Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4707—Muscular dystrophy
  • C07K14/4708—Duchenne dystrophy
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/102—Mutagenizing nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
  • C12N15/90—Stable introduction of foreign DNA into chromosome
  • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
  • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications
  • C12N2320/32—Special delivery means, e.g. tissue-specific
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2510/00—Genetically modified cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/40—Systems of functionally co-operating vectors

Definitions

• the present disclosure relates to the field of gene expression alteration, genome engineering, and genomic alteration of genes using Clustered Regularly Interspaced Short Palindromic Repeats (CRiSPR)/CRISPR-associated (Cas) 9-based systems and virai delivery systems.
• CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
• Cas CRISPR-associated 9-based systems and virai delivery systems.
• the present disclosure also relates to the field of genome engineering and genomic alteration of genes in muscle, such as skeletal muscle and cardiac muscle.
• GRISPR/Cas9-based gene editing systems can be used to introduce site-specific double strand breaks at targeted genomic ioci.
• This DNA cleavage stimulates the natural DNA-repair machinery, leading to one of two possible repair pathways.
• NHEJ non-homologous end joining
• This method can be used to intentionally disrupt, delete, or alter the reading frame of targeted gene sequences.
• a donor template is provided along with the nucleases, then the cellular machinery will repair the break by homologous recombination, which is enhanced several orders of magnitude in the presence of DNA cleavage.
• DMD is a fatal genetic disease, clinically characterized by muscle wasting, loss of ambulation, and death typically in the third decade of life due to the loss of functional dystrophin.
• DMD is the result of inherited or spontaneous mutations in the dystrophin gene. Most mutations causing DMD are a result of deletions of exon(s), pushing the translational reading frame out of frame. The majority of DMD mutations are deletions ( ⁇ 88%) of one or more of its 79 exons that shift the reading frame and terminate expression of the full-length transcript. Deletions mostly occur in two“hotspots” of the gene, which encompass exons 2 through 20 ( ⁇ 1/3 of ail deletions) and exons 45 through 55 ( ⁇ 2/3 of all deletions). Becker muscular dystrophy (BMD) patients with naturally occurring in-frame deletions of the entire 45 to 55 region of the dystrophin gene exhibit delayed disease onset and minimal skeletal muscle pathology.
• Dystrophin is a key component of a protein complex that is responsible for regulating muscle cell integrity and function. DMD patients typically lose the ability to physically support themselves during childhood, become progressively weaker during the teenage years, and die in their twenties. Current experimental gene therapy strategies for DMD require repeated administration of transient gene delivery vehicles or rely on permanent integration of foreign genetic material into the genomic DNA. Both of these methods have serious safety concerns. Furthermore, these strategies have been limited by an inability to deliver the large and complex dystrophin gene sequence. There remains a need for more precise and efficient gene editing tools for correcting and treating patients with mutations in the dystrophin gene.
• the disclosure relates to a CRISPR-Cas system.
• the CRISPR-Cas system may include one or more vectors encoding a composition, the composition comprising: (a) a first guide RNA (gRNA) molecule targeting intron 44 of dystrophin: (b) a second gRNA molecule targeting intron 55 of dystrophin; and (c) a Gas9 protein; and (d) one or more Cas9 gRNA scaffolds.
• the system comprises a single vector in some embodiments, the system comprises two or more vectors, wherein the two or more vectors comprises a first vector and a second vector.
• the first vector encodes the first gRNA molecule and the second gRNA molecule; and (b) the second vector encodes the Cas9 protein. In some embodiments, (a) the first vector encodes the first gRNA molecule; and (b) the second vector encodes the second gRNA molecule. In some embodiments, the first vector further encodes the Cas9 protein. In some embodiments,
• the second vector further encodes the Cas9 protein.
• the expression of the Cas9 protein is driven by a constitutive promoter or a muscle-specific promoter in some embodiments, the muscle-specific promoter comprises a MHCK7 promoter, a CK8 promoter, or a Spc512 promoter.
• the single vector encodes the first gRNA molecule, the second gRNA molecule, and the Cas9 protein in some embodiments, the vector comprises at least one bidirectional promoter.
• the bidirectional promoter comprises: a first promoter driving expression of the first gRNA molecule and/or the second gRNA molecule; and a second promoter driving expression of the Cas9 protein.
• the first gRNA targets the polynucleotide of SEQ ID NO:2 or a 5' truncation thereof.
• the second gRNA targets the polynucleotide of SEQ ID NO:3 or a 5’ truncation thereof.
• the Cas9 protein is SpCas9, SaCas9, or St1 Cas9 protein.
• the Cas9 gRNA scaffold is a SaCas9 gRNA scaffold in some embodiments, the SaCas9 gRNA scaffold comprises or is encoded by the polynucleotide of SEQ ID NG:4.
• the Cas9 protein is a SaCas9 protein encoded by the polynucleotide of SEQ ID NO:11.
• the vector comprises at least one polynucleotide selected from SEQ ID NOs: 1-13 and 24.
• the vector comprises the polynucleotide sequence of SEQ ID NO: 24.
• the vector comprises a polynucleotide sequence that is selected from SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:2G, SEQ ID NO:21 ,
• the vector is a viral vector.
• the vector is an Adeno-assodated virus (AAV) vector.
• AAV vector is AAV1 , AAV2, AAV3, AAV4, AAV5, AA 6, AAV7, AAV8, AAV9, AAV-10, AAV-11 , AAV-12, AAV-13, or AAVrh.74.
• the vector comprises a ubiquitous promoter or a tissue-specific promoter operably linked to the polynucleotide sequence encoding the first gRNA molecule, the second gRNA molecule, and/or the Cas9 protein.
• the tissue-specific promoter is a muscle specific promoter.
• the disclosure relates to a ceil comprising the herein described system.
• kits comprising the herein described system.
• Another aspect of the disclosure provides a method of correcting a mutant dystrophin gene in a cell. The method may include administering to a cell the herein described system
• Another aspect of the disclosure provides a method of genome editing a mutant dystrophin gene in a subject.
• the method may include administering to the subject a herein described system or ceil.
• the system or ce!i may be administered to the subject intramuscularly, intravenously, or a combination thereof.
• Another aspect of the disclosure provides a method of treating a subject having a mutant dystrophin gene.
• the method may include administering to the subject the herein described system or ceil.
• the system or cell may be administered to the subject intramuscularly, intravenously, o a combination thereof.
• FIG. 1 shows the two deletion prone hotspots in dystrophin.
• the dystrophin gene (which may be referred to as DMD) is the largest known gene in humans (2.3 Mbp).
• FIG. 2 shows details relating to the exon 45 through exon 55 mutational hotspot. Approximately 45% of all DMD mutations, and many commonly deleted single exons, are located in this region. Patients with exon 45 io 55 in-frame deletion display milder dystrophic phenotype. AONs (antisense oligonucleotides) have been used to induce exon skipping in this region.
• FIG. 3 shows excision of exons 45 through 55 of dystrophin. This system is being tested in a humanized mouse carrying the human gene with a deletion of exon 52.
• FIG. 4 shows injection of a system to excise exons 45 through 55 of dystrophin in neonatal mice.
• Neonatal mice were systemicaiiy injected at 2 days postnatal (P2) Muscles were harvested 8 weeks post-treatment.
• PGR bands show the intended deletion.
• FIG. 5 shows dystrophin expression in systemicaiiy treated mice. 10x
• FIG, 8 shows the traditional two vector system as compared to the one vector system.
• Advantages to the one vector system may include: having all necessary editing components on a single vector, ability to increase effective dose, streamlining of other vector production (single therapeutic agent), use/incorporation of muscle-specific promoters (CK8, Spc512, MHCK7), and ability to target combinations of exons and large deletions (by changing guide sequences).
• FIG, 7 shows a vector design comparison.
• the all-in-one vector components include: SaCas9 (-3.2 kb); mini po!yadeny!ation signai (8Q bp) or bGH polyadeny!ation signai (232 bp); constitutive EFS promoter (252 bp) or muscle specific promoter)
• FIG, 8 shows the all-in-one vector for deletion of exons 45-55 and in vitro analyses in HEK293s.
• FIG, 9A is a schematic diagram of the dystrophin gene from immortalized myoblasts isolated from a DMD patient, showing the deletion of exons 48-50.
• FIG, 9B shows results from deletion PCR of genomic DNA and cDNA from treated DMD patients, indicating that exon 45-55 was effectively deleted with vectors as detaiied herein.
• FSG, 9C is a Western blot of cell lysates, showing that untreated myoblasts produced no dystrophin protein, while transfected myoblasts expressed a smaller dystrophin protein compared to the positive control, consistent with hotspot deletion.
• FIG. 11 is a schematic diagram of the versions of all-in-one vector 5.
• FIG, 12 are images of TA muscle cells 8 weeks after injection with the vectors as indicated, at 1 Gx magnification.
• FIG, 14 are graphs showing the stability of all-in-one (AIO) vectors in vivo.
• the left graph are results from qPCR using TA samples 8 weeks post-injection.
• gRNAs As described herein, certain methods and engineered gRNAs have been discovered to be useful with CR!SPR/CRISPR-assoeiated (Gas) 9-based gene editing systems for altering the expression, genome engineering, and correcting or reducing the effects of mutations in the dystrophin gene involved in genetic diseases, such as DMD.
• the disclosed gRNAs were generated to target sites that are more amenable to clinical translation.
• the gene encoding S. pyogenes Cas9 (SpCas9) is too large to be delivered by adeno-associaied virus (AAV), a vector used for the systemic gene delivery to muscle when all other necessary regulatory sequences are included.
• AAV adeno-associaied virus
• the disclosed gRNAs were selected and screened for use with S. aureus Cas9 (SaCas9), which is about 1 kb smaller than SpCas9
• SaCas9 S. aureus Cas9
• the disclosed gRNAs, which target human dystrophin gene sequences, can be used with the CR!SPR/Cas9-based system to target exons 45 to 55 of the human dystrophin gene, causing genomic deietions of this region in order to restore expression of functional dystrophin in ceils from DMD patients.
• the presently disclosed subject matter also provides for methods for delivering the genetic constructs (e.g., vectors) or compositions comprising thereof to skeletal muscle and cardiac muscle.
• the vector can be an AAV, including modified AAV vectors.
• the presently disclosed subject matter describes a way to deliver active forms of this class of therapeutics to skeletal muscle or cardiac muscle that is effective, efficient, and facilitates successful genome modification, as well as provide a means to rewrite the human genome for therapeutic applications and target model species for basic science applications.
• the methods may relate to the use of a single AAV vector for the delivery of all of the editing components necessary for the excision of exons 45 through 55 of dystrophin.
• each intervening number there between with the same degree of precision is explicitly contemplated.
• the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1 , 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.Q are explicitly contemplated.
• the term“about” or“approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system.
• “about” can mean within 3 or more than 3 standard deviations, per the practice in the art.
• “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1 % of a given value.
• the term“about” refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 1 1 %, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
• the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value
• Adeno-associated virus or“AAV” as used interchangeably herein refers to a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species. AAV is not currently known to cause disease and consequently the virus causes a very rnlid immune response.
• Boding region refers to the region within a nuclease target region that is recognized and bound by the nuciease.
• Cardiac muscle or“heart muscie” as used interchangeably herein means a type of involuntary striated muscie found in the walis and histological foundation of the heart, the myocardium. Cardiac muscie is made of cardio myocytes or myocardiocytes.
• cardiac muscle condition refers to a condition related to the cardiac muscle, such as cardiomyopathy, heart failure, arrhythmia, and inflammatory heart disease.
• Coding sequence or“encoding nucieic acid” as used herein means the nucleic acids (RNA or DNA molecule) that comprise a nucleotide sequence which encodes a protein.
• the coding sequence can further include initiation and termination signals operabiy linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucieic acid is administered.
• the coding sequence may be codon optimized.
• “Complement” or“complementary” as used herein means a nucleic acid can mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucieotides or nucleotide analogs of nucleic acid molecules. “Complementarity” refers to a property shared between two nucleic acid sequences, such that when they are aligned antiparailel to each other, the nucleotide bases at each position will be complementary.
• “Correcting”,“genome editing,” and“restoring” as used herein refers to changing a mutant gene that encodes a truncated protein or no protein at ail, such that a full-length functional or partially fu!l-!ength functional protein expression is obtained.
• Correcting or restoring a mutant gene may include replacing the region of the gene that has the mutation or replacing the entire mutant gene with a copy of the gene that does not have the mutation with a repair mechanism such as homology-directed repair (HDR).
• HDR homology-directed repair
• Correcting or restoring a mutant gene may also include repairing a frameshlft mutation that causes a premature stop codon, an aberrant splice acceptor site, or an aberrant splice donor site, by generating a double stranded break in the gene that is then repaired using non-homologous end joining (NHEJ). NHEJ may add or delete at least one base pair during repair which may restore the proper reading frame and eliminate the premature stop codon. Correcting or restoring a mutant gene may also include disrupting an aberrant splice acceptor site or splice donor sequence.
• NHEJ non-homologous end joining
• Correcting or restoring a mutant gene may also include deleting a non-essential gene segment by the simultaneous action of two nucleases on the same DNA strand in order io restore the proper reading frame by removing the DNA between the two nuclease target sites and repairing the DNA break by NHEJ.
• directional promoter refers to two or more promoters that are capable of driving transcription of two separate sequences in both directions.
• one promoter drives transcription from 5’ to 3’ and the other promoter drives transcription from 3’ to 5’.
• bidirectional promoters are double-strand transcription control elements that can drive expression of at least two separate sequences, for example, coding or non-coding sequences, in opposite directions.
• Such promoter sequences may be composed of two individual promoter sequences acting in opposite directions, such as one nucleotide sequence linked to the other (complementary) nucleotide sequence, including packaging constructs comprising the two promoters in opposite directions, for example, by hybrid, chimeric or fused sequences comprising the two individual promoter sequences, or at. ieast core sequences thereof, or else by only one transcription regulating sequence that can initiate the transcription in both directions.
• the two individual promoter sequences in some embodiments, may be juxtaposed or a linker sequence can be located between the first and second sequences.
• a promoter sequence may be reversed to be combined with another promoter sequence in the opposite orientation.
• Genes located on both sides of a bidirectional promoter can be operab!y linked to a single transcription control sequence or region that drives the transcription in both directions.
• the bidirectional promoters are not juxtaposed.
• one promoter may drive transcription on the 5’ end of a nucleotide fragment, and another promoter may drive transcription from the 3’ end of the same fragment.
• a first gene can be operably linked to the bidirectional promoter with or without further regulatory elements, such as a reporter or terminator elements, and a second gene can be operably linked to the bidirectional promoter in the opposite direction and by the complementary promoter sequence, again with or without further regulatory elements.
• Donor DNA refers to a double-stranded DNA fragment or molecule that includes at ieast a portion of the gene of interest.
• the donor DNA may encode a full-functional protein or a partially- fu notional protein.
• DMD Duchenne Muscular Dystrophy
• DMD is a common hereditary monogenic disease and occurs in 1 in 3500 males.
• DMD is the result of inherited or spontaneous mutations that cause nonsense or frame shift mutations in the dystrophin gene.
• the majority of dystrophin mutations that cause DMD are deletions of exons that disrupt the reading frame and cause premature translation termination in the dystrophin gene.
• DMD patients typically lose the ability to physically support themselves during childhood, become progressively weaker during the teenage years, and die in their twenties
• Dystrophin refers to a rod-shaped cytoplasmic protein which is a part of a protein complex that connects the cytoskeieton of a muscle fiber to the surrounding extracellular matrix through the cell membrane.
• Dystrophin provides structural stability to the dystroglycan complex of the cell membrane that is responsible for regulating muscle cell integrity and function.
• the dystrophin gene or“DMD gene” as used interchangeably herein is 2.2 megabases at locus Xp21 .
• the primary transcription measures about 2,400 kb with the mature mRNA being about 14 kb. 79 exons code for the protein which is over 3500 amino acids.
• Exons 45 through 55 of dystrophin as used herein refers to an area where roughly 45% of all dystrophin mutations are located. Exon 45- ⁇ 55 deletions are associated with very miid Becker phenotypes and have even been found in asymptomatic individuals. Exon 45-55 muitiexon skipping would be beneficial for roughly 5G% of all DMD patients.
• “Frameshift” or“frameshift mutation” as used interchangeably herein refers to a type of gene mutation wherein the addition or deletion of one or more nucleotides causes a shift in the reading frame of the codons in the mRNA.
• the shift in reading frame may lead to the alteration in the amino acid sequence at protein translation, such as a missense mutation or a premature stop codon.
• A“functional gene” refers to a gene transcribed to mRNA, which is translated to a functional protein.
• Fusion protein refers to a chimeric protein created through the joining of two or more genes that originally coded for separate proteins. The translation of the fusion gene resuits in a single polypeptide with functional properties derived from each of the original proteins.
• Geneetic construct refers to the DNA or RNA molecules that comprise a nucleotide sequence that encodes a protein.
• the coding sequence includes initiation and termination signals operably linked to regulatory elements including a promoter and poiyadenyiation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered.
• the term“expressible form” refers to gene constructs that contain the necessary regulatory elements operably linked to a coding sequence that encodes a protein such that when present in the cel! of the individual, the coding sequence will be expressed
• Genetic disease refers to a disease, partially or completely, directly or indirectly, caused by one or more abnormalities in the genome, especially a condition that is present from birth.
• the abnormality may be a mutation, an insertion or a deletion.
• the abnormality may affect the coding sequence of the gene or its regulatory sequence.
• the genetic disease may be, but not limited to DMD, Becker Muscular Dystrophy (BMD), hemophilia, cystic fibrosis, Huntington's chorea, familial hypercholesterolemia (LDL receptor defect), hepatoblastoma, Wilson's disease, congenital hepatic porphyria, inherited disorders of hepatic metabolism, Lesch Nyhan syndrome, sickle cel!
• anemia tha!assaemias, xeroderma pigmentosum, Fanconi's anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, and Tay-Sachs disease.
• HDR Homology-directed repair
• a homologous piece of DNA is present in the nucleus, mostly in G2 and S phase of the ceil cycle.
• HDR uses a donor DNA template to guide repair and may be used to create specific sequence changes to the genome, including the targeted addition of whole genes. If a donor template is provided along with the CR!SPR/Cas9-based gene editing system, then the cellular machinery will repair the break by homologous recombination, which is enhanced several orders of magnitude in the presence of DNA cleavage. When the homologous DNA piece is absent, non-homologous end joining may take place instead.
• Genome editing refers to changing a gene. Genome editing may include correcting or restoring a mutant gene. Genome editing may include knocking out a gene, such as a mutant gene or a norma! gene. Genome editing may be used to treat disease or enhance muscle repair by changing the gene of interest
• nucleic acids or polypeptide sequences means that the sequences have a specified percentage of residues that are the same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence Identity in cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation.
• thymine (T) and uracil (U) may be considered equivalent identity may be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2 0
• “Mutant gene” or“mutated gene” as used interchangeably herein refers to a gene that has undergone a detectable mutation. A mutant gene has undergone a change, such as the ioss, gain, or exchange of genetic material, which affects the normal transmission and expression of the gene.
• A“disrupted gene” as used herein refers to a mutant gene that has a mutation that causes a premature stop codon. The disrupted gene product is truncated relative to a full-length undisrupted gene product.
• Non-homologous end joining (NHEJ) pathway refers to a pathway that repairs double-strand breaks in DNA by directly ligating the break ends without the need for a homologous template.
• the template-independent re-ligation of DNA ends by NHEJ is a stochastic, error-prone repair process that introduces random micro-insertions and micro-deletions (indeis) at the DNA breakpoint. This method may be used to intentionally disrupt, delete, or alter the reading frame of targeted gene sequences.
• NHEJ typically uses short homologous DNA sequences called microhomologies to guide repair. These microhomologies are often present in single-stranded overhangs on the end of double-strand breaks. When the overhangs are perfectly compatible, NHEJ usually repairs the break accurately, yet imprecise repair leading to loss of nucleotides may also occur, but is much more common when the overhangs are not compatible.
• Normal gene refers to a gene that has not undergone a change, such as a loss, gain, or exchange of genetic material.
• the normal gene undergoes normal gene transmission and gene expression.
• a normal gene may be a wild-type gene.
• Nuclease mediated NHEJ refers to NHEJ that is initiated after a nuclease, such as a Cas9 molecule, cuts double stranded DNA.
• nucleic acid or“oligonucleotide” or“polynucleotide” as used herein means at least two nucleotides covalently linked together.
• the depiction of a single strand also defines the sequence of the complementary strand.
• a nucleic acid also encompasses the complementary strand of a depicted single strand.
• Many variants of a nucleic acid may be used for ibe same purpose as a given nucleic acid.
• a nucleic acid also
• nucleic acid encompasses substantially identical nucleic acids and complements thereof.
• a single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions.
• a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.
• Nucleic acids may be single stranded or double stranded or may contain portions of both double stranded and single stranded sequence.
• the nucleic acid may be DNA, both genomic and cDNA, R A, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine.
• Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.
• “Gperably linked” as used herein means that expression of a gene is under the control of a promoter with which it is spatially connected.
• a promoter may be positioned 5’ (upstream) or 3' (downstream) of a gene under its control.
• the distance between the promoter and a gene may be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance may be accommodated without loss of promoter function
• Partiai!y-funciionai as used herein describes a protein that is encoded by a mutant gene and has less biological activity than a functional protein but more than a nonfunctional protein.
• Premature stop codon or“out-of-frame stop codon” as used interchangeably herein refers to nonsense mutation in a sequence of DNA, which results in a stop codon at location not normally found in the wild-type gene.
• a premature stop codon may cause a protein to be truncated or shorter compared to the fuli-iength version of the protein.
• Promoter means a synthetic or naturally-derived molecule which is capable of conferring, activating or enhancing expression of a nucleic acid in a cell.
• a promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or to alter the spatial expression and/or temporal expression of same.
• a promoter may also comprise distal enhancer or repressor elements, which may be located as much as several thousand base pairs from the start site of transcription.
• a promoter may be derived from sources including viral, bacterial, fungal, plants, insects, and animals.
• a promoter may regulate the expression of a gene component constitutively (constitutive promoter), or differentially with respect to ceil, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents.
• promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter, human U8 (hU8) promoter, and CMV IE promoter.
• muscle-specific promofers may include a MHCK7 promoter, a CK8 promoter, and a Spc512 promoter
• Skeletal muscle refers to a type of striated muscle, which is under the control of the somatic nervous system and attached to bones by bundles of collagen fibers known as tendons. Skeletal muscle is made up of individual components known as myocytes, or “muscle ceils”, sometimes colloquially called “muscle fibers.” Myocytes are formed from the fusion of developmental myoblasts (a type of embryonic progenitor cell that gives rise to a muscle cell) in a process known as myogenesis. These iong, cylindrical, muitinucieated ceils are also called myofibers
• “Skeletal muscle condition” as used herein refers to a condition related to the skeletal muscle, such as muscular dystrophies, aging, muscle degeneration, wound healing, and muscle weakness or atrophy.
• a mammal e.g., cow, pig, camel, llama, horse, goat, rabbit, sheep, hamsters, guinea pig, cat, dog, rat, and mouse
• a non-human primate for example, a monkey, such as a cynomo!gous or rhesus monkey, chimpan
• Target gene refers to any nucleotide sequence encoding a known or putative gene product.
• the target gene may be a mutated gene involved in a genetic disease.
• the target gene is a human dystrophin gene.
• the target gene is a mutant human dystrophin gene.
• Target region refers to the region of the target gene to which the CRiSPR/Cas9-based gene editing system is designed to bind and cleave.
• Transgene refers to a gene or genetic material containing a gene sequence that has been isolated from one organism and is introduced into a different organism. This non-native segment of DNA may retain the ability to produce RNA or protein in the transgenic organism, or it may alter the normal function of the transgenic organism's genetic code. The introduction of a transgene has the potential to change the phenotype of an organism
• “Variant” used herein with respect to a nucleic acid means (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide sequence or portion thereof; (iii) a nucleic acid that is substantially identical to a referenced nucleic acid or the complement thereof; or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, complement thereof, or a sequences substantially identical thereto.
• Variant with respect to a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity.
• Variant may also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity.
• a conservative substitution of an amino acid i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophiiicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes may be identified, in part, by considering the hydropathic index of amino acids, as understood in the art. Kyle et a!., J. Mol. Biol.
• the hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes may be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of ⁇ 2 are substituted.
• the hydrophiiicity of amino acids may also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophiiicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophiiicity of that peptide. Substitutions may be performed with amino acids having hydrophiiicity values within +2 of each other.
• hydrophobicity index and the hydrophiiicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the a ino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophiiicity, charge, size, and other properties
• Vector as used herein means a nucleic acid sequence containing an origin of replication.
• a vector may be a viral vector, bacteriophage, bacterial artificial chromosome or yeast artificial chromosome.
• a vector may be a DNA or RNA vector.
• a vector may be a self- replicating extrachromosomal vector, and preferably, is a DNA plasmid.
• any nomenclatures used in connection with, and techniques of, ceil and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art.
• the meaning and scope of the terms should be clear; in the event however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition.
• singular terms shall include pluralities and plural terms shall include the singular.
• the dystrophin gene may be a human dystrophin gene.
• the genetic constructs include at least one gRNA that targets a dystrophin gene sequence(s).
• the at least one gRNA may target human and/or rhesus monkey dystrophin gene sequences and may be SaCas9 ⁇ compatible targets.
• the disclosed gRNAs can be included in a CRiSPR/Cas9-based gene editing system, Including systems that use SaCas9, to target exons 45 through 55 of the human dystrophin gene.
• the disciosed gRNAs which may be included in a CRISPR/Cas9-based gene editing system, can cause genomic deletions of the region of exons 45 through 55 of the human dystrophin gene in order to restore expression of functional dystrophin in cells from DMD patients. a. Dystrophin Gene
• Dystrophin is a rod-shaped cytoplasmic protein that is a part of a protein complex that connects the cytoskeleton of a muscle fiber to the surrounding extracellular matrix through the cell membrane.
• Dystrophin provides structural stability to the dystroglycan complex of the cell membrane.
• the dystrophin gene is 2.2 megabases at locus Xp21.
• the primary transcription measures about 2,400 kb with the mature mRNA being approximately 14 kb.
• Normal skeleton muscle tissue contains only small amounts of dystrophin, but its absence of abnormal expression leads to the development of severe and incurable symptoms.
• DMD is the result of inherited or spontaneous mutations that cause nonsense or frame shift mutations in the dystrophin gene. Naturally occurring mutations and their consequences are relatively well understood for DMD. In-frame deletions that occur in the exon 45-55 regions (FIG, 1 , F!G. 2) contained within the rod domain can produce highly functional dystrophin proteins, and many carriers are asymptomatic or display mild symptoms.
• BMD Becker muscular dystrophy
• BMD has a wide array of phenotypes, but often if deletions are between exons 45-55 of dystrophin, the phenotype is much milder compared to DMD.
• changing a DMD genotype to a BMD genotype is a common strategy to correct dystrophin.
• There are many strategies to correct dystrophin many of which rely on restoring the reading frame of the endogenous dystrophin. This shifts the disease genotype from DMD to Becker muscular dystrophy.
• Many BMD patients have intragenic deletions that maintain the translational reading frame, leading to a shorter but largely functional dystrophin protein.
• exons 45-55 such as deletion or excision of exons 45 through 55 by, for example, NHEJ
• modification of exons 45-55 to restore reading frame ameliorates the phenotype DMD in subjects, including DMD subjects with deletion mutations.
• Exons 45 through 55 of a dystrophin gene refers to the 45th exon, 46th exon, 47th exon, 48th exon, 49th exon, 50th exon, 51st exon, 52nd exon, 53rd exon, 54th exon, and the 55th exon of the dystrophin gene. Mutations in the 45th through 55th exon region are ideally suited for permanent correction by NHEJ-based genome editing.
• the presently disclosed genetic constructs can generate deletions in the dystrophin gene.
• the dystrophin gene may be a human dystrophin gene in certain embodiments, the vector is configured to form two double stand breaks (a first double strand break and a second double strand break) in two introns (a first intron and a second intron) flanking a target position of the dystrophin gene, thereby deleting a segment of the dystrophin gene comprising the dystrophin target position.
• A“dystrophin target position” can be a dystrophin exonic target position or a dystrophin intra-exonic target position, as described herein. Deietion of the dystrophin exonic target position can optimize the dystrophin sequence of a subject suffering from Duchenne muscular dystrophy.
• the dystrophin exonic target position can comprise one or more exons of the dystrophin gene in certain embodiments, the dystrophin target position comprises exon 51 of the dystrophin gene (e.g., human dystrophin gene).
• a presently disclosed genetic construct can mediate highly efficient gene editing at the exon 45 through exon 55 region of a dystrophin gene.
• a presently disclosed genetic construct can restore dystrophin protein expression in cells from DMD patients.
• Elimination of exons 45 through 55 from the dystrophin transcript by exon skipping can be used to treat approximately 50% of ail DMD patients.
• This class of dystrophin mutations is suited for permanent correction by NHEJ-based genome editing and HDR.
• the genetic constructs described herein have been developed for targeted modification of exon 45 through exon 55 in the human dystrophin gene
• a presently disclosed genetic construct may be transfected into human DMD cells and mediate efficient gene modification and conversion to the correct reading frame. Protein restoration may be concomitant with frame restoration and detected in a bulk population of CRlSPR/Cas9- based gene editing system-treated ceils.
• CRISPR System CRISPR System
• a presently disclosed genetic construct may encode a CR!SPR/Cas9-based gene editing system that is specific for a dystrophin gene.
• “Clustered Regularly Interspaced Short Palindromic Repeats” and“CRiSPRs”, as used interchangeably herein, refers to loci containing multiple short direct repeats that are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea.
• the CRISPR system is a microbial nuclease system involved in defense against invading phages and plasmids that provides a form of acquired immunity.
• the CRISPR loci in microbial hosts contain a combination of CRiSPR-associated (Cas) genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage.
• Short segments of foreign DNA, called spacers are incorporated into the genome between CRISPR repeats, and serve as a 'memory' of past exposures.
• Cas9 forms a complex with the 3’ end of the sgRNA (also referred interchangeably herein as“gRNA”), and the protein- RNA pair recognizes its genomic target by complementary base pairing between the 5' end of the sgRNA sequence and a predefined 20 bp DNA sequence, known as the protospacer.
• This complex is directed to homologous loci of pathogen DNA via regions encoded within the crRNA, i.e , the protospacers, and protospacer-adjacent motifs (PAMs) within the pathogen genome.
• the non-coding CRISPR array is transcribed and cleaved within direct repeats into short crRNAs containing individual spacer sequences, which direct Cas nucieases to the target site (protospacer).
• the Cas9 nuciease can be directed to new genomic targets.
• CRISPR spacers are used to recognize and silence exogenous genetic elements in a manner analogous to RNAi in eukaryotic organisms.
• Type II effector system carries out. targeted DNA double-strand break in four sequential steps, using a single effector enzyme, Cas9, to cleave dsDNA.
• Cas9 a single effector enzyme
• Type !l effector system may function in alternative contexts such as eukaryotic cells.
• the Type II effector system consists of a long pre-crRNA, which is transcribed from the spacer-containing CRISPR locus, the Cas9 protein, and a tracrRNA, which is involved in pre-crRNA processing.
• the tracrRNAs hybridize to the repeat regions separating the spacers of the pre-crRNA, thus initiating dsRNA cleavage by endogenous RNase III. This cleavage is followed by a second cleavage event within each spacer by Cas9, producing mature crRNAs that remain associated with the tracrRNA and Cas9, forming a Cas9:crRNA ⁇ tracrRNA complex.
• the Cas9:crRNA-tracrRNA complex unwinds the DNA duplex and searches for sequences matching the crRNA to cleave. Target recognition occurs upon detection of complementarity between a“protospacer” sequence in the target DNA and the remaining spacer sequence in the crRNA. Cas9 mediates cleavage of target DNA if a correct
• PAM protospacer-adjacent motif
• SpCas9 the sequence must be immediately followed by the protospacer- adjacent motif (PAM), a short sequence recognized by the Cas9 nuclease that is required for DNA cleavage.
• PAM protospacer- adjacent motif
• Different Type !l systems have differing PAM requirements.
• the S pyogenes CRISPR system may have the PAM sequence for this Cas9 (SpCas9) as 5’-NRG- 3’, where R is either A o G, and characterized the specificity of this system in human cells
• a unique capability of the CRISPR/Cas9-based gene editing system is the straightforward ability to simultaneously target multiple distinct genomic loci by co-expressing a single Cas9 protein with two or more sgRNAs.
• the Streptococcus pyogenes Type II system naturally prefers fo use an“NGG” sequence, where“N” can be any nucleotide, but also accepts other PAM sequences, such as“NAG” in engineered systems (Hsu et ai., Nature Biotechnology (2013) doi:10.1 G38/nbt.2647).
• the Cas9 derived from Neisseria meningitidis normally has a native PAM of NNNNGATT, but has activity across a variety of PAMs, including a highly degenerate NNNNGNNN PAM (Esvelt et ai. Nature Methods (2013) doi:1 G.1 G38/nmeth.2681).
• N can be any nucleotide residue, e.g., any of A, G, C, or T.
• Cas9 molecules can be engineered to alter the PAM specificity of the Cas9 molecule.
• gRNA synthetically reconstituted“guide RNA”
• sgRNA chimeric single guide RNA
• CRISPR/Cas9 ⁇ based engineered systems for use in genome editing and treating genetic diseases.
• the CRISPR/Cas9-based engineered systems can be designed to target any gene, Including genes involved in a genetic disease, aging, tissue regeneration, or wound healing.
• the CRISPR/Cas9-based gene editing systems can include a Cas9 protein or Cas9 fusion protein and at least one gRNA. in certain embodiments, the system comprises two gRNA molecules.
• the Cas9 fusion protein may, for example, include a domain that has a different activity that what is endogenous to Cas9, such as a transactivation domain.
• the target gene e.g., a dystrophin gene, e.g., human dystrophin gene
• a dystrophin gene can be involved in differentiation of a ceil or any other process in which activation of a gene can be desired, or can have a mutation such as a frameshift mutation or a nonsense mutation if the target gene has a mutation that causes a premature stop codon, an aberrant splice acceptor site or an aberrant splice donor site
• the CRiSPR/Cas9-based gene editing system can be designed to recognize and bind a nucleotide sequence upstream or downstream from the premature stop codon, the aberrant splice acceptor site or the aberrant splice donor site.
• the CRiSPR-Cas9-based system can aiso be used to disrupt normal gene splicing by targeting splice acceptors and donors to induce skipping of premature stop codons or restore a disrupted reading frame.
• the CRISPR/Cas9-based gene editing system may or may not mediate off-target changes to protein-coding regions of the genome.
• the CRISPR/Cas9-based gene editing system can include a Cas9 protein or a Cas9 fusion protein.
• Cas9 protein is an endonuclease that cleaves nucleic acid and is encoded by the CRISPR loci and is involved in the Type II CRISPR system.
• the Cas9 protein can be from any bacterial or archaea species, including, but not limited to,
• Streptococcus pyogenes Staphylococcus aureus ⁇ S . aureus
• Acidovorax avenae
• Actinobacillus p!eumpneumoniae Actinobaciilus succinogenes , Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans , Aminomonas paucivorans, Bacillus cereus,
• Brady rhizobi urn sp. Brevibacilius laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus Puniceispirillum, Clostridium celluioiyticum, Clostridium perfringens, Corynebacterium accoiens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium doiichum, gamma proteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter musteiae, ilyobacter polytropus, Kinge!la kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes,
• Rhodopseudomonas palustris Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus iugdunensis, Streptococcus sp.,
• the Cas9 molecule is a Streptococcus pyogenes Cas9 molecule (aiso referred herein as“SpCas9”). in certain embodiments, the Cas9 molecule is a Streptococcus pyogenes Cas9 molecule (aiso referred herein as“SpCas9”). in certain embodiments, the Cas9 molecule is a Streptococcus pyogenes Cas9 molecule (aiso referred herein as“SpCas9”). in certain embodiments, the Cas9 molecule is a
• Staphylococcus aureus Cas9 molecule also referred herein as“SaCas9”.
• a Cas9 molecule or a Cas9 fusion protein can interact with one or more gRNA molecule and, in concert with the gRNA molecule(s), localizes to a site which comprises a target domain, and in certain embodiments, a PAM sequence.
• the ability of a Cas9 molecule or a Cas9 fusion protein to recognize a PAM sequence can be determined, for example, using a transformation assay as known in the art.
• the ability of a Cas9 molecule or a Cas9 fusion protein to interact with and cleave a target nucleic acid is PAM sequence dependent.
• a PAM sequence is a sequence in the target nucieic acid in certain embodiments, cleavage of the target nucieic acid occurs upstream from the PAM sequence.
• N can be any nucleotide residue, e.g., any of A, G, C, or T.
• Gas9 molecules can be engineered to alter the PAM specificity of the Cas9 molecule.
• the vector encodes at least one Cas9 molecule that recognizes a Protospacer Adjacent Motif (PAM) of either NNGRRT (SEG ID NO: 27) or NNGRRV (SEQ ID NO: 28).
• PAM Protospacer Adjacent Motif
• the at ieast one Cas9 molecuie is an S. aureus Cas9 moiecule. in certain embodiments, the at ieast one Cas9 molecuie is a mutant S. aureus Cas9 molecule.
• a nucleic acid encoding a Cas9 molecule or Cas9 polypeptide may comprise a nuclear localization sequence (NLS).
• Nuclear localization sequences are known in the art.
• Exemplary codon optimized nucleic acid sequences encoding a Cas9 molecule of S. aureus , and optionally containing nuclear localization sequences (NLSs), are set forth in SEQ ID NOs: 31-37.
• Another exemplary codon optimized nucleic acid sequence encoding a Cas9 molecule of S. aureus comprises the nucleotides 1293-4451 of SEQ ID NO: 38.
• the nucleotide sequence encoding a S. aureus Cas9 molecule includes the polynucleotide sequence of SEQ ID NO: 37.
• An amino acid sequence of an S. aureus Cas9 molecule is set forth in SEQ ID NO: 39.
• An amino acid sequence of an S. aureus Cas9 molecule is set forth in SEQ ID NO: 4Q.
• the CRISPR/Cas9-based gene editing system can include a fusion protein.
• the fusion protein can comprise two heterologous polypeptide domains, wherein the first polypeptide domain comprises a Gas protein and the second polypeptide domain has an activity such as transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, nucleic acid association activity, methylase activity, or demethy!ase activity.
• the fusion protein can include a Cas9 protein or a mutated Cas9 protein, fused to a second polypeptide domain that has an activity such as transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, nucleic acid association activity, methylase activity, or demeihy!ase activity.
• the second polypeptide domain can have transcription activation activity, i.e , a transactivation domain.
• a transactivation domain For example, gene expression of endogenous mammalian genes, such as human genes, can be achieved by targeting a fusion protein of ICas9 and a transactivation domain to mammalian promoters via combinations of gRNAs.
• the transactivation domain can include a p3G0 protein, VP18 protein, multiple VP16 proteins, such as a VP48 domain or VP64 domain, or p65 domain of NF kappa B transcription activator activity.
• the fusion protein may be dCas9-VP64 or dCas9-p300.
• the second polypeptide domain can have transcription repression activity.
• the second polypeptide domain can have a Kruppel associated box activity, such as a KRAB domain, ERF repressor domain activity, Mxi! repressor domain activity, SID4X repressor domain activity, Mad-SID repressor domain activity or TATA box binding protein activity.
• the fusion protein may be dCas9 ⁇ KRAB.
• the second polypeptide domain can have transcription release factor activity.
• the second polypeptide domain can have eukaryotic release factor 1 (ERF1) activity or eukaryotic release factor 3 (ERF3) activity.
• the second polypeptide domain can have histone modification activity.
• the second polypeptide domain can have histone deacetylase, histone aeeiyltransferase, histone demethylase, or histone metbyltransferase activity.
• the histone aeeiyltransferase may be p300 or CREB-binding protein (CBP) protein, or fragments thereof.
• the fusion protein may be dCas9-p3GQ.
• the second polypeptide domain can have nuclease activity that is different from the nuclease activity of the Cas9 protein.
• a nuclease, or a protein having nuclease activity is an enzyme capable of cleaving the phosphodiester bonds between the nucleotide subunits of nucleic acids Nucieases are usually further divided into endonucieases and exonucleases, although some of the enzymes may fall in both categories. Well known nucleases are deoxyribonuclease and ribonuclease.
• the second polypeptide domain can have nucleic acid association activity or nucleic acid binding protein-DNA-binding domain (DBD) is an independently folded protein domain that contains at least one motif that recognizes double- or single-stranded DNA
• a DBD can recognize a specific DNA sequence (a recognition sequence) or have a general affinity to DNA.
• nucleic acid association region selected from the group consisting of he!ix- tum-heiix region, leucine zipper region, winged helix region, winged helix-tum-heiix region, heiix-ioop-helix region, immunoglobulin fold, B3 domain, Zinc finger, HMG-box, Wor3 domain, TAL effector DNA-binding domain.
• the second polypeptide domain can have methylase activity, which involves transferring a methyl group to DNA, RNA, protein, small molecule, cytosine or adenine.
• the second polypeptide domain may include a DNA ethy!transferase.
• the second polypeptide domain can have demethylase activity.
• the second polypeptide domain can include an enzyme that remove methyl (CH3-) groups from nucleic acids, proteins (in particular histones), and other molecules.
• the second polypeptide can covert the methyl group to hydroxymethylcytosine in a mechanism for demethylating DNA.
• the second polypeptide can catalyze this reaction.
• the second polypeptide that catalyzes this reaction can be Tet1.
• the CR!SPR/Cas9-based gene editing system includes at least one gRNA molecule, for example, two gRNA molecules.
• the gRNA provides the targeting of a CRISPR/Cas9-based gene editing system.
• the gRNA is a fusion of two noncoding RNAs: a crRNA and a tracrRNA.
• the sgRNA may target any desired DNA sequence by exchanging the sequence encoding a 20 bp protospacer which confers targeting specificity through complementary base pairing with the desired DNA target.
• the gRNA mimics the naturally occurring crRNA:tracrRNA duplex involved in the Type !l Effector system.
• This duplex which may include, for example, a 42-nucleotide crRNA and a 75-nucleotide tracrRNA, acts as a guide for the Cas9 to cleave the target nucleic acid.
• The“target region’’,“target sequence,” or“protospacer” may be used interchangeably herein and refers to the region of the target gene (e.g., a dystrophin gene) to which the GRISPR/Cas9-based gene editing system targets.
• the CRISPR/Cas9-based gene editing system may include at least one gRNA, wherein each gRNA targets a different DNA sequence.
• the target DNA sequences may be overlapping.
• the target sequence or protospacer is followed by a PAM sequence at the 3’ end of the protospacer.
• Different Type II systems have differing PAM requirements.
• the Streptococcus pyogenes Type II system uses an“NGG” sequence, where “N” can be any nucleotide in some embodiments, the PAM sequence may be“NGG”, where“N” can be any nucleotide.
• the PAM sequence may be NNGRRT (SEQ ID NO: 27) or NNGRRV (SEQ ID NO: 28).
• the number of gRNA molecules encoded by a presently disclosed genetic construct can be at least 1 gRNA, at least 2 different gRNAs, at least 3 different gRNAs, at least 4 different gRNAs, at least 5 different gRNAs, at least 8 different gRNAs, at least 7 different gRNAs, at least 8 different gRNAs, at least 9 different gRNAs, at least 10 different gRNAs, at least 11 different gRNAs, at least 12 different gRNAs, at least 13 different gRNAs, at least 14 different gRNAs, at least 15 different gRNAs, at least 16 different gRNAs, at least 17 different gRNAs, at least 18 different gRNAs, at least 18 different gRNAs, at least 20 different gRNAs, at least 25 different gRNAs, at least 30 different gRNAs, at least 35 different gRNAs, at least 40 different gRNAs, at least 45 different gRNA
• the number of gRNA molecules encoded by a presently disclosed genetic construct can be less than 50 gRNAs, less than 45 different gRNAs, less than 40 different gRNAs, less than 35 different gRNAs, less than 30 different gRNAs, less than 25 different gRNAs, less than 20 different gRNAs, less than 19 different gRNAs, less than 18 different gRNAs, less than 17 different gRNAs, less than 16 different gRNAs, less than 15 different gRNAs, less than 14 different gRNAs, less than 13 different gRNAs less than 12 different gRNAs, less than 1 1 different gRNAs, less than 10 different gRNAs, less than 9 different gRNAs, less than 8 different gRNAs, less than 7 different gRNAs, less than 6 different gRNAs, less than 5 different gRNAs, less than 4 different gRNAs, or less than 3 different gRNAs.
• the number of gRNAs encoded by a presently disclosed genetic construct can be between at least 1 gRNA to at least 50 different gRNAs, at least 1 gRNA to at least 45 different gRNAs, at least 1 gRNA to at least 40 different gRNAs, at least 1 gRNA to at least 35 different gRNAs, at least 1 gRNA to at least 30 different gRNAs, at least 1 gRNA to at least 25 different gRNAs, at least 1 gRNA to at least 20 different gRNAs, at least 1 gRNA to at least 16 different gRNAs, at least 1 gRNA to at least 12 different gRNAs, at least 1 gRNA to at least 8 different gRNAs, at least 1 gRNA to at least 4 different gRNAs, at least 4 gRNAs to at least 50 different gRNAs, at least 4 different gRNAs to at least 45 different gRNAs, at least 4 different gRNAs to at least 40 different gRNAs, at least 4 different
• the genetic construct (e.g., an AAV vector) encodes one gRNA molecule, i.e. , a first gRNA molecule, and optionally a Cas9 molecule.
• a first genetic construct (e.g., a first AAV vector) encodes one gRNA molecule, i.e., a first gRNA molecule, and optionally a Cas9 molecule
• a second genetic construct (e.g., a second AAV vector) encodes one gRNA molecule, i.e., a second gRNA molecule, and optionally a Cas9 molecule.
• the gRNA molecule comprises a targeting domain (also referred to as a targeting sequence), which is a complementary polynucleotide sequence of the target DNA sequence followed by a PAM sequence.
• the gRNA may comprise a“G” at the 5’ end of the targeting domain or complementary polynucleotide sequence.
• the targeting domain of a gRNA molecule may comprise at least a 10 base pair, at least a 11 base pair, at least a 12 base pair, at least a 13 base pair, at least a 14 base pair, at least a 15 base pair, at least a 18 base pair, at least a 17 base pair, at least a 18 base pair, at least a 19 base pair, at least a 20 base pair, at least a 21 base pair, at least a 22 base pair, at least a 23 base pair, at least a 24 base pair, at least a 25 base pair, at least a 30 base pair, or at least a 35 base pair complementary polynucleotide sequence of the target DNA sequence followed by a PAM sequence.
• the targeting domain of a gRNA molecule may comprise less than a 40 base pair, less than a 35 base pair, less than a 30 base pair, less than a 25 base pair, less than a 20 base pair, less than a 19 base pair, less than a 18 base pair, less than a 17 base pair, less than a 16 base pair, less than a 15 base pair, less than a 14 base pair, less than a 13 base pair, less than a 12 base pair, less than a 1 1 base pair, or less than a 10 base pair complementary polynucleotide sequence of the target DNA sequence followed by a PAM sequence in certain embodiments, the targeting domain of a gRNA molecule has 19-25 nucleotides in length in certain embodiments, the targeting domain of a gRNA molecule is 20 nucleotides in length.
• the targeting domain of a gRNA molecule is 21 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 22 nucleotides in length. In certain embodiments, the targeting domain of a gRNA molecule is 23 nucleotides in length.
• the gRNA may target a region of the dystrophin gene (DMD).
• the gRNA can target at least one of exons, introns, the promoter region, the enhancer region, the transcribed region of the dystrophin gene in certain embodiments, the gRNA molecule targets intron 44 of the human dystrophin gene.
• the gRNA molecule targets intron 55 of the human dystrophin gene.
• a first gRNA and a second gRNA each target an intron of a human dystrophin gene such that exons 45 through 55 are deleted.
• a gRNA may bind and target a polynucleotide sequence corresponding to SEQ ID NO: 2 or a fragment thereof or a complement thereof.
• a gRNA may be encoded by a polynucleotide sequence comprising SEQ ID NO: 2 or a fragment thereof or a complement thereof.
• the targeting sequence of the gRNA may comprise the polynucleotide of SEQ ID NO: 2 or a fragment thereof, such as a 5’ truncation thereof, or a complement thereof.
• Truncations may be, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15 nucleotides shorter than SEQ ID NO: 2.
• the gRNA may bind and target the polynucleotide of SEQ ID NO: 2 in some embodiments, the gRNA may bind and target a 5' truncation of the polynucleotide of SEQ ID NO: 2.
• a gRNA may bind and target a polynucleotide sequence corresponding to SEQ ID NO: 3 or a fragment thereof or a complement thereof
• a gRNA may be encoded by a polynucleotide sequence comprising SEQ ID NO: 3 or a fragment thereof or a complement thereof.
• the targeting sequence of the gRNA may comprise the polynucleotide of SEQ ID NO: 3 or a fragment thereof, such as a 5’ truncation thereof, or a complement thereof. Truncations may be, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or 15 nucleotides shorter tban SEQ ID NO: 3.
• the gRNA may bind and target the polynucleotide of SEQ ID NO: 3.
• the gRNA may bind and target a 5’ truncation of the polynucleotide of SEQ ID NO: 3.
• a gRNA that binds and targets or is encoded by a polynucleotide sequence comprising or corresponding to SEQ ID NO: 2 or truncation thereof is paired with a gRNA that binds and targets or is encoded by a polynucleotide sequence comprising or corresponding to SEQ ID NO: 3 or truncation thereof.
• Single or multiplexed gRNAs can be designed to restore the dystrophin reading frame by targeting the mutational hotspot in exons 45-55 of dystrophin. Foiiowing treatment with a presently disclosed vector, dystrophin expression can be restored In Duchenne patient muscle cells in vitro. Human dystrophin was detected in vivo following
• candidate gRNAs are evaluated and chosen based on off-target activity, on-target activity as measured by surveyor, and distance from the exon
• the CRISPR/Cas9 ⁇ based gene editing system includes at least one gRNA scaffold.
• the gRNA scaffold facilitates Cas9 binding to the gRNA and endonuclease activity.
• the gRNA scaffold is a polynucleotide sequence that follows the gRNA targeting sequence. Together, the gRNA targeting sequence and gRNA scaffold form one polynucleotide.
• the gRNA scaffold comprises the polynucleotide sequence of SEQ ID NO: 4, or a complement thereof.
• the gRNA scaffold is encoded by the polynucleotide sequence of SEQ ID NO: 4, or a complement thereof.
• the gRNA comprises a polynucleotide that targets a sequence of SEQ ID NO: 2 or SEQ ID NO: 3 or a truncation thereof, and a polynucleotide corresponding to or encoded by the gRNA scaffold of SEQ ID NO: 4.
• the DNA targeting compositions include at least one gRNA molecule (for example, two gRNA molecules) that targets a dystrophin gene (for example, human dystrophin gene), as described above.
• the at least one gRNA molecule can bind and recognize a target region.
• the target regions can be chosen immediately upstream of possible out-of-frame stop codons such that insertions or deletions during the repair process restore the dystrophin reading frame by frame conversion.
• Target regions can also be splice acceptor sites or splice donor sites, such that insertions or deletions during the repair process disrupt splicing and restore the dystrophin reading frame by splice site disruption and exon exclusion.
• Target regions can also be aberrant stop codons such that insertions or deletions during the repair process restore the dystrophin reading frame by eliminating or disrupting the stop codon.
• the presently disclosed DNA targeting composition includes a first gRNA and a second gRNA.
• the first gRNA molecule and the second gRNA molecule may bind or target a polynucleotide of SEQ ID NO:2 and SEQ ID NO:3, respectively, or a truncation or a complement thereof.
• the first gRNA molecule and the second gRNA molecule may comprise a polynucleotide corresponding to SEQ ID NO:2 and SEQ ID NO:3, respectively, or a truncation or a complement thereof
• the deletion efficiency of the presently disclosed vectors can be related to the deletion size, i.e., the size of the segment deleted by the vectors in certain embodiments, the length or size of specific deletions is determined by the distance between the PAM sequences in the gene being targeted (e.g., a dystrophin gene).
• a specific deletion of a segment of the dystrophin gene which is defined in terms of its leng th and a sequence it comprises (e.g., exon 51), is the result of breaks made adjacent to specific PAM sequences within the target gene (e.g., a dystrophin gene).
• the deletion size is about 50 to about 2,000 base pairs (bp), e.g., about 50 to about 1999 bp, about 50 to about 1900 bp, about 50 to about 1800 bp, about 50 to about 1700 bp, about 50 to about 1850 bp, about 50 to about 1800 bp, about 50 to about 1500 bp, about 50 to about 1400 bp, about 50 to about 1300 bp, about 50 to about 1200 bp, about 50 to about 1150 bp, about 50 to about 1100 bp, about 50 to about 1000 bp, about 50 to about 900 bp, about 50 to about 850 bp, about 50 to about 800 bp, about 50 to about 750 bp, about 50 to about 700 bp, about 50 to about 600 bp, about 50 to about 500 bp, about 50 to about 400 bp, about 50 to about 350 bp, about 50 to about 300 bp, about 50 to about 250 bp, about 50 to about 250
• the genetic construct may be a vector.
• the vector may be a modified AAV vector.
• the composition may include a polynucleotide sequence encoding a CR!SPR/Cas9-hased gene editing system.
• the composition may deliver active forms of CRISPR/Cas9-based gene editing systems to skeletal muscle or cardiac muscle.
• the presently disclosed genetic constructs can be used in correcting or reducing the effects of mutations in the dystrophin gene involved in genetic diseases and/or other skeletal or cardiac muscle conditions, such as, for example, DMD.
• compositions may further comprise a donor DNA or a iransgene.
• compositions may be used in genome editing, genome engineering, and correcting or reducing the effects of mutations in genes involved in genetic diseases and/or other skeletal and/or cardiac muscle conditions a.
• a CRiSPR/Cas9 ⁇ based gene editing system specific for dystrophin gene is disclosed herein.
• the CRISPR/Cas9 ⁇ based gene editing system may include Cas9 and at least one gRNA to target the dystrophin gene.
• the CRISPR/Cas9-based gene editing system may bind and recognize a target region.
• the target regions may be chosen immediately upstream of possible out-of-frame stop codons such that insertions or deletions during the repair process restore the dystrophin reading frame by frame conversion.
• Target regions may also be splice acceptor sites or splice donor sites, such that insertions or deletions during the repair process disrupt splicing and restore the dystrophin reading frame by splice site disruption and exon exclusion.
• Target regions may also be aberrant stop codons such that insertions or deletions during the repair process restore the dystrophin reading frame by eliminating or disrupting the stop codon.
• Target regions may include an intron of the dystrophin gene.
• Target regions may include an exon of the dystrophin gene.
• composition may also include a viral delivery system in certain embodiments.
• the vector is an adeno-associated virus (AAV) vector.
• AAV vector is a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species. AAV vectors may be used to deliver AAV.
• AAV vectors may deliver Cas9 and gRNA expression cassettes on separate vectors or on the same vector.
• small Cas9 proteins derived from species such as Staphylococcus aureus or Neisseria meningitidis
• both the Cas9 and up to two gRNA expression cassettes may be combined in a single AAV vector within the 4.7 kb packaging limit.
• the AAV vector is a modified AAV vector.
• the modified AAV vector may have enhanced cardiac and skeletal muscie tissue tropism.
• the modified AAV vector may be capable of delivering and expressing the CRiSPR/Cas9-based gene editing system in the cel! of a mammal.
• the modified AAV vector may be an AAV-SASTG vector (Piacentino et al. (2012) Human Gene Therapy 23:835-646).
• the modified AAV vector may deliver nucleases to skeletal and cardiac muscle in vivo.
• the modified AAV vector may be based on one or more of several capsid types, including AAV1 , AAV2, AAV5, AAV6, AAV8, and AAV9
• the modified AAV vector may be based on AAV2 pseudotype with alternative muscle-tropic AAV capsids, such as AAV2/1 , AAV2/6, AAV2/7, AAV2/8, AAV2/9, AAV2.5, and AAV/SASTG vectors that efficiently transduce skeletal muscle or cardiac muscle by systemic and local delivery (Seto et al. Current Gene Therapy (2012) 12:139-151)
• the modified AAV vector may be AAV2I8G9 (Shen et a!. J. Biol. Chem. (2013) 288:28814-28823).
• the AAV vector may be AAVrh74.
• the genome editing may be in a skeletal uscle and/or cardiac muscle of a subject.
• the method may comprise administering to the skeletal muscle and/or cardiac muscle of the subject the system or composition for genome editing, as described above.
• the genome editing may include correcting a mutant gene or inserting a transgene. Correcting the mutant gene may include deleting, rearranging, or replacing the mutant gene. Correcting the mutant gene may include nuclease-mediated NHEJ or HDR b, Methods of Correcting a Mutant Gene and Treating a Subject
• a mutant gene e.g , a mutant dystrophin gene, e.g., a mutant human dystrophin gene
• the method can include administering to a cell or a subject a presently disclosed system or genetic construct (e.g., a vector) or a composition comprising thereof as described above.
• the method can comprise
• a vector e.g., a vector
• a composition comprising the same for genome editing in skeletal muscle and/or cardiac muscle as described above.
• Use of the presently disclosed system or genetic construct (e.g., a vector) or a composition comprising the same to deliver the CR!SPR/Cas9-based gene editing system to the skeletal muscle or cardiac muscle may restore the expression of a fui!y-functionai or partially- functional protein with a repair template or donor DNA, which can replace the entire gene or the region containing the mutation.
• the CR!SPR/Cas9-based gene editing system may be used to introduce site-specific double strand breaks at targeted genomic loci.
• Site-specific double-strand breaks are created when the GRISPR/Cas9-based gene editing system binds to a target DNA sequences, thereby permitting cleavage of the target DNA.
• This DNA cleavage may stimulate the natural DNA-repair machinery, leading to one of two possible repair pathways: homology-directed repair (HDR) or the non-homologous end joining (NHEJ) pathway.
• HDR homology-directed repair
• NHEJ non-homologous end joining
• CRiSPR/Cas9-based gene editing systems may involve using homology-directed repair or nuclease-mediated non-homologous end joining (NHEJ)-based correction approaches, which enable efficient correction in proliferation-limited primary ceil lines that may not be amenable to homologous recombination or selection-based gene correction.
• NHEJ nuclease-mediated non-homologous end joining
• NHEJ is a nuclease mediated NHEJ, which in certain embodiments, refers to NHEJ that is initiated a Cas9 molecule, cuts double stranded DNA.
• the method comprises administering a presently disclosed genetic construct (e.g., a vector) or a composition comprising thereof to the skeletal muscle or cardiac muscle of the subject for genome editing in skeletal muscle or cardiac muscle.
• Nuclease mediated NHEJ gene correction may correct the mutated target gene and offers several potential advantages over the HDR pathway.
• NHEJ does not require a donor template, which may cause nonspecific insertionai mutagenesis.
• NHEJ operates efficiently in all stages of the ceil cycle and therefore may be effectively exploited in both cycling and post-mitotic DCis, such as muscle fibers.
• the method as described above further includes administrating a donor template to the ceil.
• the donor template may include a nucleotide sequence encoding a full-functional protein or a partially-functional protein.
• the donor template may include a miniaturized dystrophin construct, termed minidystrophin (“minidys”), a full- functional dystrophin construct for restoring a mutant dystrophin gene, or a fragment of the dystrophin gene that after homology-directed repair leads to restoration of the mutant dystrophin gene.
• minidystrophin minidystrophin
• the present disclosure is also directed to genome editing with the CR!SPR/Cas9- based gene editing system to restore the expression of a full-functional or partially-functional protein with a repair template or donor DNA, which can replace the entire gene or the region containing the mutation.
• the CR!SPR/Cas9-hased gene editing system may be used to introduce site-specific double strand breaks at targeted genomic loci. Site-specific doublestrand breaks are created when the CR!SPR/Cas9-based gene editing system binds to a target DNA sequences using the gRNA, thereby permitting cleavage of the target DNA.
• the CRISPR/Gas9-based gene editing system has the advantage of advanced genome editing due to their high rate of successful and efficient genetic modification. This DNA cleavage may stimulate the natural DNA-repair machinery, leading to one of two possible repair pathways: homoiogy-directed repair (HDR) or the non-homologous end joining (NHEJ) pathway.
• HDR homoiogy
• the present disclosure is directed to genome editing with CRISPR/Cas9-based gene editing system without a repair template, which can efficiently correct the reading frame and restore the expression of a functional protein involved in a genetic disease.
• the disclosed GRISPR/Cas9-based gene editing system and methods may involve using homology-directed repair or nuclease-mediated non-homologous end joining (NHEJ)-based correction approaches, which enable efficient correction in proliferation-limited primary cell lines that may not be amenable to homologous recombination or selection-based gene correction.
• NHEJ non-homologous end joining
• This strategy integrates the rapid and robust assembly of active CRISPR/Cas9- based gene editing system with an efficient gene editing method for the treatment of genetic diseases caused by mutations in nonessentia! coding regions that cause framesbifts, premature stop codons, aberrant splice donor sites or aberrant splice acceptor sites.
• the present disclosure provides methods of correcting a mutant gene in a ceil and treating a subject suffering from a genetic disease, such as DMD.
• the method may include administering to a ceil or subject a CR!SPR/Cas9-based gene editing system, a polynucleotide or vector encoding said CRISPR/Cas9-based gene editing system, or composition of said CRISPR/Cas9-based gene editing system as described above.
• the method may include administering a CRiSPR/Cas9-based gene editing system, such as administering a Cas9 protein or Cas9 fusion protein containing a second domain having nuclease activity, a nucleotide sequence encoding said Cas9 protein or Cas9 fusion protein, and/or at least one gRNA, wherein the gRNAs target different DNA sequences.
• the target DNA sequences may be overlapping.
• the number of gRNA administered to the cell may be at least 1 gRNA, at least 2 different gRNA, at least 3 different gRNA at least 4 different gRNA, at least 5 different gRNA, at least 6 different gRNA, at least 7 different gRNA, at least 8 different gRNA, at least 9 different gRNA, at least 10 different gRNA, at least 15 different gRNA, at least 20 different gRNA, at least 30 different gRNA, or at least 50 different gRNA, as described above.
• the method may involve homology-directed repair or non-homologous end joining c.
• the present disclosure is directed to a method of treating a subject in need thereof.
• the method comprises administering to a tissue of a subject the presently disclosed system or genetic construct (e.g., a vector) or a composition comprising thereof, as described above.
• the method may comprise administering to the skeletal muscle or cardiac muscle of the subject the presently disclosed system or genetic construct (e.g , a vector) or composition comprising thereof, as described above in certain embodiments, the method may comprise administering to a vein of the subject the presently disclosed system or genetic construct (e.g., a vector) or composition comprising thereof, as described above.
• the subject is suffering from a skeletal muscle or cardiac muscle condition causing degeneration or weakness or a genetic disease.
• the subject may be suffering from Duchenne muscular dystrophy, as described above. i) Duefier e muscular dystrophy
• the method may be used for correcting the dystrophin gene and recovering full-functional or partially-functional protein expression of said mutated dystrophin gene.
• the disclosure provides a method for reducing the effects (e.g , clinical symptoms/indications) of DMD In a patient.
• the disclosure provides a method for treating DMD in a patient in some aspects and embodiments the disclosure provides a method for preventing DMD in a patient. In some aspects and embodiments the disclosure provides a method for preventing further progression of DMD in a patient.
• compositions may comprise one or more genetic constructs that encode the CRISPR/Cas9-based gene editing system, as disclosed herein.
• the genetic construct such as a plasmid, may comprise a nucleic acid that encodes the CRISPR/Cas9-based gene editing system, such as the Cas9 protein and/or Cas9 fusion proteins and/or at least one of the gRNAs.
• the compositions, as described above may comprise genetic constructs that encodes the modified AAV vector and a nucleic acid sequence that encodes the CRISPR/Cas9-based gene editing system, as disclosed herein.
• the genetic construct such as a plasmid, may comprise a nucleic acid that encodes the CRISPR/Cas9-based gene editing system.
• the compositions, as described above, may comprise genetic constructs that encodes the modified !entiviral vector, as disclosed herein.
• the genetic construct such as a recombinant plasmid or recombinant viral particle, may comprise a nucleic acid that encodes the Cas9-fusion protein and at least one gRNA.
• the genetic construct may comprise a nucleic acid that encodes the Cas9-fusion protein and at least two different gRNAs.
• the genetic construct may comprise a nucleic acid that encodes the Cas9-fusion protein and more than two different gRNAs.
• the genetic construct may comprise a promoter that operably linked to the nucleotide sequence encoding the at least one gRNA molecule and/or a Cas9 molecule.
• the promoter is operably linked to the nucleotide sequence encoding a first gRNA molecule, a second gRNA molecule, and/or a Cas9 molecule.
• the genetic construct may be present in the ceil as a functioning extrachromosomal molecule.
• the genetic construct may be a linear minichromosome including centromere, telomeres or plasmids or cosmids.
• the genetic construct may aiso be part of a genome of a recombinant viral vector, including recombinant lentivirus, recombinant adenovirus, and recombinant adenovirus associated virus.
• the genetic construct may be part of the genetic material in attenuated live microorganisms or recombinant microbial vectors which live in cells.
• the genetic constructs may comprise regulatory elements for gene expression of the coding sequences of the nucleic acid.
• the regulatory elements may be a promoter, an enhancer, an initiation codon, a stop codon, or a polyadenylation signal.
• the genetic construct is a vector.
• the vector can be an Adeno-associaied virus (AAV) vector, which encode at least one Cas9 molecule and at least one gRNA molecule; the vector is capable of expressing the at least one Cas9 molecule and the at least gRNA molecule, in the ceil of a mammal.
• AAV Adeno-associaied virus
• the vector can be a plasmid.
• the vectors can be used for in vivo gene therapy.
• the vector may be recombinant.
• the vector may comprise heterologous nucleic acid encoding the fusion protein, such as the Cas9 ⁇ fusion protein or CRiSPR/Cas9-based gene editing system.
• the vector may be a plasmid.
• the vector may be useful for transfecting cells with nucleic acid encoding the Cas9-fusion protein or CR!SPR/Cas9-based gene editing system, which the transformed host cell is cultured and maintained under conditions wherein expression of the Cas9-fusion protein or the CR!SPR/Cas9-based gene editing system takes place.
• Coding sequences may be optimized for stability and high levels of expression.
• codons are selected to reduce secondary structure formation of the RNA such as that formed due io intramolecular bonding.
• the vector may comprise heterologous nucleic acid encoding the CRISPR/Cas9- based gene editing system and may further comprise an initiation codon, which may be upstream of the CRISPR/Cas9-based gene editing system coding sequence, and a stop codon, which may be downstream of the CRISPR/Cas9-based gene editing system coding sequence.
• the initiation and termination codon may be in frame with the CRISPR/Gas9- based gene editing system coding sequence.
• the vector may aiso comprise a promoter that is operably linked to the CRISPR/Cas9 ⁇ based gene editing system coding sequence.
• the promoter that is operably linked to the CRISPR/Cas9-based gene editing system coding sequence may be a promoter from simian virus 40 (SV4G), a mouse mammary tumor virus ( TV) promoter, a human immunodeficiency virus (HIV) promoter such as the bovine immunodeficiency virus (BIV) long terminal repeat (LTR) promoter, a Moloney virus promoter, an avian leukosis virus (ALV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter, Epstein Barr virus (EBV) promoter, a U8 promoter, such as the human U6 promoter, or a Rous sarcoma virus (RSV) promoter.
• SV4G simian virus 40
• TV mammary tumor virus
• HSV human immunodeficiency virus
• HSV human immunodeficiency virus
• BIV bovine immunodeficiency virus
• LTR long terminal repeat
• the promoter may also be a promoter from a human gene such as human ubiquitin C (hllbC), human actin, human myosin, human hemoglobin, human muscle creatine, or human metalothionein.
• the promoter may also be a tissue specific promoter, such as a muscle or skin specific promoter, natural or synthetic. Examples of such promoters are described In US Patent Application Publication Nos. US20Q40175727 and US2QQ40192593, the contents of which are incorporated herein in their entirety.
• muscle-specific promoters include a Spc5-12 promoter (described in US Patent Application Publication No. US 20Q40192593, which is incorporated by reference herein in its entirety; Hakim et al. Mol. Ther.
• a MHCK7 promoter (described in Salva et al., Mol. Ther. (2QQ7) 15:320-329), a CK8 promoter (described in Park et al. PLoS ONE (2015) 10(4): e0124914), and a CK8e promoter (described in Muir et al., Mol. Ther. Methods Clin. Dev. (2014) 1 :14025).
• the expression of the gRNA and/or Cas9 protein is driven by tRNAs
• Each of the polynucleotide sequences encoding the gRNA molecule and/or Cas9 molecule may each be operabiy linked to a promoter.
• the promoters that are operabiy linked to the gRNA molecule and/or Gas9 molecule may be the same promoter.
• the promoters that are operabiy linked to the gRNA molecule and/or Cas9 molecule may be different promoters.
• the promoter may be a constitutive promoter, an inducible promoter, a repressible promoter, or a regulatabie promoter.
• the promoter may be a tissue specific promoter.
• the tissue specific promoter may be a muscle specific promoter.
• muscle-specific promoters may include a MHCK7 promoter, a CK8 promoter, and a Spc512 promoter.
• the promoter may be a CK8 promoter, a Spc512 promoter, a MHCK7 promoter, for example
• the vector may also comprise a poiyadenyiation signal, which may be
• the poiyadenyiation signal may be a SV40 poiyadenyiation signal, LTR poiyadenyiation signal, bovine growth hormone (bGH) poiyadenyiation signal, human growth hormone (hGH) poiyadenyiation signal, or human b-giohin poiyadenyiation signal.
• the SV40 poiyadenyiation signal may be a poiyadenyiation signal from a pCEP4 vector (!nvltrogen, San Diego, CA)
• the vector may also comprise an enhancer upstream of the CRiSPR/Cas9- based gene editing system, i.e., the Cas9 protein or Cas9 fusion protein coding sequence or sgRNAs, or the CRISPR/Cas9 ⁇ based gene editing system.
• the enhancer may be necessary for DNA expression.
• the enhancer may be human actin, human myosin, human hemoglobin, human muscle creatine or a viral enhancer such as one from CMV, HA, RSV or EBV.
• Polynucleotide function enhancers are described in U.S. Patent Nos. 5,593,972, 5,962,428, and WO94/016737, the contents of each are fully Incorporated by reference.
• the vector may also comprise a mammalian origin of replication in order to maintain the vector extrachromosomally and produce multiple copies of the vector in a cell.
• the vector may also comprise a regulatory sequence, which may be well suited for gene expression in a mammalian or human ceil into which the vector is administered.
• the vector may also comprise a reporter gene, such as green fluorescent protein (“GFP”) and/or a selectable marker, such as hygromycin (“Hygro”).
• the vector may be expression vectors or systems to produce protein by routine techniques and readily available starting materials including Sambrook et a!., Molecular Cloning and Laboratory Manual, Second Ed., Cold Spring Harbor (1989), which is incorporated fuliy by reference.
• the vector may comprise the nucleic acid sequence encoding the CRISPR/Cas9-based gene editing system, including the nucleic acid sequence encoding the Cas9 protein or Cas9 fusion protein and the nucieic acid sequence encoding the at least one gRNA.
• compositions comprising the above-described genetic constructs.
• the pharmaceutical compositions as detailed herein can be formulated according to the mode of administration to be used. In cases where pharmaceutical compositions are injectable pharmaceutical compositions, they are sterile, pyrogen free and particulate free.
• An isotonic formulation is preferably used. Generally, additives for isotonicity may include sodium chloride, dextrose, mannitol, sorbitol and lactose in some cases, isotonic solutions such as phosphate buffered saline are preferred. Stabilizers include gelatin and albumin. In some embodiments, a vasoconstriction agent is added to the formulation.
• the composition may further comprise a pharmaceutically acceptable excipient.
• the pharmaceutically acceptable excipient may be functional molecules as vehicles, adjuvants, carriers, or diluents.
• the pharmaceutically acceptable excipient may be a transfection facilitating agent, which may include surface active agents, such as immune- stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A, muramy! peptides, quinone analogs, vesicles such as squalene and squaiene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, poiyanions, polycations, or nanoparticies, or other known transfection facilitating agents.
• ISCOMS immune- stimulating complexes
• LPS analog including monophosphoryl lipid A, muramy! peptides, quinone analogs, vesicles such as squalene and squaiene, hyaluronic acid, lipids, lip
• the transfection facilitating agent is a polyanion, polycation, including poly-L- glutamaie (LGS), or lipid.
• the transfection facilitating agent is poly-L-giutamate, and more preferably, the po!y-L-g!utamate is present in the composition for genome editing in skeletal muscle or cardiac muscle at a concentration less than 6 mg/ml.
• the transfection facilitating agent may also include surface acfive agents such as immune-stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A, muramyi peptides, quinone analogs and vesicles such as squaiene and squaiene, and hyaluronic acid may also be used administered in conjunction with the genetic construct.
• the DNA vector encoding the composition may also include a transfection facilitating agent such as lipids, liposomes, including lecithin liposomes or other liposomes known in the art, as a DNA-liposome mixture (see for example International Patent Publication No.
• the transfection facilitating agent is a polyanion, polycation, including poiy-L-glutamate (LGS), or iipid.
• compositions may be the transfection or electroporation of the composition as a nucleic acid molecule that is expressed in the ceil and delivered to the surface of the ceil.
• the nucleic acid molecules may be electroporated using BioRad Gene Pulser Xcell or Amaxa Nucieofector lib devices.
• Transfections may include a transfection reagent, such as Lipofectamine 2000
• the transfected cells Upon delivery of the presently disclosed genetic construct or composition to the tissue, and thereupon the vector into the cells of the mammal, the transfected cells will express the gRNA mo!ecule(s) and the Cas9 molecule.
• the genetic construct or composition may be administered to a mammal to alter gene expression or to re-engineer or alter the genome.
• the genetic construct or composition may be administered to a mam a! to correct the dystrophin gene in a mammal.
• the mammal may be human, non-human primate, cow, pig, sheep, goat, antelope, bison, water buffalo, bovids, deer, hedgehogs, elephants, llama, alpaca, mice, rats, or chicken, and preferably human, cow, pig, or chicken.
• the genetic construct encoding the gRNA moiecule(s) and the Cas9 molecule can be delivered to the mammal by DNA injection (aiso referred to as DNA vaccination) with and without in vivo electroporation, liposome mediated, nanoparticie facilitated, and/or recombinant vectors.
• the recombinant vector can be delivered by any viral mode.
• the viral mode can be recombinant lentivi s, recombinant adenovirus, and/or recombinant adeno-associated virus.
• a presently disclosed genetic construct (e.g., a vector) or a composition comprising thereof can be introduced into a ceil to genetically correct a dystrophin gene (e.g., human dystrophin gene).
• a presently disclosed genetic construct (e.g., a vector) or a composition comprising thereof is introduced into a myoblast cell from a DMD patient in certain embodiments, the genetic construct (e.g., a vector) or a composition comprising thereof is introduced into a fibroblast cell from a DMD patient, and the genetically corrected fibroblast cell can be treated with MyoD to induce differentiation into myoblasts, which can be implanted into subjects, such as the damaged muscles of a subject to verify that the corrected dystrophin protein is functional and/or to treat the subject.
• the modified ceils can also be stem cells, such as induced p!uripotent stem ceils, bone marrow-derived progenitors, skeletal muscle progenitors, human skeletal myoblasts from DMD patients, CD 133+ cells, mesoangioblasts, and MyoD- or Pax7- transduced cells, or other myogenic progenitor cells.
• stem cells such as induced p!uripotent stem ceils, bone marrow-derived progenitors, skeletal muscle progenitors, human skeletal myoblasts from DMD patients, CD 133+ cells, mesoangioblasts, and MyoD- or Pax7- transduced cells, or other myogenic progenitor cells.
• the CRISPR/Cas9-based gene editing system may cause neuronal or myogenic differentiation of an induced pluripotent stem cell.
• the presently disclosed genetic constructs (e.g., vectors) or a composition comprising thereof may be administered to a subject by different routes including orally, parenterally, sublingually, transdermaliy, rectaliy, transmucosaily, topically, via inhalation, via buccal administration, intrapieurally, intravenous, intraarterial, intraperitoneai, subcutaneous, intramuscular, intranasal intrathecal, and iniraarticuiar or combinations thereof in certain embodiments, the presently disclosed genetic construct (e.g., a vector) or a composition is administered to a subject (e.g., a subject suffering from DMD) intramuscularly, intravenously or a combination thereof.
• a subject e.g., a subject suffering from DMD
• the presently disclosed genetic constructs e.g., vectors
• compositions may be administered as a suitably acceptable formulation in accordance with normal veterinary practice.
• the veterinarian may readily determine the dosing regimen and route of administration that is most appropriate for a particular animal.
• the compositions may be administered by traditional syringes, needleless injection devices, "microprojectiie bombardment gone guns", or other physical methods such as
• the presently disclosed genetic construct e.g., a vector
• a composition may be delivered to the mammal by several technologies including DNA injection (also referred to as DNA vaccination) with and without in vivo electroporation, liposome mediated, nanoparticle facilitated, recombinant vectors such as recombinant !entivirus, recombinant adenovirus, and recombinant adenovirus associated virus.
• the composition may be injected into the skeletal muscle or cardiac muscle.
• the composition may be injected into the tibialis anterior muscle or tail
• the presently disclosed genetic construct e.g., a vector
• a composition thereof is administered by 1) tail vein injections (systemic) into adult mice;
• intramuscular injections for example, local injection into a muscle such as the TA or gastrocnemius in adult mice; 3) intraperiioneal injections into P2 mice; or 4) facial vein injection (systemic) into P2 mice.
• Cell types may include, but are not limited to, immortalized myoblast cells, such as wild-type and DMD patient derived lines, for example D48-50 DMD, DMD 6594 (de!48-5G), DMD 8036 (de!48-50), C25C14 and DMD-7796 ceil lines, primal DMD derma!
• immortalized myoblast cells such as wild-type and DMD patient derived lines, for example D48-50 DMD, DMD 6594 (de!48-5G), DMD 8036 (de!48-50), C25C14 and DMD-7796 ceil lines, primal DMD derma!
• fibroblasts induced piuripotent stem cells, bone marrow-derived progenitors, skeletal muscle progenitors, human skeletal myoblasts from DMD patients, CD 133 ⁇ cells, mesoangiob!asts, cardiomyocytes, hepatocytes, chondrocytes, mesenchymal progenitor ceils, hematopoietic stem ceils, smooth muscle ceils, and MyoD- or Pax7-transduced cells, or other myogenic progenitor ceils.
• Immortalization of human myogenic cells can be used for clonal derivation of genetically corrected myogenic cells.
• Cells can be modified ex vivo to isolate and expand clonal populations of immortalized DMD myoblasts that include a genetically corrected dystrophin gene and are free of other nuclease-introduced mutations in protein coding regions of the genome.
• CRISPR/Cas9-based systems by non-virai or non-integrating viral gene transfer, or by direct delivery of purified proteins and gRNAs containing cell-penetrating motifs may enable highly specific correction in situ with minima! or no risk of exogenous DNA integration.
• kits which may be used to correct a mutated dystrophin gene.
• the kit comprises at ieast a gRNA for correcting a mutated dystrophin gene and instructions for using the GRISPR/Cas9-based gene editing system.
• a kit which may be used for genome editing of a dystrophin gene in skeletal muscle or cardiac muscle.
• the kit may comprise genetic constructs (e.g., vectors) or a composition comprising thereof for genome editing in skeletal muscle or cardiac muscle, as described above, and instructions for using said composition.
• kits may be affixed to packaging material or may be included as a package insert. While the instructions are typically written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term“instructions” may include the address of an internet site that provides the instructions.
• the genetic constructs e.g., vectors
• a composition comprising thereof for correcting a mutated dystrophin or genome editing of a dystrophin gene in skeletal muscle or cardiac muscle may include a modified AAV vector that includes a gRNA molecuie(s) and a Cas9 molecule, as described above, that specifically binds and cleaves a region of the dystrophin gene.
• the CR!SPR/Cas9-based gene editing system as described above, may be included in the kit to specifically bind and target a particular region in the mutated dystrophin gene.
• the kit may further include donor DNA, a different gRNA, or a transgene, as described above.
• Conventional CR!SPR/Cas9 systems for the treatment of DMD typically include more than one vector (FIG. 8, FIG. 7).
• one vector may encode a Cas9 protein
• a second vector may encode two gRNAs
• one vector may encode a Cas9 protein and a first gRNA
• a second vector may encode a Cas9 protein and a second gRNA.
• FIG. 3 A schematic of an experiment that uses multiple vectors to excise exons 45-55 of dystrophin in mice is shown in FIG, 3 with results shown in FIG. 4, FIG, 5, and FIG, 10.
• Neonatal mice were treated with the dual vector system via systemic/temporal vein injection. At 8 weeks post-treatment, tissue was harvested.
• PCR and sequencing confirmed the deletion of the mutational hotspot exon 45-55. Additional results are shown in FIG, 10 with either AAV-CRISPR targeting a control locus (FIG. 10, top panel) or targeting exon 45-55 (FIG. 10, bottom panel), showing that widespread dystrophin expression was observed in cardiac muscle after deletion of exon 45-55, but not in sham vector-treated mice.
• Example 1 Additional validation of the CRISPR-based approach to restore functional dystrophin gene with the dual vectors of Example 1 was performed using immortalized myoblasts isolated from a DMD patient.
• the immortalized myoblasts contained a deletion of exons 48-50, creating an out-of-frame mutation (FIG. SA).
• Patient myoblasts were transfected with the same AAV plasmids used in the HEK293 in vitro experiment in Example 1
• a one-vecfor CRISPR/Cas9 system was developed for the treatment of DMD (FIG. 6, FIG, 7).
• Advantages to a one vector system may include having all necessary editing components on a single vector, ability to increase effective dose, streamlining of other vector production (single therapeutic agent), use/incorporation of muscle-specific promoters (for example, CK8, Spc512, MHCK7), and ability to target combinations of exons and large deletions (for example, by changing guide sequences).
• FIG. 8 A schematic diagram of the all-in-one vectors developed is shown in FIG. 8. Sequences included in some or all of the herein described a!l-in-one vectors are shown in TABLE 1.
• FIG, 12, FIG. 13, and FIG 14 show results from testing these constructs in the mdx mouse.
• the all-in-one vectors are further detailed in Examples 4-7.
• Vector 1 contained exon 45-55 targeted gRNAs with ail promoters (U6, H1 , and SaCas9-driving) in forward direction and mini polyadenylation signal for SaCas9.
• Version 1 of vector 1 contained an EFS constitutive promoter.
• the sequence for version 1 of vector 1 is in SEQ ID NO:14
• Version 2 of vector 1 contained a CK8 constitutive promoter.
• the sequence for version 2 of vector 1 is in SEQ ID NQ:15.
• Vector 2 contained exon 45-55 targeted gRNAs with U5 promoter in reverse direction facing away from SaCas9-driving promoter and mini polyadenylation signal for SaCas9.
• Version 1 of vector 2 contained an EFS constitutive promoter.
• the sequence for version 1 of vector 2 is in SEQ ID NO:16.
• Version 2 of vector 2 contained a CK8 constitutive promoter.
• the sequence for version 2 of vector 2 is as in SEQ ID NO:17
• Version 3 of vector 2 contained a Spc512 promoter.
• the sequence for version 3 of vector 2 is as in SEQ ID NO: 18.
• Version 4 of vector 2 contained a MHCK7 promoter.
• the sequence for version 4 of vector 2 is as in SEQ ID NO: 19.
• Vector 3 contained exon 45-55 targeted gRNAs with U6 promoter in reverse direction facing away from SaCas9-driving promoter and mini polyadenylation signal for SaCas9
• Version 1 of vector s contained an EFS constitutive promoter.
• the sequence for version 1 of vector s is as in SEQ ID NQ:2G.
• Version 2 of vector 3 contained a CK8 promoter.
• the sequence for version 2 of vector 3 is as in SEQ ID NO:21
• Version 3 of vector 3 contained a Spc512 promoter.
• the sequence for version 3 of vector 3 is as in SEQ ID NO:22.
• Version 4 of vector s contained a MHCK7 promoter.
• the sequence for version 4 of vector 3 is as in SEQ ID NG:23.
• Version 1 of vector 5 included a constitutive promoter.
• the sequence for version 1 of vector 5 is as in SEQ ID NO: 41 .
• Version 2 of vector 5 included a CK8 promoter.
• the sequence for version 2 of vector 5 is as in SEG ID NO: 42.
• Version 3 of vector 5 included a Spc-512 promoter.
• the sequence for version 3 of vector 5 is as in SEQ ID NO: 29.
• Version 4 of vector 5 included a MHCK7 promoter.
• the sequence for version 4 of vector 5 is as in SEQ ID NO: 30.
• a CRISPR-Cas system comprising one or more vectors encoding a composition, the composition comprising: (a) a first guide RNA (gRNA) moiecuie targeting intron 44 of dystrophin; (b) a second gRNA moiecuie targeting intron 55 of dystrophin; and (c) a Cas9 protein; and (d) one or more Cas9 gRNA scaffolds.
• gRNA first guide RNA
• Cas9 Cas9
• Clause 3 The system of clause 1 , wherein the system comprises two or more vectors, wherein the two or more vectors comprises a first vector and a second vector.
• Clause 4 The system of clause 3, wherein (a) the first vector encodes the first gRNA moiecuie and the second gRNA molecule; and (b) the second vector encodes the Cas9 protein
• Clause 5 The system of clause 3, wherein (a) the first vector encodes the first gRNA moiecuie; and (b) the second vector encodes the second gRNA molecule.
• Clause 7 The system of clause 5 or 6, wherein the second vector further encodes the Cas9 protein.
• Clause 8 The system of any one of clauses 1-7, wherein the expression of the Cas9 protein is driven by a constitutive promoter or a muscle-specific promoter.
• Clause 10 The system of clause 2, wherein the single vector encodes the first gRNA moiecuie, the second gRNA moiecuie, and the Cas9 protein. [000191] Clause 11. The system of any one of clauses 1 -10, wherein the vector comprises at least one bidirectional promoter.
• Clause 12 The system of clause 11 , wherein the bidirectional promoter comprises: a first promoter driving expression of the first gRNA molecule and/or the second gRNA molecule; and a second promoter driving expression of the Cas9 protein.
• Clause 13 The system of any one of clauses 1-12, wherein the first gRNA targets the polynucleotide of SEQ ID NO:2 or a 5’ truncation thereof.
• Clause 14 The system of any one of clauses 1-13, wherein the second gRNA targets the polynucleotide of SEQ ID NO:3 or a 5’ truncation thereof.
• Clause 15 The system of any one of clauses 1-14, wherein the Cas9 protein is SpCas9, SaCas9, or St1 Cas9 protein
• Clause 18 The system of any one of clauses 1-17, wherein the Cas9 protein is a SaCas9 protein encoded by the polynucleotide of SEQ ID NG:11.
• Glause 19 The system of any one of clauses 1 -18, wherein the vector comprises at least one polynucleotide selected from SEQ ID NQs: 1 -13 and 24.
• Clause 20 The system of any one of clauses 1 -19, wherein the vector comprises the polynucleotide sequence of SEQ ID NO: 24.
• Clause 21 The system of any one of clauses 1 -20, wherein the vector comprises a polynucleotide sequence that is selected from SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NG:20, SEQ ID NO:21 ,
• Clause 22 The system of any one of clauses 1-21 , wherein the vector is a viral vector.
• Clause 23 The system of any one of clauses 1-22, wherein the vector is an Adeno-associated virus (AAV) vector.
• AAV Adeno-associated virus
• Clause 25 The system of any one of clauses 1 -24, wherein the vector comprises a ubiquitous promoter or a tissue-specific promoter operably linked to the polynucleotide sequence encoding the first gRNA molecule, the second gRNA molecule, and/or the Cas9 protein.
• Clause 28 A kit comprising the system of any one of clauses 1-26.
• Clause 29 A method of correcting a mutant dystrophin gene in a ceil, the method comprising administering to a cell the system of any one of clauses 1-26.
• Clause 30 A method of genome editing a mutant dystrophin gene in a subject, the method comprising administering to the subject the system of any one of clauses 1-26 or the cell of clause 27
• Clause 31 A method of treating a subject having a mutant dystrophin gene, the method comprising administering to the subject the system of any one of clauses 1 -26 or the cell of clause 27.
• Clause 32 The method of clause 30 or 31 , wherein the system or the cell is administered to the subject intramuscularly, intravenously, or a combination thereof.
• JCR143 DNA target sequence of gRNA targeting human dystrophin intron 44 region
• SEQ ID NO: 4 SaCas9 guide RNA scaffold, scaffold of gRNAs
• SEQ ID NO: 24 polynucleotide encoding SV40 intron
• NNGRR A or G; N can be any nucleotide residue, e.g. , any of A, G, C, or T) SEQ ID NO: 26
• N can be any nucleotide residue, e.g., any of A, G, C, or T)
• SEQ ID NO: 32 codon optimized polynucleotide encoding S. aureas Cas9
• SEQ ID NO: 34 codon optimized polynucleotide encoding S. aureas Cas9
• SEQ ID NO: 38 codon optimized polynucleotide encoding S. aureas Cas9 atggccccaaagaagaagcggaaggtcggtatccacggagt cccagcagccaagcggaactacatcct gggcctggacatcggcatcaccagcgtgggctacggcatcatcgactacgagacacgggacgtgatcg atgccggcgtgcggctgttcaaagaggccaacgtggaaaacaacgagggcaggcggagcaagagaggc gccagaaggctgaagcggcggaggcggcatagaa ccagagagtgaagaagctgctgtgttcgactacaa cctgaccgaccacagcgagctgagcggcatcaacccctacgaggccagaga
• SEQ ID NO: 37 polynucleotide sequence of S. aureus Cas9
• SEQ ID NO: 39 amino acid sequence of an S aureus Cas9 molecule
• SEQ ID NO: 40 amino acid sequence of an S. aureus Cas9

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Medicinal Chemistry (AREA)
• Virology (AREA)
• Pharmacology & Pharmacy (AREA)
• Epidemiology (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Cell Biology (AREA)
• Mycology (AREA)
• Toxicology (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Crystallography & Structural Chemistry (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (14)

Applications Claiming Priority (2)

Publications (1)

Family

ID=72837591

Family Applications (1)

Country Status (17)

Cited By (11)

Families Citing this family (5)

Citations (2)

Family Cites Families (8)

• 2020
  • 2020-04-14 WO PCT/US2020/028148 patent/WO2020214609A1/en not_active Ceased
  • 2020-04-14 MX MX2021012511A patent/MX2021012511A/es unknown
  • 2020-04-14 CA CA3137248A patent/CA3137248A1/en active Pending
  • 2020-04-14 US US17/603,330 patent/US20220184229A1/en active Pending
  • 2020-04-14 AR ARP200101048A patent/AR118670A1/es unknown
  • 2020-04-14 EP EP20790851.8A patent/EP3931331A4/en active Pending
  • 2020-04-14 AU AU2020257898A patent/AU2020257898B2/en active Active
  • 2020-04-14 SG SG11202111172QA patent/SG11202111172QA/en unknown
  • 2020-04-14 CN CN202080028248.2A patent/CN113785063A/zh active Pending
  • 2020-04-14 TW TW109112555A patent/TWI887234B/zh active
  • 2020-04-14 TW TW114119381A patent/TW202536186A/zh unknown
  • 2020-04-14 BR BR112021020515A patent/BR112021020515A2/pt unknown
  • 2020-04-14 JP JP2021560849A patent/JP2022529631A/ja active Pending
  • 2020-04-14 KR KR1020217036783A patent/KR20210151916A/ko active Pending
  • 2020-04-14 EA EA202192815A patent/EA202192815A1/ru unknown
• 2021
  • 2021-10-11 IL IL287163A patent/IL287163A/en unknown
  • 2021-10-13 CL CL2021002680A patent/CL2021002680A1/es unknown
  • 2021-10-14 CO CONC2021/0013692A patent/CO2021013692A2/es unknown
• 2025
  • 2025-01-31 JP JP2025014814A patent/JP2025087680A/ja active Pending

Patent Citations (2)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events