WO2020205426A1 - Identification complète de cibles protéiques interactives à l'aide d'un affichage d'arnm de bibliothèques uniformes - Google Patents

Identification complète de cibles protéiques interactives à l'aide d'un affichage d'arnm de bibliothèques uniformes Download PDF

Info

Publication number
WO2020205426A1
WO2020205426A1 PCT/US2020/024945 US2020024945W WO2020205426A1 WO 2020205426 A1 WO2020205426 A1 WO 2020205426A1 US 2020024945 W US2020024945 W US 2020024945W WO 2020205426 A1 WO2020205426 A1 WO 2020205426A1
Authority
WO
WIPO (PCT)
Prior art keywords
library
protein
mrna
exon
proteins
Prior art date
Application number
PCT/US2020/024945
Other languages
English (en)
Inventor
Yushen DU
Ren Sun
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2020205426A1 publication Critical patent/WO2020205426A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1062—Isolating an individual clone by screening libraries mRNA-Display, e.g. polypeptide and encoding template are connected covalently
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01085—Fatty-acid synthase (2.3.1.85)
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/08—Liquid phase synthesis, i.e. wherein all library building blocks are in liquid phase or in solution during library creation; Particular methods of cleavage from the liquid support
    • C40B50/10—Liquid phase synthesis, i.e. wherein all library building blocks are in liquid phase or in solution during library creation; Particular methods of cleavage from the liquid support involving encoding steps

Definitions

  • the present invention generally relates to methods for assaying protein-protein interactions.
  • Virus-host PPIs offer a particularly complex case as viral proteins are often multi-functional and can form extensive connections with multiple cellular proteins. These physical interactions are often crucial for viral replication and pathogenesis, making them attractive targets for the generation of antiviral drugs.
  • Influenza virus leverages PPIs to hijack and/or interfere with diverse cellular pathways, including growth, apoptosis, metabolism, and the immune response. A comprehensive evaluation of viral host interactions is therefore fundamental for understanding the functional connections between cellular networks and disease pathogenesis.
  • affinity purification-mass spectrometry is one of the most commonly used and well-established methods for detecting protein-protein interactions.
  • AP-MS affinity purification-mass spectrometry
  • high quality antibodies are required for efficient pull-down of the bait protein.
  • This limitation can be partially circumvented by tagging the target protein with high-affinity epitopes, but it is often difficult to express tagged proteins in the cell type of interest, this may result in non-physiological levels of expression, and it is difficult to determine how the tag impacts the protein-protein interactions.
  • the present invention provides methods for assaying
  • protein-protein interactions which comprise a) obtaining an exon library, b) preparing an mRNA library by transcribing the exons of the exon library, c) generating a peptide library by translating the mRNA sequences of the mRNA library, d) generating an mRNA display library by linking the peptides of the peptide library with the mRNA sequences of the mRNA library, e) generating an input library of cDNA sequences by reverse transcription of the mRNA sequences of the mRNA display library, f) enriching the cDNA sequences of the input library to obtain an enriched library of enriched cDNA sequences by using one or more proteins of interest as bait proteins, and g) obtaining enriched peptides from the enriched cDNA sequences, contacting the enriched peptides with the one or more proteins of interest, and analyzing any interactions between the enriched peptides and the one or more proteins of interest.
  • steps a) to f) are repeated one or more times whereby the enriched cDNA sequences are used as the exon library in the repeated steps.
  • step b) comprises adding a T7 promoter and a FLAG peptide sequence.
  • step b) comprises linking the transcribed exons to puromycin.
  • step b) comprises purifying the peptide-mRNA complexes by FLAG tag selection.
  • step f) comprises contacting the cDNA sequences of the input library with the bait proteins and amplifying the cDNA sequences that bind the bait proteins by PCR amplification.
  • the methods comprise sequencing the cDNA sequences of the input library and/or sequencing the enriched cDNA sequences of the enriched library.
  • the exon library is generated from fragmented DNA.
  • the exon library is generated from a given cell type and/or organism of interest.
  • the exon library is obtained from genomic DNA.
  • the methods further comprise minimizing protein fragments that do not represent complete exon sequences by using methods in the art to control the length and composition of the input library or utilizing an open reading frame (ORF) library that is substantially evenly distributed.
  • ORF open reading frame
  • Figure 1 to Figure 3 Construction of human exon library for mRNA display to detect protein-protein interactions.
  • Figure 1 The schematic diagram shows the experimental design of PED. Human exons library was enriched from fragmented DNA. The DNA fragments were transcribed in vitro and translated. Puromycin was utilized to link mRNA to its encoded protein. The nuclear acid and protein fusion complexes were pre-selected using C terminus FLAG tag as an input library. The pre-selected input library was then selected against bait proteins and subjected to high-throughput sequencing to determine the identity and frequency of each exon.
  • Figure 2 Scatter plot shows the correlation between two independent input libraries. Exon frequencies were calculated for each replicate and strong correlation were observed with biological duplicate.
  • Figure 3 The distribution of transcript frequency in input libraries is shown with histogram. Medium gray (blue) bars represent the distribution of exon library, and light gray bars correspond to cDNA library. Dark gray shows overlap between the medium gray and light gray bars.
  • Figure 4 Cellular proteins identified to be interacting with NS1. The corresponding enrichment score is shown. Data is shown as the average of 6 biological replicates and error bars represent standard error.
  • Figure 5 Interactions between NS1 protein and indicated cellular binders were examined by
  • Figure 6 GO enrichment analysis of genes that were identified to be interacting with NS1 through PED.
  • Figure 7 Cellular interaction network of NS1 binders. Interactions with confidence > 0.15 in STRING database were included. Each node represents a cellular binder, and the width of edge represents the confidence level of interactions.
  • FASN, AKTI, PDGFRA, NXF1, CPSF4, SF3B2, and TFAP2C are known host-dependent factors and the orange nodes are host-restriction factors for influenza viral replication, extracted from the IAV database.
  • the large circle indicates the cluster of genes (PABPCI, NXF1, CPSF1, CPSF4, SF3B2) involved in mRNA surveillance.
  • the irregular box indicates the cluster of genes (FASN, AKTI, PDGFRA) in the pathway of regulation of lipid metabolic process.
  • FIG. 8 to Figure 12 PED facilitates identification of binders of low abundance.
  • Figure 8 GO enrichment analysis of genes that were identified to be interacting with NS1 through AP-MS.
  • Figure 9 The Circos plot shows the overlap between proteins identified through expanded PED with AP-MS. On the outside, each arc represents the identity of gene list, using the same color code as shown on the legend (the top section is Expanded PED and the bottom section is AP-MA). On the inside, the dark gray (dark orange color) represents the genes that appear in both methods and light gray (light orange color) represents genes that are unique to one method. Purple lines link the same gene that are shared by multiple gene lists. Blue lines link the different genes where they fall into the same ontology term.
  • Figure 10 Venn plot shows the overlap among the proteins identified through expanded PED, AP-MS, and literature.
  • Figure 11 The cellular abundance of identified protein binders were compared among total cellular proteins, PED and AP-MS methods. Cellular abundance of each protein was quantified with a published cellular proteome database (PRIDE, project: PXD000418, left panel) and correlated transcript abundance was quantified through RNA-seq (right panel). ***P ⁇ 0.001 (Wilcoxon rank sum test).
  • Figure 12 Enrichment scores of each CDS are shown for CPSF4 (left panel) and PABPC1 (right panel). Orange shades indicates the previously reported domain interacting with NS1. Data is shown as the average of 6 biological replicates and error bar represents standard error.
  • FIG. 13 to Figure 19 FASN is required for viral replication and regulated by NS1.
  • FIG 16 to Figure 19 The levels of newly synthesized fatty acids or cholesterol upon expression of indicated viral proteins were examined by GC/MS.
  • Figure 20 to Figure 26 Mechanistic characterization of an NS1 IFN sensitive mutation D92Y.
  • FIG. 22 Inhibition of protein expression by WT or D92Y NS1 proteins using GFP reporter.
  • GFP reporter was transfected in 293T cells together with WT or D92Y NS1 expression plasmid. Fluorescence intensity was examined 24 hours post transfection. Empty vector was used as a control. 3 biological replicates were performed. Represented figures are shown. The histogram of fluorescence intensity is shown on the right panel. K-S test of Green Channel intensity distribution between NS1 and Ctl shows p ⁇ 0.001.
  • Figure 25 Enrichment score of each CDS is shown for CPSF1 binding with WT NS1 protein. The range of amino acids of each fragment is marked in gray boxes.
  • Figure 26
  • IP immunoprecipitation
  • Figure 27 to Figure 29 Generation of exon library for mRNA display.
  • Figure 27 and Figure 28 Gel picture (Figure 27) and histogram (Figure 28) shows the distribution of fragment sizes of the input exon library. Double-strand DNAs, from 25 bp and 1500 bp, were loaded as size markers.
  • Figure 29 Schematic diagram shows the construct of exon library for mRNA display. Enriched exon fragment is shown as the shaded (light blue) box. The sequence on the 5’ end of the Exon Fragment is SEQ ID NO: 1
  • Figure 30 and Figure 31 Quality control of the exon library.
  • Figure 30 The scatter plot shows the correlation of cDNA library and mRNA sequencing. Dots represent the frequency of a transcript/cDNA in each library.
  • Figure 31 The histogram shows the frequency of genes in exon library and cDNA library counted by HTseq software. Medium gray (blue) bars represent the distribution of exon library, and light gray bars correspond to cDNA library. Dark gray is the overlap of the medium gray and light gray portions.
  • Figure 32 Feasibility of detecting protein-protein interaction using exon display.
  • Enrichment of indicated target protein sequences after one round of enrichment 3*HA tag with linker sequence and influenza NS1 gene were spiked into the human exon library at a frequency of 0.01%.
  • Anti-HA antibodies, monoclonal and polyclonal anti- NS1 antibodies were conjugated onto protein G beads as bait proteins, respectively.
  • the enrichment scores of HA and NS1 sequences after one round of selection were measured by real-time PCR and normalized to input. The first bar in each set is 3*HA and the second bar in each set is NS1.
  • Figure 33 Identification of cellular binders of influenza virus NS 1 protein.
  • NS1 with a C-terminal HA tag was expressed in 293 T cells. GFP-HA were expressed as control. Then cell was lysed, centrifuged and proteins in the supernatant were conjugated to anti-HA beads at 4 degrees overnight. Five washes were performed to clean the conjugated bait proteins. These purified baits were then incubated with the input fusion libraries for three hours, precipitated, washed, and the precipitated fractions prepared for next generation sequencing as output library. A total of 6 replicates were performed.
  • FIG. 34 Data analysis procedure. The schematic diagram shows the general process of data analysis. Raw sequencing reads were mapped onto the human hgl9 reference genome. Enrichment scores of each coding DNA sequence (CDS, represent the exons that encode proteins) were calculated as the relative frequency of the CDS in the selection library to that in the input library. Sequencing reads with wrong
  • Figure 35 Quality control of NS1 enrichment of exon library.
  • Figure 36 Confirmation of NS1 binding cellular proteins. Complementary to
  • Figure 37 Enriched GO pathways correlated between Expanded PED and AP-
  • MS MS. GO enrichment analysis was performed for proteins identified by expanded PED method and AP-MS. The enrichment score for each pathway is shown.
  • FIG 38 FASN is required for viral replication. The effect of FASN on viral replication was examined with shRNA knock-down. shRNA construct targeting CPSF1 was transfected in 293T cells. The expression level of FASN was examined by western blot (upper panel). Viral replication capacity in cells with or without FASN knockdown was examined using mCherry reporter assay (bottom panel).
  • Figure 39 Low cell toxicity of C75. Cell viability post C75 treatment was measured by CCK8 assay at 24 hours post-treatment. The doses that were used have low cell toxicity but have significant impact on viral replication (Figure 14), which is shown in log scale.
  • Figure 40 Effect of NS1 on lipid and cholesterol synthesis.
  • Panels A-D The percentage of synthesized lipid over total lipid is shown for myristic acid (14:0), palmitic acid (16:0), palmitoleic acid (16: 1) and stearic acid (18:0). Data is shown as the average of 4 biological replicates and error bar represents standard deviation. No significant differences of cholesterol level were detected among different conditions. *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001 (two-tailed t-test).
  • Figure 41 and Figure 42 D92Y NS1 mutant has reduced binding to CPSF1.
  • Figure 41 Scatter plot shows the MiST score of all proteins detected by AP-MS using WT or mutant NS1 protein as bait. 38 proteins showed to have increased binding to mutant D92Y protein, while 80 has reduced binding to the mutant, including CPSF1 and the known CPSF complex member FIP1L1.
  • Figure 42 Interactions between NS1 proteins (WT and D92Y mutant) with CPSF1 were examined by in vitro binding. FLAG- tagged CPSF1 protein were expressed in 293T cells, purified by FLAG antibody and eluted with FLAG peptides. Binding was performed by incubating purified CPSF1 with HA-tagged NS1 that conjugated to beads by HA antibody.
  • PED Protein interaction detection by Exon Display
  • the multi-functional NS1 protein of influenza A virus was used as model bait to exemplify PED.
  • IAV influenza A virus
  • PED can be used to examine the mechanisms underlying the function and/or activity of a given protein or mutant by, for example, comparing the differential cellular binders of the given protein or mutant with a similar protein or the wildtype protein. PED can also be used as a complementary approach for the identification of PPIs, particularly for the identification of low abundance interactors.
  • NS 1 can directly bind fatty acid synthase (FASN) and affect its function, FASN protein expression was up- regulated with NS1 protein expression alone or during viral infection, and cellular lipid synthesis was significantly up-regulated upon NS1 protein expression.
  • FASN fatty acid synthase
  • PED was used to examine the differential cellular binders of wild type NS 1 and a single point mutant, D92Y, which had been previously shown to weaken the ability of NS1 to disrupt the interferon response, and it was found that the D92Y mutant failed to engage CPSF1, likely resulting in an increased host response.
  • PED provides several advantages over affinity purification-mass spectrometry (AP-MS). For example, PED overcomes some of the limitations of AP-MS by converting the task of detecting a large number of different proteins to that of detecting nuclear acid sequences, thereby significantly increasing the sensitivity and
  • PED also presents advantages over mRNA display by using natural cDNA
  • the evenly distributed input exon libraries enable the identification of interactors with single round of selection, and no specific elution conditions are needed for target binders. Moreover, as the input libraries are extracted from genomic DNA, one not need to re-generate cDNA libraries for each tissue type of a given organism.
  • the information obtained from PED also provides more robust analyses as one can directly map the sequence reads to exons, without the need for peak calling and peak comparison for fragmented cDNA libraries. These advantages also allow scaling up PED for parallel experiments. For these reasons, PED is a unique and advantageous way to detect and analyze protein-protein interactions.
  • the input library was constructed through exon enrichment of a randomly fragmented DNA library.
  • the translated protein fragments may not correlate with an intact exon, and thereby the proteins in the library may not accurately represent the proteome of any particular cell type.
  • C-terminal flag tags and a GFP bait control was used to filter out prematurely stopped or aggregated proteins and furthermore remove fragments with the wrong orientation or frame-shifts during data analysis, the presence of some protein fragments may still remain. Therefore, in some embodiments, the input library may be modified or optimized to minimize protein fragments that do not represent intact exons by, for example, using methods in the art to control the length and composition of input library or to utilize an evenly distributed ORF library.
  • PED is based on direct physical protein-protein interactions, it cannot be used to characterize other indirect protein interactions. Additionally, PED cannot detect interactions that depend on posttranslational modifications or depend on tertiary folds within a protein structure that may cross multiple exons. Further, protein interactions with low affinity or of a transient nature may be difficult to detect or analyze using PED. Therefore, in some embodiments, PED may be used in combination with other methods in the art, such as genome-wide Bi-FC, proximity labeling, protein correlation profiling methods, and the like.
  • PED is exemplified herein using NS1 of influenza A virus (IAV)
  • IAV influenza A virus
  • PED may be used as a quantitative high-throughput method to examine other PPIs of proteins such as those of Hepatitis C Virus (HCV), Human Immunodeficiency Virus (HIV), Zika Virus (ZIKV), other influenza viruses, and the like, alone or in parallel.
  • HCV Hepatitis C Virus
  • HCV Human Immunodeficiency Virus
  • ZIKV Zika Virus
  • other influenza viruses and the like, alone or in parallel.
  • PED for“parallel” analysis one may examine the property of 10 5 or more mutants of a given protein in a single experiment by coupling saturating mutagenesis and high-throughput sequencing. This allows for the discovery of many loss-of-function mutations and offers distinctive opportunities for mechanistic studies.
  • PED Differential screening is an important approach to elucidate the mechanisms underlying loss of function mutations on the viruses and to uncover cellular functions that are activated or inhibited by viral proteins.
  • PED allows one to explore the PPIs across such genetic mutants in a high- throughput manner to uncover related mechanisms.
  • PED is a new assay method for the identification of PPIs, which can be used to interpret functional variations among protein variants and mutants by quantitatively profiling their interactomes.
  • the present invention provides an assay method for protein-protein interactions, which comprises obtaining an exon library of interest, preparing an mRNA library by transcribing the exons of the exon library, generating a peptide library by translating the mRNA sequences of the mRNA library, generating an mRNA display library by linking the peptides of the peptide library with the mRNA sequences of the mRNA library, generating an input library of cDNA sequences by reverse transcription of the mRNA sequences of the mRNA display library, enriching the cDNA sequences of the input library to obtain an enriched library of enriched cDNA sequences by using one or more proteins of interest as bait proteins, and obtaining enriched peptides from the enriched cDNA sequences, contacting the enriched peptides with the one or more proteins of interest, and analyzing any interactions between the enriched peptides and the one or more proteins of interest.
  • the steps from preparing the mRNA library to obtaining enriched cDNA sequences are repeated one or more times using the enriched cDNA sequences as the exon library in the repeated steps.
  • the step of preparing the mRNA library comprises adding a T7 promoter and a FLAG peptide sequence.
  • the step of preparing the mRNA library comprises linking the transcribed exons to puromycin.
  • the step of generating the mRNA display library comprises purifying the peptide-mRNA complexes by FLAG tag selection.
  • the step of enriching the cDNA sequences comprises contacting the cDNA sequences of the input library with the bait proteins and amplifying the cDNA sequences that bind the bait proteins by PCR amplification.
  • the cDNA sequences of the input library and/or the enriched cDNA sequences of the enriched library are sequenced.
  • the exon library is generated from fragmented DNA.
  • the exon library is generated from a given cell type and/or organism of interest.
  • the exon library is obtained from genomic DNA.
  • the exon library is obtained from fragmented genomic DNA.
  • the method further comprises minimizing protein fragments that do not represent complete exon sequences by using methods in the art to control the length and composition of the input library or utilizing an open reading frame (ORF) library that is substantially evenly distributed.
  • An ORF library that is substantially evenly distributed is one wherein the frequencies of the ORFs in the library are substantially equal.
  • a substantially evenly distributed ORF library may be obtained using methods in the art.
  • the enriched peptides that bind the one or more proteins of interest and/or the resulting protein-protein complexes are further analyzed, e.g., sequenced, subjected to X-ray crystallography, etc.
  • kits for performing one or more assays as described herein comprise one or more reagents, e.g. , blocking buffers, assay buffers, diluents, wash solutions, etc.
  • the kits comprise additional components such as interpretive information, control samples, reference levels, and standards.
  • kits include a carrier, package, or container that may be compartmentalized to receive one or more containers, such as vials, tubes, and the like.
  • the kits optionally include an identifying description or label or instructions relating to its use.
  • the kits include information prescribed by a governmental agency that regulates the manufacture, use, or sale of compounds and compositions as contemplated herein.
  • the methods and kits as contemplated herein may be used in the evaluation of protein interactions with a protein of interest.
  • the methods and kits may be used for experiments to elucidate mechanism of action of the given protein.
  • the methods and kits may be used to elucidate the underlying mechanisms of a given disease, develop and/or screen for candidate protein-based therapeutics that may be used to treat the given disease, and/or assess the efficacy of a given protein-based therapeutic for treating the given disease.
  • the methods and kits may be used to identify diseases that are caused by a given protein and/or identify mutant proteins that are involved in the pathology of a given disease.
  • the methods and kits may be used to study mechanisms, e.g. , mechanisms and pathways involving given protein.
  • the methods and kits may be used to develop and screen for therapeutics that reduce or block the binding of a given protein to its intended protein (binding partner).
  • binding partner binding partner
  • PED was used to examine and compare PPIs of IAV wild type NS1 and a single amino acid point mutant, D92Y, which is known to abrogate NSl’s role in blocking the interferon response. While most interactions are conserved, the D92Y mutant failed to bind CPSF1 and, as a result, failed to suppress immune activation at the transcriptional level.
  • PED is highly complementary to current methodologies for PPI discovery, enabling both the detection of low abundance interactors and interaction domain mapping.
  • the use of high-throughput DNA sequencing as the readout for PED enables sensitive quantification of interactions, ultimately enabling massively parallel experimentation for the investigation of the cellular protein interactome.
  • Human genomic DNA was extracted from the peripheral blood mononuclear cells (PBMCs) of two independent, anonymous donors ( Figure 1). The genomic DNA was fragmented and filtered to a size of 300-700 bp ( Figure 27 & Figure 28). Two rounds of exon enrichment were performed to generate an exon DNA library. T7 promoter and FLAG tag DNA sequences were added onto the 5’ and 3’ termini of each enriched exon fragment, respectively ( Figure 29). Following in vitro transcription and mRNA purification, a puromycin linker was ligated onto the 3’ ends of the mRNA. In vitro translation was then performed using rabbit reticulocyte lysate.
  • PBMCs peripheral blood mononuclear cells
  • FLAG purification was used for pre-selection of the input library, an essential step to remove untranslated mRNAs or prematurely stopped proteins.
  • mRNA/cDNA duplexes were then generated through reverse transcription to remove secondary structures of mRNAs, prevent mRNA degradation during selection procedures, and enable PCR amplification post-selection.
  • This final displayed exon library includes complexes of nascent proteins and their corresponding mRNA/cDNA, which can be used to screen for binding to immobilized protein baits, a technique referred to herein as Protein interaction detection by Exon Display (PED).
  • PED Protein interaction detection by Exon Display
  • High-throughput sequencing can then be used to monitor the frequency change of each exon fragment before and after selection enrichment.
  • a cDNA library was generated from A549 cells to compare the coverage with the exon library.
  • RNA- puromycin-protein prey could efficiently bind to corresponding protein antibody as the bait.
  • a 3xHA tag sequence and an influenza NS1 sequence was spiked into the exon library to a frequency of 0.01% and synthesized a new input library of fusion proteins.
  • Anti -HA antibody (monoclonal) and anti -NS 1 antibodies (monoclonal and polyclonal) were immobilized onto protein G beads as baits and incubated with the fusion library.
  • the enrichment of HA or NS1 sequences after one round of selection was examined by real-time qPCR. Normalized to input, a 2-16 fold enrichment was observed of the expected prey (Figure 32). Taken together, these results demonstrate the quality of the exon library and the capability of the mRNA displayed exon library to detect PPIs.
  • NS1 As a proof-of-principle, the Protein interaction detection by Exon Display (PED) method was employed to examine the cellular binders of the influenza virus (IAV) protein, NS1 (A/WSN/33 (H1N1) strain). NS1 is important for efficient virus replication, being largely responsible for counteracting the host immune response and interfering with multiple cellular pathways. NS1 with a C-terminal HA tag was expressed in 293T cells and conjugated to anti-HA beads alongside GFP-HA as a control. Extensive washing steps were performed to clean the conjugated bait proteins.
  • IAV influenza virus
  • H1N1 H1N1
  • NS1 with a C-terminal HA tag was expressed in 293T cells and conjugated to anti-HA beads alongside GFP-HA as a control. Extensive washing steps were performed to clean the conjugated bait proteins.
  • binders four of them (CPSF4, CPSF1, PABPC1, NFX1) were previously reported and validated by Immunoprecipitation (IP)-Western, and one of them (SF3B2) was identified through previous published AP-MS screening.
  • CPSF polyadenylation specificity factor
  • AKT1 is a hub protein that has multiple connections.
  • the NS1 protein is known to induce the activation of the PI3K/AKT pathway, which supports viral replication, but no direct physical connection with AKT1 has been previously reported.
  • inhibition of ART activity was shown to restrict viral growth.
  • NS 1 is known to interact with the interferon (IFN) pathway and the basal expression level of many IFN-stimulated genes is low in A549 cells
  • IFN interferon
  • these experiments were performed in the presence and absence of 12-hour pre-treatment with type I interferon (IFND at 1,000 U/ml).
  • Interacting proteins identified by mass spectrometry were scored for confidence based on their specificity, reproducibility, and abundance using the Mi ST scoring algorithm in the art.
  • a total of 317 proteins were found to interact with NS1 with a MiST score > 0.8: 161 baits were found regardless of treatment condition, 41 were identified only in the absence of IFN, and 115 proteins were identified only in the presence of IFN (Table 2).
  • DDX6 and CPSF1 were identified by both methodologies. Nevertheless, GO analysis revealed an enrichment of the same major pathways, including RNA processing and RNA 3’ processing ( Figure 8).
  • binding domains for each interactor As the exon library was largely composed of individual exons or exon fragments, the interaction is localized to specific and
  • CPSF4 and PABPCl both appeared as significant interactors in the PED dataset and both have been previously validated as NS1 interactors. Loops 2 and 3 (the entirety of exon 3 and part of exon 4) of CPSF4 were shown to be important for NS 1 binding based on a co-crystal structure (PDB:
  • PED is capable of identifying cellular interactors of proteins and in a manner complementary to AP-MS approaches. PED also offers the potential advantages of identifying low abundance interactors and in facilitating the identification of binding domains.
  • FASN is a multi-functional protein that is critical for catalyzing and regulating fatty acid synthesis in mammalian cells. It was reported to be a host factor of influenza virus, but has not been previously shown to bind to any influenza viral protein. While influenza virus infection significantly induces fatty acid biosynthesis, the mechanisms driving this induction have remained elusive. Above, demonstrates an interaction between influenza virus NS1 and FASN (Figure 5, Figure 35). Upon NS1 expression by transient transfection, the mRNA expression level of FASN did not significantly change, however, the protein steady-state level increased (Figure 13).
  • FASN was knocked down by transient transfection of shRNA in 293T cells, and co transfected with a mCherry reporter for viral replication. Infection of these cells with wild type WSN virus (strain A/WSN/33) indicate a drop in viral replication with decreased FASN protein expression ( Figure 38). Virus replication also decreased with an increasing concentration of an FASN inhibitor, C75, while cell viability was unaffected ( Figure 14, Figure 39).
  • GC-MS gas chromatography-mass spectrometry
  • Inducible lentiviral vectors expressing influenza A virus NS1 (strain A/WSN/33 and strain A/Cal/04/09 (H1N1 pdm)), PB2 (strain A/WSN/33), PA (strain A/WSN/33), and GFP as a control, were constructed.
  • Lentiviruses were used to transduce A549 cells, which were induced to express the respective protein products with doxycycline for 24 hours. Cells were then switched to complete media containing 50% U 13 C-glucose for 24 hours to label de novo synthesized lipids.
  • one potential application is the direct comparison of PPI binding by different protein variants and mutations. This can be particularly valuable for the mechanistic interrogation of mutations discovered by genetic screens.
  • the interaction profile of a previously described NS1 mutant, D92Y, that was discovered in the high-throughput genetic screen for interferon (IFN) sensitive variants was investigated. Cells infected with influenza A viruses containing the D92Y mutation produce higher amounts of IFN compared to infection with wild-type virus, indicating an inability of this mutant NS1 to inhibit IFN induction, but the exact mechanism of this loss-of-function is unknown.
  • IFN interferon
  • CPSF1 is the largest component of CPSF complex, which is critical for pre- mRNA 3' processing, cleavage, and poly(A) addition.
  • influenza A virus NS1 By blocking the function of CPSF complex, influenza A virus NS1 inhibits cellular mRNA transport and protein expression, including the expression of many anti-viral interferon-stimulated genes.
  • a GFP expression plasmid, pEGFP- Cl was used as a reporter. While wild-type NS1 efficiently down-regulated the expression of the GFP reporter, the D92Y mutant had no impact on GFP expression relative to the control ( Figure 22).
  • CPSF1 is a large, multi-domain protein and its binding interface with NS1 has not been previously mapped.
  • enrichment of exons located on the N-terminus of the protein, especially exon 5 and 6 was observed Figure 25.
  • Figure 25 the secondary structure and exon arrangements of CPSF1 and fragmented the protein into 6 small regions that should still fold properly was examined. All fragments were expressed well in 293T cells upon transient transfection. Immunoprecipitation of each fragment revealed that only fragment 1, corresponding to amino acids 1-313 and exons 1-8, pulled down NSl ( Figure 26), consistent with the region predicted by PED.
  • WSN influenza A/WSN/33 virus
  • 293 T cells were cultured in DMEM (Corning) with 10% FBS (Corning).
  • A549 cells were cultured in RPMI 1640 (Coming) with 10% FBS (Corning). 293T cells were used for
  • transfection of mammalian expression plasmid to overexpress viral and cellular proteins A549 cells were used for transduction of lenti -virus vector expressing each bait protein for AP-MS.
  • NS1, PB2, PB1, PA, NP (from WSN strain), NS1 from Cal09 and GFP protein were cloned into pcDNA5 mammalian expression vector with lxHA affinity tag.
  • WSN NS 1 protein was cloned into Lenti-X Tet-one inducible expression plasmid with 2xStrep affinity tag at C-terminus.
  • Cellular proteins with lxFLAG tag were purchased from Harvard plasmid database, Origene, or amplified from cellular mRNA/cDNA and cloned into pCMV mammalian expression vector.
  • NS1 protein with D92Y mutation was generated using a PCR-based site-directed mutagenesis strategy.
  • PBMCs were obtained from UCLA CARF Virology Core, collected from
  • Genomic DNAs were extracted using the DNeasy Blood and Tissue Kit (Qiagen). DNAs were fragmented using Covaris focused-ultrasonic technology, and size-selected with a range from 300 bp-700 bp. The fragmented DNAs were end- repaired (NEB), dA-tailed using klenow exo- (NEB) and ligated with customized Y shape adaptor as below.
  • T7Koz TTCTAATACGACTCACTATAGGGACAATTACTATTTACAATTACCACCATGG (SEQ ID NO: 7)
  • mRNAs from A549 cells were extracted using Trizol (Thermo Fisher) and
  • the exon library (DNA templates) was transcribed by T7 run off transcription (Ambion), and 1 nmole of mRNA was ligated to the pF30P linker (Phospho-polyA-spacer9-spacer9-spacer9-ACC-puromycin, 1.2 nmoles) via the splint oligonucleotide (1.1 nmoles) by T4 DNA ligase (NEB) in a 200 pL reaction.
  • pF30P linker Phospho-polyA-spacer9-spacer9-spacer9-spacer9-ACC-puromycin, 1.2 nmoles
  • NEB T4 DNA ligase
  • RNA-protein fusions were then affinity-purified using M2 anti-Flag beads (Sigma-Aldrich) to remove sequences containing nonsense mutations and non-fused RNA templates and proteins.
  • the fusions were reverse transcribed with super script III (Invitrogen) and a fraction of the purified sample was reserved to determine the frequencies of each coding sequence in the input library.
  • the purified fusion sample was incubated with bait protein for 3 hours at 4°C. After washing, the immobilized fusion samples were eluted by heat (95 °C) and PCR amplified using the following primers (T7-Rec, Lib Rev). The amplified DNA fragments from input and post selection were then prepared for high throughput sequencing using lllumina Hiseq PEI 50. Barcodes of 6 bps were added to distinguish among different samples. 6 biological replicates were performed for each bait protein, including in vitro transcription, translation, and enrichment steps.
  • T7 -Rec GGGACAATTACTATTTACAATTACCACCATGG (SEQ ID NO: 9)
  • WT and D92Y mutant NS1 ORFs were cloned into the pLVX-TetOne-Puro vector with 2xStrep tag at the N-terminus.
  • a 2xStrep tagged GFP was cloned as a control.
  • Lenti viruses were generated by transfecting 293 T cells with pLVX-TetOne- Puro vector, Gag-Pol packaging construct and VSV-G envelope.
  • A549 cells were transduced with the generated lentiviruses and selected under 1 pg/ml puromycin. The expression of desired viral proteins was confirmed by western blot.
  • A549 cells expressing different viral proteins were induced with 1 ug/ml Dox for 24 hours. They were left untreated or treated with 1000 U/ml type I interferon for 12 hours before harvesting.
  • Strep-Tactin Sepharose beads IBA Lifesciences
  • IP buffer 50mM Tris-HCl, pH7.4, 150 mM NaCl, and 1 mM EDTA
  • Beads were washed 4 times (2 times with 0.05% NP-40 and 2 times without) prior to on-bead protein digest.
  • Streptactin-purified proteins were reduced and alkylated on beads with 20 pL reduction-alkylation buffer (50 mM Tris- HCl, pH 8.0, 2 M Urea, 1 mM Dithiothreitol (DTT), 3 mM iodoacetamide).
  • Raw MS files were analyzed by MaxQuant version 1.3.0.3 and MS/MS spectra searched by the Andromeda search engine against a database containing reviewed SwissProt human and influenza protein sequences (20,226 total).
  • MiST scoring algorithm was used to assign scores to bait-prey interactions against the GFP controls.
  • GC-MS were performed using methods in the art. Briefly, cells were cultured in a 1 : 1 ratio of U 13 C glucose tracer for 24 hours. Prior to collection, cells were imaged on Molecular Devices ImageXpress XL to assess cell numbers. Then cells were dissolved in 6 M Guanidine HC1 and transferred to glass tubes for derivatization with 3M methanolic guanidine HC1. Samples were prepared alongside standard curve samples made up of FAMES mix (Nu-chek Prep, GLC 20a) and Cholesterol (Sigma, C8667).
  • FLAG-tagged CPSF1 was expressed in 293T cells. Cells were lysed at two days post-transfection with RIPA buffer, and bound with anti-FLAG antibody for 4 hours at 4°C with constant agitation. Then CPSF1 protein was eluted with 3X FLAG peptide overnight at 4°C with constant agitation. HA-tagged WT or D92Y mutant NS1 protein was expressed in 293T cells, lysed at two days post transfection and bound with anti -HA overnight at 4°C. They were washed 5 times with RIPA buffer and incubated with eluted CPSF1 protein for 4 hours at 4°C. Samples were then washed with RIPA buffer 5 times and eluted with 60 m ⁇ of SDS-PAGE sample buffer. All samples were subjected to SDS-PAGE and western blotting analysis.
  • shRNA against FASN is ordered from Sigma (SHCLNG-NM_004104).
  • Non mammalian shRNA control (SHC002) were used as scramble control.
  • FASN was knocked down by transient transfection of shRNA in 293T cells, and co-transfected with a mCherry reporter for viral replication. 24 hours post transfection, cells were infected with wild type WSN virus (strain A/WSN/33) at MOI 0.1. The mCherry reporter intensity were examined with fluorescence microscope at 24 hours post infection.
  • Viral Replication Assay (TCID 50, Viral Copy Number, mCherry Reporter)
  • TCID50 assay were performed in A549 cells by observing cellular cytotoxic effect (CPE). Viral copy numbers were measured using real-time PCR using standard curve with the following primer targeting NP segment.
  • NP-Reverse ACC ATT GTT CCA ACT CCT TT (SEQ ID NO: 11)
  • virus-inducible mCherry reporter 50 ng virus-inducible mCherry reporter were transfected in 293T cells in 24 well plates. Media were changed 24 hours post transfection and cells were infected with indicated virus for 24 hours. The mCherry signal was observed under fluorescence microscope, as an indicator of the replication capacity of virus.
  • Quantitative real-time PCR was performed using Taq polymerase and SYBG.
  • Scored mass spectrometry data files are provided in Table 2.
  • the sequencing data are deposited to NIH Short Read Archive (SRA) with access numbers
  • a 3 : 1 ratio of the test library normal library and add equal amounts of forward/reverse custom and standard primers for the PCR step.
  • Qubit concentration was about 17.1 ng/pL (about 45 pL total).
  • T7 Tmv Koz TTCTAATACGACTCACTATAGGGACAATTACTATTTACAATTACCACCATGG (SEQ ID NO: 3)
  • o DNA template concentration is about 100-200 nM - measuring the pool DNA o 5x transcription buffer:
  • Splint (splint20): TTTTTTTTTTTTTTGGAGCCGCTACCCTTATCGT (SEQ ID NO: 12)
  • gel purification of the ligated product may be used in place of lambda endonuclease digestion and dT beads purification.
  • Option 1 Use PURE system (E. coli, https://www.neb.eom/products/e6800-purexpress- invitro-protein-synthesis-kit)
  • the current primer is best matched with the mammalian cell system (rabbit), but also can be done with E. coli.
  • the buffer condition can be changed, e.g., glycerol can be added.
  • Bind beads loaded with target in 0.2 ml buffer (can do binding in spin-x filter cup), cold room for 2-3 hours
  • T7 -Short GGGACAATTACTATTTACAATTACCACCATGG (SEQ ID NO: 5)
  • Ruepp, A. et al. CORUM The comprehensive resource of mammalian protein complexes-2009. Nucleic Acids Res. 38, 497-501 (2009).
  • a given percentage of“sequence identity” refers to the percentage of nucleotides or amino acid residues that are the same between sequences, when compared and optimally aligned for maximum correspondence over a given comparison window, as measured by visual inspection or by a sequence comparison algorithm in the art, such as the BLAST algorithm, which is described in Altschul et al ., (1990) J Mol Biol 215:403-410.
  • Software for performing BLAST e.g ., BLASTP and BLASTN
  • analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov).
  • the comparison window can exist over a given portion, e.g., a functional domain, or an arbitrarily selection a given number of contiguous nucleotides or amino acid residues of one or both sequences.
  • the comparison window can exist over the full length of the sequences being compared. For purposes herein, where a given comparison window (e.g, over 80% of the given sequence) is not provided, the recited sequence identity is over 100% of the given sequence.
  • the percentages of sequence identity of the proteins provided herein are determined using BLASTP 2.8.0+, scoring matrix BLOSUM62, and the default parameters available at blast.ncbi.nlm.nih.gov/Blast.cgi. See also Altschul, et al., (1997) Nucleic Acids Res 25:3389-3402; and Altschul, et al, (2005) FEBS J 272:5101- 5109.
  • Optimal alignment of sequences for comparison can be conducted, e.g, by the local homology algorithm of Smith & Waterman, Adv Appl Math 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J Mol Biol 48:443 (1970), by the search for similarity method of Pearson & Lipman, PNAS USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection.
  • Proteins may be made using methods in the art including chemical synthesis, biosynthesis or in vitro synthesis using recombinant DNA methods, and solid phase synthesis. See , e.g ., Kelly & Winkler (1990) Genetic Engineering Principles and Methods, vol. 12, J. K. Setlow ed., Plenum Press, NY, pp. 1-19; Merrifield (1964) J Amer Chem Soc 85:2149; Houghten (1985) PNAS USA 82:5131-5135; and Stewart & Young (1984) Solid Phase Peptide Synthesis, 2ed. Pierce, Rockford, IL, which are herein incorporated by reference.
  • Proteins may be purified using protein purification techniques in the art such as reverse phase high-performance liquid chromatography (HPLC), ion-exchange or immunoaffmity chromatography, filtration or size exclusion, or electrophoresis. See , e.g., Olsnes and Pihl (1973) Biochem. 12(16):3121-3126; and Scopes (1982) Protein Purification, Springer-Verlag, NY, which are herein incorporated by reference.
  • the polypeptides may be made by recombinant DNA techniques in the art.
  • polynucleotides that encode proteins are contemplated herein.
  • the polypeptides and polynucleotides are isolated.
  • an“isolated” compound refers to a compound that is isolated from its native environment.
  • an isolated polynucleotide is a one which does not have the bases normally flanking the 5’ end and/or the 3’ end of the
  • an isolated polypeptide is a one which does not have its native amino acids, which correspond to the full-length polypeptide, flanking the N-terminus, C-terminus, or both.
  • an isolated fragment of polypeptide refers to an isolated polypeptide that consists of only a portion of the full-length protein or comprises some, but not all, of the amino acid residues of the wild-type protein and non-native amino acids, i.e., amino acids that are different from the amino acids found at the corresponding positions of the wild-type protein, at its N- terminus, C-terminus, or both.
  • isolated polynucleotides and polypeptides are made“by the hand of man”, e.g. , using synthetic and/or recombinant techniques.
  • a“substantially purified” compound refers to a compound that is removed from its natural environment and/or is at least about 60% free, preferably about 75% free, and more preferably about 90% free, and most preferably about 95-100% free from other macromolecular components or compounds with which the compound is associated with in nature or from its synthesis.
  • “antibody” refers to naturally occurring and synthetic immunoglobulin molecules and immunologically active portions thereof (i.e., molecules that contain an antigen binding site that specifically bind the molecule to which antibody is directed against). As such, the term antibody encompasses not only whole antibody molecules, but also antibody multimers and antibody fragments as well as variants (including derivatives) of antibodies, antibody multimers and antibody fragments.
  • molecules which are described by the term“antibody” herein include: single chain Fvs (scFvs), Fab fragments, Fab’ fragments, F(ab’)2, disulfide linked Fvs (sdFvs), Fvs, and fragments comprising or alternatively consisting of, either a VL or a VH domain.
  • a compound e.g ., receptor or antibody“specifically binds” a given target (e.g., ligand or epitope) if it reacts or associates more frequently, more rapidly, with greater duration, and/or with greater binding affinity with the given target than it does with a given alternative, and/or indiscriminate binding that gives rise to non specific binding and/or background binding.
  • a given target e.g., ligand or epitope
  • background binding refer to an interaction that is not dependent on the presence of a specific structure (e.g, a given epitope).
  • an antibody that specifically binds a given protein is an antibody that binds the given protein with greater affinity, avidity, more readily, and/or with greater duration than it does to other compounds.
  • “binding affinity” refers to the propensity of a compound to associate with (or alternatively dissociate from) a given target and may be expressed in terms of its dissociation constant, Kd.
  • the antibodies have a Kd of 10 5 or less, 10 6 or less, preferably 10 7 or less, more preferably 10 8 or less, even more preferably 10 9 or less, and most preferably 10 10 or less, to their given target.
  • Binding affinity can be determined using methods in the art, such as equilibrium dialysis, equilibrium binding, gel filtration, immunoassays, surface plasmon resonance, and spectroscopy using experimental conditions that exemplify the conditions under which the compound and the given target may come into contact and/or interact. Dissociation constants may be used determine the binding affinity of a compound for a given target relative to a specified alternative. Alternatively, methods in the art, e.g, immunoassays, in vivo or in vitro assays for functional activity, etc., may be used to determine the binding affinity of the compound for the given target relative to the specified alternative.
  • the binding affinity of the antibody for the given target is at least 1-fold or more, preferably at least 5-fold or more, more preferably at least 10-fold or more, and most preferably at least 100-fold or more than its binding affinity for the specified alternative.
  • sample is used in its broadest sense and includes
  • Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum, and the like.
  • a biological sample can be obtained from a subject using methods in the art.
  • a sample to be analyzed using one or more methods described herein can be either an initial unprocessed sample taken from a subject or a subsequently processed, e.g ., partially purified, diluted, concentrated, fluidized, pretreated with a reagent (e.g, protease inhibitor, anti -coagulant, etc.), and the like.
  • the sample is a blood sample.
  • the blood sample is a whole blood sample, a serum sample, or a plasma sample.
  • the sample may be processed, e.g, condensed, diluted, partially purified, and the like.
  • the sample is pretreated with a reagent, e.g, a protease inhibitor.
  • two or more samples are collected at different time intervals to assess any difference in the amount of the analyte of interest, the progression of a disease or disorder, or the efficacy of a treatment.
  • the test sample is then contacted with a capture reagent and, if the analyte is present, a conjugate between the analyte and the capture reagent is formed and is detected and/or measured with a detection reagent.
  • a“capture reagent” refers to a molecule which specifically binds an analyte of interest.
  • the capture reagent may be immobilized on a assay substrate.
  • the capture reagent may be an antigen or an epitope thereof to which the antibody specifically binds.
  • an“assay substrate” refers to any substrate that may be used to immobilize a capture reagent thereon and then detect an analyte when bound thereto.
  • assay substrates include membranes, beads, slides, and multi-well plates.
  • a“detection reagent” refers to a substance that has a detectable label attached thereto and specifically binds an analyte of interest or a conjugate of the analyte of interest, e.g, an antibody-analyte conjugate.
  • a“detectable label” is a compound or composition that produces or can be induced to produce a signal that is detectable by, e.g, visual, spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
  • labeled as a modifier of a given substance, e.g, a labeled antibody, means that the substance has a detectable label attached thereto.
  • a detectable label can be attached directly or indirectly by way of a linker (e.g, an amino acid linker or a chemical moiety).
  • linker e.g, an amino acid linker or a chemical moiety
  • detectable labels include radioactive and non-radioactive isotopes (e.g,
  • enzymes e.g, b-galactosidase, peroxidase, etc.
  • enzyme substrates e.g., enzyme inhibitors, coenzymes, catalysts, fluorophores (e.g, rhodamine, fluorescein isothiocyanate, etc.), dyes, chemiluminescers and luminescers (e.g, dioxetanes, luciferin, etc.), and sensitizers.
  • fluorophores e.g, rhodamine, fluorescein isothiocyanate, etc.
  • dyes e.g, chemiluminescers and luminescers (e.g, dioxetanes, luciferin, etc.), and sensitizers.
  • a substance, e.g., antibody, having a detectable label means that a detectable label that is not linked, conjugated, or covalently attached to the substance, in its naturally-occurring form, has been linked, conjugated, or covalently attached to the substance by the hand of man.
  • the phrase“by the hand of man” means that a person or an object under the direction of a person (e.g, a robot or a machine operated or programmed by a person), not nature itself, has performed the specified act.
  • the steps set forth in the claims are performed by the hand of man, e.g, a person or an object under the direction of the person.
  • non-human animal includes all vertebrates, e.g, mammals and non-mammals, such as non-human primates, horses, sheep, dogs, cows, pigs, chickens, and other veterinary subjects and test animals.
  • the subject is a mammal. In some embodiments, the subject is a human.
  • diagnosis refers to the physical and active step of informing, i.e., communicating verbally or by writing (on, e.g, paper or electronic media), another party, e.g, a patient, of the diagnosis.
  • prognosis refers to the physical and active step of informing, i.e., communicating verbally or by writing (on, e.g, paper or electronic media), another party, e.g, a patient, of the prognosis.
  • “and/or” means“and” or“or”.
  • “A and/or B” means “A, B, or both A and B” and“A, B, C, and/or D” means“A, B, C, D, or a combination thereof’ and said“A, B, C, D, or a combination thereof’ means any subset of A, B, C, and D, for example, a single member subset (e.g, A or B or C or D), a two-member subset ( e.g ., A and B; A and C; etc.), or a three-member subset (e.g., A, B, and C; or A, B, and D; etc), or all four members (e.g, A, B, C, and D).
  • phrase“one or more of’ e.g.,“one or more of A, B, and/or
  • C means“one or more of A”,“one or more of B”,“one or more of C”,“one or more of A and one or more of B”,“one or more of B and one or more of C”,“one or more of A and one or more of C” and“one or more of A, one or more of B, and one or more of C”.
  • phrase“comprises or consists of A” is used as a tool to avoid excess page and translation fees and means that in some embodiments the given thing at issue:
  • composition comprises A or consists of A.
  • sentence“In some embodiments, the composition comprises or consists of A” is to be interpreted as if written as the following two separate sentences:“In some embodiments, the composition comprises A. In some embodiments, the composition consists of A.”
  • the composition comprises A, B, or C” is to be interpreted as if written as the following three separate sentences:“In some embodiments, the composition comprises A. In some embodiments, the composition comprises B. In some embodiments, the composition comprises C.” As another example, the sentence“In some embodiments, the composition comprises at least A, B, or C” is to be interpreted as if written as the following three separate sentences:“In some embodiments, the composition comprises at least A. In some embodiments, the composition comprises at least B. In some embodiments, the composition comprises at least C.”

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

L'invention concerne des procédés de détection et d'analyse d'interactions protéine-protéine avec une spécificité et une sensibilité élevées.
PCT/US2020/024945 2019-03-29 2020-03-26 Identification complète de cibles protéiques interactives à l'aide d'un affichage d'arnm de bibliothèques uniformes WO2020205426A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962826611P 2019-03-29 2019-03-29
US62/826,611 2019-03-29

Publications (1)

Publication Number Publication Date
WO2020205426A1 true WO2020205426A1 (fr) 2020-10-08

Family

ID=72666854

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/024945 WO2020205426A1 (fr) 2019-03-29 2020-03-26 Identification complète de cibles protéiques interactives à l'aide d'un affichage d'arnm de bibliothèques uniformes

Country Status (1)

Country Link
WO (1) WO2020205426A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999011777A1 (fr) * 1997-09-03 1999-03-11 Biovation Limited Procedes d'analyse de proteines
WO2010039852A2 (fr) * 2008-09-30 2010-04-08 Abbott Laboratories Banques d’anticorps améliorées
US20180094256A1 (en) * 2008-07-25 2018-04-05 X-Body, Inc. Protein screening methods
US20190085324A1 (en) * 2015-10-28 2019-03-21 The Broad Institute Inc. Assays for massively combinatorial perturbation profiling and cellular circuit reconstruction

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999011777A1 (fr) * 1997-09-03 1999-03-11 Biovation Limited Procedes d'analyse de proteines
US20180094256A1 (en) * 2008-07-25 2018-04-05 X-Body, Inc. Protein screening methods
WO2010039852A2 (fr) * 2008-09-30 2010-04-08 Abbott Laboratories Banques d’anticorps améliorées
US20190085324A1 (en) * 2015-10-28 2019-03-21 The Broad Institute Inc. Assays for massively combinatorial perturbation profiling and cellular circuit reconstruction

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZHU, J ET AL.: "Protein interaction mapping with ribosome-displayed using PLATO ORF libraries", NATURE PROTOCOLS, vol. 9, no. 1, January 2014 (2014-01-01), pages 90 - 103, XP055746892 *

Similar Documents

Publication Publication Date Title
Eystathioy et al. A phosphorylated cytoplasmic autoantigen, GW182, associates with a unique population of human mRNAs within novel cytoplasmic speckles
O'Connor et al. Ubiquitin‐Activated Interaction Traps (UBAIT s) identify E3 ligase binding partners
Gupta et al. Ubiquitination screen using protein microarrays for comprehensive identification of Rsp5 substrates in yeast
Low et al. A systems-wide screen identifies substrates of the SCFβTrCP ubiquitin ligase
Hirose et al. A spliceosomal intron binding protein, IBP160, links position-dependent assembly of intron-encoded box C/D snoRNP to pre-mRNA splicing
Slavoff et al. Peptidomic discovery of short open reading frame–encoded peptides in human cells
Lautier et al. Co-translational assembly and localized translation of nucleoporins in nuclear pore complex biogenesis
Ma et al. SKAR links pre-mRNA splicing to mTOR/S6K1-mediated enhanced translation efficiency of spliced mRNAs
Vester et al. Quantitative analysis of cellular proteome alterations in human influenza A virus‐infected mammalian cell lines
Fischer et al. Chromatin mapping identifies BasR, a key regulator of bacteria-triggered production of fungal secondary metabolites
Scholes et al. Identification and selectivity profiling of small-molecule degraders via multi-omics approaches
Wilkinson et al. Ubiquitin-like protein Hub1 is required for pre-mRNA splicing and localization of an essential splicing factor in fission yeast
Busch et al. MitoRibo-Tag mice provide a tool for in vivo studies of mitoribosome composition
Du et al. mRNA display with library of even-distribution reveals cellular interactors of influenza virus NS1
Casaca et al. The heterogeneous ribonuclear protein C interacts with the hepatitis delta virus small antigen
Luo et al. mRNA interactions with disordered regions control protein activity
WO2015030585A2 (fr) Procédés pour détecter des lysines ayant subi une modification post-traductionnelle dans un polypeptide
Lindström Elucidation of motifs in ribosomal protein S9 that mediate its nucleolar localization and binding to NPM1/nucleophosmin
Huang et al. Computational prediction and experimental validation identify functionally conserved lncRNAs from zebrafish to human
Assis et al. Identification of novel proteins and mRNAs differentially bound to the Leishmania Poly (A) Binding Proteins reveals a direct association between PABP1, the RNA-binding protein RBP23 and mRNAs encoding ribosomal proteins
Dibus et al. FBXO38 ubiquitin ligase controls centromere integrity via ZXDA/B stability
Yumerefendi et al. Library-based methods for identification of soluble expression constructs
WO2020205426A1 (fr) Identification complète de cibles protéiques interactives à l'aide d'un affichage d'arnm de bibliothèques uniformes
WO2023023553A2 (fr) Compositions, systèmes et procédés d'activation et de silençage de l'expression génique
JP2017530726A (ja) 抗体様タンパク質

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20783218

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20783218

Country of ref document: EP

Kind code of ref document: A1