WO2020198640A1 - Programmable imaging methods and compositions - Google Patents

Programmable imaging methods and compositions Download PDF

Info

Publication number
WO2020198640A1
WO2020198640A1 PCT/US2020/025369 US2020025369W WO2020198640A1 WO 2020198640 A1 WO2020198640 A1 WO 2020198640A1 US 2020025369 W US2020025369 W US 2020025369W WO 2020198640 A1 WO2020198640 A1 WO 2020198640A1
Authority
WO
WIPO (PCT)
Prior art keywords
binding
preselected
cell
host cell
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/025369
Other languages
French (fr)
Inventor
Samuel Gordon RODRIQUES
Nicholas Craig BARRY
Edward Boyden
Adam Henry Marblestone
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Massachusetts Institute of Technology
Original Assignee
Massachusetts Institute of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Massachusetts Institute of Technology filed Critical Massachusetts Institute of Technology
Publication of WO2020198640A1 publication Critical patent/WO2020198640A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • C07K2319/81Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding

Definitions

  • the invention in some aspects, relates to method and products for genetically targeted detection of proteins in cells using programmable nucleic acids to target expressed proteins in cells, tissues, and organisms.
  • methods of genetically targeted detection including: delivering to at least one host cell one or more preselected binding agents comprising an independently selected programmable binding sequence, wherein each preselected binding agent is capable of selectively binding a corresponding matched specific target agent; fixing the at least one host cell under conditions wherein the one or more preselected binding agents in the fixed host cell is capable of selectively binding the matched specific target agent to which it corresponds; contacting the at least one fixed host cell with a composition comprising the matched specific target agents corresponding to the one or more preselected binding agents; and determining the binding of the one or more preselected binding agents and corresponding matched specific target agents in the at least one fixed host cell.
  • the preselected binding agent comprises one or more of a polypeptide molecule and a nucleic acid molecule. In certain embodiments, the preselected binding agent comprises a polypeptide/nucleic acid complex. In some embodiments, each of the independently selected programmable binding sequences correspond to a nucleic acid sequence in a matched specific target agent. In some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different independently selected programmable binding sequences are delivered into the host cell. In certain embodiments, each of the programmable binding sequence corresponds to and is capable of selectively binding a matched specific target agent. In some embodiments, the preselected binding agent comprises at least one of: a nucleic acid- binding molecule and a nucleic acid analog.
  • the nucleic acid- binding molecule is one or more of: a nucleic acid-binding polypeptide, a DNA-binding molecule, and a DNA-binding polypeptide.
  • the preselected binding agent comprises a transcription activator-like effector (TALE) sequence.
  • the preselected binding agent comprises a megaTAL effector sequence.
  • the preselected binding agent comprises a CRISPR/Cas9 sequence or Cas9 analog sequence effector sequence.
  • the Cas9 analog sequence comprises a Cas13a (c2c2), Cpfl , or MIMIVIRE sequence.
  • the preselected binding agent comprises a zinc finger (ZF) effector sequence.
  • the specific target agent comprises at least one double-stranded nucleic acid molecule. In some embodiments, the specific target agent comprises at least one single- stranded nucleic acid molecule. In certain embodiments, the specific target agent comprises one or more independently selected detectable labels. In some embodiments, the preselected programmable binding agent comprises a detectable label. In some embodiments, the detectable label comprises a fluorescent label. In some embodiments, fixing the at least one host cell comprises contacting the host cell with at least one cell fixative.
  • the cell fixative comprises at least one of: MeOH, EtOH, acetone, an amine, a cleavable molecule, a cleavable polypeptide, a cleavable cross-linker molecule, and an aldehyde.
  • fixing comprises contacting the at least one host cell with an alcohol solution.
  • the alcohol solution comprises at least one of MeOH and EtOH.
  • the at least one host cell is a plurality of host cells comprising one or more cell types.
  • a means for determining a characteristic of the one or more preselected binding agents in the fixed host cell comprises detecting the one or more specific target agents bound to the matched preselected binding agent in the contacted fixed host cell.
  • the characteristic is one or more of: localization, presence, absence, and amount.
  • the at least one host cell is obtained from a subject. In certain embodiments, the at least one host cell is obtained from culture. In some embodiments, the at least one host cell comprises a neuron.
  • the one or more preselected binding agent is a plurality of independently preselected binding agents. In some embodiments, the preselected binding agent is delivered to the at least one host cell using a physical delivery means.
  • the physical delivery means comprises at least one of microinjection, electroporation, ballistic delivery, and laser delivery.
  • the preselected binding agent is delivered to the at least one host cell by means of a vector.
  • the vector is a viral vector or a non- viral vector.
  • the viral vector is a lentivirus vector (LV), an adenovirus vectors (AdV), an adeno-associated virus vectors (AAV), or a herpes simplex-1 virus vectors (HSV-1s).
  • the non-viral vector is a lipid nanoparticle (LNP), a liposome, a polymer, or a cell-derived membrane vesicle (CMV).
  • the preselected binding agent is delivered to the at least one host cell by a means comprising a cell-penetrating molecule.
  • the cell-penetrating molecule comprises a cell-penetrating polypeptide.
  • the host cell is sectioned after the fixing.
  • determining the binding of the one or more preselected programmable binding agents and corresponding matched specific target agents comprises: contacting the corresponding matched specific target agents with two or more independently selected detectable labels; imaging the detectable labels; quenching the detectable labels; and repeating steps (i)-(iii) one or more times.
  • determining the binding of the one or more preselected binding agents and corresponding matched specific target agents comprises simultaneously contacting one or more of the corresponding matched specific target agents with two or more independently selected detectable labels and sequentially detecting the detectable labels.
  • the detectable labels are detected with a means comprising a fluorescent in situ hybridization (FISH) method.
  • the cell is a vertebrate cell, optionally a mammalian cell, optionally a human cell.
  • compositions including a fixed cell or cell section that includes at least one preselected programmable binding agent bound to its matched specific target agent, forming a bound complex, wherein the preselected binding agent comprises an independently selected programmable binding sequence, and wherein the preselected binding agent is selected, in part, based on its capability to selectively bind its matched specific target agent.
  • the cell or cell section comprises two or more different independently preselected programmable binding agents bound to their matched specific target agents each forming a bound complex.
  • the bound complex comprises a detectable label.
  • the preselected binding agent comprises one or more of a polypeptide molecule and a nucleic acid molecule.
  • the preselected binding agent comprises a polypeptide/nucleic acid complex.
  • each of the independently selected programmable binding sequences correspond to a nucleic acid sequence in a matched specific target agent.
  • the preselected binding agent includes at least one of: a nucleic acid-binding molecule and a nucleic acid analog.
  • the nucleic acid-binding molecule is one or more of: a nucleic acid-binding polypeptide, a DNA-binding molecule, and a DNA-binding polypeptide.
  • the preselected binding agent comprises a transcription activator-like effector (TALE) sequence.
  • TALE transcription activator-like effector
  • the preselected binding agent comprises a megaTAL effector sequence. In some embodiments, the preselected binding agent comprises a CRISPR/Cas9 sequence or Cas9 analog sequence effector sequence. In some embodiments, the Cas9 analog sequence comprises a Cas13a (c2c2), Cpfl, or MIMIVIRE sequence. In some embodiments, the preselected binding agent comprises a zinc finger (ZF) effector sequence. In certain embodiments, the specific target agent comprises at least one double-stranded nucleic acid molecule. In some embodiments, the specific target agent comprises at least one single- stranded nucleic acid molecule. In certain embodiments, the detectable label comprises a fluorescent label. In some embodiments, the fixed cell is a neuron.
  • the fixed cell section is a section of a neuron.
  • the fixed cell is a vertebrate cell, optionally is a mammalian cell, and optionally is a human cell.
  • the fixed cell section is a section of a vertebrate cell, optionally a section of a mammalian cell, and optionally is a section of a human cell.
  • the preselected binding agent is part of a fusion protein.
  • the at least a portion of the fixed cell includes all of the fixed cell.
  • the at least a portion of the fixed cell comprises a section obtained from the fixed cell.
  • Figure 1A-H shows photomicrographic images of cells visualized with an embodiment of a method of the invention.
  • Fig. 1 A & B show HEK cells expressing PL61 that were fixed with the ethanol protocol described in Example land stained with Hairpin 13.
  • Fig. 1A shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. IB shows detected fluorescence of Cy5 (attached to hairpin 13), which indicates co- localization of the mRuby and Cy5 signals.
  • Fig. 1C & D show HEK cells expressing PL62 that were fixed as above and were stained with Hairpin 13.
  • Fig. 1C shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. 1A shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. ID shows detected fluorescence of Cy5 (attached to hairpin 13), which indicates there was no co- localization of the mRuby and Cy5 signals.
  • Fig. IE & F show HEK cells expressing PL62 that were fixed as above and were stained with Hairpin 14.
  • Fig. IE shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. IF shows detected fluorescence of Cy5 (attached to hairpin 14), which indicates there was no co- localization of the mRuby and Cy5 signals.
  • Fig. 1G & H shows HEK cells expressing PL62 that were fixed as above and stained with Hairpin 14.
  • Fig. 1G shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. 1H shows detected fluorescence of Cy5 (attached to hairpin 14), which indicates strong co- localization of the mRuby and Cy5 signals.
  • Figure 2A-H shows photomicrographic images of cells visualized with an embodiment of a method of the invention.
  • Fig. 2A & B show HEK cells expressing PL61 that were fixed with the methanol protocol described in Example 1 and stained with Hairpin 13.
  • Fig. 2A shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. 2B shows detected fluorescence of Cy5 (attached to hairpin 13), which indicates co- localization of the mRuby and Cy5 signals.
  • Fig. 2C & D show HEK cells expressing PL62 that were fixed as above and were stained with Hairpin 13.
  • Fig. 2C shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. 2A & B show HEK cells expressing PL61 that were fixed with the methanol protocol described in Example 1 and stained with Hairpin 13.
  • Fig. 2A shows detected fluorescence of mRuby, which indicates the location
  • FIG. 2D shows detected fluorescence of Cy5 (attached to hairpin 13), which indicates there was no co- localization of the mRuby and Cy5 signals.
  • Fig. 2E & F show HEK cells expressing PL62 that were fixed as above and were stained with Hairpin 14.
  • Fig. 2E shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. 2F shows detected fluorescence of Cy5 (attached to hairpin 14), which indicates there was no co- localization of the mRuby and Cy5 signals.
  • Fig. 2G & H shows HEK cells expressing PL62 that were fixed as above and stained with Hairpin 14.
  • Fig. 2G shows detected fluorescence of mRuby, which indicates the location of the TALEs.
  • Fig. 2H shows detected fluorescence of Cy5 (attached to hairpin 14), which indicates strong co- localization of the mRuby and Cy5 signals.
  • Figure 3A-H provides photomicrographic images showing HEK cells transfected with ZF 140-COD A-3-GFP fusion protein constructs, fixed with either 95% MeOH + 5% Acetic acid (Fig. 3A-D) or 4% paraformaldehyde (Fig. 3E-H), then blocked in zinc binding buffer and stained with either cognate (Fig. 3A, 3C, 3E, and 3G) or non-cognate (Fig. 2B, 3D,
  • Staining detected in Fig. 3A, 3B, 3E, and 3F is (green) indicated native GFP signal.
  • Staining detected in Fig. 3C, 3D, 3G, and 3H is (blue or magenta) indicated fluorescent DNA hairpin signal.
  • Figure 4A-B shows a photomicrographic image of the hippocampus of mouse brain injected intracranially with an AAV PHP.eB coding for a zinc finger protein.
  • the mouse was perfused with ice-cold 95% methanol, 5% acetic acid and the brain sliced into 50mm coronal sections on a vibratome. Following blocking in zinc binding buffer, sections were stained with their fluorescent cognate oligonucleotide hairpins (Fig. 4A) and DAPI (Fig. 4B).
  • SEQ ID NO: 1 is a target DNA sequence of TALE(13):
  • SEQ ID NO: 2 is a target DNA sequence of TALE(14)
  • SEQ ID NO: 3 is DNA sequence referred to herein as Hairpin 13:
  • SEQ ID NO: 4 is DNA sequence referred to herein as Hairpin 14:
  • the invention in part, relates to multiplex methods to determine characteristics of one or a plurality of different polypeptides in a single preparation.
  • Certain aspects of the invention include genetic targeting to permit detection of polypeptides by utilizing programmability of nucleic acids for use in methods to detect the presence, absence, and/or location of preselected binding agents in fixed biological cells and tissues.
  • Methods of the invention comprise preselecting binding agents that each selectively binds its own matched specific target agent, delivering the preselected binding agents into host cells, fixing the host cells under conditions in which the preselected binding agents retain capability to selectively bind their specific target agents in the fixed host cells, contacting the fixed host cells with the specific matched target agents, and detecting target agents bound to their matched binding agent in the fixed host cells using suitable detection methods.
  • methods of the invention are based, in part, on the ability to include different detectable labels on specific target agents that are each able to selectively bind a matched preselected binding agent when it is present in a fixed host cell. This permits the use and detection of different detectable labels in a preparation of single host cell or plurality of host cells, thereby permitting detectable labels to be used to determine one or more characteristics of preselected binding agents in host cells.
  • Certain aspects of the invention comprise contacting a fixed host cell with a matched specific target agent that comprises a detectable label, and some aspects of the invention comprise contacting a fixed host cell with a matched specific target agent that does not, at that time, comprise a detectable label.
  • Methods of the invention may be carried out in a single host cell or a plurality of host cells, and a plurality of cells may include one or more than one different cell types.
  • some embodiments of the invention may comprise delivering a one preselected binding agent to the cells and certain embodiments of the invention may comprise delivering two or more different preselected binding agents to the cells.
  • the different combinations of host cell types, preselected binding agents, and flexibility in detectable labeling of matched target agents permits methods of the invention, unlike previous methods, to be utilized to detect characteristics of numerous different preselected binding agents using essentially infinite color imaging.
  • host cell fixation methods that permit the preselected binding agents to retain the capability to selectively bind their own matched specific target agents greatly expands the number of different selective bindings that can be determined in a sample that includes a single host cell or a sample comprising a plurality of host cells using methods of the invention.
  • the term“preselected” used in reference to a binding agent or a target agent means that the agent, compound, or a component thereof was chosen at least in part based on one or more of characteristics, such as but not limited to: amino acid sequence, nucleic acid sequence, binding specificity, binding selectively, binding capability to bind and/or interact with a detectable label agent, stability, localization of expression, efficiency of expression, suitable delivery means, etc.
  • the term “independently selected” used in reference to one or more of: agents, components, detectable labels, and molecules means that the agents, components, respectively may be selected that are the same as others selected, may be different from all others selected, or may be different from a portion of those selected.
  • a binding agent or target agent used in methods of the invention may include: one polypeptide, one nucleic acid, two or more
  • polypeptides two or more nucleic acid, one polypeptide and one nucleic acid, one or more polypeptides and one or more nucleic acids, and any of the foregoing that also includes one or more additional components.
  • additional component are: a detectable label, a trafficking molecule, and a delivery molecule.
  • polypeptide and“protein” are used interchangeably herein and the term polypeptide may be used to refer to a full-length protein and may also be used to refer to a fragment of a full-length protein, and/or functional variants thereof.
  • polynucleotide and“nucleic acid sequence” may be used
  • RNA Ribonucleic acid
  • DNA DNA
  • mRNA DNA
  • cDNA DNA
  • fragments thereof RNA
  • a preselected binding agent included in an embodiment of the invention may be a single molecule or may include two or more independently selected molecules.
  • a preselected binding agent used in certain methods of the invention includes one or more of a polypeptide and a nucleic acid.
  • a binding agent may include 1, 2, 3, 4 or more molecules, each independently selected from polypeptides, nucleic acids, chemical entities, and other molecules.
  • a non-limiting example of a binding agent that may be used in methods of the invention comprises a polypeptide and a nucleic acid molecule.
  • a binding agent or one or more components thereof that are delivered into a host cell are considered herein as“exogenous” to the host cell.
  • a target agent or one or more components there of that are contacted to a host cell are considered to be exogenous. It will be understood that if an agent or component thereof is naturally present in a host cell, and the agent or component thereof is also delivered into the host cell according to a method of the invention, the delivered agent or component thereof is considered to be, and is referred to herein as“exogenous”.
  • a cell into which an exogenous protein, nucleic acid or other component is delivered is referred to herein as a “host” cell.
  • Embodiments of the invention utilize preselected binding agents, such as but not limited to programmable DNA-binding proteins, non-limiting examples of which are TAL effectors and zinc fingers as programmable DNA binding proteins in cells, and
  • methods comprise delivering one or a plurality of preselected DNA-binding protein agents into a host cell, fixing the host cell under conditions that permit selective binding of the preselected DNA-binding protein agents with their specific target agents when the fixed cells are contacted with the specific target agents under suitable binding conditions.
  • the methods permit detection of detectable labels on the bound target agents, thereby providing information on one or more characteristics of the preselected DNA-binding proteins in the fixed host cells.
  • characteristics that may be determined are: presence, absence, quantity, cellular localization, and localization in a tissue or subject.
  • aspects of the invention may include preselecting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
  • Preselected binding agents may be delivered into 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more host cells.
  • Preselected binding agents delivered into a plurality of host cells may be independently selected. Independent selection can be used such that in some embodiments of the invention at least one preselected binding agent is delivered to each host cell in a plurality of host cells. In other embodiments of the invention, independent selection may result in a different preselected binding agent delivered into different host cells in a plurality of host cells. In still other embodiments of the invention independent selection can result in one or more preselected binding agents delivered to some but not all host cells in a plurality of host cells.
  • certain embodiments of the invention include delivering two or more preselected binding agents into host cells in a plurality of host cells, independent selection can be used to prepare a plurality of host cells in which different host cells comprise different combinations of preselected binding agents.
  • Another aspect of the invention includes methods of timing delivery of one or more preselected binding agents into one or more host cells.
  • means that may be used to impact timing of delivery of a preselected binding agent to a host cell are: inclusion of an inducible promoter, use of pharmacological regulation, temperature regulation.
  • two or more preselected binding agents may be delivered to a host cell or to host cells in a plurality of host cells at different times.
  • Certain methods of the invention include preselecting a binding agent sequence that has the capability to selectively bind a specific“matched” target agent.
  • the terms“match” and“matched” when used in reference to a binding agent and target agent mean that under suitable conditions the binding agent and target agent selectively bind to each other, forming what may be referred to herein as a“bound complex”.
  • a bound complex includes one preselected binding agent bound to its target agent, and in some aspects of the invention a bound complex comprises a preselected binding agent, its matched target agent, and one or more additional molecules.
  • additional molecules that may be included in a bound complex are: polypeptides, nucleic acids, and detectable agents.
  • a binding agent useful in a method of the invention may include one or more of a binding domain, a nucleic acid binding domain, a single-stranded binding domain, a double-stranded binding domain, a nucleic acid sequence that is complementary to a nucleic acid sequence present in its matched target agent, etc.
  • Non-limiting examples of components that may be included in preselected binding agents of the invention are: TAL sequences, CRISPR/Cas9 sequences, zinc finger (ZF) effector sequences, and Cas9 analog sequence effector sequences.
  • Examples of Cas9 analog sequences include, but are not limited to: Cas13a (c2c2), Cpfl, and MIMIVIRE sequences. It will be understood that routine methods can be utilized to identify and use additional art- known binding agents in certain embodiments of methods of the invention.
  • a programmable binding sequence may be a sequence that binds a nucleic acid, such as but not limited to DNA.
  • a preselected binding agent comprises a programmable nucleic acid recognition component.
  • Certain methods of the invention include delivering one or a plurality of preselected binding agents into a host cell, wherein each preselected binding agent comprises a nucleic acid binding sequence or nucleic acid analog that when contacted with a target agent comprising a matched nucleic acid sequence, selectively binds that specific target agent.
  • nucleic acid-binding molecules that may be used in methods of the invention are: nucleic acid-binding polypeptides, DNA-binding molecules, DNA-binding polypeptides, and other art-known nucleic acid-binding molecules.
  • a transcription activator-like (TAL) effector also referred to herein as a transcription activator-like effector (TALE) sequence
  • TALE transcription activator-like effector
  • TAL effector sequences that selectively bind specific nucleic acid sequences are suitable for use in embodiments of the invention in which a preselected binding agent is a preselected TAL effector sequence that has the capability to selectively bind its specific target nucleic acid sequence and can be preselected with routine methods and delivered to one or more host cells.
  • methods include use of a TAL labeling scheme, wherein a subset of a large number of TALEs are the preselected binding agents that are expressed randomly in host cells, the host cells are fixed under appropriate conditions to permit the TALEs to selectively bind their matched target agents, and the bound target agents are detected. Detection of the bound target agents can be used to identify single host cells on the basis of the specific preselected TALEs expressed in the host cells prior to the host cell fixation.
  • Non-limiting examples of preselected binding agents and matched target agents include a PL62 TALES sequence as a preselected binding agent and a target agent comprising a Hairpin 14 sequence.
  • Another non-limiting example includes a PL61 TALES sequence as a preselected binding agent and a target agent comprising Hairpin 13 sequence. Additional non-limiting examples are provided herein.
  • a zinc finger (ZF) effector sequence is included in a binding agent of the invention.
  • Art-known ZF effector sequences that selectively bind specific nucleic acid sequences are suitable for use in embodiments of the invention in which a preselected binding agent is a preselected ZF effector sequence that has the capability to selectively bind its specific target nucleic acid sequence.
  • ZF effector sequences and binding partners are suitable for use in certain embodiments of the invention are known in the art and can be preselected with routine methods and delivered to one or more host cells.
  • methods include use of a ZF labeling scheme, wherein a subset of a large number of ZFs are the preselected binding agents that are expressed randomly in host cells, the host cells are fixed under appropriate conditions to permit the ZFs to selectively bind their matched target agents, and the bound target agents are detected. Detection of the bound target agents can be used to identify single host cells on the basis of the specific preselected ZFs expressed in the host cells prior to the host cell fixation.
  • Non-limiting examples of preselected binding agents and matched target agents include: SRC-140-4 set forth herein as SEQ ID NO: 7; SRC-140-5 set forth herein as SEQ ID NO: 8; and SRC-140-CODA-3 set forth herein as SEQ ID NO: 9.
  • a non-limiting example of a double-stranded probe used as a target agent for SRC- 140-4 may be prepared by annealing: acatcGAGGACGGCagcgt (SEQ ID NO: 10) and (SEQ ID NO: 11).
  • a non-limiting example of a double-stranded probe used as a target agent for SRC-140-5 may be prepared by annealing: ttgaaGAAGATGGTgcgct (SEQ ID NO: 12) and agcgc A
  • SEQ ID NO: 13 As non-limiting example of target agents for SRC-140-CODA-3, two probe sequences including:
  • Atgta may be used in certain
  • Probe sequences set forth herein comprise:
  • detectable label which are the DNA sequences to which detectable label may be attached.
  • detectable label that can be used in certain embodiments of methods and compositions of the invention are: AlexF546N and Atto488N. It will be understood that other art-known detectable labels are suitable for use in methods and compositions of the invention.
  • binding agents and their matched target agents are known in the art and suitable for use in methods and compositions of the invention.
  • a type of preselected binding agent suitable for use in embodiments of the invention is a megaTAL effector sequence.
  • Specific art-known megaTAL effector sequences are suitable for use in certain embodiments of the invention and can be preselected with routine methods.
  • Embodiments of methods of the invention may comprise delivering one or more preselected binding agents into a host cell, wherein the binding agent comprises a sequence that selectively binds a specific target agent.
  • the term“delivery” is used in reference to direct and indirect delivery.
  • a non-limiting example of indirectly delivering a preselected binding agent into a host cell in a method of the invention is delivering a vector that encodes the preselected binding agent or component to the host cell, with subsequent expression of the preselected binding agent in the host cell.
  • Numerous art- known means are suitable for use in methods of the invention to indirectly deliver one or more binding agents, polypeptides, nucleic acids, and other molecules into a host cell.
  • a preselected binding agent is delivered as part of a fusion protein.
  • Non-limiting examples of direct delivery methods that can be used in certain embodiments of methods of the invention are: physical delivery means, non-viral vector delivery means, and use of a carrier-molecule for delivery into the host cell.
  • Non-limiting examples of direct delivery means used in certain embodiments of the invention are preselected binding agent delivery using: nanoparticles, liposomes, polymers, cell- penetrating molecules, and cell-derived membrane vesicles (CMV).
  • Additional non- limiting methods to directly deliver a binding agent in a method of the invention are: electroporation, microinjection, laser delivery, and ballistic delivery. Additional direct and indirect delivery means that are suitable for use in methods of the invention are known and routinely practiced in the art.
  • a preselected binding agent that is delivered into a host cell is part of a fusion protein. It is well known in the art how to prepare and utilize fusion proteins that comprise one or more polypeptide sequences.
  • a fusion protein can be used to deliver a binding agent, such as a TAL effector sequence, a CRISPR/Cas9 sequence, a zinc finger (ZF) effector sequence, and a Cas9 analog effector sequence, or other preselected binding agent into a host cell.
  • a fusion protein comprising a preselected binding agent includes one or more additional polypeptides.
  • Non-limiting examples of types of additional polypeptides that may be included are opsins; regulatory proteins; enzymes; structural proteins such as, but not limited to tubulin and actin; synaptic proteins such as, but not limited to Homer and Bassoon; detectable polypeptides, etc.
  • a fusion protein comprising a preselected binding agent for use in a method of the invention may be delivered to (expressed) in a specific cell type, tissue type, organ type, and/or region in a subject, or in vitro, for example in culture, or in a slice preparation, etc.
  • Methods for preparing and/or delivering a fusion protein or its encoding nucleic acid sequence are well known in the art. Routine methods can be used in conjunction with teaching provided herein to express a preselected binding agent in a desired host cell, tissue, or region in a subject or in vitro and to process the host cell according to further methods of the invention in order to permit detection of characteristics of the preselected binding agent such as presence, absence, expression level, localization, etc. as described elsewhere herein.
  • Routine methods for fusion protein preparation and delivery can be used in methods of the invention to deliver a preselected binding agent into at least one of: a specific cell type, a specific cell subtype, a specific spatial region within an organism, and a sub-cellular region within a cell.
  • Routine genetic procedures can also be used to control parameters of expression, such as but not limited to: the amount of a preselected binding agent expressed, the timing of its expression, targeting of the binding agent to a specific location in a host cell, etc.
  • a reagent for genetically targeted expression of a preselected binding agent is a vector comprising a gene encoding the preselected binding agent.
  • the term“vector” refers to a nucleic acid molecule capable of transporting between different genetic environments another nucleic acid to which it has been operatively linked.
  • the term “vector” may also be used to refer to a virus or organism that is capable of transporting the nucleic acid molecule.
  • One type of vector is an episome, i.e., a nucleic acid molecule capable of extra-chromosomal replication. Some vectors are capable of autonomous replication and/or expression of nucleic acids to which they are linked.
  • Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as“expression vectors”.
  • Other vectors that may be used in certain methods of the invention include, but are not limited to viruses such as lentiviruses, retroviruses, adenoviruses, and phages.
  • Vectors useful for indirect delivery in certain embodiments of the invention can genetically insert a preselected binding agent into dividing and/or non- dividing cells and can insert the preselected binding agent into an in vivo, in vitro, or ex vivo host cell.
  • Vectors useful in certain indirect delivery methods of the invention may include additional sequences such as, but not limited to, one or more signal sequences, trafficking sequences, promoter sequences, or combinations thereof.
  • a vector may be a lentivirus, adenovirus, adeno-associated virus, or other vector that comprises a gene encoding a preselected binding agent (also referred to herein as an “effector”), a non-limiting example of which is a TAL effector.
  • a TAL effector encoded in a vector is expressed in a cell, the cell is fixed, and then the cell is contacted with a specific target agent matched to the TAL effector.
  • Non-limiting examples of target sequences that are matched to specific TAL effectors are: a TALES(13) sequence (SEQ ID NO: 1) and a TALES(14) sequence (SEQ ID NO: 2).
  • a vector comprising a nucleic acid encoding a TAL binding agent, SRC-60B (SEQ ID NO: 5) is delivered into a cell, the TAL binding agent is expressed in the cell, the cell contacted with a fixation means, and after fixation the cell is contacted with a specific target agent for SRC-60B, a non-limiting example of which is the sequence set forth herein as SEQ ID NO: 6.
  • SEQ ID NO: 22 is DNA sequence set forth as SEQ ID NO: 6 without the 5Atto488N label. It will be understood that the identification of certain detectable labels herein may optionally be shown with a number “3” or“5” indicating their attachment position on the probe nucleic acid molecule.
  • Adeno-associated viruses such as AAV8, AAV1, AAV2, AAV4, AAV5, AAV9, are non-limiting examples of vectors that may be used in embodiments of methods of the invention to express in a cell, a fusion protein comprising a preselected binding agent.
  • AAVs Adeno-associated viruses
  • expression vectors and methods of their preparation and use are well known in the art.
  • suitable expression vectors and methods for their use to deliver a preselected binding agent to a host cell are provided herein.
  • Promoters that may be used in methods and vectors for indirect delivery of preselected binding agents in methods of the invention include, but are not limited to, cell- specific promoters or general promoters.
  • Non-limiting examples promoters that can be used in vectors of the invention are: ubiquitous promoters, such as, but not limited to: CMV, CAG, CBA, and EFla promoters; and tissue-specific promoters, such as but not limited to: Synapsin, CamKIIa, GFAP, RPE, ALB, TBG, MBP, MCK, TNT, and aMHC promoters. Methods to select and use ubiquitous promoters and tissue-specific promoters are well known in the art.
  • tissue-specific promoter that can be used in certain methods of the invention to express a preselected binding agent in a host cell such as a neuron is a synapsin promoter.
  • Additional tissue-specific promoters and general promoters are well known in the art and may be suitable for use in methods of the invention.
  • Additional sequences that may be included in a fusion protein that comprises a preselected binding agent and is suitable for use in embodiments of the invention are trafficking sequences, including, but not limited to: Kir2.1 sequences and functional variants thereof, KGC sequences, ER2 sequences, etc.
  • Trafficking polypeptides and their encoding nucleic acid sequences that are suitable for use in embodiments of the invention are known in the art and routine methods can be used to include and use such sequences in fusion proteins and vectors, respectively, for use in methods of the invention.
  • Other art- known molecules and sequences may be included in a fusion protein used in the invention and routine procedures, including, but not limited to: fluorescent proteins, for example see: Addgene Plasmid Depository (Watertown, MA), (addgene.org/fluorescent- proteins/localization/).
  • Another non-limiting example of a sequences that may be included in a vector in some embodiments of the invention is an actin fusion, which may be used in membrane localization. See for example Murakoshi, H. et al.
  • a sequences that may be included in a vector in some embodiments of the invention is a palmitoylation domain, which may be used in membrane localization. See for example Goedhart, J. et al, Nat Commun. 2012 Mar 20;
  • fusion proteins to deliver different preselected binding agents and their use in certain methods of the invention.
  • fusions of TALs to fluorescent polypeptides were expressed in cultured HEK host cell samples. The expression was validated by the presence of fluorescence. Host cell samples were fixed using a variety of fixation protocols, including aldehyde, alcohol, and acetone fixations. After fixation, target agents comprising (1) DNA hairpins that included the binding sequence of the TALs and a fluorophore or (2) different sequence (not including TAL binding sequences) and a fluorophore were incubated with the fixed host cell samples. In (1), excess hairpin target agents were removed from solution and fluorescence detected.
  • a fluorescent signal from the specific target agent DNA hairpin was detected and determined to co-localized with the fluorescent signal from the TAL fusion protein, and no fluorescent signal was detected from the non-specific DNA hairpin, and there was no signal detected in host cell samples fixed with an aldehyde solution.
  • specific target agent DNA hairpins were detected and determined to co-localize with the fluorescent signal from the TAL fusion protein, with no fluorescent signal detected from host samples contacted with the non-specific DNA hairpin and no specific target agent comprising the matched DNA hairpin.
  • specific target agent DNA hairpins were detected and determined to co-localize with the fluorescent signal from the TAL fusion protein, with no fluorescent signal detected from host samples contacted with the non-specific DNA hairpin and no specific target agent comprising the matched DNA hairpin.
  • fusions of Zinc Fingers to fluorescent polypeptides were expressed in cultured HEK host cell samples. The expression was validated by the presence of fluorescence. Host cell samples were fixed using a variety of fixation protocols, including aldehyde, alcohol, and acetone fixations. After fixation, target agents comprising (1) nucleic acid sequences (target agents) comprising the binding sequence of the ZFs and a fluorophore or (2) different sequence (not including ZF binding sequences) and a fluorophore were incubated with the fixed host cell samples. In (1), excess ZF target agents were removed from solution and fluorescence detected. The binding was found to co-localize with the fluorescent signal from the ZF fusion protein, with no fluorescent signal detected from host samples contacted with the non-specific DNA sequences not comprising ZF target agent DNA sequences.
  • target agents comprising (1) nucleic acid sequences (target agents) comprising the binding sequence of the ZFs and a fluorophore or (2) different sequence (not including ZF binding sequence
  • fixation methods of the invention are suitable to permit the fixed host cell samples to be contacted with target agent DNAs specific for their expressed preselected binding proteins, and the binding detected. Detection may include identifying localization in the host cell, quantification, and other parameters. In some aspects of the invention, more than one preselected binding protein may be expressed in a host cell and after binding and assessment of one target agent DNA, the bound target agent DNAs may be removed and a second target agent DNA may be contacted with the fixed host cells.
  • This process may be repeated 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times permitting assessment of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different preselected binding proteins expressed in a host cell.
  • the host cell, or a plurality of host cells may be fixed and following fixation may be contacted with one or more independently selected matched target agents.
  • Independent selection of target agents permits either a single specific target agent or two or more different target agents to be included in certain embodiments methods of the invention. For example, if in an embodiment of a method of the invention one preselected binding agent is delivered to a single host cell, after suitable fixation, the host cell may be contacted with the single matched target agent. If in another embodiment of a method of the invention two or more preselected binding agents are delivered to a single host cell, after suitable fixation, the host cell may be contacted with the two or more matched target agents.
  • the target agents that contact the host cells may be independently selected such that after suitable fixation: all of the host cells are contacted with the same target agent; a subset of the host cells are contacted with the same target agent; or each of the host cells are contacted with a different target agent.
  • Hairpin sequences may be used as matched target agents in certain methods of the invention.
  • DNA binding sequences and matched hairpin target agent sequences are known in the art, see for example: Praetorius, F. and Deitz, H. Science 24 Mar 2017: Vol. 355, Issue 6331, pp 54881, the content of which is incorporated herein by reference in its entirety.
  • the fixed cell or cells are contacted with the target polynucleotide under suitable binding conditions.
  • the recognition of the target sequence by the expressed binding protein results in a binding complex comprising the target polynucleotide and the binding protein.
  • a target polynucleotide is detectable, thus permitting detection of the binding complex.
  • a target polynucleotide includes and/or is attached to a detectable label.
  • a Zinc finger binding polypeptide sequence is selected and an expression vector is prepared that comprises the DNA encoding the binding protein, in this example, SRC-140-4, the sequence of which is set forth herein as SEQ ID NO: 7.
  • the vector is delivered into a cell and the selected zinc finger binding protein is expressed in the cell.
  • the cell is processed using one or more methods of the invention such as, but not limited to: fixation, washing, permeabilization, etc. and the cell is contacted with its target polynucleotide, which in this example, comprises a double-strand probe prepared by annealing the sequences set forth therein as: SEQ ID NO: 10 and SEQ ID NO: 11, which includes a detectable label: AlexF546N.
  • the double-stranded probe binds the SRC-140-4 Zinc finger binding protein. After the cell is contacted, one or more bound complexes of the SRC-140-4 Zinc finger binding protein and its matched double-stranded target polynucleotide can be detected by determining the presence of the detectable label.
  • a specific target nucleic acid may comprise a detectable label and different target nucleic acids may comprise different detectable labels, thus permitting differential detection of target nucleic acids and the specific binding agent to which they are bound.
  • a specific target nucleic acid may not initially comprise a detectable label but subsequently comprise a detectable label.
  • Strategies may include variations in parameters such as, but not limited to: timing of including one or more detectable labeled target agents, type of detectable labels on one or more target agents, means to detect one or more detectable labels on target agents; and one or more of serial and sequential contact of a fixed host cell comprising a preselected binding agent with one or more detectably labeled matched target agents, etc., thus permitting differential detection of target nucleic acids and the specific binding agent to which they are bound.
  • Serial detection methods of the invention may include contacting a fixed host cell or plurality of fixed host cells comprising one or more preselected binding agents, with two or more matched specific target agents comprising different detectable labels. After binding and removal of unbound target agents, the fixed host cell(s) are exposed to a series of detection means, each suitable to detect at least one of the different detectable labels. Use of a series of two or more different detection means, each type of detectable label in the fixed host cell(s) may be individually detected, thereby permitting identification of one or more characteristics of each different preselected binding agent bound to its matched detectably labeled target agent.
  • Successive detection methods may include contacting a fixed host cell or plurality of fixed host cells comprising one or more preselected binding agents with a succession of their matched target agents and utilizing a suitable detection means following contact with each type of matched target agent.
  • fixed host cell(s) may be contacted with a first matched specific target agent and the detectable label detected to assess the target agent bound to its matched binding agent in the fixed cell(s).
  • the first matched specific target agent the fixed host cell or plurality of host cells may be contacted with a second (different) matched target agent and the detectable label detected to assess the second target agent bound to its matched binding agent in the fixed host cell(s).
  • a matched target agent comprising a detectable label may be removed from its matched binding agent, at a time that may be subsequent to detection of the detectable label in the fixed host cell. It will be understood that a fixed host cell or plurality of fixed host cells may be contacted with two or more different matched target agents at the same time and/or at different times, and that a type of matched target agent may be contacted with a fixed host cell or plurality of fixed host cells one or more times, either alone or with one or more different matched target agents.
  • detection means that can be used in methods of the invention are: fluorescence detection, luminescence detection, chromogenic detection, autoradiography, fluorography, phosphor imaging, etc.
  • Certain embodiments of methods of the invention include contacting a fixed host cell with at least one target agent and detecting the target agent in the fixed host cell.
  • a target agent used in methods of the invention may comprise a detectable label at the time the fixed host cell is contacted with the target agent, or the target agent may not include a detectable label at the time of contact, but a detectable label may be subsequently attached to the target agent.
  • the term“detection agent” may be used interchangeably with the term“detectable label”.
  • the detectable label may be detected as a determination of one or more characteristics of the preselected binding agent to which the matched target agent is bound in the fixed host cell.
  • a target agent used in a method of the invention may comprise a detectable label or detectable agent, and when the target agent is bound to its matched preselected binding agent in a fixed host cell, detecting the detectable label provides information about characteristics of the target agent, the preselected binding agent, and the target agent/preselected binding agent bound complex.
  • Non-limiting examples of means suitable to attach a detectable label to a target agent for use in embodiments of the invention are: a chemical bond, crosslinking, a covalent bond, a non-covalent bond, and other art-known method for attaching a detectable label to a target molecule.
  • Various labeling techniques and attachment methods suitable for use in combination with the teaching presented herein are routinely used in the art. See for example, Bioconjugate Techniques, Hermanson, Greg T. Academic press, 2013, the content of which is incorporated herein by reference in its entirety.
  • Non-limiting examples of types of detectable agents that can be used in certain embodiments of the invention as part of a detectable label are: fluorophores, isotopes, and bioluminescent agents.
  • a detectable label comprises a fluorophore.
  • fluorophore molecules and agents that are suitable for use in certain embodiments of the invention are synthetic fluorophores, fluorescent polypeptides and variants thereof that selectively bind a specific region or functional group on its target molecule, which may be a target agent as described herein.
  • Non-limiting examples of detectable labels that may be attached to one or more of target agents and used in embodiments of methods of the invention are: green fluorescent protein (GFP); enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP); yellow fluorescent protein (YFP), dtTomato, mCherry, DsRed, mRuby, cyan fluorescent protein (CFP); far red fluorescent proteins, etc.
  • GFP green fluorescent protein
  • EGFP enhanced green fluorescent protein
  • RFP red fluorescent protein
  • YFP yellow fluorescent protein
  • dtTomato mCherry
  • DsRed mRuby
  • CFP cyan fluorescent protein
  • FFP far red fluorescent proteins
  • Numerous fluorescent proteins and their encoding nucleic acid sequences are known in the art and routine methods can be used to include such sequences in molecules, agents, fusion proteins and vectors, respectively, for use in methods of the invention.
  • Different detection means may be used in embodiments of the invention to detect different fluorophore detectable labels.
  • Methods for detecting detectable labels used in methods on the invention include, but are not limited to one more of: microscopy, autoradiography, fluorescence microscopy, bioluminescence imaging, MRI detection methods, radioisotope detection methods, etc.
  • Art-known methods for detecting detectable labels in fixed cells may be used in conjunction with the teaching provided herein for assessing, quantifying, localizing a detectable label in an embodiment of a method of the invention.
  • a fluorophore detectable label is covalently attached to a dsDNA target agent during synthesis of the target agent, the fluorophore is detected using FISH methods after the dsDNA target agent is bound by its matched TALE binding agent that is present in a fixed host cell.
  • the method of the invention includes a form of“in situ hybridization” using double-stranded DNA, wherein the hybridization of the preselected binding agent (the TAL protein) by the detectably labeled matched target agent is carried in a fixed system.
  • Methods of the invention permit delivering a preselected DNA-binding agent comprising a polypeptide into one or more host cells, fixing the host cells, binding the preselected DNA-binding agent to a matched target agent that comprises a detectable label, thereby essentially enabling labeling and detection of the polypeptide using the versatility and
  • Methods of the invention include delivering a preselected binding agent into one or a plurality of cells.
  • suitable fixation methods and solutions can result in the retention of the capability of a binding agent to selectively bind its matched target agent in the fixed tissue.
  • Non-limiting examples of components of fixative solutions that that have now been shown to be useful in embodiments of methods of the invention are: alcohols such as methanol and ethanol.
  • a non-limiting example of components included in a fixative solution that may be used in certain embodiments of the invention comprises a methanol and acetic acid fixative solution.
  • Percentage ratios (v/v) of methanol to acetic acid that may be included in a fixative solution are: 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%,
  • Percentage ratios (v/v) of ethanol to acetic acid that may be included in a fixative solution are: 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,
  • a fixative solution when contacted with a host cell is at a temperature of: -40°C, -30°C, -29°C, -28°C, -27°C, -26°C, -25°C, -24°C, - 23°C, -22°C, -21°C, -20°C, -19°C, -18°C, -17°C, -16°C, -15°C, -14C, -13°C, -12°C, -11°C, -10°C, -9°C, -8°C, -7°C, -6°C, -5°C, -4°C, -3°C, -2°C, -1°C, 0°C, 1°C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C,
  • a fixative solution may be between -40°C and -25°C; -30°C and -10°C; -25°C and -15°C; -25°C and 1°C; and -25°C and 25°C.
  • a host cell is contacted with a fixative solution and incubated in that solution for a period of time.
  • An incubation time period used in a method of the invention may be less than one minute, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50,
  • an incubation time of a host cell in a fixative solution is in a range from: 1-120 minutes, 1 to 60 minutes, 1 to 50 minutes, 1 to 40 minutes, 1 to 30 minutes, 1 to 25 minutes, 1 to 20 minutes, 1 to 15 minutes, 1 to 10 minutes, 1 to 5 minutes, 10 to 20 minutes, 10 to 30 minutes, or 15 to 25 minutes.
  • the incubation time of a host cell in a fixative solution is in a range from: 1- 120 minutes, 1 to 60 minutes, 1 to 50 minutes, 1 to 40 minutes, 1 to 30 minutes, 1 to 25 minutes, 1 to 20 minutes, 1 to 15 minutes, 1 to 10 minutes, 1 to 5 minutes, 10 to 20 minutes, 10 to 30 minutes, or 15 to 25 minutes.
  • Embodiments of methods of the invention include different solutions and times and the disclosure provided herein may be used in combination with art-known procedures to practice aspects of methods of the invention.
  • Addition fixatives that may be used in embodiments of methods of the invention include, but are not limited to: (1) zinc-based fixatives such as, but limited to that presented in Lykidis, D. et al, Nucleic Acids
  • a preselected binding agent comprises a component that recognizes and selectively binds a matched component in a specific target agent.
  • one or both of a preselected binding agent and its matched target agent in addition to their specific matched sequences, may also include additional sequences, such as one or more amino acid and nucleic acid sequences.
  • additional sequences such as one or more amino acid and nucleic acid sequences.
  • sequence variation in one or more specific matched pair sequences, and/or in additional sequences that are included in a predetermined binding agent and/or its matched target agent.
  • a sequence that includes variation from its“parent” sequence, and retains at least a portion of the function of the parent sequence is referred to as a functional variant.
  • the term“functional variant” as used herein in the context of a preselected binding agent or target agent for use in a methods of the invention describes a molecule with one or more of the following characteristics: (1) the variant differs in sequence from the molecule of which it is a variant; (2) the variant is a fragment of the molecule of which it is a variant and is identical in sequence to the fragment of which it is a variant, and/or (3) the variant is a fragment and differs in sequence from the fragment of the molecule of which it is a variant.
  • the term“parent” in reference to a sequence means a sequence from which a variant originates.
  • a parent sequence may be a fusion protein comprising a PL62 TALES sequence (also referred to herein as a PL62 TAL effector sequence) and a functional variant of that parent fusion protein sequence may have 1, 2, 3, 4, 5 or more modifications in its sequence, while retaining at least a portion of the function of the parent in a method of the invention.
  • a parent sequence may be a fusion protein comprising a SRC-140-CODA-3 sequence (SEQ ID NO: 16) and a functional variant of that parent fusion protein sequence may have 1, 2, 3, 4, 5 or more modifications in its sequence, while retaining at least a portion of the function of the parent in a method of the invention.
  • a sequence modification may be one or more of a substitution, deletion, insertion or a combination thereof.
  • the amino acid sequence of a variant fusion protein comprising PL62 TALES may be identical to its parent fusion protein sequence except that it has one, two, three, four, five, or more amino acid substitutions, deletions, insertions, or combinations thereof, while retaining at least a portion of the function of the parent molecule of which they are a variant.
  • a sequence of a binding agent maintains its capability to selectively bind its specific matched target agent, and regions of the binding agent that don't alter the binding properties may include one or more substitutions, deletions, insertions, combinations thereof, or other modifications.
  • the term“preselected binding agent” will be understood to encompass functional variants. Methods described herein and other art-known are suitable to assess function of a modified preselected binding agent characteristics such as, but not limited to: expression, localization in a host cell, tissue localization, level of expression, stability, internal localization in a host cell, etc.
  • a functional variant of a preselected binding agent used in a methods of the invention can maintain at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more of a level of function of a characteristic of the parent preselected binding agent, and will maintain the capability to selectively bind to its matched target agent.
  • Sequence modifications that can be included in a fusion protein that result in altered expression, localization, etc. are known in the art and can be used in embodiments of methods of the invention, while maintaining the capability of the preselected binding agent to selectively bind its matched target agent.
  • a variant of a polypeptide that is part of a preselected binding agent or a variant of a fusion protein used in certain embodiments of the invention may include one or more deletions, point mutations, truncations, amino acid substitutions and/or additions of amino acids or non-amino acid moieties. Modifications of a polypeptide of the invention may be made in certain aspects of the invention by modification of the nucleic acid sequence that encodes the fusion protein.
  • conservative amino acid substitutions may be made in a component of a preselected binding agent and/or a fusion protein used in certain methods of the invention.
  • a“conservative amino acid substitution” refers to an amino acid substitution that does not alter the relative charge or size characteristics of the polypeptide in which the amino acid substitution is made.
  • substitutions of amino acids may, in some embodiments of the invention, include substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.
  • Polypeptide variants can be prepared according to methods for altering polypeptide sequence and known to one of ordinary skill in the art.
  • Sequence identity can be determined using standard techniques known in the art.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the sequence of one protein for optimal alignment with the other protein).
  • the amino acid residues at corresponding amino acid positions are then compared.
  • Such an alignment can be performed using any one of a number of well-known computer algorithms designed and used in the art for such a purpose.
  • percent identity/similarity of polynucleotide sequences encoding a polypeptide of the invention can be determined using art-known alignment and comparison methods for nucleic acid molecules.
  • a site or region for introducing an amino acid sequence modification may be preselected, and the mutation per se need not be preselected.
  • random mutagenesis may be conducted at the target codon or region and the expressed polypeptide screened for the level of desired function or activity.
  • Techniques for making substitution mutations at preselected sites in DNA having a known sequence are well known, for example, M13 primer mutagenesis and PCR mutagenesis.
  • Variant sequences may in some embodiments of the invention be prepared by site specific mutagenesis of nucleic acids in the DNA encoding a polypeptide that is a portion of a binding agent used in a method of the invention, using cassette or PCR mutagenesis or other techniques known in the art, to produce DNA encoding the polypeptide.
  • activity of variant or fragment of a polynucleotide or polypeptide can be tested by cloning the gene encoding the altered polypeptide into a bacterial or mammalian expression vector, introducing the vector into an appropriate host cell, expressing the altered polypeptide, and testing for a functional capability of the polypeptide as disclosed herein. Additional methods for generating recombinant polypeptides are known in the art may include use of prokaryotic and eukaryotic expression systems including but not limited to bacterial and mammalian expression systems.
  • a target agent and/or fusion protein of the invention is encoded by a mammalian-codon-optimized nucleic acid sequence, which may in some embodiments be a human-codon optimized nucleic acid sequence.
  • An aspect of the invention provides a nucleic acid sequence that encodes a fusion protein comprising a preselected binding agent or variant thereof of the invention, and that is optimized for expression with a mammalian cell.
  • a nucleic acid sequence is optimized for expression in a human cell.
  • a host cell used in methods and with sequences of the invention may be an excitable cell or a non-excitable cell.
  • a host cell in which a preselected binding agent or functional variant thereof of the invention may be expressed and may be used in methods of the invention may be a prokaryotic or a eukaryotic cell.
  • Useful host cells include, but are not limited to, vertebrate host cells, which in some embodiments of the invention may be mammalian host cells.
  • a non-limiting example of host cells in which a preselected binding agent can be delivered and subsequently imaged using a method of the invention are excitable cells, which include host cells able to produce and respond to electrical signals.
  • a host cell into which a preselected binding agent is delivered in an embodiment of a method of the invention is one or more of: a single cell, an isolated cell, a cell that is one of a plurality of cells, a cell that is one in a network of two or more interconnected cells, a cell that is one of two or more cells that are in physical contact with each other, etc.
  • Non-limiting examples of cells that may be used as host cells in embodiments of methods of the invention include: nervous system cells, neurons, cardiac cells, circulatory system cells, visual system cells, auditory system cells, secretory cells, endocrine cells, and muscle cells.
  • a cell used in conjunction with the invention may be a healthy normal cell, which is not known to have a disease, disorder or abnormal condition.
  • a host cell used in conjunction with methods and compositions of the invention is an abnormal cell, for example, a cell obtained from a subject diagnosed as having a disorder, disease, or condition, including, but not limited to a degenerative cell, a neurological disease-bearing cell, a cell model of a disease or condition, an injured cell, etc.
  • a cell may be a control cell.
  • a host cell can be a model cell for a disease or condition.
  • a cell may be a free cell in culture, a free cell obtained from a subject, a cell obtained in a solid biopsy from a subject, organ, or solid culture, etc.
  • means for separating a cell or plurality of cells for fixation, staining, and detection methods of the invention may include art-known means such as, but not limited to: dissecting one or a plurality of cells from the cell’s source and sectioning a tissue that includes the cell, for example using cryostat sectioning, vibratome sectioning, microtome sectioning, etc.
  • a method of the invention may be performed, in part, on a cell section, which means on a portion of a cell that has been removed from the cell. Routine means of cell sectioning may be used to obtain one or more sections from a tissue and/or cell on which later binding and imaging steps may be performed.
  • Cell sectioning may include one or more of frozen sectioning, paraffin sectioning, sectioning of host cells in tissues infiltrated with one or more agents such as epoxy, methacrylate resins, paraffin wax- based histological waxes, etc.
  • sections of host cells and tissues may be obtained using cryostat sectioning, vibratome sectioning microtome sectioning or other suitable art-known tissue and/or cell sectioning means.
  • a preselected binding agent is delivered to one or more cells in cell culture, a cell suspension, a cell in a solution, a cell obtained from a subject, and a cell in a subject (in vivo cells).
  • Methods of the invention may be carried out in in cultured cells, cultured tissues (e.g., brain slice preparations, etc.), and in living subjects, etc.
  • the term“subject” may refer to a: human, non-human primate, cow, horse, pig, sheep, goat, dog, cat, rat, mouse, fly or other host organism.
  • a host subject is an invertebrate subject and in other aspects of the invention a host subject is a vertebrate.
  • a host subject is a mammal.
  • one or more preselected binding agents is delivered into at least one host cell in a host subject and the host cell(s) are subsequently removed from the subject and fixed and further processed according to methods of the invention outside of the subject.
  • a non-limiting example of a case in which such an approach may be used is a situation in which the host subject is a human.
  • a host cell may be removed from a subject prior to delivery of one or more preselected binding agents.
  • one or more preselected binding agents is delivered into at least one host cell in a host subject and the host cell(s) are fixed prior to removal from the subject.
  • Further processing of the fixed cells according to methods of the invention may occur in the subject or the fixed host cells may be removed from the host subject and further processed according to methods of the invention.
  • host subjects in which such an approach may be used are: invertebrates, a rodent, a bird, or other non-human subjects.
  • Some embodiments of the invention include of one or a plurality of host cells in methods and compositions for genetically targeted detection.
  • Such methods may include use of whole, living cells into which are delivered one or more preselected binding agents that include independently selected programmable binding sequences, wherein each preselected binding agent is capable of selectively binding a corresponding matched specific target agent.
  • the whole host cells are then fixed under conditions wherein the one or more preselected binding agents in the fixed host cell is capable of selectively binding the matched specific target agent to which it corresponds.
  • the whole, now fixed, host cells are contacted with the matched specific target agents corresponding to the one or more preselected binding agents, and binding of the one or more preselected binding agents and their corresponding matched specific target agents is determined in the whole fixed host cell or plurality of whole fixed host cells.
  • the whole, now fixed, host cells are sectioned and the fixed host cell sections are contacted with the matched specific target agents corresponding to the one or more preselected binding agents, and binding of the one or more preselected binding agents and corresponding matched specific target agents is determined in the fixed cell section.
  • portion of a cell may be a section of a cell, and the phrase:“at least a portion of the host cell” means (1) the entire host cell, or (2) some, but less than all of the host cell, non-limiting examples of which are: a section or multiple sections obtained from the host cell.
  • one or more preselected binding agents are delivered into a host cell, or a localized region of a host cell, for example the soma, dendrite, axon, etc.
  • Methods of the invention can be used to contact the host cell with one or more matched binding agents and to detect the bound pair in the host cell after fixation.
  • Certain embodiments of methods of the invention can be used to assess changes in a host cell, host, tissue, and/or a host subject by comparing results obtained in sample host cells with results in a control host cell.
  • Some embodiments of the invention include delivery of a preselected binding agent into a host cell and contacting the host cell with one or more candidate compounds or treatments prior to fixing the host cell.
  • a host cell is contacted with a candidate compound or treatment before delivery of one or more preselected binding agents to the host cell.
  • the contact with the candidate compound or treatment occurs after delivery of one or more preselected binding agents to the host cell, tissue, and/or subject.
  • the host cells are contacted with matched specific binding agents, binding is detected, and one or more characteristics of the delivered preselected binding agent determined by assessing the binding.
  • Results in host cells contacted with a candidate compound or treatment may be compared to results from host cells prepared, fixed, and detected, under similar conditions except without contact with the candidate compound or treatment. Differences in the binding can be used to assess the impact of the candidate compound or treatment on one or more characteristics of the preselected binding agent.
  • control results results obtained from the host cell, tissue, or subject that was not contacted with the candidate compound or treatment may be referred to as “control results” and the non-contacted host cells as“control host cells”.
  • a control may be as described above and also may be a predetermined value, which can take a variety of forms. It can be a single cut-off value, such as a median or mean. It can be established based upon comparative groups. Other examples of comparative groups may include host cells or tissues that have a disorder or condition and groups without the disorder or condition. Another comparative group may be host cells from a group with a family history of a disease or condition and host cells from a group without such a family history. A predetermined value can be arranged, for example, where a tested population is divided equally (or unequally) into groups based on results of testing. Those skilled in the art are able to select appropriate control groups and values for use in comparative methods of the invention.
  • a host cell, tissue, and/or a subject that include a host cell can be monitored for the presence or absence of a change that occurs in test conditions versus a control condition.
  • a characteristic such as level of expression or cell localization may differ in a host cell contacted with a candidate compound or treatment compared to the level of expression or localization in a control host cell.
  • a characteristic that can be assessed by detecting binding of a preselected target agent and its matched binding agent may be one or more of: a downstream effect on one or more additional cells, which occurs due to the modulation of an activity in the host cell to which the preselected binding agent was delivered.
  • Candidate-compound candidate-treatment identification methods of the invention may be carried out in a host cell in a subject or in cultured or in vitro host cells.
  • Candidate-compound identification methods of the invention may include delivery of a preselected binding agent into a cell in the subject, contacting the subject with the candidate compound or treatment (before and/or after delivering the preselected binding agent), fixing the host cells, and contacting the fixed host cell with a matched binding agent, and detecting the binding as an assessment of one or more characteristics of the preselected binding agent.
  • a result of contacting a host cell, tissue, and/or subject with a candidate compound or candidate treatment can be measured and compared to a control value as a determination of the presence or absence of an effect of the candidate compound or candidate treatment, respectively, on a characteristic in the host cell.
  • Further information that can be obtained using methods of the invention to detect bound pairs of binding agents and their specific target agents in one or a plurality of fixed host cells includes but is not limited to: the level of expression of the preselected binding agent and the effect on expression and/or localization of the binding agent resulting when prior to fixation, the host cell is contacted with a candidate modulatory compound, toxin, or other test agent.
  • Methods of the invention can be used to assess one or more aspects of up to dozens or hundreds of different preselected binding agents a host cell or plurality of host cells.
  • Non-limiting examples of procedures in which methods of the invention may be used are: screening for effects of candidate agents on host cells; assessing the internal environment of host cells and its response to external changes; identifying specific individual host cells in a plurality of host cells in which two or more of the host cells comprise independently selected different preselected binding agents; and determining localization and expression of one or more specific binding agents in neuronal host cells as a means of mapping projections and connections of such cells at the level of single cell resolution.
  • compositions An agent, host cell, compound, or molecule used in a method of the invention may be part of a composition.
  • a composition means a solution in which the agent, compound, or molecule is present.
  • Non-limiting examples of compositions are: culture media, a diluent, a solution, or other environment in which the agent, host cell, compound or molecule is located.
  • a non-limiting example of a composition is a solution that comprises a vector for delivery into a host cell in a method of the invention.
  • Another non-limiting example of a composition is a solution in which target agents are present when contacted with a fixed host cell.
  • composition used in certain methods of the invention may include one or more of: a liquid, an aqueous solution, culture media, a solute, a preservative, a fixative, or other suitable component.
  • a composition may include all or part of a fixed cell that includes at least one preselected programmable binding agent bound to its matched specific target agent, thereby forming a bound complex.
  • the preselected binding agent includes an independently selected programmable binding sequence, and the preselected binding agent is selected, at least in part, based on its capability to selectively bind its matched specific target agent.
  • the fixed cell or the part of the fixed cell include two or more different independently preselected programmable binding agents bound to their matched specific target agents each forming a bound complex.
  • a composition used in a method of the invention can but need not be a
  • pharmaceutical composition means a composition that comprises at least one pharmaceutically acceptable carrier that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable.
  • a pharmaceutical composition may be used in certain embodiments of methods of the invention, if, as a non-limiting example, one or more preselected binding agents are to be delivered into a host cell in a host subject.
  • at least one pharmaceutical composition is utilized in the delivery of one or more preselected binding agents to one or more host cells in a subject, host cells comprising the delivered preselected binding agent are removed from the subject and are fixed subsequent to their removal. In such cases the use of pharmaceutical compositions may be advantageous for the health and safety of the host subject.
  • a pharmaceutical composition comprises one or more preselected binding agents, encoding molecules, a vector that are delivered to a host cell, a host tissue, host subject, and/or a host cell in a subject, in combination with one or more additional preselected binding agents and/or in combination with one or more additional molecules, therapeutic agents, candidate agents, candidate treatments, and therapeutic regimens that are also administered to the host cell, host tissue, host subject, and/or host cell in a subject.
  • a pharmaceutical composition used in the foregoing methods may, in addition to one or more preselected binding agents, contain an effective amount of a candidate compound or therapeutic compound to alter a characteristic of a preselected binding agent in a host cell in the host subject.
  • a pharmaceutical composition of the invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials that are well-known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Pat. No. 5,211,657 and others are known by those skilled in the art. In certain embodiments of the invention, such preparations may contain salt, buffering agents, preservatives, compatible carriers, aqueous solutions, water, etc.
  • a preselected binding agent into a host cell may be achieved by various means described herein and other art-known means. Such administration may be done once, or a plurality of times prior to fixation of the host cell. If administered multiple times to a host subject, one or more preselected binding agents, polypeptides, encoding nucleic acids, and/or vectors may be administered via different routes. For example, though not intended to be limiting: a first (or the first few) administrations may be made directly into a tissue in the host subject while later administrations may be systemic.
  • the amount of a preselected binding agent delivered into a host cell, or the amount of a target agent that contacts a fixed host cell are amounts sufficient to permit sufficient binding of the preselected target agent to its matched target agent in a fixed cell and to permit detection of a detectable label attached to the target agent for determination of one or more characteristics of the preselected binding agent in the host cell. Suitable amounts can be readily determined by a practitioner using teaching provided herein in conjunction with art-known methods, and without a need for undue experimentation.
  • HEK Human embryonic kidney
  • Hairpins (sequences shown below) were diluted to ImM in TALE binding buffer and heated to 95°C for 90 seconds, and then held at room temperature for 30 minutes.
  • the buffer was prepared with 25 mM Tris, 250 mM NaCl, 5% glycerol and 5 mM TCEP, pH 8.5.
  • PL61 CAG-NLS-TALE(13)-mRuby2, which expresses a TAL effector that targets the sequence set forth as: tgctacgactaggtatacct (SEQ ID NO: 1). This sequence is from the mouse genome and is not present in human genome.
  • a fusion protein expressed from PL61 : CAG-NLS-TALE(13)-mRuby2 is also referred to herein as PL61 TALES.
  • PL62 CAG-NLS-TALE(14)-mRuby2, which expresses a TAL effector that targets the sequence set forth as: (SEQ ID NO: 2). This sequence from the mouse genome and is not present in human genome.
  • a fusion protein expressed from PL62: CAG-NLS-TALE(14)-mRuby2 is also referred to herein as PL62 TALES.
  • SEQ ID NO: 3 comprises the target sequence set forth as SEQ ID NO: 1 and a detectable label.
  • SEQ ID NO: 3 may be referred to herein as a specific target agent that is matched to the preselected binding agent, the TALE(13) effector.
  • SEQ ID NO: 20 is the DNA sequence set forth as SEQ ID NO: 3 without the 5Cy5 label.
  • SEQ ID NO: 4 comprises the target sequence set forth as SEQ ID NO: 2 and a detectable label.
  • SEQ ID NO: 4 may be referred to herein as a specific target agent that is matched to the preselected binding agent, the TALE(14) effector.
  • SEQ ID NO: 21 is the DNA sequence set forth as SEQ ID NO: 4 without the 5Cy5 label.
  • HEK cells were cultured on glass-bottom culture wells (Grace BioLabs) that had been pretreated with matrigel as per routine practice.
  • Cells were contacted with a solution comprising 4% formaldehyde/2.5% glutaraldehyde in PBS for 10 minutes at room temperature.
  • Cells were contacted with a solution pre-cooled to -20°C and comprising 95% ethanol and 5% acetic acid that. Following application of this solution to the cells, the cells were placed at -20°C for 10 minutes.
  • Cells were contacted with 100% acetone that was pre-cooled to -20°C. Following application of this solution to the cells, the cells were placed at -20°C for 10 minutes.
  • Fig. 1A-H and Fig. 2A-H show results from studies using the methanol fixation method (#3 above) and the ethanol fixation method (#4 above). These studies demonstrated successful visualization in the cells using embodiments of methods of the invention.
  • Fig. 1A shows the location of the TALES, evidenced by the detected fluorescence of mRuby.
  • Fig. IB which shows detected fluorescence of Cy5 (attached to hairpin 13), in the same location as the mRuby signal of Fig. 1A.
  • Fig. 1C shows the location of the TALES, evidenced by the detected fluorescence of mRuby.
  • Fig. ID shows a lack of detected fluorescence indicating that there was no co-localization of the PL62 TALES and hairpin 13.
  • Fig. IE shows the location of the PL62 TALES, evidenced by the detected fluorescence of mRuby.
  • Fig. IF shows a lack of detected fluorescence, which indicated that there was no co-localization of the PL62 TALES and hairpin 14.
  • Fig. 1G shows the location of the PL62 TALES, evidenced by the detected fluorescence of mRuby.
  • Fig. 1H shows detected fluorescence of Cy5 (attached to hairpin 14), in the same location as the mRuby signal of Fig. 1G.
  • Fig. 2A shows the location of the TALES, evidenced by the detected fluorescence of mRuby.
  • Fig. 2B shows detected fluorescence of Cy5 (attached to hairpin 13), in the same location as the mRuby signal of Fig. 2A.
  • Fig. 2C shows the location of the TALES, evidenced by the detected fluorescence of mRuby.
  • Fig. 2D shows a lack of corresponding detected fluorescence, which demonstrated that there was no co-localization of the PL62 TALES and hairpin 13.
  • Fig. 2E shows the location of the PL62 TALES, evidenced by the detected fluorescence of mRuby.
  • Fig. 2F shows a lack of detected fluorescence, which indicated that there was no co-localization of the PL62 TALES and hairpin 14.
  • Fig. 2G shows the location of the PL62 TALES, evidenced by the detected fluorescence of mRuby.
  • Fig. 2H shows detected fluorescence of Cy5 (attached to hairpin 14), in the same location as the mRuby signal of Fig. 2G.
  • Two probe sequences (sequences shown below) were mixed at a 1 : 1 ratio in ZBB, heated to 95°C and then brought to room temperature.
  • the zinc binding buffer included PBS with 5% BSA, 20 mM ZnCh. 1 mM MgCh and 100 mg/ml salmon sperm DNA.
  • the zinc binding buffer (ZIB) included PBS with 20 pM ZnCh. 1 mM MgCh and 100 pg/ml salmon sperm DNA
  • SRC-140-4 set forth herein as SEQ ID NO: 7.
  • SRC-140-5 set forth herein as SEQ ID NO: 8.
  • a double-stranded probe was used in experiments with SRC-140-4.
  • the probe was prepared by annealing the following two sequences: acatcGAGGACGGCagcgt (SEQ ID NO: 10) and
  • a double-stranded probe was used in experiments with SRC-140-5.
  • the probe was prepared by annealing the following two sequences: ttgaaGAAGATGGTgcgct (SEQ ID NO: 12) and
  • the DNA sequence of the complete plasmid encoding 140-COD A-3 is set forth herein as SEQ ID NO: 16.
  • HEK cells were cultured on glass-bottom culture wells (Grace BioLabs) that had been pretreated with matrigel as per routine practice.
  • Fixation Protocol 1 Standard 10% fixation protocol, with Alternative fixation protocols with 100% methanol and 70% ethanol.
  • Example 5 The studies performed in Example 5 are repeated as described except using ethanol fixation is used instead of methanol fixation.
  • Zinc fingers are observed to bind to their cognate DNA sequences following fixation with ethanol.
  • the fingers only bind to their cognate binding sequences.
  • the mouse was transcardially perfused with methanol, the brain removed and immersed in methanol. After 2 days in methanol, the brain was equilibrated in PBS with 30% sucrose until it sank, and 50mm sections were cut on the cryostat. The sections were equilibrated in ZBB for 12 hours, and stained with the double-stranded probes in ZBB similar to as described for cell culture in other Examples herein. Results indicated the co-localization of the GFP signal and the zinc finger binding signal.
  • Fig. 4A- B shows staining with the fluorescent cognate oligonucleotide hairpins (Fig. 4A) and with DAPI (Fig. 4B).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention encompasses methods and compounds for genetically targeted visualization using programmable nucleic acids to target expressed proteins in cells, tissues, and organisms.

Description

PROGRAMMABLE IMAGING METHODS AND COMPOSITIONS
RELATED APPLICATIONS
This application claims benefit under 35 U.S.C. § 119(e) of U.S. provisional application serial number 62/824,521, filed March 27, 2019, the disclosure of which is incorporated by reference herein in its entirety.
GOVERNMENT INTEREST
This invention was made with government support under NIH 2388357, NIH 2732707, NIH 3843505, and 5R01-DA029639-07 each awarded by the National Institutes of Health. The government has certain rights in the invention.
FIELD OF THE INVENTION
The invention, in some aspects, relates to method and products for genetically targeted detection of proteins in cells using programmable nucleic acids to target expressed proteins in cells, tissues, and organisms.
BACKGROUND OF THE INVENTION
Visualization of proteins in biological systems currently relies predominantly on the use of antibodies or fluorescent proteins. With such methods, only 4 or 5 fluorescent proteins can be used for visualization in a sample because of issues of spectral mixing. Although it may be possible to visualize higher numbers of antibodies in a single sample if the sample is subjected to multiple rounds of antibody staining, the process is laborious and requires the development of different high-quality antibodies for each target. Each approach is limited in its efficiency and usefulness for visualization.
SUMMARY OF THE INVENTION
According to an aspect of the invention, methods of genetically targeted detection, are provided, the methods including: delivering to at least one host cell one or more preselected binding agents comprising an independently selected programmable binding sequence, wherein each preselected binding agent is capable of selectively binding a corresponding matched specific target agent; fixing the at least one host cell under conditions wherein the one or more preselected binding agents in the fixed host cell is capable of selectively binding the matched specific target agent to which it corresponds; contacting the at least one fixed host cell with a composition comprising the matched specific target agents corresponding to the one or more preselected binding agents; and determining the binding of the one or more preselected binding agents and corresponding matched specific target agents in the at least one fixed host cell. In some embodiments, the preselected binding agent comprises one or more of a polypeptide molecule and a nucleic acid molecule. In certain embodiments, the preselected binding agent comprises a polypeptide/nucleic acid complex. In some embodiments, each of the independently selected programmable binding sequences correspond to a nucleic acid sequence in a matched specific target agent. In some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different independently selected programmable binding sequences are delivered into the host cell. In certain embodiments, each of the programmable binding sequence corresponds to and is capable of selectively binding a matched specific target agent. In some embodiments, the preselected binding agent comprises at least one of: a nucleic acid- binding molecule and a nucleic acid analog. In some embodiments, the nucleic acid- binding molecule is one or more of: a nucleic acid-binding polypeptide, a DNA-binding molecule, and a DNA-binding polypeptide. In some embodiments, the preselected binding agent comprises a transcription activator-like effector (TALE) sequence. In certain embodiments, the preselected binding agent comprises a megaTAL effector sequence. In some embodiments, the preselected binding agent comprises a CRISPR/Cas9 sequence or Cas9 analog sequence effector sequence. In some embodiments, the Cas9 analog sequence comprises a Cas13a (c2c2), Cpfl , or MIMIVIRE sequence. In certain embodiments, the preselected binding agent comprises a zinc finger (ZF) effector sequence. In some embodiments, the specific target agent comprises at least one double-stranded nucleic acid molecule. In some embodiments, the specific target agent comprises at least one single- stranded nucleic acid molecule. In certain embodiments, the specific target agent comprises one or more independently selected detectable labels. In some embodiments, the preselected programmable binding agent comprises a detectable label. In some embodiments, the detectable label comprises a fluorescent label. In some embodiments, fixing the at least one host cell comprises contacting the host cell with at least one cell fixative. In certain embodiments, the cell fixative comprises at least one of: MeOH, EtOH, acetone, an amine, a cleavable molecule, a cleavable polypeptide, a cleavable cross-linker molecule, and an aldehyde. In some embodiments, fixing comprises contacting the at least one host cell with an alcohol solution. In some embodiments, the alcohol solution comprises at least one of MeOH and EtOH. In certain embodiments, the at least one host cell is a plurality of host cells comprising one or more cell types. In some embodiments, a means for determining a characteristic of the one or more preselected binding agents in the fixed host cell, comprises detecting the one or more specific target agents bound to the matched preselected binding agent in the contacted fixed host cell. In some embodiments, the characteristic is one or more of: localization, presence, absence, and amount. In some embodiments, the at least one host cell is obtained from a subject. In certain embodiments, the at least one host cell is obtained from culture. In some embodiments, the at least one host cell comprises a neuron. In some embodiments, the one or more preselected binding agent is a plurality of independently preselected binding agents. In some embodiments, the preselected binding agent is delivered to the at least one host cell using a physical delivery means. In certain embodiments, the physical delivery means comprises at least one of microinjection, electroporation, ballistic delivery, and laser delivery. In some embodiments, the preselected binding agent is delivered to the at least one host cell by means of a vector. In certain embodiments, the vector is a viral vector or a non- viral vector. In some embodiments, the viral vector is a lentivirus vector (LV), an adenovirus vectors (AdV), an adeno-associated virus vectors (AAV), or a herpes simplex-1 virus vectors (HSV-1s). In some embodiments, the non-viral vector is a lipid nanoparticle (LNP), a liposome, a polymer, or a cell-derived membrane vesicle (CMV). In certain embodiments, the preselected binding agent is delivered to the at least one host cell by a means comprising a cell-penetrating molecule. In some embodiments, the cell-penetrating molecule comprises a cell-penetrating polypeptide. In some embodiments, the host cell is sectioned after the fixing. In certain embodiments, determining the binding of the one or more preselected programmable binding agents and corresponding matched specific target agents comprises: contacting the corresponding matched specific target agents with two or more independently selected detectable labels; imaging the detectable labels; quenching the detectable labels; and repeating steps (i)-(iii) one or more times. In some
embodiments, determining the binding of the one or more preselected binding agents and corresponding matched specific target agents comprises simultaneously contacting one or more of the corresponding matched specific target agents with two or more independently selected detectable labels and sequentially detecting the detectable labels. In some embodiments, the detectable labels are detected with a means comprising a fluorescent in situ hybridization (FISH) method. In certain embodiments, the cell is a vertebrate cell, optionally a mammalian cell, optionally a human cell. According to another aspect of the invention, compositions are provided, the compositions including a fixed cell or cell section that includes at least one preselected programmable binding agent bound to its matched specific target agent, forming a bound complex, wherein the preselected binding agent comprises an independently selected programmable binding sequence, and wherein the preselected binding agent is selected, in part, based on its capability to selectively bind its matched specific target agent. In some embodiments, the cell or cell section comprises two or more different independently preselected programmable binding agents bound to their matched specific target agents each forming a bound complex. In certain embodiments, the bound complex comprises a detectable label. In some embodiments, the preselected binding agent comprises one or more of a polypeptide molecule and a nucleic acid molecule. In some embodiments, the preselected binding agent comprises a polypeptide/nucleic acid complex. In some embodiments, each of the independently selected programmable binding sequences correspond to a nucleic acid sequence in a matched specific target agent. In certain embodiments, the preselected binding agent includes at least one of: a nucleic acid-binding molecule and a nucleic acid analog. In some embodiments, the nucleic acid-binding molecule is one or more of: a nucleic acid-binding polypeptide, a DNA-binding molecule, and a DNA-binding polypeptide. In some embodiments, the preselected binding agent comprises a transcription activator-like effector (TALE) sequence. In certain
embodiments, the preselected binding agent comprises a megaTAL effector sequence. In some embodiments, the preselected binding agent comprises a CRISPR/Cas9 sequence or Cas9 analog sequence effector sequence. In some embodiments, the Cas9 analog sequence comprises a Cas13a (c2c2), Cpfl, or MIMIVIRE sequence. In some embodiments, the preselected binding agent comprises a zinc finger (ZF) effector sequence. In certain embodiments, the specific target agent comprises at least one double-stranded nucleic acid molecule. In some embodiments, the specific target agent comprises at least one single- stranded nucleic acid molecule. In certain embodiments, the detectable label comprises a fluorescent label. In some embodiments, the fixed cell is a neuron. In some embodiments, the fixed cell section is a section of a neuron. In some embodiments, the fixed cell is a vertebrate cell, optionally is a mammalian cell, and optionally is a human cell. In certain embodiments, the fixed cell section is a section of a vertebrate cell, optionally a section of a mammalian cell, and optionally is a section of a human cell. In some embodiments, the preselected binding agent is part of a fusion protein. In some embodiments, the at least a portion of the fixed cell includes all of the fixed cell. In certain embodiments, the at least a portion of the fixed cell comprises a section obtained from the fixed cell.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1A-H shows photomicrographic images of cells visualized with an embodiment of a method of the invention. Fig. 1 A & B show HEK cells expressing PL61 that were fixed with the ethanol protocol described in Example land stained with Hairpin 13. Fig. 1A shows detected fluorescence of mRuby, which indicates the location of the TALEs. Fig. IB shows detected fluorescence of Cy5 (attached to hairpin 13), which indicates co- localization of the mRuby and Cy5 signals. Fig. 1C & D show HEK cells expressing PL62 that were fixed as above and were stained with Hairpin 13. Fig. 1C shows detected fluorescence of mRuby, which indicates the location of the TALEs. Fig. ID shows detected fluorescence of Cy5 (attached to hairpin 13), which indicates there was no co- localization of the mRuby and Cy5 signals. Fig. IE & F show HEK cells expressing PL62 that were fixed as above and were stained with Hairpin 14. Fig. IE shows detected fluorescence of mRuby, which indicates the location of the TALEs. Fig. IF shows detected fluorescence of Cy5 (attached to hairpin 14), which indicates there was no co- localization of the mRuby and Cy5 signals. Fig. 1G & H shows HEK cells expressing PL62 that were fixed as above and stained with Hairpin 14. Fig. 1G shows detected fluorescence of mRuby, which indicates the location of the TALEs. Fig. 1H shows detected fluorescence of Cy5 (attached to hairpin 14), which indicates strong co- localization of the mRuby and Cy5 signals.
Figure 2A-H shows photomicrographic images of cells visualized with an embodiment of a method of the invention. Fig. 2A & B show HEK cells expressing PL61 that were fixed with the methanol protocol described in Example 1 and stained with Hairpin 13. Fig. 2A shows detected fluorescence of mRuby, which indicates the location of the TALEs. Fig. 2B shows detected fluorescence of Cy5 (attached to hairpin 13), which indicates co- localization of the mRuby and Cy5 signals. Fig. 2C & D show HEK cells expressing PL62 that were fixed as above and were stained with Hairpin 13. Fig. 2C shows detected fluorescence of mRuby, which indicates the location of the TALEs. Fig. 2D shows detected fluorescence of Cy5 (attached to hairpin 13), which indicates there was no co- localization of the mRuby and Cy5 signals. Fig. 2E & F show HEK cells expressing PL62 that were fixed as above and were stained with Hairpin 14. Fig. 2E shows detected fluorescence of mRuby, which indicates the location of the TALEs. Fig. 2F shows detected fluorescence of Cy5 (attached to hairpin 14), which indicates there was no co- localization of the mRuby and Cy5 signals. Fig. 2G & H shows HEK cells expressing PL62 that were fixed as above and stained with Hairpin 14. Fig. 2G shows detected fluorescence of mRuby, which indicates the location of the TALEs. Fig. 2H shows detected fluorescence of Cy5 (attached to hairpin 14), which indicates strong co- localization of the mRuby and Cy5 signals.
Figure 3A-H provides photomicrographic images showing HEK cells transfected with ZF 140-COD A-3-GFP fusion protein constructs, fixed with either 95% MeOH + 5% Acetic acid (Fig. 3A-D) or 4% paraformaldehyde (Fig. 3E-H), then blocked in zinc binding buffer and stained with either cognate (Fig. 3A, 3C, 3E, and 3G) or non-cognate (Fig. 2B, 3D,
3F, and 3H) fluorescent DNA hairpins. Staining detected in Fig. 3A, 3B, 3E, and 3F is (green) indicated native GFP signal. Staining detected in Fig. 3C, 3D, 3G, and 3H is (blue or magenta) indicated fluorescent DNA hairpin signal.
Figure 4A-B shows a photomicrographic image of the hippocampus of mouse brain injected intracranially with an AAV PHP.eB coding for a zinc finger protein. Two weeks post-injection, the mouse was perfused with ice-cold 95% methanol, 5% acetic acid and the brain sliced into 50mm coronal sections on a vibratome. Following blocking in zinc binding buffer, sections were stained with their fluorescent cognate oligonucleotide hairpins (Fig. 4A) and DAPI (Fig. 4B).
BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 is a target DNA sequence of TALE(13):
Figure imgf000007_0001
SEQ ID NO: 2 is a target DNA sequence of TALE(14)
Figure imgf000007_0002
SEQ ID NO: 3 is DNA sequence referred to herein as Hairpin 13:
Figure imgf000007_0003
SEQ ID NO: 4 is DNA sequence referred to herein as Hairpin 14:
Figure imgf000007_0004
Figure imgf000008_0001
Figure imgf000009_0001
Figure imgf000010_0001
Figure imgf000011_0001
Figure imgf000012_0001
Figure imgf000013_0001
DETAILED DESCRIPTION
The invention, in part, relates to multiplex methods to determine characteristics of one or a plurality of different polypeptides in a single preparation. Certain aspects of the invention include genetic targeting to permit detection of polypeptides by utilizing programmability of nucleic acids for use in methods to detect the presence, absence, and/or location of preselected binding agents in fixed biological cells and tissues.
Methods of the invention comprise preselecting binding agents that each selectively binds its own matched specific target agent, delivering the preselected binding agents into host cells, fixing the host cells under conditions in which the preselected binding agents retain capability to selectively bind their specific target agents in the fixed host cells, contacting the fixed host cells with the specific matched target agents, and detecting target agents bound to their matched binding agent in the fixed host cells using suitable detection methods.
One advantage of methods of the invention compared to prior visualization methods is that methods of the invention are based, in part, on the ability to include different detectable labels on specific target agents that are each able to selectively bind a matched preselected binding agent when it is present in a fixed host cell. This permits the use and detection of different detectable labels in a preparation of single host cell or plurality of host cells, thereby permitting detectable labels to be used to determine one or more characteristics of preselected binding agents in host cells.
Certain aspects of the invention comprise contacting a fixed host cell with a matched specific target agent that comprises a detectable label, and some aspects of the invention comprise contacting a fixed host cell with a matched specific target agent that does not, at that time, comprise a detectable label. Methods of the invention may be carried out in a single host cell or a plurality of host cells, and a plurality of cells may include one or more than one different cell types. In a plurality of cells, some embodiments of the invention may comprise delivering a one preselected binding agent to the cells and certain embodiments of the invention may comprise delivering two or more different preselected binding agents to the cells. The different combinations of host cell types, preselected binding agents, and flexibility in detectable labeling of matched target agents permits methods of the invention, unlike previous methods, to be utilized to detect characteristics of numerous different preselected binding agents using essentially infinite color imaging.
In addition to the combinations of methods described herein, inclusion of host cell fixation methods that permit the preselected binding agents to retain the capability to selectively bind their own matched specific target agents greatly expands the number of different selective bindings that can be determined in a sample that includes a single host cell or a sample comprising a plurality of host cells using methods of the invention. As used herein the term“preselected” used in reference to a binding agent or a target agent means that the agent, compound, or a component thereof was chosen at least in part based on one or more of characteristics, such as but not limited to: amino acid sequence, nucleic acid sequence, binding specificity, binding selectively, binding capability to bind and/or interact with a detectable label agent, stability, localization of expression, efficiency of expression, suitable delivery means, etc. As used herein the term “independently selected” used in reference to one or more of: agents, components, detectable labels, and molecules means that the agents, components, respectively may be selected that are the same as others selected, may be different from all others selected, or may be different from a portion of those selected.
As used herein the term“agent” is used to refer to a single molecule or a complex of two or more molecules. For example, a binding agent or target agent used in methods of the invention may include: one polypeptide, one nucleic acid, two or more
polypeptides, two or more nucleic acid, one polypeptide and one nucleic acid, one or more polypeptides and one or more nucleic acids, and any of the foregoing that also includes one or more additional components. Non-limiting examples of an additional component are: a detectable label, a trafficking molecule, and a delivery molecule.
The terms“polypeptide” and“protein” are used interchangeably herein and the term polypeptide may be used to refer to a full-length protein and may also be used to refer to a fragment of a full-length protein, and/or functional variants thereof. As used herein, the terms“polynucleotide” and“nucleic acid sequence” may be used
interchangeably and may comprise genetic material including, but not limited to: RNA, DNA, mRNA, cDNA, etc., which may include full length sequences, functional variants, and/or fragments thereof.
Binding Agents
A preselected binding agent included in an embodiment of the invention may be a single molecule or may include two or more independently selected molecules. A preselected binding agent used in certain methods of the invention includes one or more of a polypeptide and a nucleic acid. A binding agent may include 1, 2, 3, 4 or more molecules, each independently selected from polypeptides, nucleic acids, chemical entities, and other molecules. A non-limiting example of a binding agent that may be used in methods of the invention comprises a polypeptide and a nucleic acid molecule. A binding agent or one or more components thereof that are delivered into a host cell are considered herein as“exogenous” to the host cell. Similarly, a target agent or one or more components there of that are contacted to a host cell are considered to be exogenous. It will be understood that if an agent or component thereof is naturally present in a host cell, and the agent or component thereof is also delivered into the host cell according to a method of the invention, the delivered agent or component thereof is considered to be, and is referred to herein as“exogenous”. A cell into which an exogenous protein, nucleic acid or other component is delivered is referred to herein as a “host” cell.
Embodiments of the invention utilize preselected binding agents, such as but not limited to programmable DNA-binding proteins, non-limiting examples of which are TAL effectors and zinc fingers as programmable DNA binding proteins in cells, and
CRISPR/Cas9 effectors. The use of such programmable agents in certain embodiments of the invention permits inclusion within a single cell of a plurality of binding agents that each specifically binds its target sequence, permitting precise detection of a plurality of preselected polypeptides. In some aspects of the invention, methods comprise delivering one or a plurality of preselected DNA-binding protein agents into a host cell, fixing the host cell under conditions that permit selective binding of the preselected DNA-binding protein agents with their specific target agents when the fixed cells are contacted with the specific target agents under suitable binding conditions. The methods permit detection of detectable labels on the bound target agents, thereby providing information on one or more characteristics of the preselected DNA-binding proteins in the fixed host cells. Non- limiting examples of characteristics that may be determined are: presence, absence, quantity, cellular localization, and localization in a tissue or subject.
Aspects of the invention may include preselecting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, or more binding agents each having the capability to selectively bind its matched specific target agent. Preselected binding agents may be delivered into 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more host cells. Preselected binding agents delivered into a plurality of host cells may be independently selected. Independent selection can be used such that in some embodiments of the invention at least one preselected binding agent is delivered to each host cell in a plurality of host cells. In other embodiments of the invention, independent selection may result in a different preselected binding agent delivered into different host cells in a plurality of host cells. In still other embodiments of the invention independent selection can result in one or more preselected binding agents delivered to some but not all host cells in a plurality of host cells.
It will be understood that because certain embodiments of the invention include delivering two or more preselected binding agents into host cells in a plurality of host cells, independent selection can be used to prepare a plurality of host cells in which different host cells comprise different combinations of preselected binding agents.
Another aspect of the invention includes methods of timing delivery of one or more preselected binding agents into one or more host cells. Non-limiting examples of means that may be used to impact timing of delivery of a preselected binding agent to a host cell are: inclusion of an inducible promoter, use of pharmacological regulation, temperature regulation. In some aspects of the invention, two or more preselected binding agents may be delivered to a host cell or to host cells in a plurality of host cells at different times.
Other art-known means may also be included in methods of the invention to control delivery and/or modulate expression of one or more preselected binding agent in a host cell.
Certain methods of the invention include preselecting a binding agent sequence that has the capability to selectively bind a specific“matched” target agent. As used herein the terms“match” and“matched” when used in reference to a binding agent and target agent, mean that under suitable conditions the binding agent and target agent selectively bind to each other, forming what may be referred to herein as a“bound complex”. In certain aspects of the invention a bound complex includes one preselected binding agent bound to its target agent, and in some aspects of the invention a bound complex comprises a preselected binding agent, its matched target agent, and one or more additional molecules. Non-limiting examples of additional molecules that may be included in a bound complex are: polypeptides, nucleic acids, and detectable agents.
A binding agent useful in a method of the invention may include one or more of a binding domain, a nucleic acid binding domain, a single-stranded binding domain, a double-stranded binding domain, a nucleic acid sequence that is complementary to a nucleic acid sequence present in its matched target agent, etc. Specific protein-nucleic acid binding sites/sequences; nucleic acid/nucleic acid binding sites/sequences;
protein/protein binding sites/sequences; and conditions under which their selective binding occurs are used in methods of the invention. Methods to select and confirm matched sequence pairs that selectively bind each other are well known and routinely practiced in the art. Non-limiting examples of components that may be included in preselected binding agents of the invention are: TAL sequences, CRISPR/Cas9 sequences, zinc finger (ZF) effector sequences, and Cas9 analog sequence effector sequences. Examples of Cas9 analog sequences include, but are not limited to: Cas13a (c2c2), Cpfl, and MIMIVIRE sequences. It will be understood that routine methods can be utilized to identify and use additional art- known binding agents in certain embodiments of methods of the invention. Some methods of the invention include use of programmable binding sequences. A programmable binding sequence may be a sequence that binds a nucleic acid, such as but not limited to DNA. In certain aspects of the invention, a preselected binding agent comprises a programmable nucleic acid recognition component.
Methods for selecting and delivering one or more programmable nucleic acid recognition components to cells, tissues, and organisms are known in the art and can be used in combination with the teaching provided herein. Non-limiting examples of art-know methods for preparing and using programmable nucleic acid recognition systems, recognition sequences, binding sequences, and components thereof described in the art, see for example: Ghaemmaghaml, S. (2003) Nature Vol. 425, 737-741; Deng, W. et al, (2015) PNAS, Vol. 112, No. 38, 11870-11875; and Shechner, D. M., et al, (2015) Nature Methods Vol. 12(7):664-670; each of which is incorporated herein by reference in its entirety. Art-known methods and compounds for selecting programmable recognition sequences and binding sequences may be used in combination with the teaching provided in certain embodiments of methods of the invention.
Certain methods of the invention include delivering one or a plurality of preselected binding agents into a host cell, wherein each preselected binding agent comprises a nucleic acid binding sequence or nucleic acid analog that when contacted with a target agent comprising a matched nucleic acid sequence, selectively binds that specific target agent. Non-limiting examples of nucleic acid-binding molecules that may be used in methods of the invention are: nucleic acid-binding polypeptides, DNA-binding molecules, DNA-binding polypeptides, and other art-known nucleic acid-binding molecules.
In certain aspects of the invention a transcription activator-like (TAL) effector, also referred to herein as a transcription activator-like effector (TALE) sequence, is included in a binding agent of the invention. In addition to those disclosed herein, other art-known TAL effector sequences that selectively bind specific nucleic acid sequences are suitable for use in embodiments of the invention in which a preselected binding agent is a preselected TAL effector sequence that has the capability to selectively bind its specific target nucleic acid sequence and can be preselected with routine methods and delivered to one or more host cells.
In some aspects of the invention, methods include use of a TAL labeling scheme, wherein a subset of a large number of TALEs are the preselected binding agents that are expressed randomly in host cells, the host cells are fixed under appropriate conditions to permit the TALEs to selectively bind their matched target agents, and the bound target agents are detected. Detection of the bound target agents can be used to identify single host cells on the basis of the specific preselected TALEs expressed in the host cells prior to the host cell fixation.
Non-limiting examples of preselected binding agents and matched target agents include a PL62 TALES sequence as a preselected binding agent and a target agent comprising a Hairpin 14 sequence. Another non-limiting example includes a PL61 TALES sequence as a preselected binding agent and a target agent comprising Hairpin 13 sequence. Additional non-limiting examples are provided herein.
In certain aspects of the invention a zinc finger (ZF) effector sequence is included in a binding agent of the invention. Art-known ZF effector sequences that selectively bind specific nucleic acid sequences are suitable for use in embodiments of the invention in which a preselected binding agent is a preselected ZF effector sequence that has the capability to selectively bind its specific target nucleic acid sequence. ZF effector sequences and binding partners are suitable for use in certain embodiments of the invention are known in the art and can be preselected with routine methods and delivered to one or more host cells.
In some aspects of the invention, methods include use of a ZF labeling scheme, wherein a subset of a large number of ZFs are the preselected binding agents that are expressed randomly in host cells, the host cells are fixed under appropriate conditions to permit the ZFs to selectively bind their matched target agents, and the bound target agents are detected. Detection of the bound target agents can be used to identify single host cells on the basis of the specific preselected ZFs expressed in the host cells prior to the host cell fixation.
Non-limiting examples of preselected binding agents and matched target agents include: SRC-140-4 set forth herein as SEQ ID NO: 7; SRC-140-5 set forth herein as SEQ ID NO: 8; and SRC-140-CODA-3 set forth herein as SEQ ID NO: 9. A non-limiting example of a double-stranded probe used as a target agent for SRC- 140-4 may be prepared by annealing: acatcGAGGACGGCagcgt (SEQ ID NO: 10) and
Figure imgf000020_0001
(SEQ ID NO: 11). A non-limiting example of a double-stranded probe used as a target agent for SRC-140-5 may be prepared by annealing: ttgaaGAAGATGGTgcgct (SEQ ID NO: 12) and agcgc A
Figure imgf000020_0002
(SEQ ID NO: 13). As non-limiting example of target agents for SRC-140-CODA-3, two probe sequences including:
gccga
Figure imgf000020_0003
ID NO: 14) and atgta may be used in certain
Figure imgf000020_0004
embodiments of the invention. Probe sequences set forth herein comprise:
Figure imgf000020_0005
19), which are the DNA sequences to which detectable label may be attached. Non- limiting examples of a detectable label that can be used in certain embodiments of methods and compositions of the invention are: AlexF546N and Atto488N. It will be understood that other art-known detectable labels are suitable for use in methods and compositions of the invention.
Numerous other examples of binding agents and their matched target agents are known in the art and suitable for use in methods and compositions of the invention.
Another non-limiting example of a type of preselected binding agent suitable for use in embodiments of the invention is a megaTAL effector sequence. Specific art-known megaTAL effector sequences are suitable for use in certain embodiments of the invention and can be preselected with routine methods.
Binding Agent Delivery
Embodiments of methods of the invention may comprise delivering one or more preselected binding agents into a host cell, wherein the binding agent comprises a sequence that selectively binds a specific target agent. As used herein, the term“delivery” is used in reference to direct and indirect delivery. A non-limiting example of indirectly delivering a preselected binding agent into a host cell in a method of the invention is delivering a vector that encodes the preselected binding agent or component to the host cell, with subsequent expression of the preselected binding agent in the host cell. Numerous art- known means are suitable for use in methods of the invention to indirectly deliver one or more binding agents, polypeptides, nucleic acids, and other molecules into a host cell. In certain aspects of the invention, a preselected binding agent is delivered as part of a fusion protein.
Non-limiting examples of direct delivery methods that can be used in certain embodiments of methods of the invention are: physical delivery means, non-viral vector delivery means, and use of a carrier-molecule for delivery into the host cell. Non-limiting examples of direct delivery means used in certain embodiments of the invention are preselected binding agent delivery using: nanoparticles, liposomes, polymers, cell- penetrating molecules, and cell-derived membrane vesicles (CMV). Additional non- limiting methods to directly deliver a binding agent in a method of the invention are: electroporation, microinjection, laser delivery, and ballistic delivery. Additional direct and indirect delivery means that are suitable for use in methods of the invention are known and routinely practiced in the art.
In some embodiments of the invention a preselected binding agent that is delivered into a host cell is part of a fusion protein. It is well known in the art how to prepare and utilize fusion proteins that comprise one or more polypeptide sequences. In certain embodiments of the invention, a fusion protein can be used to deliver a binding agent, such as a TAL effector sequence, a CRISPR/Cas9 sequence, a zinc finger (ZF) effector sequence, and a Cas9 analog effector sequence, or other preselected binding agent into a host cell. In some aspects of the invention, a fusion protein comprising a preselected binding agent includes one or more additional polypeptides. Non-limiting examples of types of additional polypeptides that may be included are opsins; regulatory proteins; enzymes; structural proteins such as, but not limited to tubulin and actin; synaptic proteins such as, but not limited to Homer and Bassoon; detectable polypeptides, etc.
A fusion protein comprising a preselected binding agent for use in a method of the invention may be delivered to (expressed) in a specific cell type, tissue type, organ type, and/or region in a subject, or in vitro, for example in culture, or in a slice preparation, etc. Methods for preparing and/or delivering a fusion protein or its encoding nucleic acid sequence are well known in the art. Routine methods can be used in conjunction with teaching provided herein to express a preselected binding agent in a desired host cell, tissue, or region in a subject or in vitro and to process the host cell according to further methods of the invention in order to permit detection of characteristics of the preselected binding agent such as presence, absence, expression level, localization, etc. as described elsewhere herein. Routine methods for fusion protein preparation and delivery can be used in methods of the invention to deliver a preselected binding agent into at least one of: a specific cell type, a specific cell subtype, a specific spatial region within an organism, and a sub-cellular region within a cell. Routine genetic procedures can also be used to control parameters of expression, such as but not limited to: the amount of a preselected binding agent expressed, the timing of its expression, targeting of the binding agent to a specific location in a host cell, etc.
In some embodiments of the invention a reagent for genetically targeted expression of a preselected binding agent is a vector comprising a gene encoding the preselected binding agent. As used herein in reference to indirect delivery means, the term“vector” refers to a nucleic acid molecule capable of transporting between different genetic environments another nucleic acid to which it has been operatively linked. The term “vector” may also be used to refer to a virus or organism that is capable of transporting the nucleic acid molecule. One type of vector is an episome, i.e., a nucleic acid molecule capable of extra-chromosomal replication. Some vectors are capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as“expression vectors”. Other vectors that may be used in certain methods of the invention include, but are not limited to viruses such as lentiviruses, retroviruses, adenoviruses, and phages. Vectors useful for indirect delivery in certain embodiments of the invention can genetically insert a preselected binding agent into dividing and/or non- dividing cells and can insert the preselected binding agent into an in vivo, in vitro, or ex vivo host cell.
Vectors useful in certain indirect delivery methods of the invention may include additional sequences such as, but not limited to, one or more signal sequences, trafficking sequences, promoter sequences, or combinations thereof. In certain embodiments of the invention, a vector may be a lentivirus, adenovirus, adeno-associated virus, or other vector that comprises a gene encoding a preselected binding agent (also referred to herein as an “effector”), a non-limiting example of which is a TAL effector. In some embodiments of the invention a TAL effector encoded in a vector is expressed in a cell, the cell is fixed, and then the cell is contacted with a specific target agent matched to the TAL effector. Non-limiting examples of target sequences that are matched to specific TAL effectors are: a TALES(13) sequence (SEQ ID NO: 1) and a TALES(14) sequence (SEQ ID NO: 2). In certain embodiments of the invention, a vector comprising a nucleic acid encoding a TAL binding agent, SRC-60B (SEQ ID NO: 5), is delivered into a cell, the TAL binding agent is expressed in the cell, the cell contacted with a fixation means, and after fixation the cell is contacted with a specific target agent for SRC-60B, a non-limiting example of which is the sequence set forth herein as SEQ ID NO: 6. SEQ ID NO: 22 is DNA sequence set forth as SEQ ID NO: 6 without the 5Atto488N label. It will be understood that the identification of certain detectable labels herein may optionally be shown with a number “3” or“5” indicating their attachment position on the probe nucleic acid molecule.
Some embodiments of the invention include a vector comprising a gene encoding a preselected Zinc Finger (ZF) binding agent. Non-limiting examples of the encoding sequences are: SRC-140-4 (SEQ ID NO: 7), SRC-140-5 (SEQ ID NO: 8), and SRC-140- CODA-3 (SEQ ID NO: 9). The sequence set forth herein as SEQ ID NO: 16 is a non- limiting example of a plasmid vector sequence that comprises a sequence encoding a preselected binding agent, in this instance, SRC-140-CODA-3 (SEQ ID NO: 9).
It will be understood that other vectors and other sequences encoding a preselected binding agent can be used and included in methods of the invention. Adeno-associated viruses (AAVs) such as AAV8, AAV1, AAV2, AAV4, AAV5, AAV9, are non-limiting examples of vectors that may be used in embodiments of methods of the invention to express in a cell, a fusion protein comprising a preselected binding agent. Expression vectors and methods of their preparation and use are well known in the art. Non-limiting examples of suitable expression vectors and methods for their use to deliver a preselected binding agent to a host cell are provided herein.
Promoters that may be used in methods and vectors for indirect delivery of preselected binding agents in methods of the invention include, but are not limited to, cell- specific promoters or general promoters. Non-limiting examples promoters that can be used in vectors of the invention are: ubiquitous promoters, such as, but not limited to: CMV, CAG, CBA, and EFla promoters; and tissue-specific promoters, such as but not limited to: Synapsin, CamKIIa, GFAP, RPE, ALB, TBG, MBP, MCK, TNT, and aMHC promoters. Methods to select and use ubiquitous promoters and tissue-specific promoters are well known in the art. A non-limiting example of a tissue-specific promoter that can be used in certain methods of the invention to express a preselected binding agent in a host cell such as a neuron is a synapsin promoter. Additional tissue-specific promoters and general promoters are well known in the art and may be suitable for use in methods of the invention. Additional sequences that may be included in a fusion protein that comprises a preselected binding agent and is suitable for use in embodiments of the invention are trafficking sequences, including, but not limited to: Kir2.1 sequences and functional variants thereof, KGC sequences, ER2 sequences, etc. Trafficking polypeptides and their encoding nucleic acid sequences that are suitable for use in embodiments of the invention are known in the art and routine methods can be used to include and use such sequences in fusion proteins and vectors, respectively, for use in methods of the invention. Other art- known molecules and sequences may be included in a fusion protein used in the invention and routine procedures, including, but not limited to: fluorescent proteins, for example see: Addgene Plasmid Depository (Watertown, MA), (addgene.org/fluorescent- proteins/localization/). Another non-limiting example of a sequences that may be included in a vector in some embodiments of the invention is an actin fusion, which may be used in membrane localization. See for example Murakoshi, H. et al. Brain Cell Biol. 2008 August; 36(1-4): 31-42, the content of which is incorporated by reference herein in its entirety. Another non-limiting example of a sequences that may be included in a vector in some embodiments of the invention is a palmitoylation domain, which may be used in membrane localization. See for example Goedhart, J. et al, Nat Commun. 2012 Mar 20;
3: 751, the content of which is incorporated by reference herein in its entirety.
The use of fusion proteins to deliver different preselected binding agents and their use in certain methods of the invention has now been demonstrated. As a non-limiting example, fusions of TALs to fluorescent polypeptides were expressed in cultured HEK host cell samples. The expression was validated by the presence of fluorescence. Host cell samples were fixed using a variety of fixation protocols, including aldehyde, alcohol, and acetone fixations. After fixation, target agents comprising (1) DNA hairpins that included the binding sequence of the TALs and a fluorophore or (2) different sequence (not including TAL binding sequences) and a fluorophore were incubated with the fixed host cell samples. In (1), excess hairpin target agents were removed from solution and fluorescence detected. In host cell samples fixed with an alcohol solution only, a fluorescent signal from the specific target agent DNA hairpin was detected and determined to co-localized with the fluorescent signal from the TAL fusion protein, and no fluorescent signal was detected from the non-specific DNA hairpin, and there was no signal detected in host cell samples fixed with an aldehyde solution. In other embodiments of the invention comprising fixation of host cell samples with a methanol solution, specific target agent DNA hairpins were detected and determined to co-localize with the fluorescent signal from the TAL fusion protein, with no fluorescent signal detected from host samples contacted with the non-specific DNA hairpin and no specific target agent comprising the matched DNA hairpin. In some embodiments of the invention comprising fixation of host cell samples with ethanol, specific target agent DNA hairpins were detected and determined to co-localize with the fluorescent signal from the TAL fusion protein, with no fluorescent signal detected from host samples contacted with the non-specific DNA hairpin and no specific target agent comprising the matched DNA hairpin.
As another non-limiting example, fusions of Zinc Fingers to fluorescent polypeptides were expressed in cultured HEK host cell samples. The expression was validated by the presence of fluorescence. Host cell samples were fixed using a variety of fixation protocols, including aldehyde, alcohol, and acetone fixations. After fixation, target agents comprising (1) nucleic acid sequences (target agents) comprising the binding sequence of the ZFs and a fluorophore or (2) different sequence (not including ZF binding sequences) and a fluorophore were incubated with the fixed host cell samples. In (1), excess ZF target agents were removed from solution and fluorescence detected. The binding was found to co-localize with the fluorescent signal from the ZF fusion protein, with no fluorescent signal detected from host samples contacted with the non-specific DNA sequences not comprising ZF target agent DNA sequences.
Certain embodiments of the invention include use of fixation protocols prior to contacting host cells with a target agent DNA, for example that binds to the TAL effector, ZF effector, or other preselected binding polypeptide. Certain examples of fixatives and fixative protocols that may be used in methods of the invention are provided herein, and include but are not limited to: 10% formalin, 4% paraformaldehyde, methanol-containing fixatives, ethanol-containing fixatives, and procedures described elsewhere herein. These and other fixative methods of the invention may be used in certain embodiments of the invention to fix host cell samples in which one or more preselected binding proteins have been expressed. The fixation methods of the invention are suitable to permit the fixed host cell samples to be contacted with target agent DNAs specific for their expressed preselected binding proteins, and the binding detected. Detection may include identifying localization in the host cell, quantification, and other parameters. In some aspects of the invention, more than one preselected binding protein may be expressed in a host cell and after binding and assessment of one target agent DNA, the bound target agent DNAs may be removed and a second target agent DNA may be contacted with the fixed host cells.
This process may be repeated 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times permitting assessment of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different preselected binding proteins expressed in a host cell.
Target agents
After delivery of one or more preselected binding agents to a host cell, the host cell, or a plurality of host cells may be fixed and following fixation may be contacted with one or more independently selected matched target agents. Independent selection of target agents permits either a single specific target agent or two or more different target agents to be included in certain embodiments methods of the invention. For example, if in an embodiment of a method of the invention one preselected binding agent is delivered to a single host cell, after suitable fixation, the host cell may be contacted with the single matched target agent. If in another embodiment of a method of the invention two or more preselected binding agents are delivered to a single host cell, after suitable fixation, the host cell may be contacted with the two or more matched target agents. In a situation in which an embodiment of the invention includes delivering one or more preselected binding agents to two or more host cells, the target agents that contact the host cells may be independently selected such that after suitable fixation: all of the host cells are contacted with the same target agent; a subset of the host cells are contacted with the same target agent; or each of the host cells are contacted with a different target agent.
As described herein, a target agent used in a method of the invention may include a region or sequence that matches and selectively binds a preselected binding agent that has been delivered to and/or expressed in a host cell. In a non-limiting example, an independently selected target agent comprises a specific double-stranded DNA (dsDNA) sequence that is selectively bound by a preselected TAL effector binding agent. The preselected TAL effector binding agent is delivered to a host cell and the host cell is fixed under suitable conditions to permit binding of the preselected TAL effector binding agent and its matched target agent. After fixation, the host cell is contacted with the target agent and the target agent is detected, which indicates one or more characteristics of the preselected TAL effectors. Hairpin sequences may be used as matched target agents in certain methods of the invention. DNA binding sequences and matched hairpin target agent sequences are known in the art, see for example: Praetorius, F. and Deitz, H. Science 24 Mar 2017: Vol. 355, Issue 6331, pp 54881, the content of which is incorporated herein by reference in its entirety. Following fixation of a cell or cells comprising the expressed binding protein, the fixed cell or cells are contacted with the target polynucleotide under suitable binding conditions. The recognition of the target sequence by the expressed binding protein results in a binding complex comprising the target polynucleotide and the binding protein. In some embodiments of the invention, a target polynucleotide is detectable, thus permitting detection of the binding complex. In some embodiments of the invention, a target polynucleotide includes and/or is attached to a detectable label.
As another non-limiting example, a Zinc finger binding polypeptide sequence is selected and an expression vector is prepared that comprises the DNA encoding the binding protein, in this example, SRC-140-4, the sequence of which is set forth herein as SEQ ID NO: 7. In this example, the vector is delivered into a cell and the selected zinc finger binding protein is expressed in the cell. The cell is processed using one or more methods of the invention such as, but not limited to: fixation, washing, permeabilization, etc. and the cell is contacted with its target polynucleotide, which in this example, comprises a double-strand probe prepared by annealing the sequences set forth therein as: SEQ ID NO: 10 and SEQ ID NO: 11, which includes a detectable label: AlexF546N. The double-stranded probe binds the SRC-140-4 Zinc finger binding protein. After the cell is contacted, one or more bound complexes of the SRC-140-4 Zinc finger binding protein and its matched double-stranded target polynucleotide can be detected by determining the presence of the detectable label.
In some embodiments a specific target nucleic acid may comprise a detectable label and different target nucleic acids may comprise different detectable labels, thus permitting differential detection of target nucleic acids and the specific binding agent to which they are bound. In certain embodiments of the invention a specific target nucleic acid may not initially comprise a detectable label but subsequently comprise a detectable label. Non-limiting examples of different steps that may be included in embodiments of methods of the invention: are: contact a fixed host cell with two or more target agents comprising the same type of detectable label; contacting a fixed host cell with two or more target agents comprising two or more different detectable labels; removing one or more detectably labeled target agent from a fixed host cell; and contacting fixed host cell with one or more different detectably labeled target agents at one or more different times. It will be understood that certain embodiments of methods of the invention may utilize additional detectable labeling strategies suitable to permit detection of a plurality of polypeptides in a host cell, host cells, and/or tissues comprising one or a plurality of host cells. Strategies may include variations in parameters such as, but not limited to: timing of including one or more detectable labeled target agents, type of detectable labels on one or more target agents, means to detect one or more detectable labels on target agents; and one or more of serial and sequential contact of a fixed host cell comprising a preselected binding agent with one or more detectably labeled matched target agents, etc., thus permitting differential detection of target nucleic acids and the specific binding agent to which they are bound.
Serial detection methods of the invention may include contacting a fixed host cell or plurality of fixed host cells comprising one or more preselected binding agents, with two or more matched specific target agents comprising different detectable labels. After binding and removal of unbound target agents, the fixed host cell(s) are exposed to a series of detection means, each suitable to detect at least one of the different detectable labels. Use of a series of two or more different detection means, each type of detectable label in the fixed host cell(s) may be individually detected, thereby permitting identification of one or more characteristics of each different preselected binding agent bound to its matched detectably labeled target agent.
Certain embodiments of the invention may use methods for successive detection methods. Successive detection methods may include contacting a fixed host cell or plurality of fixed host cells comprising one or more preselected binding agents with a succession of their matched target agents and utilizing a suitable detection means following contact with each type of matched target agent. For example, fixed host cell(s) may be contacted with a first matched specific target agent and the detectable label detected to assess the target agent bound to its matched binding agent in the fixed cell(s). After detection, the first matched specific target agent the fixed host cell or plurality of host cells may be contacted with a second (different) matched target agent and the detectable label detected to assess the second target agent bound to its matched binding agent in the fixed host cell(s). These steps may be repeated 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, or more times, which enables detection of a corresponding number of bound target agents and the concomitant determination of one or more characteristics of the bound matched preselected binding agents in a single fixed host cell or a plurality of fixed host cells.
It will be understood that in certain aspects of the invention, a matched target agent comprising a detectable label may be removed from its matched binding agent, at a time that may be subsequent to detection of the detectable label in the fixed host cell. It will be understood that a fixed host cell or plurality of fixed host cells may be contacted with two or more different matched target agents at the same time and/or at different times, and that a type of matched target agent may be contacted with a fixed host cell or plurality of fixed host cells one or more times, either alone or with one or more different matched target agents.
Detection Agents and Imaging
As used herein the terms:“detect” and“detection” used in reference to determining binding mean identifying using any suitable means, a detectable label or other physical characteristic associated with a target agent. Non-limiting examples of detection means that can be used in methods of the invention are: fluorescence detection, luminescence detection, chromogenic detection, autoradiography, fluorography, phosphor imaging, etc.
Certain embodiments of methods of the invention include contacting a fixed host cell with at least one target agent and detecting the target agent in the fixed host cell. A target agent used in methods of the invention may comprise a detectable label at the time the fixed host cell is contacted with the target agent, or the target agent may not include a detectable label at the time of contact, but a detectable label may be subsequently attached to the target agent.
As used herein the term“detection agent” may be used interchangeably with the term“detectable label”. In instances where a target agent comprises a detectable label when it contacts the host cell and binds its matched binding agent in the host cell, the detectable label may be detected as a determination of one or more characteristics of the preselected binding agent to which the matched target agent is bound in the fixed host cell. A target agent used in a method of the invention may comprise a detectable label or detectable agent, and when the target agent is bound to its matched preselected binding agent in a fixed host cell, detecting the detectable label provides information about characteristics of the target agent, the preselected binding agent, and the target agent/preselected binding agent bound complex.
Non-limiting examples of means suitable to attach a detectable label to a target agent for use in embodiments of the invention are: a chemical bond, crosslinking, a covalent bond, a non-covalent bond, and other art-known method for attaching a detectable label to a target molecule. Various labeling techniques and attachment methods suitable for use in combination with the teaching presented herein are routinely used in the art. See for example, Bioconjugate Techniques, Hermanson, Greg T. Academic press, 2013, the content of which is incorporated herein by reference in its entirety.
Non-limiting examples of types of detectable agents that can be used in certain embodiments of the invention as part of a detectable label are: fluorophores, isotopes, and bioluminescent agents. In certain aspects of the invention, a detectable label comprises a fluorophore. Non-limiting examples of fluorophore molecules and agents that are suitable for use in certain embodiments of the invention are synthetic fluorophores, fluorescent polypeptides and variants thereof that selectively bind a specific region or functional group on its target molecule, which may be a target agent as described herein.
Non-limiting examples of detectable labels that may be attached to one or more of target agents and used in embodiments of methods of the invention are: green fluorescent protein (GFP); enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP); yellow fluorescent protein (YFP), dtTomato, mCherry, DsRed, mRuby, cyan fluorescent protein (CFP); far red fluorescent proteins, etc. Numerous fluorescent proteins and their encoding nucleic acid sequences are known in the art and routine methods can be used to include such sequences in molecules, agents, fusion proteins and vectors, respectively, for use in methods of the invention. Different detection means may be used in embodiments of the invention to detect different fluorophore detectable labels. The use of different detectable labels, a non-limiting example of which is the use of different fluorophore detectable labels, can permit serial and successive detection strategies as described elsewhere herein.
Methods for detecting detectable labels used in methods on the invention include, but are not limited to one more of: microscopy, autoradiography, fluorescence microscopy, bioluminescence imaging, MRI detection methods, radioisotope detection methods, etc. Art-known methods for detecting detectable labels in fixed cells may be used in conjunction with the teaching provided herein for assessing, quantifying, localizing a detectable label in an embodiment of a method of the invention.
In a non-limiting example of a method of the invention, a fluorophore detectable label is covalently attached to a dsDNA target agent during synthesis of the target agent, the fluorophore is detected using FISH methods after the dsDNA target agent is bound by its matched TALE binding agent that is present in a fixed host cell. In this example, the method of the invention includes a form of“in situ hybridization” using double-stranded DNA, wherein the hybridization of the preselected binding agent (the TAL protein) by the detectably labeled matched target agent is carried in a fixed system. Methods of the invention permit delivering a preselected DNA-binding agent comprising a polypeptide into one or more host cells, fixing the host cells, binding the preselected DNA-binding agent to a matched target agent that comprises a detectable label, thereby essentially enabling labeling and detection of the polypeptide using the versatility and
programmability of DNA within the environment of the host cells.
Fixation
Methods of the invention include delivering a preselected binding agent into one or a plurality of cells. In such embodiments, it has now been demonstrated that application of suitable fixation methods and solutions can result in the retention of the capability of a binding agent to selectively bind its matched target agent in the fixed tissue. Non-limiting examples of components of fixative solutions that that have now been shown to be useful in embodiments of methods of the invention are: alcohols such as methanol and ethanol.
A non-limiting example of components included in a fixative solution that may be used in certain embodiments of the invention comprises a methanol and acetic acid fixative solution. Percentage ratios (v/v) of methanol to acetic acid that may be included in a fixative solution are: 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%,
46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%,
61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% methanol to 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%,
63%, 62%, 61%, 60%, 59%, 58%, 57%, 56%, 55%, 54%, 53%, 52%, 51%, 50%, 49%,
48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%,
33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%,
18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, and 0% acetic acid, respectively, including all percentages in the range provided.
Another non-limiting example of a fixative solution that may be used in certain embodiments of the invention comprises an ethanol and acetic acid fixative solution. Percentage ratios (v/v) of ethanol to acetic acid that may be included in a fixative solution are: 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,
34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% ethanol to 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60%, 59%, 58%, 57%, 56%, 55%, 54%, 53%, 52%, 51%, 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%,
29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, and 0% acetic acid, respectively, including all percentages in the range provided.
Certain embodiments of methods of the invention may include use a cell fixative comprising at least one of: MeOH, EtOH, acetone, an amine, a cleavable molecule, a cleavable polypeptide, a cleavable cross-linker molecule, and an aldehyde. Additional non-limiting examples of components that may be used in an embodiment of a fixative method of the invention are: DSP, SPDP, EGS, Hepes -glutamic acid buffer-mediated organic solvent protection effect (HOPE) and osmium. In some aspects of the invention fixation methods may include use of one or more: heterobifunctional crosslinker, homobifunctional crosslinker, and zero-length crosslinker.
In some embodiments of the invention, a fixative solution, when contacted with a host cell is at a temperature of: -40°C, -30°C, -29°C, -28°C, -27°C, -26°C, -25°C, -24°C, - 23°C, -22°C, -21°C, -20°C, -19°C, -18°C, -17°C, -16°C, -15°C, -14C, -13°C, -12°C, -11°C, -10°C, -9°C, -8°C, -7°C, -6°C, -5°C, -4°C, -3°C, -2°C, -1°C, 0°C, 1°C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 30°C, 40°C, or 50°C, including all temperatures in the range provided. In some embodiments of the invention, a fixative solution may be between -40°C and -25°C; -30°C and -10°C; -25°C and -15°C; -25°C and 1°C; and -25°C and 25°C.
In certain embodiments of the invention a host cell is contacted with a fixative solution and incubated in that solution for a period of time. An incubation time period used in a method of the invention may be less than one minute, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50,
55, 60, or more minutes, including all times within the range of times provided. In some aspects of the invention an incubation time of a host cell in a fixative solution is in a range from: 1-120 minutes, 1 to 60 minutes, 1 to 50 minutes, 1 to 40 minutes, 1 to 30 minutes, 1 to 25 minutes, 1 to 20 minutes, 1 to 15 minutes, 1 to 10 minutes, 1 to 5 minutes, 10 to 20 minutes, 10 to 30 minutes, or 15 to 25 minutes.
A host cell of the invention may be washed one or more times subsequent to the fixation incubation. Non-limiting examples of solutions with which a fixed host cell may be contacted and/or washed in an embodiment of the invention are solutions comprising one or more of: PBS, PBS and Triton X-100, a cell permeabilizing agent, binding buffer, one or more target agents, one or more detectably labeled target agents, and one or more detectable labels. Times of periods of washing and/or contact may range from be less than one minute, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160,
170, 180, or more minutes, including all times within the range of times provided. In some aspects the incubation time of a host cell in a fixative solution is in a range from: 1- 120 minutes, 1 to 60 minutes, 1 to 50 minutes, 1 to 40 minutes, 1 to 30 minutes, 1 to 25 minutes, 1 to 20 minutes, 1 to 15 minutes, 1 to 10 minutes, 1 to 5 minutes, 10 to 20 minutes, 10 to 30 minutes, or 15 to 25 minutes.
Embodiments of methods of the invention include different solutions and times and the disclosure provided herein may be used in combination with art-known procedures to practice aspects of methods of the invention. Addition fixatives that may be used in embodiments of methods of the invention include, but are not limited to: (1) zinc-based fixatives such as, but limited to that presented in Lykidis, D. et al, Nucleic Acids
Research, 2007, vol 35, No. 12 e85, in which tissue is stabilized with some advantages over traditional precipitant or cross-linking fixatives with regard to nucleic acid and protein preservation, and (2) aldehyde formulations such as Periodate-Lysine- Paraformaldehyde as described in, for example: Pieri, L. et al, Eur J Histochem.
2002;46(4):365-75, in which sodium periodate and lysine accompany paraformaldehyde in the fixative solution. Each of the abovementioned references are incorporated herein by reference in their entirety.
Sequences and Functional Variants
As described else herein, a preselected binding agent comprises a component that recognizes and selectively binds a matched component in a specific target agent. In some embodiments of the invention, one or both of a preselected binding agent and its matched target agent, in addition to their specific matched sequences, may also include additional sequences, such as one or more amino acid and nucleic acid sequences. It will be understood that in some methods of the invention there may be sequence variation in one or more specific matched pair sequences, and/or in additional sequences that are included in a predetermined binding agent and/or its matched target agent. As used herein, a sequence that includes variation from its“parent” sequence, and retains at least a portion of the function of the parent sequence is referred to as a functional variant.
The term“functional variant” as used herein in the context of a preselected binding agent or target agent for use in a methods of the invention, describes a molecule with one or more of the following characteristics: (1) the variant differs in sequence from the molecule of which it is a variant; (2) the variant is a fragment of the molecule of which it is a variant and is identical in sequence to the fragment of which it is a variant, and/or (3) the variant is a fragment and differs in sequence from the fragment of the molecule of which it is a variant. As used herein, the term“parent” in reference to a sequence means a sequence from which a variant originates. For example, though not intended to be limiting, a parent sequence may be a fusion protein comprising a PL62 TALES sequence (also referred to herein as a PL62 TAL effector sequence) and a functional variant of that parent fusion protein sequence may have 1, 2, 3, 4, 5 or more modifications in its sequence, while retaining at least a portion of the function of the parent in a method of the invention. In another non-limiting example, a parent sequence may be a fusion protein comprising a SRC-140-CODA-3 sequence (SEQ ID NO: 16) and a functional variant of that parent fusion protein sequence may have 1, 2, 3, 4, 5 or more modifications in its sequence, while retaining at least a portion of the function of the parent in a method of the invention.
As used herein the term“modified” or“modification” in reference to a polypeptide sequence or a nucleic acid sequence refers to a change of 1, 2, 3, 4, or more amino acids or nucleic acids, respectively in the sequence as compared to the parent preselected binding agent. As used herein, a sequence modification may be one or more of a substitution, deletion, insertion or a combination thereof. As an example, though not intended to be limiting, the amino acid sequence of a variant fusion protein comprising PL62 TALES may be identical to its parent fusion protein sequence except that it has one, two, three, four, five, or more amino acid substitutions, deletions, insertions, or combinations thereof, while retaining at least a portion of the function of the parent molecule of which they are a variant.
In embodiments of the invention, a sequence of a binding agent maintains its capability to selectively bind its specific matched target agent, and regions of the binding agent that don't alter the binding properties may include one or more substitutions, deletions, insertions, combinations thereof, or other modifications. As used herein, the term“preselected binding agent” will be understood to encompass functional variants. Methods described herein and other art-known are suitable to assess function of a modified preselected binding agent characteristics such as, but not limited to: expression, localization in a host cell, tissue localization, level of expression, stability, internal localization in a host cell, etc. A functional variant of a preselected binding agent used in a methods of the invention can maintain at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more of a level of function of a characteristic of the parent preselected binding agent, and will maintain the capability to selectively bind to its matched target agent.
Methods of sequence alignments, modifications, etc. are routinely practiced in the art. Sequence modifications that can be included in a fusion protein that result in altered expression, localization, etc. are known in the art and can be used in embodiments of methods of the invention, while maintaining the capability of the preselected binding agent to selectively bind its matched target agent.
A variant of a polypeptide that is part of a preselected binding agent or a variant of a fusion protein used in certain embodiments of the invention may include one or more deletions, point mutations, truncations, amino acid substitutions and/or additions of amino acids or non-amino acid moieties. Modifications of a polypeptide of the invention may be made in certain aspects of the invention by modification of the nucleic acid sequence that encodes the fusion protein.
It will also be understood that conservative amino acid substitutions may be made in a component of a preselected binding agent and/or a fusion protein used in certain methods of the invention. As used herein, a“conservative amino acid substitution” refers to an amino acid substitution that does not alter the relative charge or size characteristics of the polypeptide in which the amino acid substitution is made. Conservative
substitutions of amino acids may, in some embodiments of the invention, include substitutions made amongst amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Polypeptide variants can be prepared according to methods for altering polypeptide sequence and known to one of ordinary skill in the art.
Sequence identity can be determined using standard techniques known in the art.
To determine the percent identity (similarity) of two amino acid sequences the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the sequence of one protein for optimal alignment with the other protein). The amino acid residues at corresponding amino acid positions are then compared. When a position in one sequence is occupied by the same amino acid residue as the corresponding position in the other sequence, then the molecules have identity/similarity at that position. The percent identity or percent similarity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity or % similarity = number of identical positions/total number of positions x 100). Such an alignment can be performed using any one of a number of well-known computer algorithms designed and used in the art for such a purpose. Similarly, percent identity/similarity of polynucleotide sequences encoding a polypeptide of the invention can be determined using art-known alignment and comparison methods for nucleic acid molecules.
A site or region for introducing an amino acid sequence modification may be preselected, and the mutation per se need not be preselected. For example, to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at the target codon or region and the expressed polypeptide screened for the level of desired function or activity. Techniques for making substitution mutations at preselected sites in DNA having a known sequence are well known, for example, M13 primer mutagenesis and PCR mutagenesis. Variant sequences may in some embodiments of the invention be prepared by site specific mutagenesis of nucleic acids in the DNA encoding a polypeptide that is a portion of a binding agent used in a method of the invention, using cassette or PCR mutagenesis or other techniques known in the art, to produce DNA encoding the polypeptide. In certain embodiments of the invention, activity of variant or fragment of a polynucleotide or polypeptide can be tested by cloning the gene encoding the altered polypeptide into a bacterial or mammalian expression vector, introducing the vector into an appropriate host cell, expressing the altered polypeptide, and testing for a functional capability of the polypeptide as disclosed herein. Additional methods for generating recombinant polypeptides are known in the art may include use of prokaryotic and eukaryotic expression systems including but not limited to bacterial and mammalian expression systems.
It is understood in the art that the codon systems in different organisms can be slightly different, and that therefore where the expression of a given protein from a given organism is desired, the nucleic acid sequence can be modified for expression within that organism. Thus, in some embodiments, a target agent and/or fusion protein of the invention is encoded by a mammalian-codon-optimized nucleic acid sequence, which may in some embodiments be a human-codon optimized nucleic acid sequence. An aspect of the invention provides a nucleic acid sequence that encodes a fusion protein comprising a preselected binding agent or variant thereof of the invention, and that is optimized for expression with a mammalian cell. In certain aspects of the invention, a nucleic acid sequence is optimized for expression in a human cell.
Host Cells and Subjects
A host cell used in methods and with sequences of the invention may be an excitable cell or a non-excitable cell. A host cell in which a preselected binding agent or functional variant thereof of the invention may be expressed and may be used in methods of the invention may be a prokaryotic or a eukaryotic cell. Useful host cells include, but are not limited to, vertebrate host cells, which in some embodiments of the invention may be mammalian host cells. A non-limiting example of host cells in which a preselected binding agent can be delivered and subsequently imaged using a method of the invention are excitable cells, which include host cells able to produce and respond to electrical signals. Examples of excitable cell types include, but are not limited to neurons, muscles, cardiac cells, and secretory cells (such as pancreatic cells, adrenal medulla cells, pituitary cells, etc.). A host cell into which a preselected binding agent is delivered in an embodiment of a method of the invention is one or more of: a single cell, an isolated cell, a cell that is one of a plurality of cells, a cell that is one in a network of two or more interconnected cells, a cell that is one of two or more cells that are in physical contact with each other, etc.
Non-limiting examples of cells that may be used as host cells in embodiments of methods of the invention include: nervous system cells, neurons, cardiac cells, circulatory system cells, visual system cells, auditory system cells, secretory cells, endocrine cells, and muscle cells. In some embodiments, a cell used in conjunction with the invention may be a healthy normal cell, which is not known to have a disease, disorder or abnormal condition. In some embodiments, a host cell used in conjunction with methods and compositions of the invention is an abnormal cell, for example, a cell obtained from a subject diagnosed as having a disorder, disease, or condition, including, but not limited to a degenerative cell, a neurological disease-bearing cell, a cell model of a disease or condition, an injured cell, etc. In some embodiments of the invention, a cell may be a control cell. In some aspects of the invention a host cell can be a model cell for a disease or condition.
In embodiments of the invention a cell may be a free cell in culture, a free cell obtained from a subject, a cell obtained in a solid biopsy from a subject, organ, or solid culture, etc. In certain embodiments of the invention, means for separating a cell or plurality of cells for fixation, staining, and detection methods of the invention may include art-known means such as, but not limited to: dissecting one or a plurality of cells from the cell’s source and sectioning a tissue that includes the cell, for example using cryostat sectioning, vibratome sectioning, microtome sectioning, etc. In some embodiments of the invention, a method of the invention may be performed, in part, on a cell section, which means on a portion of a cell that has been removed from the cell. Routine means of cell sectioning may be used to obtain one or more sections from a tissue and/or cell on which later binding and imaging steps may be performed. Cell sectioning may include one or more of frozen sectioning, paraffin sectioning, sectioning of host cells in tissues infiltrated with one or more agents such as epoxy, methacrylate resins, paraffin wax- based histological waxes, etc. In some embodiments of the invention sections of host cells and tissues may be obtained using cryostat sectioning, vibratome sectioning microtome sectioning or other suitable art-known tissue and/or cell sectioning means.
In certain embodiments of the invention, a preselected binding agent is delivered to one or more cells in cell culture, a cell suspension, a cell in a solution, a cell obtained from a subject, and a cell in a subject (in vivo cells). Methods of the invention may be carried out in in cultured cells, cultured tissues (e.g., brain slice preparations, etc.), and in living subjects, etc. As used herein, the term“subject” may refer to a: human, non-human primate, cow, horse, pig, sheep, goat, dog, cat, rat, mouse, fly or other host organism. In some aspects of the invention a host subject is an invertebrate subject and in other aspects of the invention a host subject is a vertebrate. In certain embodiments of the invention, a host subject is a mammal. In some aspects of the invention one or more preselected binding agents is delivered into at least one host cell in a host subject and the host cell(s) are subsequently removed from the subject and fixed and further processed according to methods of the invention outside of the subject. A non-limiting example of a case in which such an approach may be used is a situation in which the host subject is a human. Alternatively, a host cell may be removed from a subject prior to delivery of one or more preselected binding agents. In some aspects of the invention one or more preselected binding agents is delivered into at least one host cell in a host subject and the host cell(s) are fixed prior to removal from the subject. Further processing of the fixed cells according to methods of the invention may occur in the subject or the fixed host cells may be removed from the host subject and further processed according to methods of the invention. Non-limiting examples of host subjects in which such an approach may be used are: invertebrates, a rodent, a bird, or other non-human subjects.
Some embodiments of the invention include of one or a plurality of host cells in methods and compositions for genetically targeted detection. Such methods may include use of whole, living cells into which are delivered one or more preselected binding agents that include independently selected programmable binding sequences, wherein each preselected binding agent is capable of selectively binding a corresponding matched specific target agent. The whole host cells are then fixed under conditions wherein the one or more preselected binding agents in the fixed host cell is capable of selectively binding the matched specific target agent to which it corresponds. In some embodiments of the invention the whole, now fixed, host cells are contacted with the matched specific target agents corresponding to the one or more preselected binding agents, and binding of the one or more preselected binding agents and their corresponding matched specific target agents is determined in the whole fixed host cell or plurality of whole fixed host cells. In alternative embodiments of the invention the whole, now fixed, host cells are sectioned and the fixed host cell sections are contacted with the matched specific target agents corresponding to the one or more preselected binding agents, and binding of the one or more preselected binding agents and corresponding matched specific target agents is determined in the fixed cell section. As used herein, the term“portion” of a cell may be a section of a cell, and the phrase:“at least a portion of the host cell” means (1) the entire host cell, or (2) some, but less than all of the host cell, non-limiting examples of which are: a section or multiple sections obtained from the host cell.
Controls and Use
In certain embodiments of compositions and methods of the invention, one or more preselected binding agents are delivered into a host cell, or a localized region of a host cell, for example the soma, dendrite, axon, etc. Methods of the invention can be used to contact the host cell with one or more matched binding agents and to detect the bound pair in the host cell after fixation. Certain embodiments of methods of the invention can be used to assess changes in a host cell, host, tissue, and/or a host subject by comparing results obtained in sample host cells with results in a control host cell. Some embodiments of the invention include delivery of a preselected binding agent into a host cell and contacting the host cell with one or more candidate compounds or treatments prior to fixing the host cell. In some embodiments, a host cell is contacted with a candidate compound or treatment before delivery of one or more preselected binding agents to the host cell. In certain embodiments, the contact with the candidate compound or treatment occurs after delivery of one or more preselected binding agents to the host cell, tissue, and/or subject. Following suitable fixation, the host cells are contacted with matched specific binding agents, binding is detected, and one or more characteristics of the delivered preselected binding agent determined by assessing the binding. Results in host cells contacted with a candidate compound or treatment may be compared to results from host cells prepared, fixed, and detected, under similar conditions except without contact with the candidate compound or treatment. Differences in the binding can be used to assess the impact of the candidate compound or treatment on one or more characteristics of the preselected binding agent.
It will be understood that results obtained from the host cell, tissue, or subject that was not contacted with the candidate compound or treatment may be referred to as “control results” and the non-contacted host cells as“control host cells”. As used herein a control may be as described above and also may be a predetermined value, which can take a variety of forms. It can be a single cut-off value, such as a median or mean. It can be established based upon comparative groups. Other examples of comparative groups may include host cells or tissues that have a disorder or condition and groups without the disorder or condition. Another comparative group may be host cells from a group with a family history of a disease or condition and host cells from a group without such a family history. A predetermined value can be arranged, for example, where a tested population is divided equally (or unequally) into groups based on results of testing. Those skilled in the art are able to select appropriate control groups and values for use in comparative methods of the invention.
A host cell, tissue, and/or a subject that include a host cell can be monitored for the presence or absence of a change that occurs in test conditions versus a control condition. For example, in a host cell, a characteristic such as level of expression or cell localization may differ in a host cell contacted with a candidate compound or treatment compared to the level of expression or localization in a control host cell. In some embodiments of methods of the invention a characteristic that can be assessed by detecting binding of a preselected target agent and its matched binding agent may be one or more of: a downstream effect on one or more additional cells, which occurs due to the modulation of an activity in the host cell to which the preselected binding agent was delivered.
Candidate-compound candidate-treatment identification methods of the invention may be carried out in a host cell in a subject or in cultured or in vitro host cells.
Candidate-compound identification methods of the invention that are performed in a host subject, may include delivery of a preselected binding agent into a cell in the subject, contacting the subject with the candidate compound or treatment (before and/or after delivering the preselected binding agent), fixing the host cells, and contacting the fixed host cell with a matched binding agent, and detecting the binding as an assessment of one or more characteristics of the preselected binding agent. A result of contacting a host cell, tissue, and/or subject with a candidate compound or candidate treatment can be measured and compared to a control value as a determination of the presence or absence of an effect of the candidate compound or candidate treatment, respectively, on a characteristic in the host cell.
Further information that can be obtained using methods of the invention to detect bound pairs of binding agents and their specific target agents in one or a plurality of fixed host cells includes but is not limited to: the level of expression of the preselected binding agent and the effect on expression and/or localization of the binding agent resulting when prior to fixation, the host cell is contacted with a candidate modulatory compound, toxin, or other test agent. Methods of the invention can be used to assess one or more aspects of up to dozens or hundreds of different preselected binding agents a host cell or plurality of host cells. Non-limiting examples of procedures in which methods of the invention may be used are: screening for effects of candidate agents on host cells; assessing the internal environment of host cells and its response to external changes; identifying specific individual host cells in a plurality of host cells in which two or more of the host cells comprise independently selected different preselected binding agents; and determining localization and expression of one or more specific binding agents in neuronal host cells as a means of mapping projections and connections of such cells at the level of single cell resolution.
Compositions An agent, host cell, compound, or molecule used in a method of the invention may be part of a composition. As used herein, a composition means a solution in which the agent, compound, or molecule is present. Non-limiting examples of compositions are: culture media, a diluent, a solution, or other environment in which the agent, host cell, compound or molecule is located. A non-limiting example of a composition is a solution that comprises a vector for delivery into a host cell in a method of the invention. Another non-limiting example of a composition is a solution in which target agents are present when contacted with a fixed host cell. In addition to one or more of an agent, host cell, vector, molecule, or compound, molecule, a composition used in certain methods of the invention may include one or more of: a liquid, an aqueous solution, culture media, a solute, a preservative, a fixative, or other suitable component.
In some aspects of the invention, a composition may include all or part of a fixed cell that includes at least one preselected programmable binding agent bound to its matched specific target agent, thereby forming a bound complex. The preselected binding agent includes an independently selected programmable binding sequence, and the preselected binding agent is selected, at least in part, based on its capability to selectively bind its matched specific target agent. In such compositions of the invention, the fixed cell or the part of the fixed cell include two or more different independently preselected programmable binding agents bound to their matched specific target agents each forming a bound complex.
A composition used in a method of the invention can but need not be a
pharmaceutical composition. The term“pharmaceutical composition” as used herein, means a composition that comprises at least one pharmaceutically acceptable carrier that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable. A pharmaceutical composition may be used in certain embodiments of methods of the invention, if, as a non-limiting example, one or more preselected binding agents are to be delivered into a host cell in a host subject. In certain embodiments of the invention, at least one pharmaceutical composition is utilized in the delivery of one or more preselected binding agents to one or more host cells in a subject, host cells comprising the delivered preselected binding agent are removed from the subject and are fixed subsequent to their removal. In such cases the use of pharmaceutical compositions may be advantageous for the health and safety of the host subject. In certain aspects of the invention a pharmaceutical composition comprises one or more preselected binding agents, encoding molecules, a vector that are delivered to a host cell, a host tissue, host subject, and/or a host cell in a subject, in combination with one or more additional preselected binding agents and/or in combination with one or more additional molecules, therapeutic agents, candidate agents, candidate treatments, and therapeutic regimens that are also administered to the host cell, host tissue, host subject, and/or host cell in a subject. A pharmaceutical composition used in the foregoing methods may, in addition to one or more preselected binding agents, contain an effective amount of a candidate compound or therapeutic compound to alter a characteristic of a preselected binding agent in a host cell in the host subject. In some embodiments of the invention, a pharmaceutical composition of the invention may include a pharmaceutically acceptable carrier.
Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials that are well-known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Pat. No. 5,211,657 and others are known by those skilled in the art. In certain embodiments of the invention, such preparations may contain salt, buffering agents, preservatives, compatible carriers, aqueous solutions, water, etc.
Delivery of a preselected binding agent into a host cell may be achieved by various means described herein and other art-known means. Such administration may be done once, or a plurality of times prior to fixation of the host cell. If administered multiple times to a host subject, one or more preselected binding agents, polypeptides, encoding nucleic acids, and/or vectors may be administered via different routes. For example, though not intended to be limiting: a first (or the first few) administrations may be made directly into a tissue in the host subject while later administrations may be systemic.
The amount of a preselected binding agent delivered into a host cell, or the amount of a target agent that contacts a fixed host cell are amounts sufficient to permit sufficient binding of the preselected target agent to its matched target agent in a fixed cell and to permit detection of a detectable label attached to the target agent for determination of one or more characteristics of the preselected binding agent in the host cell. Suitable amounts can be readily determined by a practitioner using teaching provided herein in conjunction with art-known methods, and without a need for undue experimentation.
Examples Example 1
Studies were performed to assess embodiments of visualization methods of the invention in cells. In some of the studies cells were transfected with and expressed PL61, which specifically interacts with Hairpin 13 but not Hairpin 14. In other studies, cells were transfected with and expressed PL62, which specifically interacts with Hairpin 14 but not Hairpin 13. The comparison of the results demonstrated the ability of
embodiments of methods of the invention to permit specific visualization of polypeptides in cells.
Materials and Methods
Cells
Human embryonic kidney (HEK) cells Hairpins
Hairpins (sequences shown below) were diluted to ImM in TALE binding buffer and heated to 95°C for 90 seconds, and then held at room temperature for 30 minutes.
TALE binding buffer
The buffer was prepared with 25 mM Tris, 250 mM NaCl, 5% glycerol and 5 mM TCEP, pH 8.5.
Sequences
PL61 : CAG-NLS-TALE(13)-mRuby2, which expresses a TAL effector that targets the sequence set forth as: tgctacgactaggtatacct (SEQ ID NO: 1). This sequence is from the mouse genome and is not present in human genome. A fusion protein expressed from PL61 : CAG-NLS-TALE(13)-mRuby2 is also referred to herein as PL61 TALES.
PL62: CAG-NLS-TALE(14)-mRuby2, which expresses a TAL effector that targets the sequence set forth as:
Figure imgf000044_0001
(SEQ ID NO: 2). This sequence from the mouse genome and is not present in human genome. A fusion protein expressed from PL62: CAG-NLS-TALE(14)-mRuby2 is also referred to herein as PL62 TALES.
Figure imgf000044_0002
(SEQ ID NO: 3). SEQ ID NO: 3 comprises the target sequence set forth as SEQ ID NO: 1 and a detectable label. SEQ ID NO: 3 may be referred to herein as a specific target agent that is matched to the preselected binding agent, the TALE(13) effector. SEQ ID NO: 20 is the DNA sequence set forth as SEQ ID NO: 3 without the 5Cy5 label.
Hairpin 14:
Figure imgf000045_0001
NO: 4). SEQ ID NO: 4 comprises the target sequence set forth as SEQ ID NO: 2 and a detectable label. SEQ ID NO: 4 may be referred to herein as a specific target agent that is matched to the preselected binding agent, the TALE(14) effector. SEQ ID NO: 21 is the DNA sequence set forth as SEQ ID NO: 4 without the 5Cy5 label.
Experimental procedures were as follows:
(1) HEK cells were cultured on glass-bottom culture wells (Grace BioLabs) that had been pretreated with matrigel as per routine practice.
(2) The cells were then transfected with plasmids PL61 or PL62 (described below), using Trans-IT X2 transfection reagent according to manufacturer’s instructions (Mirus Bio, Madison, WI).
(3) Cells were given 24 hours to express the construct, and expression was validated by the presence of fluorescence in the cells.
(4) Cells were fixed using one of the following Fixation Protocols.
Fixation Protocol 1
Cells were contacted with 10% formalin at room temperature for 10 minutes.
Fixation Protocol 2
Cells were contacted with a solution comprising 4% formaldehyde/2.5% glutaraldehyde in PBS for 10 minutes at room temperature.
Fixation Protocol 3
Cells were contacted with a solution precooled to -20°C and comprising 95% methanol and 5% acetic acid. After application of this solution to the cells, the cells were placed at -20°C for 10 minutes. Fixation Protocol 4
Cells were contacted with a solution pre-cooled to -20°C and comprising 95% ethanol and 5% acetic acid that. Following application of this solution to the cells, the cells were placed at -20°C for 10 minutes.
Fixation Protocol 5
Cells were contacted with 100% acetone that was pre-cooled to -20°C. Following application of this solution to the cells, the cells were placed at -20°C for 10 minutes.
(5) After the fixation procedure, the fixed cells were processed as follows:
a) all fixed cells were washed twice in PBS;
b) cells that had been fixed with aldehyde solutions were washed for 15 minutes in a solution of 0.5% Triton X-100 in PBS to permeabilize the cells;
c) all cells were washed twice in TALE binding buffer (see below);
d) all cells were contacted with a solution of ImM hairpins in TALE binding buffer for one hour; and
e) all cells were washed in TALE binding buffer to remove excess hairpins.
(6) All processed cells were imaged using standard fluorescence-imaging methods.
Results
Fig. 1A-H and Fig. 2A-H show results from studies using the methanol fixation method (#3 above) and the ethanol fixation method (#4 above). These studies demonstrated successful visualization in the cells using embodiments of methods of the invention.
Example 2
Experiments were performed to assess different fixation protocols. In one study, ethanol fixation methods were assessed. See Example 1 for sequences and methods.
Ethanol fixation study:
In HEK cells transfected with PL61, fixed with the ethanol protocol (method #4, Example 1), and stained with Hairpin 13, Fig. 1A shows the location of the TALES, evidenced by the detected fluorescence of mRuby. Co-localization of the PL61 TALES and the hairpin 13 was evidenced in Fig. IB, which shows detected fluorescence of Cy5 (attached to hairpin 13), in the same location as the mRuby signal of Fig. 1A.
In HEK cells transfected with PL62, fixed with the ethanol protocol (method #4, Example 1), and stained with Hairpin 13, Fig. 1C shows the location of the TALES, evidenced by the detected fluorescence of mRuby. Fig. ID shows a lack of detected fluorescence indicating that there was no co-localization of the PL62 TALES and hairpin 13.
In experiments that included HEK cells transfected with and expressed PL62, fixed as using Fixation Protocol 4, Example 1, and stained with Hairpin 14. Fig. IE shows the location of the PL62 TALES, evidenced by the detected fluorescence of mRuby. Fig. IF shows a lack of detected fluorescence, which indicated that there was no co-localization of the PL62 TALES and hairpin 14.
In studies that included HEK cells transfected and expressing with PL62, fixed with the ethanol protocol (Fixation Protocol 4, Example 1), and stained with Hairpin 14, Fig. 1G shows the location of the PL62 TALES, evidenced by the detected fluorescence of mRuby. Co-localization of the PL62 TALES and the hairpin 14 was evidenced in Fig. 1H, which shows detected fluorescence of Cy5 (attached to hairpin 14), in the same location as the mRuby signal of Fig. 1G.
Example 3
Methanol fixation study:
Experiments were performed to assess different fixation protocols. In one study, methanol fixation methods were assessed. See Example 1 for sequences and methods.
In HEK cells transfected with PL61, fixed with the methanol protocol (method #3 in Example 1), and stained with Hairpin 13, Fig. 2A shows the location of the TALES, evidenced by the detected fluorescence of mRuby. Co-localization of the PL61 TALES and the hairpin 13 was evidenced in Fig. 2B, which shows detected fluorescence of Cy5 (attached to hairpin 13), in the same location as the mRuby signal of Fig. 2A.
In HEK cells transfected with PL62, fixed with the methanol protocol (method #3., Example 1), and stained with Hairpin 13, Fig. 2C shows the location of the TALES, evidenced by the detected fluorescence of mRuby. Fig. 2D shows a lack of corresponding detected fluorescence, which demonstrated that there was no co-localization of the PL62 TALES and hairpin 13. In experiments that included HEK cells transfected with and expressed PL62, fixed as using Fixation Protocol 3 (Example 1), and stained with Hairpin 14. Fig. 2E shows the location of the PL62 TALES, evidenced by the detected fluorescence of mRuby. Fig. 2F shows a lack of detected fluorescence, which indicated that there was no co-localization of the PL62 TALES and hairpin 14.
In studies that included HEK cells transfected and expressing with PL62, fixed with the methanol protocol (Fixation Protocol 3, Example 1), and stained with Hairpin 14, Fig. 2G shows the location of the PL62 TALES, evidenced by the detected fluorescence of mRuby. Co-localization of the PL62 TALES and the hairpin 14 was evidenced in Fig. 2H, which shows detected fluorescence of Cy5 (attached to hairpin 14), in the same location as the mRuby signal of Fig. 2G.
The studies and results demonstrate the effective use of embodiments of methods of the invention to specifically label and visualize target proteins expressed in cells using nucleic acid molecules that bind to the targeted proteins.
Example 4
Additional Tale experiments were performed using methods described in Example 1, except using a Tale with the sequence set forth as SEQ ID NO: 5 also referred to herein as SRC-60B. Imaging results of experiments demonstrated that SRC-60B (SEQ ID NO:
5) bound the following sequence:
Figure imgf000048_0001
Example 5
Studies were performed to assess embodiments of visualization methods that include use of zinc fingers as programmable DNA binding proteins in cells. The results demonstrated the ability of embodiments of methods of the invention to permit specific visualization of polypeptides in cells. These studies included staining zinc fingers, (programmable DNA binding proteins) with conjugate DNA strands following methanol or PFA fixation.
Materials
Cells used·. Human embryonic kidney (HEK) cells Probes
Two probe sequences (sequences shown below) were mixed at a 1 : 1 ratio in ZBB, heated to 95°C and then brought to room temperature.
ZF binding buffer
The zinc binding buffer (ZBB) included PBS with 5% BSA, 20 mM ZnCh. 1 mM MgCh and 100 mg/ml salmon sperm DNA.
ZF imaging buffer
The zinc binding buffer (ZIB) included PBS with 20 pM ZnCh. 1 mM MgCh and 100 pg/ml salmon sperm DNA
Sequences
The DNA sequences of three zinc fingers used in experiments were:
SRC-140-4 set forth herein as SEQ ID NO: 7.
SRC-140-5 set forth herein as SEQ ID NO: 8.
SRC-140-CODA-3 set forth herein as SEQ ID NO: 9.
A double-stranded probe was used in experiments with SRC-140-4. The probe was prepared by annealing the following two sequences: acatcGAGGACGGCagcgt (SEQ ID NO: 10) and
Figure imgf000049_0001
A double-stranded probe was used in experiments with SRC-140-5. The probe was prepared by annealing the following two sequences: ttgaaGAAGATGGTgcgct (SEQ ID NO: 12) and
Figure imgf000049_0002
For experiments with SRC-140-CODA-3, the following two probe sequences were used:
Figure imgf000049_0003
The DNA sequence of the complete plasmid encoding 140-COD A-3 is set forth herein as SEQ ID NO: 16.
Methods
(1) HEK cells were cultured on glass-bottom culture wells (Grace BioLabs) that had been pretreated with matrigel as per routine practice.
(2) The cells were then transfected with plasmids set forth herein as : SRC-140-4, set forth herein as SEQ ID NO: 7 and SRC-140-5, set forth herein as SEQ ID NO: 8, using Trans- IT X2 transfection reagent according to manufacturer’s instructions (Mirus Bio, Madison, WI). In some studies cultured HEK cells were transfected with plasmids set forth herein as SRC-140-CODA-3, set forth herein as SEQ ID NO: 9, using Trans-IT X2 transfection reagent according to manufacturer’s instructions (Mirus Bio, Madison, WI).
(3) Cells were given 24 hours to express the construct, and expression was validated by the presence of fluorescence in the cells.
(4) Cells were fixed using one of the following Fixation Protocols.
Fixation Protocol 1 Standard 10% fixation protocol, with Alternative fixation protocols with 100% methanol and 70% ethanol.
1. Fix cells 20 minutes in 10% normal-buffered formalin, or 4% paraformaldehyde.
2. Permeabilize cells 5 minutes in 0.1% triton-X in lx PBS.
a. Alternative: permeabilize cells 5 minutes in 100% methanol or permeabilize cells 5 minutes in 70% ethanol.
3. Wash cells one time (lx) for 5 minutes in lx PBS.
a. Alternative: For cells permeabilized with methanol or ethanol in Step (4)2. a, wash cells two times (2x), 5 minutes each time in PBS.
4. Block 30 minutes in zinc binding buffer (ZBB).
5. Incubate blocked cells 30 minutes with hairpins at room temperature (RT).
6. Wash cells 3 times, 10 minutes each time in zinc imaging buffer (ZIB).
7. Replace ZIB solution with DAPI in ZIB and image cells after 5 minutes Fixation Protocol 2: Standard methanol fixation protocol
1. Fix cells 20 minutes in ice-cold 95% methanol/5% acetic acid.
2. Wash cells 2 times, 5 minute each time, in lx PBS.
3. Block 30 minutes in zinc binding buffer (ZBB).
4. Incubate blocked cells 30 minutes with hairpins.
5. Wash cells 3 times, 10 minutes each time, in zinc imaging buffer (ZIB).
6. Replace ZIB with DAPI in ZIB and image cells after 5 minutes.
(5) All processed cells were imaged using standard fluorescence-imaging methods.
Results
Experimental results from experiments using SRC-140-CODA-3 are shown in Fig. 3A-H, in which the Zinc fingers were observed to bind to their cognate DNA sequences following fixation with PFA (see Step 4, Fixation Protocol 1) and with methanol (see Step 4, Fixation Protocol 2). Staining after fixation in methanol was roughly 5x stronger than staining after fixation in PFA. As in the case of the TALEs (see previous Examples), the fingers only bound to their cognate binding sequences. Similar results were seen in studies performed using SRC-140-4 and its probes, and in studies performed using SRC- 140-5 and its probes.
Example 6
The studies performed in Example 5 are repeated as described except using ethanol fixation is used instead of methanol fixation. In results of these studies the Zinc fingers are observed to bind to their cognate DNA sequences following fixation with ethanol. As in the case of the TALEs, the fingers only bind to their cognate binding sequences.
Example 7
In vivo studies were performed to test the binding of ZIFs to their hairpins in mouse brain. In these experiments, a mouse brain was injected intracranially with an AAV PHP.eB coding for a zinc finger protein (see Chan, K. et al, (2017) Nature
Neuroscience Vol. 20, 1172-1179 and Deverman, B., et al, (2016) Nature Biotechnology Vol. 34:204-209, the content of each of which is incorporated by reference herein in its entirety). The vector expressed the SRC-140-4 protein, which is encoded by nucleic acid sequence set forth as SEQ ID NO: 7), in the mouse brain.
a) In some studies, after 3 weeks, the mouse was transcardially perfused with methanol, the brain removed and immersed in methanol. After 2 days in methanol, the brain was equilibrated in PBS with 30% sucrose until it sank, and 50mm sections were cut on the cryostat. The sections were equilibrated in ZBB for 12 hours, and stained with the double-stranded probes in ZBB similar to as described for cell culture in other Examples herein. Results indicated the co-localization of the GFP signal and the zinc finger binding signal.
b) In some studies, at two weeks post-injection, the mouse was perfused with ice- cold 95% methanol, 5% acetic acid and the brain sliced into 50mm coronal sections on a vibratome. Following blocking in zinc binding buffer, sections were stained and Fig. 4A- B shows staining with the fluorescent cognate oligonucleotide hairpins (Fig. 4A) and with DAPI (Fig. 4B).
Equivalents
Although several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto; the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and/or methods, if such features, systems, articles, materials, and/or methods are not mutually inconsistent, is included within the scope of the present invention.
Where a range of values is provided, it is understood that each intervening value is encompassed. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
The indefinite articles“a” and“an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean“at least one.” The phrase“and/or,” as used herein in the specification and in the claims, should be understood to mean“either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified, unless clearly indicated to the contrary.
All references, patents and patent applications and publications that are cited or referred to in this application are incorporated by reference in their entirety herein.
What is claimed is:

Claims

Claims
1. A method of genetically targeted detection, comprising:
a) delivering to at least one host cell one or more preselected binding agents comprising an independently selected programmable binding sequence, wherein each preselected binding agent is capable of selectively binding a corresponding matched specific target agent;
b) fixing the at least one host cell under conditions wherein the one or more preselected binding agents in the fixed host cell is capable of selectively binding the matched specific target agent to which it corresponds;
c) contacting the at least one fixed host cell with a composition comprising the matched specific target agents corresponding to the one or more preselected binding agents; and
d) determining the binding of the one or more preselected binding agents and corresponding matched specific target agents in the at least one fixed host cell.
2. The method of claim 1, wherein the preselected binding agent comprises one or more of a polypeptide molecule and a nucleic acid molecule.
3. The method of claim 1 or 2, wherein the preselected binding agent comprises a polypeptide/nucleic acid complex.
4. The method of any one of claims 1-3, wherein each of the independently selected programmable binding sequences correspond to a nucleic acid sequence in a matched specific target agent.
5. The method of claim 1, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different independently selected programmable binding sequences are delivered into the host cell.
6. The method of claim 5, wherein each of the programmable binding sequence corresponds to and is capable of selectively binding a matched specific target agent.
7. The method of any one of claims 1-6, wherein the preselected binding agent comprises at least one of: a nucleic acid-binding molecule and a nucleic acid analog.
8. The method of claim 7, wherein the nucleic acid-binding molecule is one or more of: a nucleic acid-binding polypeptide, a DNA-binding molecule, and a DNA-binding polypeptide.
9. The method of any one of claims 1-8, wherein the preselected binding agent comprises a transcription activator-like effector (TALE) sequence.
10. The method of any one of claims 1-8, wherein the preselected binding agent comprises a megaTAL effector sequence.
11. The method of any one of claims 1-8, wherein the preselected binding agent comprises a CRISPR/Cas9 sequence or Cas9 analog sequence effector sequence.
12. The method of claim 11, wherein the Cas9 analog sequence comprises a Cas13a (c2c2), Cpfl, or MIMIVIRE sequence.
13. The method of any one of claims 1-8, wherein the preselected binding agent comprises a zinc finger (ZF) effector sequence.
14. The method of any one of claims 1-13, wherein the specific target agent comprises at least one double-stranded nucleic acid molecule.
15. The method of any one of claims 1-13, wherein the specific target agent comprises at least one single-stranded nucleic acid molecule.
16. The method of any one of claims 1-15, wherein the specific target agent comprises one or more independently selected detectable labels.
17. The method of any one of claims 1-15, wherein the preselected programmable binding agent comprises a detectable label.
18. The method of claim 16 or 17, wherein the detectable label comprises a fluorescent label.
19. The method of any one of claims 1-18, wherein fixing the at least one host cell comprises contacting the host cell with at least one cell fixative.
20. The method of claim 19, wherein the cell fixative comprises at least one of:
MeOH, EtOH, acetone, an amine, a cleavable molecule, a cleavable polypeptide, a cleavable cross-linker molecule, and an aldehyde.
21. The method of any one of claims 1-20, wherein fixing comprises contacting the at least one host cell with an alcohol solution.
22. The method of claim 21, wherein the alcohol solution comprises at least one of MeOH and EtOH.
23. The method of any one of claims 1-22, wherein the at least one host cell is a plurality of host cells comprising one or more cell types.
24. The method of any one of claims 1-23, wherein a means for determining a characteristic of the one or more preselected binding agents in the fixed host cell, comprises detecting the one or more specific target agents bound to the matched preselected binding agent in the contacted fixed host cell.
25. The method of claim 24, wherein the characteristic is one or more of: localization, presence, absence, and amount.
26. The method of any one of claims 1-25, wherein the at least one host cell is obtained from a subject.
27. The method of any one of claims 1-25, wherein the at least one host cell is obtained from culture.
28. The method of any one of claims 1-27, wherein the at least one host cell comprises a neuron.
29. The method of any one of claims 1-28, wherein the one or more preselected binding agent is a plurality of independently preselected binding agents.
30. The method of any one of claims 1-29, wherein the preselected binding agent is delivered to the at least one host cell using a physical delivery means.
31. The method of claim 30, wherein the physical delivery means comprises at least one of microinjection, electroporation, ballistic delivery, and laser delivery.
32. The method of any one of claims 1-29, wherein the preselected binding agent is delivered to the at least one host cell by means of a vector.
33. The method of claim 32, wherein the vector is a viral vector or a non-viral vector.
34. The method of claim 33, wherein the viral vector is a lentivirus vector (LV), an adenovirus vectors (AdV), an adeno-associated virus vectors (AAV), or a herpes simplex- 1 virus vectors (HSV-ls).
35. The method of claim 33, wherein the non-viral vector is a lipid nanoparticle (LNP), a liposome, a polymer, or a cell-derived membrane vesicle (CMV).
36. The method of any one of claims 1-29, wherein the preselected binding agent is delivered to the at least one host cell by a means comprising a cell-penetrating molecule.
37. The method of claim 36, wherein the cell-penetrating molecule comprises a cell- penetrating polypeptide.
38. The method of any one of claims 1-37, wherein determining the binding of the one or more preselected programmable binding agents and corresponding matched specific target agents comprises:
i. contacting the corresponding matched specific target agents with two or more independently selected detectable labels;
ii. imaging the detectable labels;
iii. quenching the detectable labels; and iv. repeating steps (i.)-(iii.) one or more times.
39. The method of any one of claims 1-37, wherein determining the binding of the one or more preselected binding agents and corresponding matched specific target agents comprises simultaneously contacting one or more of the corresponding matched specific target agents with two or more independently selected detectable labels and sequentially detecting the detectable labels.
40. The method of claim 39, wherein the detectable labels are detected with a means comprising a fluorescent in situ hybridization (FISH) method.
41. The method of any one of claims 1-40, wherein the cell is a vertebrate cell, optionally a mammalian cell, optionally a human cell.
42. The method of any one of claims 1-41, further comprising sectioning the host cell after fixation of the host cell.
43. A composition comprising: at least a portion of a fixed cell comprising at least one preselected programmable binding agent bound to its matched specific target agent, forming a bound complex, wherein the preselected binding agent comprises an
independently selected programmable binding sequence, and wherein the preselected binding agent is selected, in part, based on its capability to selectively bind its matched specific target agent.
44. The composition of claim 43, wherein the at least a portion of the fixed cell comprises two or more different independently preselected programmable binding agents bound to their matched specific target agents each forming a bound complex.
45. The composition of claim43 or 44, wherein the bound complex comprises a detectable label.
46. The composition of any one of claims 43-45, wherein the preselected binding agent comprises one or more of a polypeptide molecule and a nucleic acid molecule.
47. The composition of any one of claims 43-45, wherein the preselected binding agent comprises a polypeptide/nucleic acid complex.
48. The composition of any one of claims 43-47, wherein each of the independently selected programmable binding sequences correspond to a nucleic acid sequence in a matched specific target agent.
49. The composition of any one of claims 43-48, wherein the preselected binding agent comprises at least one of: a nucleic acid-binding molecule and a nucleic acid analog.
50. The composition of claim 49, wherein the nucleic acid-binding molecule is one or more of: a nucleic acid-binding polypeptide, a DNA-binding molecule, and a DNA- binding polypeptide.
51. The composition of any one of claims 43-50, wherein the preselected binding agent comprises a transcription activator-like effector (TALE) sequence.
52. The composition of any one of claims 43-50, wherein the preselected binding agent comprises a megaTAL effector sequence.
53. The composition of any one of claims 43-50, wherein the preselected binding agent comprises a CRISPR/Cas9 sequence or Cas9 analog sequence effector sequence.
54. The composition of claim 53, wherein the Cas9 analog sequence comprises a Cas13a (c2c2), Cpfl, or MIMIVIRE sequence.
55. The composition of any one of claims 43-50, wherein the preselected binding agent comprises a zinc finger (ZF) effector sequence.
56. The composition of any one of claims 43-55, wherein the specific target agent comprises at least one double-stranded nucleic acid molecule.
57. The composition of any one of claims 43-55, wherein the specific target agent comprises at least one single-stranded nucleic acid molecule.
58. The composition of claim 45, wherein the detectable label comprises a fluorescent label.
59. The method of any one of claims 43-58, wherein the fixed cell is a neuron.
60. The composition of any one of claims 43-59, wherein the fixed cell is a vertebrate cell, optionally is a mammalian cell, and optionally is a human cell.
61. The composition of any one of claims 43-60, wherein the preselected binding agent is part of a fusion protein.
62. The composition of any one of claims 43-61, wherein the at least a portion of the fixed cell includes all of the fixed cell.
63. The composition of any one of claims 43-61, wherein the at least a portion of the fixed cell comprises a section obtained from the fixed cell.
PCT/US2020/025369 2019-03-27 2020-03-27 Programmable imaging methods and compositions Ceased WO2020198640A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962824521P 2019-03-27 2019-03-27
US62/824,521 2019-03-27

Publications (1)

Publication Number Publication Date
WO2020198640A1 true WO2020198640A1 (en) 2020-10-01

Family

ID=72611864

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/025369 Ceased WO2020198640A1 (en) 2019-03-27 2020-03-27 Programmable imaging methods and compositions

Country Status (1)

Country Link
WO (1) WO2020198640A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170268035A1 (en) * 2014-10-17 2017-09-21 Howard Hughes Medical Institute Genomic probes
US20180320226A1 (en) * 2014-08-19 2018-11-08 President And Fellows Of Harvard College RNA-Guided Systems For Probing And Mapping Of Nucleic Acids
US20180340221A1 (en) * 2015-09-24 2018-11-29 Sigma-Aldrich Co. Llc Methods and reagents for molecular proximity detection using rna-guided nucleic acid binding proteins
US20190040370A1 (en) * 2015-11-23 2019-02-07 The Regents Of The University Of California Tracking and manipulating cellular rna via nuclear delivery of crispr/cas9

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180320226A1 (en) * 2014-08-19 2018-11-08 President And Fellows Of Harvard College RNA-Guided Systems For Probing And Mapping Of Nucleic Acids
US20170268035A1 (en) * 2014-10-17 2017-09-21 Howard Hughes Medical Institute Genomic probes
US20180340221A1 (en) * 2015-09-24 2018-11-29 Sigma-Aldrich Co. Llc Methods and reagents for molecular proximity detection using rna-guided nucleic acid binding proteins
US20190040370A1 (en) * 2015-11-23 2019-02-07 The Regents Of The University Of California Tracking and manipulating cellular rna via nuclear delivery of crispr/cas9

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
WU ET AL.: "Progress and Challenges for Live- cell Imaging of Genomic Loci Using CRISPR-based Platforms", GENOMICS , PROTEOMICS, & BIOINFORMATICS, vol. 17, no. 2, 30 January 2019 (2019-01-30), pages 119 - 128, XP085733119, DOI: 10.1016/j.gpb.2018.10.001 *

Similar Documents

Publication Publication Date Title
US20250382639A1 (en) Disrupting the linc complex for treating laminopathy
JP2022527199A (en) Adeno-associated virus with engineered capsids
JP7408838B2 (en) Codon-optimized GLA gene and its use
BR112020001996A2 (en) non-human animal, and methods for testing and for optimizing the ability of a crispr / cas nuclease to excise a genomic nucleic acid in vivo, to test the crispr / cas-induced recombination of a genomic acid with an exogenous donor nucleic acid in vivo and to optimize the ability of crispr / cas to induce recombination of a genomic nucleic acid with an exogenous donor nucleic acid in vivo.
Bear et al. Nuclear poly (A)-binding protein PABPN1 is associated with RNA polymerase II during transcription and accompanies the released transcript to the nuclear pore
CN110996658B (en) Non-human animals comprising a humanized ASGR1 locus
CN114945666A (en) Compositions and methods for efficient recombination of RNA molecules
JP2021513847A (en) Gene editing using homology-independent universal genome engineering technology
JPWO2010010887A1 (en) Tissue expression promoter
McKeown et al. Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp‐1
US7803920B2 (en) ECAT16 gene expressed specifically in ES cells and utilization of the same
Petkova et al. Live‐imaging of revertant and therapeutically restored dystrophin in the DmdEGFP‐mdx mouse model for duchenne muscular dystrophy
CN107827970B (en) An antitumor protein peptide that inhibits FOXM1
JP4271026B2 (en) A pharmaceutical composition for diagnosing, preventing or treating tumor lesions comprising a regulator of actin polymerization state
CAVALLI formaldehyde cross-linking in Drosophila embryos
JP2018021026A (en) Fibrosis inhibitor
EP4395541A1 (en) Aavr knockout mouse in combination with human liver chimerism and methods of use and production of the same
WO2021188993A1 (en) Method of engineering and isolating adeno-associated virus
Donat et al. Generation of Transgenic Lines of Zebrafish Expressing Fluorescently Tagged CCM Proteins to Study Their Function and Subcellular Localization Within the Vasculature
Zajdel et al. Differential expression of tropomyosin during segmental heart development in Mexican axolotl
CN117836420A (en) Recombinant TERT-encoding viral genome and vector
JP2001157588A (en) Gene trap using green fluorescent protein
HK40109651A (en) Recombinant tert-encoding viral genomes and vectors
Schiltz Analysis of normal and aberrant expression of HMGI-C
Amacher Myocardiocyte regulatory elements and trans-acting factors of the mouse muscle creatine kinase gene

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20778635

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20778635

Country of ref document: EP

Kind code of ref document: A1