding sequence or direct repeat sequence are not contiguous. In some embodiments, a scaffold sequence comprises a direct repeat sequence.
In some embodiments, the capped-sgRNA sequence is synthetic or comprises non- naturally occurring nucleotides. In some embodiments, a capped-guideRNA of the disclosure or a sequence encoding the guide RNA comprises or consists of modified or synthetic RNA nucleotides. Exemplary modified RNA nucleotides include, but are not limited to, pseudouridine (Y), dihydrouridine (D), inosine (I), and 7-methylguanosine (m7G), hypoxanthine, xanthine, xanthosine, 7- methylguanine, 5, 6-Dihydrouracil, 5-methylcytosine, 5-methylcytidine, 5- hydropxymethylcytosine, isoguanine, and isocytosine. Capped-sgRNAs of the disclosure may bind modified RNA within a target sequence. Within a target sequence, capped-guide RNAs of the disclosure may bind modified RNA. Exemplary epigenetically or post-transcriptionally modified RNA include, but are not limited to, 2 -0-Methylation (2’- OMe) (2,-0-methylation occurs on the oxygen of the free T - OH of the ribose moiety), N6- methyladenosine (m6A), and 5-methylcytosine (m5C). In some embodiments of the compositions of the disclosure, a capped-guide RNA of the disclosure comprises at least one sequence encoding a non-coding C/D box small nucleolar RNA (snoRNA) sequence. In some embodiments, the snoRNA sequence comprises at least one sequence that is complementary to the target RNA, wherein the target sequence of the RNA molecule comprises at least one 2’-OMe. In some embodiments, the snoRNA sequence comprises at least one sequence that is complementary to the target RNA, wherein the at least one sequence that is complementary to the target RNA comprises a box C motif (RETGAETGA) and a box D motif (CUGA).
In some embodiments, a sequence encoding a capped-guide RNA of the disclosure comprises or consists essentially of a spacer sequence and a scaffold or direct repeat sequence, wherein the spacer and the scaffold or direct repeat are operably linked. In one embodiment, the spacer and scaffold and/or direct repeat are separated by a linker sequence. In some embodiments, the linker sequence may include or consist of 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 15, 20, 25, 30, 35, 40, 45, 50, nucleotides or any number of nucleotides in between. In some embodiments, the linker sequence may include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15,
20, 25, 30, 35, 40, 45, 50, nucleotides or any number of nucleotides in between.
In some embodiments, therapeutic or pharmaceutical compositions including the capped-sgRNAs or methods of gene therapy using the capped-sgRNAs of the disclosure do not include a PAMmer oligonucleotide. In other embodiments, optionally, non-therapeutic or non-pharmaceutical compositions may include a PAMmer oligonucleotide. In some embodiments of the compositions of the disclosure, a guide RNA or a portion thereof includes a sequence complementary to a protospacer flanking sequence (PFS). In some embodiments, including those wherein a guide RNA or a portion thereof includes a sequence
complementary to a PFS, the RNA binding protein may include a sequence isolated or derived from a Cas protein, such as, without limitation, a Cas9, Casl3b, or Casl3d protein. In some embodiments, including those wherein a guide RNA or a portion thereof includes a sequence complementary to a PFS, the RNA binding protein may include a sequence encoding a Cas protein, such as, without limitation, a Cas9, Cas 13b, or Casl3d protein, or an RNA-binding portion thereof. In some embodiments, the guide RNA or a portion thereof does not include a sequence complementary to a PFS.
Spacer
The capped-sgRNA disclosed herein comprises a“spacer” or“spacer sequence” that is complementary to a specific sequence within a target RNA. The spacer sequence can be designed to hybridize with any target sequence of interest.
In one embodiment, the spacer sequence comprised within the capped-sgRNA is about 10 to about 30 nucleotides (e.g., about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides). In another embodiment, the spacer sequence is about 15 to about 25 nucleotides (e.g., about 18 to about 22 nucleotides, or about 20 nucleotides). In another embodiment, the spacer sequence is at least 50% complementary, at least 60% complementary, or at least 70% complementary to a target sequence in an RNA molecule (e.g., an mRNA). In another embodiment, the spacer sequence is at least 80% (e.g., at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to a target sequence in an RNA molecule (e.g., an mRNA). In another embodiment, the spacer sequence is 100% complementar to the target sequence. Exemplary spacer sequences for the capped-sgRNAs disclosed herein are:
TTTGCTGGAATCGAGGAATGTGCTT (SEQ ID NO: 278)
GTTGCGGTGCTTTGCTGGAATCGAG (SEQ ID NO: 279)
TTTCGGTCATGTTGCGGTGCTTTGC (SEQ ID NO: 280)
AGGAAGCTCATTTCGGTCATGTTGC (SEQ ID NO: 281)
CTCGCTGCTCAGGAAGCTCATTTCG (SEQ ID NO: 282)
CC AC C AAC ACCT CGCTGCT C AGGAA (SEQ ID NO: 283)
In another embodiment of the capped-sgRNAs disclosed herein, spacer sequences may comprise a CRISPR RNA (crRNA). In another embodiment, spacer sequences of the disclosure comprise or consist of a sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence. Upon binding to a target sequence of an RNA molecule, the spacer sequence may guide one or more of a
scaffold or direct repeat sequence and a Cas polypeptide or fusion protein to the RNA molecule. In some embodiments, a spacer sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively (partially or substantially) to the target sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96,
97%, 98%, 99%, or any percentage identity in between to the target sequence. In some embodiments, a spacer sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence has 100% identity the target sequence.
In some embodiments of the compositions of the disclosure, a capped-guide RNA or a portion thereof comprises or consists of between 10 and 100 nucleotides, inclusive of the endpoints. In some embodiments, a spacer sequence of the disclosure comprises or consists of between 10 and 30 nucleotides, inclusive of the endpoints. In some embodiments, a spacer sequence of the disclosure comprises or consists of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the spacer sequence of the disclosure comprises or consists of 20 nucleotides. In some embodiments, the spacer sequence of the disclosure comprises or consists of 21 nucleotides. In some embodiments, a scaffold or direct repeat sequence of the disclosure comprises or consists of between 10 and 100 nucleotides, inclusive of the endpoints. In some embodiments, a scaffold or direct repeat sequence of the disclosure comprises or consists of 30, 35, 40, 45, 50, 55, 60, 65, 70, 76, 80, 87, 90, 95, 100, or any number of nucleotides in between. In some embodiments, the scaffold or direct repeat sequence of the disclosure comprises or consists of between 85 and 95 nucleotides, inclusive of the endpoints. In some embodiments, the scaffold or direct repeat sequence of the disclosure comprises or consists of 85 nucleotides. In some embodiments, the scaffold or direct repeat sequence of the disclosure comprises or consists of 90 nucleotides. In some embodiments, the scaffold or direct repeat sequence of the disclosure comprises or consists of 93 nucleotides.
In some embodiments of the compositions of the disclosure, a capped-guide RNA or a portion thereof does not comprise a nuclear localization sequence (NLS).
In some embodiments of the compositions of the disclosure, a capped-guide RNA, or a portion thereof does not comprise a sequence complementary to a protospacer adjacent motif (PAM).
In some embodiments, therapeutic or pharmaceutical compositions of the disclosure do not include a PAMmer oligonucleotide. In other embodiments, optionally, non-therapeutic or non-pharmaceutical compositions may include a PAMmer oligonucleotide. In some
embodiments of the compositions of the disclosure, a guide RNA or a portion thereof includes a sequence complementary to a protospacer flanking sequence (PFS). In some embodiments, including those wherein a guide RNA or a portion thereof includes a sequence complementary to a PFS, the RNA binding protein may include a sequence isolated or derived from a Cas protein, such as, without limitation, a Cas9, Casl3b, or Casl3d protein. In some embodiments, including those wherein a guide RNA or a portion thereof includes a sequence complementary to a PFS, the RNA binding protein may include a sequence encoding a Cas protein, such as, without limitation, a Cas9, Cas 13b, or Casl3d protein, or an RNA-binding portion thereof In some embodiments, the guide RNA or a portion thereof does not comprise a sequence complementary to a PFS.
Target RNA
The“target sequence” can be a stretch of nucleic acid sequences or a sequence motif present in an RNA molecule (e.g., mRNA) of interest to which a spacer sequence of the capped-sgRNA hybridizes, provided sufficient conditions for hybridization exist.
Hybridization between the spacer and the target sequence is, for example, based on Watson- Crick base pairing rules, which enables programmability of the spacer sequence.
In one embodiment, the mRNA including the target sequence additionally includes one or more start codons and/or an endogenous m7G cap. In another embodiment, the target sequence is located downstream of an endogenous m7G cap, with its 5’ end located either upstream or downstream of a desired start codon. Any start codon in the target mRNA can be selected as the desired start codon. Upon hybridization between the spacer sequence of the capped-sgRNA and the target sequence, the m7G cap of the capped-sgRNA can be recruited to the vicinity of the desired start codon, and closer in proximity to the desired start codon than the endogenous m7G cap of the mRNA. In one embodiment, the m7G cap of the bound capped-sgRNA recruits translation initiation factors (e g., EIF4E) and initiates protein translation from the desired start codon. In another embodiment, recruitment of the translation initiation factors occurs subsequent to the binding of the m7G cap of the capped- sgRNA. Without wishing to be bound by theory, the recruitment of an m7G cap via a capped- sgRNA to the vicinity of a desired start codon in a transcript allows for enhanced protein translation, as compared to protein translation initiated by the endogenous m7G cap of the transcript.
In one embodiment, the target sequence includes the desired start codon of the target mRNA. For example, the 5’ end of the target sequence can be upstream of the desired start
codon and the 3’ end of the target sequence can be downstream of the desired start codon. In one embodiment, the 5’ end of the target sequence is located between 1 and 50 nucleotides (e.g., about 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 nucleotides) upstream of the first nucleotide of the desired start codon (e.g., an“A”). In another embodiment, the 5’ end of the target sequence is located between 1 and 50 nucleotides (e.g., about 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32,
31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6,
5, 4, 3, or 2 nucleotides) downstream of the last nucleotide of the desired start codon. In some embodiments, the target sequence does not overlap with the desired start codon. The location ranges of the target sequence between about 1 and 50 nucleotides upstream or downstream of the desired start codon accounts for the differing structural properties of the various Cas proteins capable of being used with the capped-sgRNAs disclosed herein. In another embodiment, the target sequence is not required to be located between 1 and 50 nucleotides upstream or downstream from a desired start codon, rather the target sequence is located anywhere on the transcript. This is particularly relevant if the 5’UTR is large.
Direct Repeat/ Scaffold
The capped-sgRNA disclosed herein includes both a“spacer sequence” and a“direct repeat” (or“DR” or“direct repeat sequence” or“DR sequence”). In one embodiment, DR is comprised within a scaffold sequence which is capable of binding to a corresponding (or cognate) Cas polypeptide. In another embodiment, a DR is capable of binding to a corresponding (or cognate) Cas polypeptide. A direct repeat sequence disclosed herein is a repetitive sequence found within a CRISPR locus (naturally -occurring in a bacterial genome or plasmid). It is well known that one would be able to infer the DR sequence of a corresponding Cas protein if the sequence of the associated CRISPR locus is know n.
Generally, a DR is a nucleic acid sequence that consists of two or more repeats of a specific sequence, i.e., nucleotide sequences present in multiple copies in the genome. A DR sequence may or may not have intervening nucleotides. In one embodiment, a DR sequence disclosed herein includes about 10 to about 100 nucleotides (e.g. about 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, or 98 nucleotides). In another embodiment, the DR sequence is orientated either 5’ or 3’ to a spacer within the sgRNA. In one embodiment,
the direct repeat sequence is located 5’ to the spacer. In another embodiment, the DR sequence is located 3’ to the spacer.
Exemplar}' DR sequences for the capped-sgRNAs disclosed herein are shown below.
Exemplary direct repeat sequences for Casl3a are SEQ ID Nos 284-298.
An exemplary Casl3b direct repeat sequence is:
GTTGTGGAAGGTCCAGTTTTGAGGGGCTATTACAAC (SEQ ID NO: 299)
An exemplary Casl3d (contig e-k87_l 1092736) Direct Repeat Sequence is:
GTGAGAAGTCTCCTTATGGGGAGATGCTAC (SEQ ID NO: 300)
An exemplary Casl3d (160582958 _gene49834) Direct Repeat Sequence is:
GAACTACACCCCTCTGTTCTTGTAGGGGTCTAACAC (SEQ ID NO: 301) Additional exemplary Casl3d Direct Repeat sequences are:
C ACC CGT GC A AAATT GC AGGGGT CT AAAAC (SEQ ID NO: 302)
GACCAACACCTCTGCAAAACTGCAGGGGTCTAAAAC (SEQ ID NO: 303)
AACCCCTACCAACTGGTCGGGGTTTGAAAC (SEQ ID NO: 304)
An exemplary scaffold sequence for Cas9 is:
TTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCC GTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 305)
Scaffold/DR sequences of the disclosure bind the CRISPR Cas RNA-binding protein of the disclosure. Scaffold/DR sequences of the disclosure may include a trans acting RNA (tracrRNA). Upon binding to a target sequence of an RNA molecule, the scaffold/DR sequence guides a fusion protein to the RNA molecule. In some embodiments, a scaffold/ DR sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively (partially or substantially) to the target sequence has at least 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 96, 97%, 98%, 99%, or any percentage identity in between to the target sequence. In some embodiments, a scaffold/ DR sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence has 100% identity the target sequence. In some embodiments, scaffold/DR sequences of the disclosure comprise a secondary structure or a tertiary structure. Exemplary secondary structures include, but are not limited to, a helix, a stem loop, a bulge, a tetraloop and a pseudo not. Exemplary tertiary structures include, but are not limited to, an A-form of a helix, a B-form of a helix, and a Z-form of a helix. Exemplary tertiary structures include, but are not limited to, a twisted or helicized stem loop. Exemplary tertiary structures include, but are not limited to, a twisted or helicized pseudoknot. In some embodiments, scaffold/DR sequences of the disclosure comprise at least one secondary structure or at least one tertiary structure. In some embodiments, scaffold/ DR sequences of the disclosure include one or more secondary structure(s) or one or more tertiary structure(s).
Linker
The capped-sgRNA disclosed herein can include a“linker” or“linker sequence” between the m7G cap or analog thereof and the spacer and/or DR sequences. In one embodiment, the linker sequence includes about 5 to about 25 nucleotides (e.g., about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides). In another embodiment, the linker sequence is non-complementary to any sequence within the RNA molecule comprising the target sequence. Exemplary sequences for such a linker include, without limitation: GTCAGATCG (SEQ ID NO: 306), GTCAGATCGCCT(SEQ ID NO: 307), GTCAGATCGCCTGGA(SEQ ID NO: 308), and GTCAGATCGCCTGGAATT(SEQ ID NO: 309). Any suitable linker sequences known in the art are also contemplated herein. In some embodiments, the linker sequence is modified to adjust the editing window.
RNase P processing site
Some embodiments provide a nucleic acid encoding the capped-sgRNA described herein, where an unprocessed capped-sgRNA is first generated upon transcription of the nucleic acid. In one embodiment, an unprocessed capped-sgRNA includes an RNase P processing site, which is downstream of the spacer and/or direct repeat and upstream of a poly-A tail. In this manner, an RNase P binds to the processing site and removes the downstream sequence (e.g., the poly-A tail) to generate a capped-sgRNA disclosed herein. Exemplary RNase P processing sites can be found at Esakova and Krasilnikov, RNA
16: 1725-1747, 2010 (e.g., See Figure 1 of Esakova and Krasilnikov), incorporated herein by reference in its entirety. The RNase P processing site is known to include elements recognizable by RNase P, such as those described in Kirsebom et al. Biochimie 89: 1183— 1194, 2007 and Lai et al. FEBS Lett 584: 287-296, 2010, both of which are incorporated herein by reference in their entirety. For example, the RNase P processing site can include all or a portion of a bacterial (e.g., E. coli) pre-tRNA, 4.5S rRNA precursor, or yeast pre-rRNA that includes an RNase cleavage site. Structures that resemble tmRNA, operon mRNAs, phage RNAs, OLE RNA from extremophilic bacteria are also contemplated herein as RNase P processing sites. All or a portion of a viral non-tRNA such as TYMV RNA are also useful as RNase P processing sites. In some embodiments, an RNase P processing site includes a tRNA-like small RNA (e.g., GenBank Accession No. FJ209302).
An exemplary structure of an unprocessed capped-sgRNA is shown in FIG. IB. In this embodiment, the unprocessed capped-sgRNA includes from 5’ to 3’: an m7G cap, a linker, a spacer, a direct repeat, an RNase P processing site, and a poly-A tail. In another embodiment, the RNase P processing site and poly-A tail is removed upon RNase P processing, thereby generating the capped-sgRNA with the structure of FIG. 1C, wherein a is a guanosine or adenine, b’ is a spacer sequence and c’ is a direct repeat sequence.
III. CRISPR/Cas Polypeptides
The capped-sgRNAs disclosed herein are capable of binding with their cognate or corresponding RNA-binding CRISPR/Cas polypeptides (e.g., via a direct repeat sequence in the capped-sgRNA). In one embodiment, the capped-sgRNA includes a spacer sequence that confers target specificity to the Cas/sgRNA complex. CRISPR/Cas polypeptides are well known in the art and any particular Cas polypeptide can be adapted for use in the capped- sgRNA systems disclosed herein. In some embodiments, the Cas polypeptides for use as disclosed herein have altered activity compared to its corresponding wild type Cas polypeptide. In some embodiments, the Cas polypeptides are nuclease-deficient Cas (dCas) polypeptides. Nuclease-deficient Cas polypeptides have altered (e.g., diminished or abolished) nuclease activity without substantially diminished binding affinity to the sgRNA. These Cas polypeptides are useful, for example, in mediating the direct association between the capped-sgRNA and the target mRNA, and in protecting the 3’ end of the capped-sgRNA from degradation. In some embodiments, the dCas for use with the capped-sgRNA disclosed herein is devoid of cleavage activity that is applicable to the target RNA. In some
embodiments, the dCas polypeptide for use with the capped-sgRNA disclosed herein retains cleavage activity that is applicable to the capped-sgRNA. In some embodiments, the dCasl3 comprises an inactivated target cleavage domain and a retained or partially retained (i.e., activated or partially activated) guide cleavage domain.
In one embodiment, the Cas polypeptide is Casl3b. In another embodiment, the Cas polypeptide is dead or nuclease deficient Cas 13b (dCasl3b). In another embodiment, the dCasl3b comprises an inactivated target cleavage domain and a retained (i.e., activated) guide cleavage domain as exemplified in Figures IB and ID. In one embodiment, the Cas polypeptide disclosed herein is a Type II CRISPR Cas protein. In some embodiments, the Type II CRISPR Cas protein includes a Cas9 protein. Exemplary Cas9 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, bacteria or archaea. Exemplary Cas9 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Streptococcus pyogenes , Haloferax mediteranii , Mycobacterium tuberculosis , Francisella tularensis subsp. novicida , Pasteurella multocida , Neisseria meningitidis , Campylobacter jejune , Streptococcus thermophilus , Campylobacter lari CF89-12, Mycoplasma gallisepticum str. F, Nitratifractor salsuginis str. DSM 16511, Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria cinerea, a
Gluconacetobacter diazotrophicus, an Azospirillum B510, a Sphaerochaeta globus str.
Buddy, Flavobacterium columnare, Fluviicola taffensis, Bacteroides coprophilus,
Mycoplasma mobile, Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus johnsonii, Staphylococcus pseudintermedius, Filifactor alocis, Treponema denticola, Legionella pneumophila str. Paris, Suttere!la wadsworthensis, Corynebacter diphtherias, Streptococcus aureus, and Francisella novicida.
Some embodiments of the capped-sgRNA compositions or methods disclosed herein provide a Cas9 polypeptide. In certain embodiments, the Cas9 polypeptide lacks part or all of the nuclease domains (e.g., the RuvC and/or HNH domains) of a wild type Cas9 polypeptide, and therefore are nuclease-deficient. These truncated Cas9 polypeptides have a smaller size as compared to a wild type Cas9. The RuvC and HNH nuclease domains can also be inactivated, for example, as a result of point mutations within these domains. For instance, D10A and H840A mutations in Streptococcus pyogenes Cas9 (SpCas9) results in nuclease- deficient SpCas9. An exemplary sequence of a nuclease-deficient SpCas9 is SEQ ID NO:
310. The RuvC domain is distributed among 3 non-contiguous portions of the nuclease- deficient Cas9 primary structure (residues 1-60, 719-775, and 910-1099). The HNH domain is composed of residues 776-909.
Some embodiments provide a Cas polypeptide that is a Cas9 polypeptide that lacks all or a part of (1) an HNH domain, (2) at least one RuvC nuclease domain, (3) a Cas9 polypeptide DNase active site, (4) a bba-metal fold comprising a Cas9 polypeptide active site, or (5) a Cas9 polypeptide that lacks all or part of one or more of the HNH domain, at
least one RuvC nuclease domain, a Cas9 polypeptide DNase active site, and/or a bba-metal fold comprising a Cas9 polypeptide active site as compared to a corresponding wild type Cas9 polypeptide.
The Cas9 polypeptides described herein can be archaeal or bacterial Cas9
polypeptides. Exemplary Cas9 polypeptide include those derived from Haloferax mediteranii, Mycobacterium tuberculosis, Francisella tularensis subsp. novicida, Pasteurella multocida, Neisseria meningitidis, Campylobacter jejune, Streptococcus thermophilus LMD- 9 CRISPR 3, Campylobacter lari CF89-12, Mycoplasma gallisepticum sir. F, Nitratifr actor salsuginis str. DSM 1651 1, Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria cinerea, Gluconacetobacter diazotrophicus, Azospirillum B510, Sphaerochaeta globus str. Buddy, Flavobacterium columnare, Fluviicola taffensis, Bacteroides coprophilus,
Mycoplasma mobile, Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus johnsonii, Staphylococcus pseudintermedius, Filif actor alocis, Treponema denticola, Legionella pneumophila str. Paris, Sutterella wadsworthensis, Corynebacter diphtheriae, Streptococcus aureus , and Francisella novicida.
Any Cas polypeptides with altered nuclease activity as compared to a naturally occurring Cas polypeptide is contemplated herein. Additional types of nuclease-deficient Cas polypeptides are described in e.g., Brezgin et al. Int J Mol Sci 20(23):6041, 2019 and Xu and Lei, J Mol Biol 431 :34-47, 2019, incorporated by reference in its entirety.
Exemplary Cas polypeptide sequences disclosed in the methods for translational enhancement WO2019/204828 are incorporated herein by reference in their entirety and can be used in conjunction with the corresponding capped-sgRNAs disclosed herein.
In some embodiments of the compositions of the disclosure, the CRISPR Cas protein comprises a Type V CRISPR Cas protein. In some embodiments, the Type V CRISPR Cas protein comprises a Cpfl protein. Exemplary Cpfl proteins of the disclosure may be isolated or derived from any species, including but not limited to, bacteria or archaea. Exemplary Cpfl proteins of the disclosure may be isolated or derived from any species, including but not limited to, Francisella tularensis subsp. novicida, Acidaminococcus sp. BV3L6 and
Lachnospiraceae bacterium sp. ND2006. Exemplary Cpfl proteins of the disclosure may be nuclease inactivated.
In some embodiments, the CRISPR Cas protein comprises a Type VI CRISPR Cas protein or portion thereof. In some embodiments, the Type VI CRISPR Cas protein comprises a Casl3 protein or portion thereof. Exemplary Casl3 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, bacteria or
archaea. Exemplary Cas 13 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Leptotrichia wadei, Listeria seeligeri serovar l/2b (strain ATCC 35967 / DSM 20751 / CLP 100100 / SLCC 3954), Lachnospiraceae bacterium, Clostridium aminophilum DSM 10710, Carnobacterium gallinarum DSM 4847, Paludibacter propionicigenes WB4, Listeria weihenstephanensis FSL R9-0317, Listeria
weihenstephanensis FSL R9-0317, bacterium FSL M6-0635 (Listeria newyorkensis), Leptotrichia wadei F0279, Rhodobacter capsulatus SB 1003, Rhodobacter capsulatus R121, Rhodobacter capsulatus DE442 and Corynebacterium ulcer ans. Exemplary Cas 13 proteins of the disclosure may be DNA nuclease inactivated. Exemplary Cas 13 proteins of the disclosure include, but are not limited to, Casl3a, Casl3b, Casl3c, Casl3d, and orthologs thereof. Exemplary Cas 13b proteins of the disclosure include, but are not limited to, subtypes 1 and 2 referred to herein as Csx27 and Csx28, respectively.
In some embodiments of the compositions of the disclosure, the sequence encoding the RNA binding protein comprises a sequence isolated or denved from a Casl3d protein or also called CasRx/Casl3d proteins. CasRX/Casl3d is an effector of the type VI-D CRISPR- Cas systems. In some embodiments, the CasRX/Casl3d protein is an RNA-guided RNA endonuclease enzyme that can cut or bind RNA. In some embodiments, the CasRX/Casl3d protein can include one or more higher eukaryotes and prokaryotes nucleotide-binding (HEPN) domains. In some embodiments, the CasRX/Casl3d protein can include either a wild-type or mutated HEPN domain. In some embodiments, the CasRX/Casl3d protein includes a mutated HEPN domain that cannot cut RNA but can process guide RNA. In some embodiments, the CasRX/Casl3d protein does not require a protospacer flanking sequence. Also see WO Publication No. W02019/040664 & US2019/0062724, which is incorporated herein by reference in its entirety, for further examples and sequences of CasRX/Casl3d protein.
In some instances the Cas polypeptide has a sequence that is at least 80% identical (e.g. at least 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, or 99% identical) to any of the Cas polypeptides (e.g., any of the wild type or nuclease-deficient Cas polypeptides) of the present disclosure.
Nuclease deficient S. pyogenes Cas9 proteins may comprise a substitution of an Alanine (A) for an Aspartic Acid (D) at position 10 and an alanine (A) for a Histidine (H) at position 840. Exemplary nuclease deficient S. pyogenes Cas9 proteins of the disclosure may comprise or consist of the amino acid sequence (D10A and H840A bolded and underlined):
Exemplary wild type Francisella tularensis subsp. Novicida Cpfl (FnCpfl) proteins of the disclosure may comprise or consist of the amino acid sequence:
Exemplary wild type Lachnospiraceae bacterium sp. ND2006 Cpfl (LbCpfl) proteins of the disclosure may comprise or consist of the ammo acid sequence:
Exemplary wild type Acidaminococcus sp. BV3L6 Cpfl (AsCpfl) proteins of the disclosure may comprise or consist of the amino acid sequence:
In some embodiments of the compositions of the disclosure, the sequence encoding the RNA binding protein comprises a sequence isolated or derived from a CRISPR Cas protein or RNA-binding portion thereof. In some embodiments, the CRISPR Cas protein comprises a Type VI CRISPR Cas protein. In some embodiments, the Type VI CRISPR Cas protein comprises a Cas 13 protein. Exemplary Cas 13 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, bacteria or archaea.
Exemplary Cas 13 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Leptotrichia wadei, Listeria seeligeri serovar l/2b (strain ATCC 35967 / DSM 20751 / CIP 100100 / SLCC 3954), Lachnospiraceae bacterium, Clostridium aminophilum DSM 10710, Carnobacterium gallinarum DSM 4847, Paludibacter propionicigenes WB4, Listeria weihenstephanensis FSL R9-0317, Listeria
weihenstephanensis FSL R9-0317, bacterium FSL M6-0635 (Listeria newyorkensis), Leptotrichia wadei F0279, Rhodobacter capsulatus SB 1003, Rhodobacter capsulatus R121, Rhodobacter capsulatus DE442 and Corynebacterium ulcerans. Exemplary Cas 13 proteins of the disclosure may be DNA nuclease inactivated. Exemplary Cas 13 proteins of the disclosure include, but are not limited to, Casl3a, Casl3b, Casl3c, Casl3d, and orthologs thereof. Exemplary Cas 13b proteins of the disclosure include, but are not limited to, subtypes 1 and 2 referred to herein as Csx27 and Csx28, respectively.
Exemplary Casl3a proteins include, but are not limited to:
Exemplary wild type Casl3a proteins of the disclosure may comprise or consist of the amino acid sequence:
Exemplary wild type Bergeyella zoohelcum ATCC 43767 Casl3b (BzCasl3b) proteins of the disclosure may comprise or consist of the ammo acid sequence:
An exemplary nuclease deficient Casl3b (dCasl3b) nucleic acid sequence with C- terminal nuclear export sequence is:
An exemplary nuclease deficient Casl3b (dCasl3b) nucleic acid sequence with stop codon (making it an independent reading frame) is as follows:
Exemplary wild type Casl3d proteins of the disclosure may comprise or consist of the amino acid sequences:
Additional exemplary Casl3d sequences and direct repeat sequences for Casl3d are listed as SEQ ID Nos: 1-277 in the corresponding sequence listing.
IV. Nucleic acids encoding the capped-sgRNA and/or the Cas polypeptide
Some embodiments disclosed herein provide compositions comprising a nucleic acid sequence encoding the capped-sgRNAs described herein, and vectors (e.g., expression vector(s)) comprising the nucleic acid sequences. In some embodiments, nucleic acid sequences encoding the capped-sgRNAs are operably linked to one or more promoters.
Suitable promoters include, without limitation, RNA polymerase II promoters such as, without limitation, CMV, PGK, and EFla promoters. In one embodiment, the RNA polymerase II promoter is an RNA Pol II transcribed non-coding RNA. The sgRNA is transcribed by the RNAase polymerase II, acquires an m7G cap and becomes polyadenylated. Additional promoters suitable for driving expression of the capped-sgRNA are also contemplated, such as, without limitation, bacteriophage promoters (e.g., RNA polymerase T3, T7, and SP6), ubiquitous promoters, tissue-specific promoters, inducible promoters, and constitutive promoters. For example, liver-specific promoters as described in
PCT/US06/00668 are contemplated herein. For example, promoters for genes encoding genes encoding c-jun; jun-b; c-fos; c-myc; serum amyloid A; apolipoprotein B editing catalytic subunit; liver regeneration factors, such as LRF-I; signal transducers; activators of transcription, such as STAT-3; serum alkaline phosphates (SAP); insulin-like growth factor binding proteins, such as IGFBP-I; cyclin Dl; active protein- 1; CCAAT enhancer core binding protein; ornithine decarboxylase; phosphatase of regenerating liver- 1; early growth response gene-1; hepatocyte growth factors; hemopexin; insulin-like growth factors (IGF), such as IGF-I and IGF -2; hepatocyte nuclear family 1; hepatocyte nuclear family 4;
hepatocyte Arg-Ser-rich domain-containing proteins; glucose 6-phosphatase; acute phase proteins, such as semm amyloid A and serum amyloid P (SAA/SAP); steroid hydroxylases; leukotriene hydroxylases; fatty acid hydroxylases; desmolase; peptidyl isomerases; and sterol demethylases.
In one embodiment, vectors comprising the nucleic acids that encode the capped- sgRNA further include a sequence that encodes a Cas polypeptide (e.g., any of the Cas polypeptides described herein, such as, without limitation, a truncated nuclease-deficient Cas protein). The capped-sgRNA and the Cas transcript can be transcribed from the same promoter, or from different promoters. RNA polymerase II promoters (e.g. CMV, PGK, and EF la promoters), for example, are suitable for driving expression of both the sgRNA and the Cas gene. In some embodiments, the Cas transcript is expressed from one promoter, such as a PGK promoter, and the capped-sgRNA is expressed from a different promoter, such as an EFla promoter.
Some embodiments disclosed herein provide nucleic acids encoding the Cas polypeptides and vectors comprising the nucleic acids that encode the Cas polypeptides. Nucleic acids encoding the Cas polypeptides can be operably linked to one or more promoters. Suitable promoters include RNA polymerase II promoters (e.g., CMV, PGK, and EFla promoters), bacteriophage promoters (e.g., RNA polymerase T3, T7, and SP6), ubiquitous promoters, tissue-specific promoters, inducible promoters, and constitutive promoters. The Cas polypeptide can be associated with or include or be in operable linkage with a tag or detectable agent, such as a fluorescent agent, a fluorescent protein, an enzyme.
In some embodiments, a sequence encoding a capped-guide RNA of the disclosure includes a sequence encoding a promoter to drive expression of the guide RNA. In some embodiments, a vector that includes a sequence encoding a capped-guide RNA of the disclosure includes a sequence encoding a promoter to drive expression of the guide RNA. In some embodiments, a promoter driving expression of the guide RNA includes a sequence encoding a constitutive promoter, or an inducible promoter. In some embodiments, a promoter to drive expression of the guide RNA includes a sequence encoding a hybrid or a recombinant promoter. In some embodiments, a promoter to drive expression of the guide RNA is a promoter capable of expressing the guide RNA in a mammalian cell or a human cell. In some embodiments, a promoter to drive expression of the guide RNA is a promoter capable of expressing the guide RNA and restricting the guide RNA to the nucleus of the cell. In some embodiments, a promoter to drive expression of the guide is a human RNA polymerase promoter or a sequence isolated or derived from a human RNA polymerase promoter. In some embodiments, a promoter to drive expression of the guide RNA is a U6 promoter or a sequence isolated or derived from a U6 promoter. In some embodiments, a promoter to drive expression of the guide RNA is a human tRNA promoter or a sequence isolated or derived from a human tRNA promoter. In some embodiments, a promoter to drive
expression of the guide RNA is a human valine tRNA promoter or a sequence isolated or derived from a human valine tRNA promoter.
In some embodiments of the compositions of the disclosure, a promoter to drive expression of the capped-guide RNA further includes a regulatory element. In some embodiments, a vector that includes promoter to drive expression of the guide RNA further includes a regulatory element. In some embodiments, a regulatory element enhances expression of the guide RNA. Exemplary regulatory elements include, but are not limited to, an enhancer element, an intron, an exon, or a combination thereof.
In some embodiments, the nucleic acid sequences encoding the Cas polypeptides are linked to one or more localization signals. Localization signals are amino acid sequences on a protein that tags the protein for transportation to a particular location in a cell. An exemplary localization signal is a nuclear localization signal (NLS), which is an amino acid sequence that tags a protein for import into the cell nucleus by nuclear transport. In one embodiment, one or more localization signals is/are operably linked to the sequence encoding a Cas polypeptide. In some embodiments, the localization signal is a nuclear localization signal (NLS). An exemplary NLS is SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 477)) and nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 478)). Other NLSs are known in the art; see, e.g., Konermann et al., Cell 173:665-676, 2018; Cokol et ah, EMBO Rep. 1(5):411—415 (2000); Freitas and Cunha, Curr Genomics 10(8): 550-557 (2009), incorporated herein by reference in their entirety. Without limitation, additional NLSs are those that have K(K/R)X(K/R) as a putative consensus sequence (e.g., PAAKRVKLD (SEQ ID NO: 479)). Other additional NLSs include KRSWSMAF (SEQ ID NO: 480) and KRKYF (SEQ ID NO: 481). In some embodiments, vectors comprising the nucleic acids that encode the Cas polypeptide further encode a capped-sgRNA (e.g., any of the capped-sgRNAs described herein). In some embodiments, the localization signal is a nuclear export signal (NES). Incorporating an NES is particularly suited for altering molecular machinery in the cytoplasm. In one embodiment, an NES is the HIV -REV NES or the PKI NES.
In other embodiments, the nucleic acids encoding the capped-sgRNA and/or the Cas polypeptide can be further operably linked to a sequence that encodes one or more reporter genes, or effector genes such as, without limitation, endonucleases that have nuclease activity. In one embodiment, a nucleic acid sequence encodes a capped-sgRNA disclosed herein and a fusion protein that includes a dCas polypeptide and an endonuclease. Any suitable reporter genes are contemplated, including but not limited to, fluorescent reporters.
In addition, any suitable endonucleases are contemplated for fusing with a Cas polypeptide, in particular a dCas polypeptide.
V. Vectors
Vectors contemplated for the present disclosure can include those that are suitable for expression in a selected host, whether prokaryotic or eukaryotic, for example, phage, plasmid, and viral vectors. Viral vectors may be either replication competent or replication defective retroviral vectors. Viral propagation generally will occur only in complementing host cells comprising replication defective vectors, for example, when using replication defective retroviral vectors in methods provided herein viral replication will not occur.
Vectors may comprise kozak sequences (Lodish et al., Molecular Cell Biology, 4th ed., 1999) and may also contain the ATG start codon. Promoters that function in a eukaryotic host are from, without limitation, SV40, LTR, CMV, EF- 1 a, white cloud mountain minnow b-actin.
In some embodiments of the compositions of the disclosure, a vector of the disclosure includes one or more of a sequence encoding at least one capped-guide RNA of the disclosure, one or more promoters to drive expression of the one or more guide RNAs and a sequence encoding a regulatory element. In some embodiments of the compositions of the disclosure, the vector further includes a sequence encoding a Cas polypeptide, a dCas polypeptide or a dCas-fusion protein.
Copy number and positional effects are considered in designing transiently and stably expressed vectors. Copy number can be increased by, for example, dihydrofolate reductase amplification. Positional effects can be optimized by, for example, Chinese hamster elongation factor- 1 vector pDEF38 (CHEF1), ubiquitous chromatin opening elements (UCOE), scaffold/matrix-attached region of human (S/MAR), and artificial chromosome expression (ACE) vectors, as well as by using site-specific integration methods known in the art. The expression constructs containing the vector can further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constructs can include a translation initiating codon at the beginning and a termination codon (UAA, UGA, or UAG) appropriately positioned at the end of the polypeptide to be translated.
Considering the above-mentioned factors, exemplary vectors suitable for expressing Cas polypeptides and/or sgRNAs in bacteria include Piggy Bac transposon vectors, pTT vectors (e.g., from Biotechnology Research Institute (Montreal, Canada)), pQE70, pQE60,
and pQE-9 (e.g. those available from Qiagen (Mississauga, Ontario, Canada)); vectors derived from pcDNA3, available from Invitrogen (Carlsbad, CA); pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH6a, pNH18A, pNH46A, available from Stratagene (La Jolla, CA); and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from
Pharmacia (Peapack, NJ). Among suitable eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl, and pSG available from Stratagene (La Jolla, CA); and pSVK3, pBPV, pMSG and pSVL, available from Pharmacia (Peapack, NJ).
A pTT vector backbone can be used for expressing the Cas polypeptide and/or sgRNA (Durocher et a , Nucl. Acids Res. 30:E9 (2002)). Briefly, the backbone of a pTT vector may be prepared by obtaining pIRESpuro/EGFP (pEGFP) and pSEAP basic vector(s), for example from Clontech (Palo Alto, CA), and pcDNA3.1 , pCDNA3.1 /Myc-(His)6 and pCEP4 vectors can be obtained from, for example, Invitrogen (Carlsbad, CA). As used herein, the pTT5 backbone vector can generate a pTT5 -Gateway vector and be used to transiently express proteins in mammalian cells. The pTT5 vector can be derivatized to pTT5-A, pTT5-B, pTT5-D, pTT5-E, pTT5-H, and pTT5-I, for example. As used herein, the pTT2 vector can generate constructs for stable expression in mammalian cell lines.
A pTT vector can be prepared by deleting the hygromycin (Bsml and Sail excision followed by fill-in and ligation) and EBNA1 (Clal and Nsil excision followed by fill-in and ligation) expression cassettes. The ColEI origin (Fspl-Sall fragment, including the 3' end of the b-lactamase open reading frame (ORF) can be replaced with a Fspl-Sall fragment from pcDNA3.1 containing the pMBI origin (and the same 3' end of b-lactamase ORF). A Myc- (His)6 C-terminal fusion tag can be added to SEAP (Hindlll-Hpal fragment from pSEAP- basic) following in-frame ligation in pcDNA3.1 /Myc-His digested with Hindlll and EcoPvV. Plasmids can subsequently be amplified in E. coli (DH5a) grown in LB medium and purified using MAXI prep columns (Qiagen, Mississauga, Ontario, Canada). To quantify, plasmids can be subsequently diluted in, for example, 50 mM Tris-HCl pH 7.4 and absorbencies can be measured at 260 nm and 280 nm. Plasmid preparations with A260/A280 ratios between about 1 .75 and about 2.00 are suitable for producing the Fc-fusion constructs.
The expression vector pTT5 allows for extrachromosomal replication of the cDNA driven by a cytomegalovirus (CMV) promoter. The plasmid vector pCDNA- pDEST40 is a Gateway -adapted vector which can utilize a CMV promoter for high-level expression.
SuperGlo GFP variant (sgGFP) can be obtained from Q-Biogene (Carlsbad, CA). Preparing a pCEP5 vector can be accomplished by removing the CMV promoter and polyadenylation signal of pCEP4 by sequential digestion and self-ligation using Sail and Xbal enzymes
resulting in plasmid pCEP4A. A Gblll fragment from pAdCMV5 (Massie et al, J. Virol. 72:2289-2296 (1998)), encoding the CMV5-poly(A) expression cassette ligated in Bglll- linearized pCEP4A, resulting in the pCEP5 vector.
Additional vectors include optimized for use in CHO-S or CHO-S-derived cells, such as pDEF38 (CHEF 1) and similar vectors (Running Deer et al., Biotechnol. Prog. 20:880-889 (2004)). The CHEF vectors contain DNA elements that lead to high and sustained expression in CHO cells and derivatives thereof. They may include, but are not limited to, elements that prevent the transcriptional silencing of transgenes.
Vectors may include a selectable marker for propagation in a host. A selectable marker can allow the selection of transformed cells based on their ability to thrive in the presence or absence of a chemical or other agent that inhibits an essential cell function. Selectable markers confer a phenotype on a cell expressing the marker, so that the cell can be identified under appropriate conditions. Suitable markers include genes coding for proteins which confer drug resistance or sensitivity thereto, impart color to, or change the antigenic characteristics of those cells transfected with a molecule encoding the selectable marker, when the cells are grown in an appropriate selective medium.
Suitable selectable markers include dihydro folate reductase or G41 8 for neomycin resistance in eukaryotic cell culture; and tetracycline, kanamycin, or ampicillin resistance genes for culturing in E. coli and other bacteria. Suitable selectable markers also include cytotoxic markers and drug resistance markers, whereby cells are selected by their ability to grow on media containing one or more of the cytotoxins or drugs; auxotrophic markers, by which cells are selected for their ability to grow on defined media with or without particular nutrients or supplements, such as thymidine and hypoxanthine; metabolic markers for which cells are selected, for example, for ability to grow on defined media containing a defined substance, for example, an appropriate sugar as the sole carbon source; and markers which confer the ability of cells to form colored colonies on chromogenic substrates or cause cells to fluoresce.
Retroviral vectors are contemplated herein. One such vector, the ROSA geo retroviral vector, which maps to mouse chromosome six, was constructed with the reporter gene in reverse orientation with respect to retroviral transcription, downstream of a splice acceptor sequence (U.S. Patent No. 6,461,864; Zambrowicz et al., Proc. Natl. Acad. Sci. 94:3789-3794 (1997)). Infecting embryonic stem (ES) cells with ROSA geo retroviral vector resulted in the ROSA geo26 (ROSA26) mouse strain by random retroviral gene trapping in the ES cells.
Adeno-associated viral vectors (AAV vectors) are contemplated herein. The term“adeno-associated virus” or“AAV” as used herein can refer to a member of the class of viruses associated with this name and belonging to the genus dependoparvovirus, family Parvoviridae. Multiple serotypes of this virus are known to be suitable for gene deliver ' ; all known serotypes can infect cells from various tissue types. At least 11 or 12, sequentially numbered, are disclosed in the prior art. Non-limiting exemplary serotypes useful in the methods disclosed herein include any of the 11 or 12 serotypes, e.g., AAV2, AAV5, and AAV8, or variant serotypes e.g. AAV-DJ. The AAV structural particle is composed of 60 protein molecules made up of VP1, VP2, and VP3. Each particle contains approximately 5 VP1 proteins, 5 VP2 proteins and 50 VP3 proteins ordered into an icosahedral structure.
AAV is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review, see Muzyczka et al, Curr. Topics in Micro and Immunol.158:97-129 (1992)). AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo. AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther. 2009 Aug; 11(4): 442-447; Asokan et al., Mol Ther. 2012 April; 20(4): 699-708. AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. For example, AAV2, AAV5, AAV2/5, AAV2/8 and AAV2/7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al, Vision Research 2008, 48(3):377-385; Khani et al, Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3954-61; Allocca et al, J. Virol.
2007 81(20): 11372-11380). In some embodiments, the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in PCT/US2014/060163; for example, a virus particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT/US2014/060163, and a Cas sequence and capped-guide RNA sequence as described herein. In some embodiments, the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44. In some embodiments, the AAV incorporates inverted terminal repeats (ITRs) derived from the AAV2 serotype. Exemplary left and right ITRs are presented in Table 6 of WO 2018/026976 and are listed below:
It should be noted, however, that numerous modified versions of the AAV2 ITRs are used in the field, and the ITR sequences shown below are exemplary and are not intended to be limiting. Modifications of these sequences are known in the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure. Expression of the Cas polypeptide and/or sgRNA in the AAV vector can be driven by a promoter described herein or known in the art. In some embodiments, AAV vectors capable of delivering ~4.5kb are used for packaging of the nucleic acids encoding capped-sgRNAs or Cas polypeptides. In some embodiments, AAVs capable of packaging larger transgenes such as about 4.6kb, 4.7kb, 4.8kb, 4.9kb, 5.0kb, 5. lkb, 5.2kb, 5.3kb, 5.4kb, 5.5kb, 5.6kb, 5.7kb, 5.8kb, 5.9kb,
6.0kb, 6. lkb, 6.2kb, 6.3kb, 6.4kb, 6.5kb, 6.6kb, 6.7kb, 6.8kb, 6.9kb, 7.0kb, 7.5kb, 8.0kb, 9.0kb, lO.Okb, ll.Okb, 12.0kb, 13.0kb, 14.0kb, 15.0kb, or larger are used.
A DNA insert comprising nucleic acids (optionally contained in a vector or vectors) encoding Cas9 polypeptides or sgRNAs can be operatively linked to an appropriate promoter, such as the phage lambda PL promoter; the E. coli lac, trp, phoA, and tac promoters; the SV40 early and late promoters; and promoters of retroviral LTRs. Suitable vectors and promoters also include the pCMV vector with an enhancer, pcDNA3.1 ; the pCMV vector with an enhancer and an intron, pCIneo; the pCMV vector with an enhancer, an intron, and a tripartate leader, pTT2, and CHEF1. The promoter sequences include at least the minimum number of bases or elements necessary to initiate transcription of a gene of interest at levels detectable above background. Within the promoter sequence may be a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. In alternative embodiments, eukaryotic promoters will often, but not always, contain“TATA” boxes and“CAT” boxes.
The expression constmcts can further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding
portion of the transcripts expressed by the constructs can include a translation initiating codon at the beginning and a termination codon (UAA. LJGA. or UAG) appropriately positioned at the end of the polypeptide to be translated.
In some embodiments of the compositions and methods of the disclosure, the vector is or comprises an“RNA targeting system” comprising (a) nucleic acid sequence encoding an Cas polypeptide or dCas polypeptide or dCas polypeptide fusion protein; and (b) a capped- single guide RNA (capped-sgRNA) sequence comprising: an RNA sequence (or spacer sequence) that hybridizes to or binds to a target RNA sequence and an RNA sequence (direct repeat or scaffold sequence) capable of binding to or associating with the Cas polypeptide and wherein the RNA targeting system recognizes the target RNA and enhances translation of the target RNA. In some embodiments, the nucleic acid sequence or vector is a single vector.
VI. Cells
Some embodiments disclosed herein provide cells comprising the nucleic acid or nucleic acids (e.g., vector or vectors) that encode Cas9 polypeptides or capped-sgRNAs. In some embodiments, the cells transfected may be a prokaryotic cell, a eukaryotic cell, a yeast cell, an insect cell, an animal cell, a mammalian cell, a human cell, etc. The proteins expressed in mammalian cells have been glycosylated properly. Examples of useful mammalian host cell lines are HEK293, CHO, sp2/0, NSO, COS, BHK, and PerC6.
In some embodiments, the target mRNA is in a cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a prokary otic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a bovine, murine, feline, equine, porcine, canine, simian, or human cell. In some embodiments, the cell is a plant cell. In some embodiments, the cell is in a subject or patient. In some embodiments, the cell is in vivo, in vitro, ex vivo , or in situ. In some embodiments, the composition comprises a vector comprising composition comprising the capped-guide RNA of the disclosure and/or a Cas polypeptide or dCas polypeptide. In some embodiments, the vector is a viral vector for transducing a cell. In some embodiments, the viral vector is an AAV vector.
Transfection of animal cells typically involves opening transient pores or“holes” in the cell membrane, to allow the uptake of material. There are various methods of introducing foreign DNA into a eukaryotic cell. Transfection can be carried out using calcium phosphate, by electroporation, or by mixing a cationic lipid with the material to produce liposomes,
which fuse with the cell membrane and deposit their cargo inside. Many materials have been used as carriers for transfection, which can be divided into three kinds: (cationic) polymers, liposomes, and nanoparticles.
VII. Methods of modulating protein translation
Some embodiments disclosed herein provide compositions for and methods of enhancing protein translation in a cell, comprising introducing capped-sgRNAs (e.g., any of the capped-sgRNAs described herein) and Cas polypeptides (e.g., any of the Cas
polypeptides described herein) into the cell. The methods of enhancing protein translation can include introducing or administering a nucleic acid or nucleic acids (e.g., vector or vectors) encoding the capped-sgRNA and the Cas polypeptides into a cell. In some embodiments, provided herein are methods of regulating translation of an mRNA in a cell that include contacting the cell with a nucleic acid comprising (a) a sequence encoding a Cas polypeptide; and (b) a sequence encoding a capped-sgRNA comprising (i) an m7G cap; (ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and (iii) a direct repeat capable of binding to the Cas polypeptide.
Methods of measuring levels of protein translation are known in the art. Exemplary methods include, without limitation, western blot, mass spectrometry, antibody staining, and mean fluorescence intensity flow cytometry. In instances where a reporter construct is linked to the target mRNA, protein translation can also be measured based on the levels of the reporter molecule.
In some embodiments, enhancing translation or increasing or upregulating gene expression refers to an increase in the amount of peptide translated from the target mRNA as compared to a control. In some embodiments, the control includes a level of peptide translated from the target mRNA in the absence of the capped-sgRNA compositions and methods. In some embodiments, the control includes the level of the peptide translated from the target mRNA prior to addition of the compositions disclosed herein. In some
embodiments, translation is increased about 1.1 fold, about 1.2 fold, about 1.3 fold, about 1.4 fold, about 1.5 fold, about 1.6 fold, about 1.7 fold, about 1.8 fold, about 1.9 fold, about 2 fold, about 2.5 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 1000 fold, or about 10,000 fold relative to the control. The amount of peptide translated can be determined by any method known in the art.
Gene Therapy/ Therapeutic Targets
In certain embodiments, methods of modulating protein translation are useful for treating patients afflicted with a disease or disorder. In one embodiment, methods of using the capped-sgRNA compositions disclosed herein are haploinsufficiencies. Exemplary haploinsufficiency diseases or disorders include, without limitation, Autosomal dominant Retinitis Pigmentosa (RP11) caused by mutations in PRPF31, Autosomal dominant Retinitis Pigmentosa (RP31) caused by mutations in TOPORS, Frontotemporal dementia caused by mutations in GRN, DeVivo Syndrome (Glutl deficiency) caused by mutations in SLC2A1, Dravet syndrome caused by mutations in SCN1A, 1 q21.1 Deletion Syndrome, 5q-Syndrome in Myelodysplastic Syndrome (MDS), 22ql 1.2 Deletion Syndrome, CHARGE Syndrome, Cleidocrainial Dysostosis, Ehlers-Danlos Syndrome, Frontotemporal Dementia caused by mutations in Progranulin, Haploinsufficiency of A20, Holoprosencephaly (caused by haploinsufficiency in the Sonic Hedgehog gene), Holt-Oram Syndrome, Marfan Syndrome, Dyskeratosis Congenita, and Phelan-McDermid Syndrome.
In another embodiment, methods of using the capped-sgRNA compositions disclosed herein for treating haploinsufficiency diseases or disorders, such as, without limitation, those listed in the preceding paragraph, involving mutations which lead to introduction of a premature termination codon (PTC) resulting in degradation from mutant allele or loss of function of the protein (or less protein to be produced) are contemplated herein.
In another embodiment, methods of translation enhancement using the capped-sgRNA compositions disclosed herein are useful for treating cancer. In one embodiment, the methods can be used for upregulating protein expression of tumor suppressor genes (TSG) in tissue predisposed to cancer due to hereditary (or acquired) mutations of TSG. In another embodiment, the methods can be used for upregulating protein expression from genes that would prevent cancer from metastasizing (ie angiogenesis genes). In another embodiment, the methods can be used for upregulating protein expression from genes that would result in the cancer being more susceptible to follow-up treatments. In another embodiment, the methods can be used for translational enhancement to prevent cancer evasion of the immune system.
As used herein, the“administration” of the compositions disclosed herein (e.g., a fusion RNA, viral particle, vector, polynucleotide, cell, population of cells, or pharmaceutical composition or formulation) to a subject includes any route of introducing or delivering to a subject the agent to perform its intended function. Administration can be carried out by any
suitable route, including orally, intranasally, intraocularly, ophthalmically, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), or topically.
Administration includes self-administration and the administration by another.
In some aspects, the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a capped-sgRNA composition(s) of the disclosure. Also provided herein are methods for treating a disease or condition in a subject in need thereof, the methods comprising, consisting of, or consisting essentially of administering a nucleic acid sequence comprising/encoding (a) a capped- sgRNA disclosed herein; and (b) a dCas polypeptide, a vector comprising the nucleic acid sequence, or a viral particle comprising the vector to the subject, thereby enhancing translation of a target mRNA in the subject or patient. In some embodiments, the target mRNA is involved in the etiology of a disease or condition in the subject.
In some embodiments of the methods described herein, the subject or patient is an animal. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a bovine, equine, porcine, canine, feline, simian, murine, or human. In some embodiments, the subject is a human.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, a genetic disease or disorder. In some embodiments, the genetic disease or disorder is a single-gene disease or disorder. In some embodiments, the single-gene disease or disorder is an autosomal dominant disease or disorder, an autosomal recessive disease or disorder, an X-chromosome linked (X-linked) disease or disorder, an X-linked dominant disease or disorder, an X-linked recessive disease or disorder, a Y -linked disease or disorder or a mitochondrial disease or disorder. In some embodiments, the genetic disease or disorder is a multiple-gene disease or disorder. In some embodiments, the genetic disease or disorder is a multiple-gene disease or disorder. In some embodiments, the single-gene disease or disorder is an autosomal dominant disease or disorder including, but not limited to, Huntington's disease, neurofibromatosis type 1, neurofibromatosis type 2, Marfan syndrome, hereditary nonpolyposis colorectal cancer, hereditary multiple exostoses, Von Willebrand disease, and acute intermittent porphyria. In some embodiments, the single-gene disease or disorder is an autosomal recessive disease or disorder including, but not limited to, Albinism, Medium-chain acyl-CoA dehydrogenase deficiency, cystic fibrosis, sickle-cell disease, Tay-Sachs disease, Niemann-Pick disease, spinal muscular atrophy, and Roberts syndrome. In some embodiments, the single-gene disease or disorder is X-linked disease or disorder including, but not limited to, muscular
dystrophy, Duchenne muscular dystrophy, Hemophilia, Adrenoleukodystrophy (ALD), Rett syndrome, and Hemophilia A. In some embodiments, the single-gene disease or disorder is a mitochondrial disorder including, but not limited to, Leber’s hereditary optic neuropathy.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, an immune disease or disorder. In some embodiments, the immune disease or disorder is an immunodeficiency disease or disorder including, but not limited to, B-cell deficiency, T-cell deficiency, neutropenia, asplenia, complement deficiency, acquired immunodeficiency syndrome (AIDS) and immunodeficiency due to medical intervention (immunosuppression as an intended or adverse effect of a medical therapy). In some embodiments, the immune disease or disorder is an autoimmune disease or disorder including, but not limited to, Achalasia, Addison’s disease, Adult Still's disease, Agammaglobulinemia, Alopecia areata, Amyloidosis, Anti- GBM/Anti-TBM nephritis, Antiphospholipid syndrome, Autoimmune angioedema, Autoimmune dysautonomia, Autoimmune encephalomyelitis, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune urticaria, Axonal & neuronal neuropathy (AMAN), Balo disease, Behcet’s disease, Benign mucosal pemphigoid, Bullous pemphigoid, Castleman disease (CD), Celiac disease, Chagas disease, Chronic inflammatory demyelinating polyneuropathy (CIDP), Chronic recurrent multifocal osteomyelitis (CRMO), Churg-Strauss Syndrome (CSS) or Eosinophilic
Granulomatosis (EGPA), Cicatricial pemphigoid, Cogan’s syndrome, Cold agglutinin disease, Congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn’s disease, Dermatitis herpetiformis, Dermatomyositis, Devic’s disease (neuromyelitis optica), Discoid lupus, Dressier’ s syndrome, Endometriosis, Eosinophilic esophagitis (EoE), Eosinophilic fasciitis, Erythema nodosum, Essential mixed cryoglobulinemia, Evans syndrome,
Fibromyalgia, Fibrosing alveolitis, Giant cell arteritis (temporal arteritis), Giant cell myocarditis, Glomerulonephritis, Goodpasture’s syndrome, Granulomatosis with
Polyangiitis, Graves’ disease, Guillain-Barre syndrome, Hashimoto’s thyroiditis, Hemolytic anemia, Henoch-Schonlein purpura (HSP), Herpes gestationis or pemphigoid gestationis (PG), Hidradenitis Suppurativa (HS) (Acne Inversa), Hypogammalglobulinemia, IgA Nephropathy, IgG4-related sclerosing disease, Immune thrombocytopenic purpura (ITP), Inclusion body myositis (IBM), Interstitial cystitis (IC), Juvenile arthritis, Juvenile diabetes (Type 1 diabetes), Juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, Leukocytoclastic vasculitis, Lichen planus, Lichen sclerosus, Ligneous conjunctivitis, Linear
IgA disease (LAD), Lupus, Lyme disease chronic, Meniere’s disease, Microscopic polyangiitis (MPA), Mixed connective tissue disease (MCTD), Mooren’s ulcer, Mucha- Habermann disease, Multifocal Motor Neuropathy (MMN) or MMNCB, Multiple sclerosis, Myasthenia gravis, Myositis, Narcolepsy, Neonatal Lupus, Neuromyelitis optica,
Neutropenia, Ocular cicatricial pemphigoid, Optic neuritis, Palindromic rheumatism (PR), PANDAS, Paraneoplastic cerebellar degeneration (PCD), Paroxysmal nocturnal
hemoglobinuria (PNJJ), Parry Romberg syndrome, Pars planitis (peripheral uveitis), Parsonnage-Tumer syndrome, Pemphigus, Peripheral neuropathy, Perivenous
encephalomyelitis, Pernicious anemia (PA), POEMS syndrome, Polyarteritis nodosa, Polyglandular syndromes type I, II, III, Polymyalgia rheumatica, Polymyositis,
Postmyocardial infarction syndrome, Postpericardiotomy syndrome, Primary biliary cirrhosis, Primary sclerosing cholangitis, Progesterone dermatitis, Psoriasis, Psoriatic arthritis, Pure red cell aplasia (PRC A), Pyoderma gangrenosum, Raynaud’s phenomenon, Reactive Arthritis, Reflex sympathetic dystrophy, Relapsing polychondritis, Restless legs syndrome (RLS), Retroperitoneal fibrosis, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt syndrome, Scleritis, Scleroderma, Sjogren’s syndrome, Sperm & testicular autoimmunity, Stiff person syndrome (SPS), Subacute bacterial endocarditis (SBE), Susac’s syndrome, Sympathetic ophthalmia (SO), Takayasu’s arteritis, Temporal arteritis/Giant cell arteritis, Thrombocytopenic purpura (TTP), Tolosa-Hunt syndrome (THS), Transverse myelitis, Type 1 diabetes, Ulcerative colitis (UC), Undifferentiated connective tissue disease (UCTD), Uveitis, Vasculitis, Vitiligo, Vogt-Koyanagi-Harada Disease, or Wegener’s granulomatosis.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, an inflammatory disease or disorder.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, a metabolic disease or disorder.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, a degenerative or a progressive disease or disorder. In some embodiments, the degenerative or a progressive disease or disorder includes, but is not limited to, amyotrophic lateral sclerosis (ALS), Huntington’s disease, Alzheimer’s disease, and aging.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, an infectious disease or disorder.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, a pediatric or a developmental disease or disorder.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, a cardiovascular disease or disorder.
In some embodiments of the compositions and methods of the disclosure, a disease or disorder of the disclosure includes, but is not limited to, a proliferative disease or disorder. In some embodiments, the proliferative disease or disorder is a cancer. In some embodiments, the cancer includes, but is not limited to, Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML), Adrenocortical Carcinoma, AIDS-Related Cancers, Kaposi Sarcoma (Soft Tissue Sarcoma), AIDS-Related Lymphoma (Lymphoma), Primary CNS Lymphoma (Lymphoma), Anal Cancer, Appendix Cancer, Gastrointestinal Carcinoid Tumors, Astrocytomas, Atypical Teratoid/Rhabdoid Tumor, Central Nervous System (Brain Cancer), Basal Cell Carcinoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Ewing Sarcoma, Osteosarcoma, Malignant Fibrous Histiocytoma, Brain Tumors, Breast Cancer, Burkitt Lymphoma, Carcinoid Tumor, Carcinoma, Cardiac (Heart) Tumors, Embryonal Tumors, Germ Cell Tumor, Primary CNS Lymphoma, Cervical Cancer, Cholangiocarcinoma, Chordoma, Chronic Lymphocytic Leukemia (CLL), Chronic Myelogenous Leukemia (CML), Chronic Myeloproliferative Neoplasms, Colorectal Cancer , Craniopharyngioma, Cutaneous T-Cell Lymphoma, Ductal Carcinoma In Situ, Embryonal Tumors, Endometrial Cancer (UterineCancer), Ependymoma, Esophageal Cancer, Esthesioneuroblastoma (Head and Neck Cancer), Ewing Sarcoma (Bone Cancer), Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Eye Cancer, Childhood Intraocular Melanoma, Intraocular Melanoma,
Retinoblastoma, Fallopian Tube Cancer, Fibrous Histiocytoma of Bone, Malignant, and Osteosarcoma, Gallbladder Cancer, Gastric (Stomach) Cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Stromal Tumors (GIST) (Soft Tissue Sarcoma), Childhood
Gastrointestinal Stromal Tumors, Germ Cell Tumors, Childhood Extracranial Germ Cell Tumors, Extragonadal Germ Cell Tumors, Ovarian Germ Cell Tumors, Testicular Cancer, Gestational Trophoblastic Disease, Hairy Cell Leukemia, Head and Neck Cancer, Heart Tumors, Hepatocellular (Liver) Cancer, Histiocytosis, Hodgkin Lymphoma, Hypopharyngeal Cancer (Head and Neck Cancer), Intraocular Melanoma, Islet Cell Tumors, Pancreatic Neuroendocrine Tumors, Kaposi Sarcoma (Soft Tissue Sarcoma), Kidney (Renal Cell) Cancer, Langerhans Cell Histiocytosis, Laryngeal Cancer (Head and Neck Cancer),
Leukemia, Lip and Oral Cavity Cancer (Head and Neck Cancer), Liver Cancer, Lung Cancer
(Non-Small Cell and Small Cell), Childhood Lung Cancer, Lymphoma, Male Breast Cancer, Malignant Fibrous Histiocytoma of Bone and Osteosarcoma, Melanoma, Merkel Cell Carcinoma (Skin Cancer), Mesothelioma, Metastatic Squamous Neck Cancer with Occult Primary (Head and Neck Cancer), Midline Tract Carcinoma With NUT Gene Changes, Mouth Cancer (Head and Neck Cancer), Multiple Endocrine Neoplasia Syndromes, Multiple Myeloma/Plasma Cell Neoplasms, Mycosis Fungoides (Lymphoma), Myelodysplastic Syndromes, Myelodysplastic/Myeloproliferative Neoplasms, Nasal Cavity and Paranasal Sinus Cancer (Head and Neck Cancer), Nasopharyngeal Cancer (Head and Neck Cancer), Neuroblastoma, Non- Hodgkin Lymphoma, Non-Small Cell Lung Cancer, Oral Cancer, Lip and Oral Cavity Cancer and Oropharyngeal Cancer, Osteosarcoma and Malignant Fibrous Histiocytoma of Bone, Ovarian Cancer, Pancreatic Cancer, Pancreatic Neuroendocrine Tumors (Islet Cell Tumors), Papillomatosis, Paraganglioma, Parathyroid Cancer, Penile Cancer, Pharyngeal Cancer (Head and Neck Cancer), Pheochromocytoma , Plasma Cell Neoplasm/Multiple Myeloma, Pleuropulmonary Blastoma, Pregnancy and Breast Cancer, Primary Central Nervous System (CNS) Lymphoma, Primary Peritoneal Cancer, Prostate Cancer, Rectal Cancer, Recurrent Cancer, Renal Cell (Kidney) Cancer, Retinoblastoma, Rhabdomyosarcoma, Childhood (Soft Tissue Sarcoma), Saliv ary Gland Cancer (Head and Neck Cancer), Sarcoma, Childhood Rhabdomyosarcoma (Soft Tissue Sarcoma), Childhood Vascular Tumors (Soft Tissue Sarcoma), Ewing Sarcoma (Bone Cancer), Kaposi Sarcoma (Soft Tissue Sarcoma), Osteosarcoma (Bone Cancer), Uterine Sarcoma, Sezary Syndrome, Lymphoma, Skin Cancer, Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Cell Carcinoma of the Skin, Squamous Neck Cancer, Stomach (Gastric) Cancer, T-Cell Lymphoma, Testicular Cancer, Throat Cancer (Head and Neck Cancer), Nasopharyngeal Cancer, Oropharyngeal Cancer, Hypopharyngeal Cancer, Thymoma and Thymic Carcinoma , Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Ureter, Renal Cell Cancer, Urethral Cancer, Uterine Sarcoma, Vaginal Cancer, Vascular Tumors (Soft Tissue Sarcoma), Vulvar Cancer, Wilms Tumor and Other Childhood Kidney Tumors.
In some embodiments of the methods of the disclosure, a subject of the disclosure has been diagnosed with the disease or disorder. In some embodiments, the subject of the disclosure presents at least one sign or symptom of the disease or disorder. In some embodiments, the subject has a biomarker predictive of a risk of developing the disease or disorder. In some embodiments, the biomarker is a genetic mutation.
In some embodiments of the methods of the disclosure, a subject of the disclosure is female. In some embodiments of the methods of the disclosure, a subject of the disclosure is male. In some embodiments, a subject of the disclosure has two XX or XY chromosomes. In some embodiments, a subject of the disclosure has two XX or XY chromosomes and a third chromosome, either an X or a Y.
In some embodiments of the methods of the disclosure, a subject of the disclosure is a neonate, an infant, a child, an adult, a senior adult, or an elderly adult. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,28, 29, 30 or 31 days old. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months old. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or any number of years or partial years in between of age.
In some embodiments of the methods of the disclosure, a subject of the disclosure is a mammal. In some embodiments, a subject of the disclosure is a non-human mammal.
In some embodiments of the methods of the disclosure, a subject of the disclosure is a human.
In some embodiments of the methods of the disclosure, a therapeutically effective amount comprises a single dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises at least one dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises one or more dose(s) of a composition of the disclosure. In some embodiments of the methods of the disclosure, a therapeutically effective amount eliminates a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount reduces a severity of a sign or symptom of the disease or disorder.
In some embodiments of the methods of the disclosure, a therapeutically effective amount eliminates the disease or disorder.
In some embodiments of the methods of the disclosure, a therapeutically effective amount prevents an onset of a disease or disorder. In some embodiments, a therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, a therapeutically effective amount reduces the severity of a sign or symptom of the disease or
disorder. In some embodiments, a therapeutically effective amount improves a prognosis for the subject.
In some embodiments of the methods of the disclosure, a composition of the disclosure is administered to the subject systemically. In some embodiments, the composition of the disclosure is administered to the subject by an intravenous route. In some
embodiments, the composition of the disclosure is administered to the subject by an injection or an infusion.
In some embodiments of the methods of the disclosure, a composition of the disclosure is administered to the subject locally. In some embodiments, the composition of the disclosure is administered to the subject by an intraosseous, intraocular,
intracerebrospinal, or intraspinal route. In some embodiments, the composition of the disclosure is administered directly to the cerebral spinal fluid of the central nervous system.
In some embodiments, the composition of the disclosure is administered directly to a tissue or fluid of the eye and does not have bioavailability outside of ocular structures. In some embodiments, the composition of the disclosure is administered to the subject by an injection or an infusion.
Also provided herein is a pharmaceutical composition comprising any one or more of the capped-sgRNAs and Cas or dCas polypeptide, or the nucleic acid sequences encoding the polypeptide, and a carrier. In some embodiments, a composition can be one or more polynucleotides encoding a capped-guide nucleotide sequence-Cas polypeptide or fusion polypeptide. In some embodiments, a composition can be any of the nucleic acids or proteins described herein. In some embodiments, a composition can be any polynucleotide described herein. In some embodiments, the carrier is a pharmaceutically acceptable carrier. In some embodiments, the composition is a pharmaceutical composition comprising a capped-guide nucleotide sequence-Cas poly peptide or fusion polypeptide, and a pharmaceutically acceptable carrier. In some embodiments, the composition or pharmaceutical composition further composes one or more gRNAs, capped-sgRNAs, crRNAs, and/or tracrRNAs.
Briefly, pharmaceutical compositions disclosed herein may comprise a capped-guide nucleotide sequence-Cas polypeptide or fusion polypeptide or a nucleotide sequence encoding the same, optionally comprised in an AAV, which is optionally also immune orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as
glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions of the present disclosure may be formulated for oral, intravenous, topical, enteral, subpial, and/or parenteral administration. In certain embodiments, the compositions of the disclosure are formulated for intravenous administration.
In some embodiments of the methods of the disclosure, a composition of the disclosure is administered to the subject locally. In some embodiments, the composition of the disclosure is administered to the subject by an intraosseous, intraocular,
intracerebrospinal, intraspinal, or subpial route. In some embodiments, the composition of the disclosure is administered directly to the cerebral spinal fluid of the central nervous system.
In some embodiments, the composition of the disclosure is administered directly to a tissue or fluid of the eye and does not have bioavailability outside of ocular structures. In some embodiments, the composition of the disclosure is administered to the subject by an injection or an infusion.
In some embodiments, the compositions disclosed herein are formulated as pharmaceutical compositions. Briefly, pharmaceutical compositions for use as disclosed herein may include a protein(s) or a polynucleotide encoding the protein(s), optionally comprised in an AAV, which is optionally also immune orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may include buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol;
proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
Compositions of the disclosure may be formulated for oral, intravenous, topical, enteral, intraocular, and/or parenteral administration. In some embodiments, intraocular
administration includes, without limitation, subretinal, intravitreal, or topical (via eye drops) administration. In certain embodiments, the compositions of the disclosure are formulated for intravenous administration.
EXAMPLES
The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit
the invention. One skilled in the art can develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention.
Example 1: Modulation of translation using dCas and capped-sgRNA
Exemplaty constructs for generating nuclease dead Cas (dCasl3b) and m7G capped- sgRNA are show n in FIG. 1 A. dCas and capped-sgRNA were transcribed from either the same promoter (i), or independent promoters (ii) by RNA polymerase II. An exemplary structure for the unprocessed capped-sgRNA is shown in FIG. IB. From 5’ to 3’, the capped- sgRNA contains the m7G cap, a linker of variable length, a spacer, a direct repeat, an RNase P processing site such as a tRNA-like small RNA, and a poly -A tail. An exemplary chemical composition of a capped-sgRNA is shown in FIG. 1C. Variants of the m7G cap include either guanosine or adenine for the second nucleotide of the di -nucleotide m7G cap (at the a’ position). FIG. ID shows RNase P processing to trim downstream sequences, including the poly-A tail, from the transcript. The capped-RNA complexed with dCas, binds to a site on the target messenger RNA thereby bringing the m7G cap of the sgRNA to the vicinity of a desired start codon (FIG. IE).
A two construct system was used to test the ability of dCas and capped-sgRNA to regulate translation in trans. The first construct includes a dCasl3b gene driven by a PGK promoter, followed by a NLS-Turquoise reporter which is driven by an EF la promoter. The second construct includes a sequence encoding a capped sgRNA, a 5’UTR region of ATF4, and the ATF4 ORF linked to an NL-Citrine promoter. Both the sequence encoding a capped sgRNA and the ATF4 ORF are driven by a TRE promoter. The second construct further includes an rtTA-P2A-Puro construct linked to an NLS-Cherry reporter via an IRES sequence. The rtTA-P2A-Puro-IRES-NLS-Cherry portion is driven by the EF1 a promoter. A number of different types of capped sgRNAs (sg(l), sg(2), sg(3), sg(4), sg(5), sg(6)) were generated, each included a spacer that targets the ATF4 transcript at a different site. The sequences of the sgRNAs are listed in below. The target sequences were within the“sgRNA targeting window” as shown in FIG. 1G. Control capped-sgRNAs were also generated that do not target a sequence within the ATF4 transcript. These control capped-sgRNAs are referred to as non-targeting sgRNAs. Each capped-sgRNA was tested using dCas gradient in combination with a target ATF4 transcript gradient. The plots in FIG. 1H reflect log2 fold difference in Citrine/Cherry ratio between each capped sgRNA - sg (al), sg(a2), sg(a3), sg(a4), sg(a5) and sg(a6), and non-targeting sgRNAs. A spacer targeting a region just 3’
proximal to the start codon AUG was shown to result in the biggest increase in protein expression. The results demonstrate that optimal translational control is a function of the target sequence chosen, the expression level of the target RNA, and the expression level of dCas.
Uncapped-sgRNAs that correspond to each of the capped-sgRNA tested were subjected to the same gradient test. As shown in FIG. II, uncapped-sgRNAs were either ineffective in enhancing translation, or only minimally enhanced translation. These results showed that the localized recruitment of the 5’ m7G cap proximal to a start codon enabled an enhancement in translation.
ADDITIONAL EMBODIMENTS
Embodiment 1 : A capped single guide RNA (Capped-sgRNA) comprising from 5’ to 3’:
an m7G cap,
a linker,
a spacer complementary to a target sequence in a messenger RNA, a direct repeat sequence, and
a Ribonuclease P (RNase P) processing site,
wherein the direct repeat sequence is capable of binding to a Cas protein.
Embodiment 2: The Capped-sgRNA of Embodiment 1, wherein the Cas protein is a nuclease dead Cas (dCas) protein.
Embodiment 3: The Capped-sgRNA of Embodiment 1, wherein the m7G cap comprises one or more chemical modifications relative to the structure of a naturally occurring m7G cap.
Embodiment 4: The Capped-sgRNA of Embodiment 1, wherein the linker comprises about 5 to about 25 nucleotides.
Embodiment 5: The Capped-sgRNA of Embodiment 4, wherein the linker comprises about 8 to about 20 nucleotides.
Embodiment 6: The Capped-sgRNA of Embodiment 1, wherein the linker is non complementary to any messenger RNA sequence.
Embodiment 7: The Capped-sgRNA of Embodiment 1, wherein the linker comprises the sequence of GTC AGATCGCCTGGAATT.
Embodiment 8: The Capped-sgRNA of Embodiment 1, wherein the target sequence is proximal to a target start codon of the messenger RNA relative to a 5 ni7G cap of the messenger RNA.
Embodiment 9: The Capped-sgRNA of Embodiment 1, wherein the target sequence comprises the target start codon of the messenger RNA.
Embodiment 10: The Capped-sgRNA of Embodiment 8, wherein the 5’ end of the target sequence is upstream to the target start codon of the messenger RNA.
Embodiment 11: The Capped-sgRNA of Embodiment 8, wherein the 5’ end of the target sequence is dow nstream to the target start codon of the messenger RNA.
Embodiment 12: The Capped-sgRNA of Embodiment 1, wherein the spacer is at least 80% complementary to the target sequence in the messenger RNA.
Embodiment 13: The Capped-sgRNA of Embodiment 1, wherein the spacer is at least 90% complementary to the target sequence in the messenger RNA.
Embodiment 14: The Capped-sgRNA of Embodiment 1, further comprising a polyadenylated tail.
Embodiment 15: The Capped-sgRNA of Embodiment 1, having the structure:
wherein a’ is a guanosine or adenine, b’ is the linker, and c’ is the spacer.
Embodiment 16: An expression vector encoding the Capped-sgRNA of Embodiment 1.
Embodiment 17: The expression vector of Embodiment 16, further encodes a nuclease dead Cas9.
Embodiment 18: A Capped-sgRNA generated by processing the Capped-sgRNA of Embodiment 1 using an RNase P.
Embodiment 19: An expression vector comprising a nucleic acid sequence encoding:
a nuclease dead Cas (dCas), and
a capped single guide RNA (Capped-sgRNA) comprising
an m7G cap,
a linker,
a spacer complementary to a target sequence in a messenger RNA, and a direct repeat sequence, wherein the direct repeat sequence is capable of binding to the dCas protein.
Embodiment 20: The expression vector of Embodiment 19, wherein the Capped-sgRNA further comprises a Ribonuclease P (RNase P) processing site.
Embodiment 21: The expression vector of Embodiment 19, wherein the Capped-sgRNA further comprises a polyadenylated tail.
Embodiment 22: The expression vector of Embodiment 19, wherein the dCas and the Capped-sgRNA are under the control of the same promoter.
Embodiment 23; The expression vector of Embodiment 19, wherein the dCas and the Capped-sgRNA are under the control of different promoters.
Embodiment 24: A method of enhancing protein translation comprising:
(a) providing a nuclease dead Cas (dCas) protein, and a capped single guide RNA (Capped-sgRNA) comprising from 5’ to 3’: an m7G cap,
a linker,
a spacer complementary to a target sequence in a messenger RNA, and a direct repeat sequence,
wherein the direct repeat sequence is capable of binding to the dCas protein, and wherein the target sequence is proximal to a start codon of the messenger RNA relative to a 5’ m7G cap of the messenger RNA.
(b) allowing the Capped-sgRNA to bind to the target sequence and the dCas protein to bind to the direct repeat sequence of the Capped-sgRNA, thereby localizing the m7G cap of the Capped-sgRNA to the target sequence.
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A complex comprising:
a Cas polypeptide; and
a capped-sgRNA comprising
(i) an m7G cap or an analog thereof;
(ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and
(iii) a direct repeat capable of binding to the Cas polypeptide.
2. The complex of claim 1, wherein the RNA molecule is a messenger RNA (mRNA).
3. The complex of claim 2, wherein the mRNA has an endogenous m7G cap.
4. The complex of claim 3, wherein the target sequence is dow nstream of the endogenous m7G cap of the mRNA.
5. The complex of any one of claims 2-4, wherein the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is upstream of the start codon.
6. The complex of claim 5, wherein the 5’ end of the target sequence is between 1 to 50 nucleotides upstream of the first nucleotide of the start codon.
7. The complex of claim 6, wherein the 5’ end of the target sequence is between 1 to 15 nucleotides upstream of the first nucleotide of the start codon.
8. The complex of any one of claims 5-7, wherein the target sequence comprises the start codon.
9. The complex of any one of claims 2-4, wherein the mRNA comprises a start codon, and wherein the 5 end of the target sequence is downstream of the start codon.
10. The complex of claim 9, wherein the 5’ end of the target sequence is between 1 to 50 nucleotides dow nstream of the last nucleotide of the start codon.
11. The complex of claim 10, wherein the 5’ end of the target sequence is between 1 to 15 nucleotides dow nstream of the last nucleotide of the start codon.
12. The complex of claim 10, wTrerein the 5’ end of the target sequence is between 1 to 5 nucleotides downstream of the last nucleotide of the start codon.
13. The complex of any one of claims 1-12, wherein the spacer is at least 80%
complementary to the target sequence.
14. The complex of claim 13, wTierein the spacer is at least 90% complementary to the target sequence.
15. The complex of any one of claims 1-14, wherein the spacer comprises about 10 to about 40 nucleotides.
16. The complex of claim 15, wTrerein the spacer comprises about 15 to about 25 nucleotides.
17. The complex of claim 16, wTierein the spacer comprises about 20 nucleotides.
18. The complex of any one of claims 1-17, wherein the spacer is connected to the m7G cap or analog there of via a linker.
19. The complex of claim 18, wTierein the linker comprises about 5 to about 25 nucleotides.
20. The complex of claim 19, wTierein the linker comprises about 8 to about 15 nucleotides.
21. The complex of any one of claims 18-20, wherein the linker is not complementary' to any sequence in the mRNA.
22. The complex of any one of claims 18-21, wherein the linker is conjugated to the m7G cap or analog thereof via polyethylene glycol.
23. The complex of any one of claims 1-22, wherein the Cas polypeptide is a nuclease- deficient Cas (dCas) polypeptide, wherein the dCas comprises an inactivated target cleavage domain and a retained guide cleavage domain.
24. The complex of claim 23, wherein the nuclease-deficient Cas polypeptide is a nuclease- deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d.
25. The complex of claim 24, wherein the direct repeat is capable of binding to a nuclease- deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d.
26. The complex of claim 23, wherein the nuclease-deficient Cas polypeptide is a nuclease- deficient Cas9 (dCas9) polypeptide.
27. The complex of claim 26, wherein the direct repeat is capable of binding to a nuclease- deficient Cas9 (dCas9) polypeptide.
28. A nucleic acid comprising a sequence encoding the capped-sgRNA in the complex of any one of claims 1-27.
29. The nucleic acid of claim 28, further comprising a sequence encoding the Cas polypeptide in the complex of any one of claims 1-27.
30. A nucleic acid comprising a sequence encoding a capped-sgRNA, wherein the capped- sgRNA comprises:
(i) an m7G cap or analog thereof;
(ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and
(iii) a direct repeat capable of binding to a Cas polypeptide.
31. The nucleic acid of claim 30, wherein the RNA molecule is an mRNA.
32. The nucleic acid of claim 31, wherein the mRNA has an endogenous m7G cap.
33. The nucleic acid of claim 32, wherein the target sequence is dow nstream of the endogenous m7G cap of the mRNA.
34. The nucleic acid of any one of claims 31-33, wherein the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is upstream of the start codon.
35. The nucleic acid of claim 34, wherein the 5’ end of the target sequence is between 1 and 50 nucleotides upstream of the first nucleotide of the start codon.
36. The nucleic acid of claim 35, wherein the 5’ end of the target sequence is between 1 to 15 nucleotides upstream of the first nucleotide of the start codon.
37. The nucleic acid of any one of claims 34-36, wherein the target sequence comprises the start codon.
38. The nucleic acid of any one of claims 31-33, wherein the mRNA comprises a start codon, and wherein the 5’ end of the target sequence is downstream of the start codon.
39. The nucleic acid of claim 38, wherein the 5’ end of the target sequence is between 1 to 50 nucleotides downstream of the last nucleotide of the start codon.
40. The nucleic acid of claim 39, wherein the 5’ end of the target sequence is between 1 to 15 nucleotides downstream of the last nucleotide of the start codon.
41. The nucleic acid of claim 40, wherein the 5’ end of the target sequence is between 1 to 5 nucleotides downstream of the last nucleotide of the start codon.
42. The nucleic acid of any one of claims 30-41, wherein the spacer is at least 80% complementary to the target sequence.
43. The nucleic acid of claim 42, wherein the spacer is at least 90% complementary to the target sequence.
44. The nucleic acid of any one of claims 30-43, wherein the spacer comprises about 10 to about 40 nucleotides.
45. The nucleic acid of claim 44, wherein the spacer comprises about 15 to about 25 nucleotides.
46. The nucleic acid of claim 45, wherein the spacer comprises about 20 nucleotides.
47. The nucleic acid of any one of claims 30-46, wherein the spacer is connected to the m7G cap or analog thereof via a linker.
48. The nucleic acid of claim 47, wherein the linker comprises about 5 to about 25 nucleotides.
49. The nucleic acid of claim 48, wherein the linker comprises about 8 to about 20 nucleotides.
50. The nucleic acid of any one of claims 47-49, wherein the linker is not complementary to any sequence in the mRNA.
51. The nucleic acid of any one of claims 47-50, wherein the linker is conjugated to the m7G cap or analog thereof via polyethylene glycol.
52. The nucleic acid of any one of claims 30-51, further comprising a sequence encoding a RNase P processing site.
53. The nucleic acid of any one of claims 30-52, further comprising a poly-T sequence.
54. The nucleic acid of claim 52, further comprising a poly-T sequence downstream of the sequence encoding a RNase P processing site.
55. The nucleic acid of any one of claims 30-54, further comprising a sequence encoding the Cas polypeptide.
56. The nucleic acid of claim 55, wherein the Cas polypeptide is a nuclease-deficient Cas polypeptide.
57. The nucleic acid of claim 56, wherein the nuclease-deficient Cas polypeptide is a nuclease-deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d.
58. The nucleic acid of claim 57, wherein the direct repeat is capable of binding to a nuclease-deficient Casl3 (dCasl3) polypeptide, wherein the dCasl3 is dCasl3b or dCasl3d.
59. The nucleic acid of claim 56, wherein the nuclease-deficient Cas polypeptide is a nuclease-deficient Cas9 (dCas9) polypeptide.
60. The nucleic acid of any one of claims 30-59, further comprising one or more RNA polymerase II promoters.
61. The nucleic acid of any one of claims 55-60, wherein the sequence encoding the capped- sgRNA and the sequence encoding the Cas polypeptide are expressed from the same promoter.
62. The nucleic acid of any one of claims 55-60, wherein the sequence encoding the capped- sgRNA and the sequence encoding the Cas polypeptide are expressed from different promoters.
63. A vector comprising the nucleic acid of any one of claims 30-62.
64. The vector of claim 63, wherein the vector is an AAV vector.
65. A cell comprising the nucleic acid of any one of claims 30-52.
66. A method of regulating translation of an mRNA in a cell, the method comprising contacting the cell with a nucleic acid comprising
(a) a sequence encoding a Cas polypeptide; and
(b) a sequence encoding a capped-sgRNA comprising
(i) an m7G cap or analog thereof;
(ii) a spacer capable of specifically hybridizing with a target sequence in an RNA molecule; and
(iii) a direct repeat capable of binding to the Cas polypeptide.
67. The method of claim 66, wherein the Cas polypeptide is a nuclease-deficient Cas 13 (dCasl3) polypeptide.
68. The method of claim 67, wherein the dCasl3 polypeptide is dCasl3b or dCasl3d.
69. The method of claim 68, wherein the dCasl3b comprises an inactivated target cleavage domain and a retained guide cleavage domain.
70. The method of claim 69, wherein the dCasl3d comprises an inactivated target cleavage domain and a retained guide cleavage domain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/604,128 US20220220473A1 (en) | 2019-04-16 | 2020-04-16 | Protein translational control |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962834582P | 2019-04-16 | 2019-04-16 | |
| US62/834,582 | 2019-04-16 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020214830A1 true WO2020214830A1 (en) | 2020-10-22 |
Family
ID=72837854
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/028501 Ceased WO2020214806A1 (en) | 2019-04-16 | 2020-04-16 | Protein translational control |
| PCT/US2020/028546 Ceased WO2020214830A1 (en) | 2019-04-16 | 2020-04-16 | Protein translational control |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/028501 Ceased WO2020214806A1 (en) | 2019-04-16 | 2020-04-16 | Protein translational control |
Country Status (2)
| Country | Link |
|---|---|
| US (2) | US20220204978A1 (en) |
| WO (2) | WO2020214806A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022219200A1 (en) | 2021-04-16 | 2022-10-20 | Ucl Business Ltd | Casrx/cas13d systems targeting c9orf72 |
| WO2023167276A1 (en) * | 2022-03-04 | 2023-09-07 | 国立研究開発法人科学技術振興機構 | Capped rna and method for producing same, apparatus for producing protein, and method for producing protein |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA3005968A1 (en) | 2015-11-23 | 2017-06-01 | The Regents Of The University Of California | Tracking and manipulating cellular rna via nuclear delivery of crispr/cas9 |
| WO2018208998A1 (en) | 2017-05-10 | 2018-11-15 | The Regents Of The University Of California | Directed editing of cellular rna via nuclear delivery of crispr/cas9 |
| EP4208549A4 (en) | 2020-09-04 | 2025-04-16 | Verve Therapeutics, Inc. | Compositions and methods for capping rnas |
| WO2024178399A2 (en) * | 2023-02-24 | 2024-08-29 | Cornell University | Programmable mrna translation guided by synthetic trans-rna |
| EP4671372A3 (en) | 2024-01-29 | 2026-03-11 | Arnatar Therapeutics, Inc | Translation enhancing nucleic acid compounds: aso coupled translation - upregulation 1 (act-up1) and uses thereof |
| WO2025165891A1 (en) | 2024-01-29 | 2025-08-07 | Arnatar Therapeutics, Inc | Translation enhancing nucleic acid compounds: aso coupled translation - upregulation 1 (act-up1) and uses thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018154387A1 (en) * | 2017-02-22 | 2018-08-30 | Crispr Therapeutics Ag | Compositions and methods for gene editing |
| WO2019060746A1 (en) * | 2017-09-21 | 2019-03-28 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19502912A1 (en) * | 1995-01-31 | 1996-08-01 | Hoechst Ag | G-Cap Stabilized Oligonucleotides |
| WO2007123579A2 (en) * | 2005-12-28 | 2007-11-01 | Translational Therapeutics | Translational dysfunction based therapeutics |
| CA2921556A1 (en) * | 2013-08-16 | 2015-02-19 | Rana Therapeutics, Inc. | Compositions and methods for modulating rna |
| WO2016106236A1 (en) * | 2014-12-23 | 2016-06-30 | The Broad Institute Inc. | Rna-targeting system |
| CN120842296A (en) * | 2015-09-21 | 2025-10-28 | 垂林克生物技术有限公司 | Compositions and methods for synthesizing 5'-capped RNA |
-
2020
- 2020-04-16 US US17/604,139 patent/US20220204978A1/en active Pending
- 2020-04-16 US US17/604,128 patent/US20220220473A1/en active Pending
- 2020-04-16 WO PCT/US2020/028501 patent/WO2020214806A1/en not_active Ceased
- 2020-04-16 WO PCT/US2020/028546 patent/WO2020214830A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018154387A1 (en) * | 2017-02-22 | 2018-08-30 | Crispr Therapeutics Ag | Compositions and methods for gene editing |
| WO2019060746A1 (en) * | 2017-09-21 | 2019-03-28 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
Non-Patent Citations (1)
| Title |
|---|
| HINNEBUSCH, AG: "Molecular Mechanism of Scanning and Start Codon Selection in Eukaryotes", MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, vol. 75, no. 3, September 2011 (2011-09-01), pages 434 - 467, XP055750149, DOI: 10.1128/MMBR.00008-11 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022219200A1 (en) | 2021-04-16 | 2022-10-20 | Ucl Business Ltd | Casrx/cas13d systems targeting c9orf72 |
| WO2023167276A1 (en) * | 2022-03-04 | 2023-09-07 | 国立研究開発法人科学技術振興機構 | Capped rna and method for producing same, apparatus for producing protein, and method for producing protein |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220220473A1 (en) | 2022-07-14 |
| WO2020214806A1 (en) | 2020-10-22 |
| US20220204978A1 (en) | 2022-06-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220220473A1 (en) | Protein translational control | |
| US10822617B2 (en) | RNA-targeting fusion protein compositions and methods for use | |
| WO2021007529A1 (en) | Rna-targeting knockdown and replacement compositions and methods for use | |
| JP2025028917A (en) | Nucleic Acid Constructs and Methods of Use | |
| WO2019204828A1 (en) | Fusion proteins and fusion ribonucleic acids for tracking and manipulating cellular rna | |
| CN113286619A (en) | Compositions and methods for modulating adaptive immunity | |
| CA3026055A1 (en) | Novel crispr enzymes and systems | |
| US20240011026A1 (en) | Rna editing via recruitment of spliceosome components | |
| US20240209366A1 (en) | High efficiency trans-splicing for replacement of targeted rna sequences in human cells | |
| EP3841116A1 (en) | Fasl immunomodulatory gene therapy compositions and methods for use | |
| WO2020241903A1 (en) | Method for treating muscular dystrophy by targeting dmpk gene | |
| US20250290067A1 (en) | Localization of trans-splicing nucleic acid molecules to and within the cellular nucleus | |
| WO2024259332A2 (en) | Methods and compositions for regulating gene expression | |
| WO2025227064A1 (en) | Genomic editing methods to treat cardiovascular disease, and compositions for use in practicing the same | |
| EP4713444A2 (en) | Fusion proteins comprising cas enzymes and dna-binding proteins | |
| HK40111673A (en) | Rna editing via recruitment of spliceosome components | |
| WO2025261493A1 (en) | Method for targeted regulation of pcsk9 by means of epigenetic editing and use thereof | |
| CN118202051A (en) | RNA editing by recruiting spliceosomal components |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20790727 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20790727 Country of ref document: EP Kind code of ref document: A1 |
















































