WO2020181803A1 - Image encoding method and image decoding method, and encoding apparatus and decoding apparatus - Google Patents

Abstract

The present disclosure relates to an image encoding method and an image decoding method, and an encoding apparatus and a decoding apparatus. The encoding method comprises: carrying out single-stage or multi-stage decomposition on an original image by means of a wavelet transform function, so as to obtain a wavelet transform coefficient corresponding to pixel data of a plurality of sub-images, and a level of each of the sub-images; determining an effective numerical value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image corresponding to the wavelet transform coefficient; determining an encoding DNA sequence of the wavelet transform coefficient according to a correlation between a DNA base sequence and a number, and the effective numerical value; and according to the level of the sub-image, connecting the encoding DNA sequence of the wavelet transform coefficient, and determining an encoding DNA sequence of the original image. According to the present disclosure, the image compression rate is high, and the representation of the number may comprise a number of a binary system or above, such that the probability of four basic bases consecutively appearing is reduced, thereby lowering the difficulty of DNA synthesis.

Description

Image coding method, decoding method, coding device and decoding device Technical field

The present disclosure relates to the field of information processing technology, and in particular to an image encoding method, decoding method, encoding device, and decoding device.

Background technique

With the development of life science and technology, as well as the cross-development of life science and other science and technology, it is possible to use genetic material deoxyribonucleic acid (DNA) as a storage medium. The development of DNA synthesis and sequencing technology provides technical support for its becoming a digital storage carrier. Digital information DNA storage refers to the storage of digital information in the base sequence of DNA. This technology uses a DNA synthesizer to artificially synthesize DNA for storage, and a DNA sequencer to read the stored information. As a storage medium, DNA has the following advantages compared with existing tape or hard disk storage media: First, the DNA body is very small, and a base pair is only dozens of atoms in size. With DNA as the storage medium, the overall volume of data will be reduced. It is much smaller than traditional optical discs or hard disks; the second is the high density of DNA. 1 gram of DNA is less than the size of a drop of dew on your fingertips, but it can store 700TB of data, which is equivalent to 14,000 Blu-ray discs with 50GB capacity, or 233 3TB The latter is about 151 kg in weight; the third is that the DNA is extremely stable and can be stored for a long time.

In related technologies, in August 2012, a Harvard team led by George Church and Sriram Kosuri synthesized a DNA sequence that can store 96 bits of data. The specific storage method is to assign binary values to the constituent bases of DNA, adenine (A), guanine (G), cytosine (C), and thymine (T), respectively, and synthesize the DNA sequence through a microfluidic chip. Match the position of the sequence to the relevant data set. When you need to read data, you only need to restore the DNA sequence to binary.

With the development of the Internet, people’s demand for high-definition images is also increasing. Using DNA as a storage medium to directly store image data has the following shortcomings: the compression rate of information is low, and the encoding of images will produce a large number of nucleic acid sequences. , Resulting in a large synthesis workload and high cost; low flexibility, that is, to encode an image, all the nucleic acid sequences corresponding to the synthesized image are required, and arbitrary selection of image accuracy and random extraction of image information cannot be achieved; during encoding and decoding The mismatch rate is high, and it is not easy to fully recover. For example, the binary data reading may have DNA base insertion or deletion, causing decoding errors, resulting in errors in the recovery of the entire image or the partial window of the image; the base repetition rate of the coding sequence Higher.

Summary of the invention

To overcome the problems in the related art, the present disclosure provides an image encoding method, decoding method, encoding device, and decoding device.

According to a first aspect of the embodiments of the present disclosure, there is provided an encoding method, including;

The original image is decomposed at one level or multiple levels through the wavelet transform function to obtain wavelet transform coefficients corresponding to the pixel data of multiple sub-images and the levels of the sub-images;

Determining the effective value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image corresponding to the wavelet transform coefficient;

Determining the coding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value;

According to the level of the sub-image, the coding DNA sequence of the wavelet transform coefficient is connected to determine the coding DNA sequence of the original image.

In a possible implementation manner, the determining the effective value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image corresponding to the wavelet transform coefficient includes:

According to the wavelet transform coefficient, dividing the wavelet transform coefficient corresponding to the pixel data of the sub-image by the maximum absolute value of the wavelet transform coefficient corresponding to the pixel data of the sub-image to obtain a first value;

Determine the effective value of the wavelet transform coefficient according to the first value and the level of the sub-image.

In a possible implementation manner, the determining the effective value of the wavelet transform coefficient according to the first value and the level of the sub-image includes:

Determining the effective number of digits of the first value according to the corresponding relationship between the level of the sub-image, pixel information, and the number of significant digits, where the pixel information includes pixel brightness, pixel chroma, and pixel saturation;

According to the effective number of digits of the first value, the effective value of the wavelet transform coefficient is determined.

In a possible implementation, the number is a decimal number.

In a possible implementation manner, the determining the coding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value includes:

Determine the coding DNA sequence of the wavelet transform coefficient according to the number and symbol of the effective value, the corresponding relationship between the DNA base sequence and the number, and the corresponding relationship between the DNA base sequence and the symbol.

In a possible implementation, the correspondence between the DNA base sequence and the number includes:

When the number of digits of the effective value is less than or equal to the preset value, the DNA base sequence and the number have a one-to-one correspondence;

When the number of digits of the effective value is greater than the preset value, wherein the high-order digits of the effective value that are less than or equal to the preset value have a one-to-one correspondence with the DNA base sequence, which is greater than the preset value. There is a many-to-one correspondence between the low digits of the value and the DNA base sequence.

In a possible implementation manner, the many-to-one correspondence relationship includes: multiple consecutive low-order digits correspond to the same base sequence.

In a possible implementation manner, the determining the coding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value includes:

According to the corresponding relationship between the DNA base sequence and the number and the effective value, sequentially code the DNA base sequence corresponding to the effective value;

When N consecutive identical numbers appear in the effective value, (N≥2), code according to the format "base sequence corresponding to the same number, DNA base sequence corresponding to N" to determine the wavelet transform coefficient The coding DNA sequence.

In a possible implementation, according to the level of the sub-image, connecting the coding DNA sequence of the wavelet transform coefficients to determine the coding DNA sequence of the original image includes:

According to the sub-image level sequence, the coding DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images are sequentially connected to determine the coding DNA sequence of the original image.

In a possible implementation manner, the coding DNA sequence corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-image is sequentially connected according to the sub-image level order to determine the coding DNA sequence of the original image ,include:

According to the format "level number+preset base label+maximum absolute value+level number+preset base label", in sequence before the coding DNA sequence corresponding to the wavelet transform coefficient corresponding to the pixel data of the sub-image Adding the DNA base sequence corresponding to the largest absolute value in the wavelet transform coefficient to obtain the coding DNA sequence of the sub-image;

According to the sub-image level sequence, the coding DNA sequences of the sub-images are sequentially connected to determine the coding DNA sequence of the original image.

In a possible implementation manner, according to the sub-image level order, sequentially connecting the coding DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images to determine the coding DNA sequence of the original image includes :

According to the sub-image level order, sequentially connect the coding DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images;

According to the preset length value, cutting the ligated coding DNA sequence into M rows of DNA subsequences (M≥1);

According to the preset width value, cut the DNA subsequence into X DNA fragments (X≥1);

The base sequence corresponding to the index mark is added to the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment number of the DNA fragment.

In a possible implementation manner, the sub-image information includes: a level number of the sub-image, pixel information, and a type mark of the sub-image.

In a possible implementation manner, the base sequence corresponding to an index mark is added to the DNA fragment, and the index mark includes sub-image information corresponding to the DNA fragment and the line number and segment number of the DNA fragment, including :

The base sequence corresponding to the index mark is added to the front and back ends of the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment number of the DNA fragment.

According to a second aspect of the embodiments of the present disclosure, there is provided an image decoding method, including:

Acquiring the coding DNA sequence of the original image;

Extracting the index-marking base sequence and the DNA fragment sequence in the coding DNA sequence according to the preset number of index-marking base sequence bits;

Determining the wavelet transform coefficient of the sub-image according to the corresponding relationship between the index mark base sequence and the number and the corresponding relationship between the DNA fragment sequence and the number;

Perform the inverse transform of the wavelet transform on the wavelet transform coefficients to obtain a decoded image.

According to a third aspect of the embodiments of the present disclosure, there is provided an image encoding device, including:

The decomposition module is used to decompose the original image at one or more levels through a wavelet transform function to obtain wavelet transform coefficients corresponding to pixel data of multiple sub-images and the levels of the sub-images;

A processing module, configured to determine the effective value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image corresponding to the wavelet transform coefficient;

An encoding module for determining the encoding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value;

The connection module is used to connect the coding DNA sequence of the wavelet transform coefficient according to the level of the sub-image to determine the coding DNA sequence of the original image.

In a possible implementation manner, the processing module includes:

The processing sub-module is configured to divide the wavelet transform coefficient corresponding to the pixel data of the sub-image by the maximum absolute value of the wavelet transform coefficient corresponding to the pixel data of the sub-image according to the wavelet transform coefficient to obtain a first value ；

The determining sub-module is configured to determine the effective value of the wavelet transform coefficient according to the first value and the level of the sub-image.

In a possible implementation manner, the determining submodule includes:

The first determining unit is configured to determine the effective number of digits of the first value according to the corresponding relationship between the level of the sub-image, pixel information, and the number of significant digits. The pixel information includes pixel brightness, pixel chroma, and pixel saturation;

The second determining unit is configured to determine the effective value of the wavelet transform coefficient according to the effective number of bits of the first value.

In a possible implementation, the number is a decimal number.

In a possible implementation manner, the encoding module includes:

The first coding sub-module is used to determine the wavelet based on the number and symbol of the effective value, the corresponding relationship between the DNA base sequence and the number, and the corresponding relationship between the DNA base sequence and the symbol The DNA sequence encoding the transformation coefficients.

In a possible implementation, the correspondence between the DNA base sequence and the number includes:

When the number of digits of the effective value is less than or equal to the preset value, the DNA base sequence and the number have a one-to-one correspondence;

When the number of digits of the effective value is greater than the preset value, wherein the high-order digits of the effective value that are less than or equal to the preset value have a one-to-one correspondence with the DNA base sequence, which is greater than the preset value. There is a many-to-one correspondence between the low digits of the value and the DNA base sequence.

In a possible implementation manner, the many-to-one correspondence relationship includes: multiple consecutive low-order digits correspond to the same base sequence.

In a possible implementation manner, the encoding module includes:

The second encoding sub-module is used to sequentially encode the DNA base sequence corresponding to the effective value according to the corresponding relationship between the DNA base sequence and the number and the effective value;

The third coding sub-module, when N consecutive identical numbers appear in the effective value, (N≥2), code according to the format "base sequence corresponding to the same number, DNA base sequence corresponding to N", Determine the coding DNA sequence of the wavelet transform coefficients.

In a possible implementation manner, the connection module includes:

The connection sub-module is configured to sequentially connect the coding DNA sequence corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-image according to the sub-image level order to determine the coding DNA sequence of the original image.

In a possible implementation manner, the connection submodule includes:

The first processing unit is configured to sequentially correspond to the wavelet transform coefficients corresponding to the pixel data of the sub-image according to the format "level number + preset base label + maximum absolute value + level number + preset base label" Adding the DNA base sequence corresponding to the largest absolute value in the wavelet transform coefficient before the coding DNA sequence to obtain the coding DNA sequence of the sub-image;

The first connecting unit sequentially connects the coding DNA sequences of the sub-images according to the sub-image level order to determine the coding DNA sequences of the original image.

In a possible implementation manner, the connection submodule includes:

The second connecting unit is configured to sequentially connect the coded DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images in the order of the sub-image levels;

The second processing unit is configured to cut the linked coding DNA sequence into M rows of DNA subsequences (M≥1) according to the preset length value;

The third processing unit is configured to cut the DNA subsequence into X DNA fragments (X≥1) according to the preset width value;

The adding unit is used to add the base sequence corresponding to the index mark to the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the line number and segment number of the DNA fragment.

In a possible implementation manner, the sub-image information includes: a level number of the sub-image, pixel information, and a type mark of the sub-image.

In a possible implementation manner, the adding unit includes:

The adding subunit is used to add the base sequence corresponding to the index mark at the front and back ends of the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment number of the DNA fragment .

According to a fourth aspect of the embodiments of the present disclosure, there is provided an image decoding device, including:

An acquisition module for acquiring the coding DNA sequence of the original image;

The extraction module is used to extract the index mark base sequence and the DNA fragment sequence in the coding DNA sequence according to the preset number of index mark base sequence bits;

The determining module is configured to determine the wavelet transform coefficient of the sub-image according to the corresponding relationship between the index mark base sequence and the number and the corresponding relationship between the DNA fragment sequence and the number;

The transform module is used to perform the inverse transform of the wavelet transform on the wavelet transform coefficients to obtain a decoded image.

According to a fifth aspect of the embodiments of the present disclosure, there is provided an image storage method, including:

The method according to any one of claims 1 to 13, encoding the original picture into a DNA sequence;

Synthesize nucleic acid fragments from the DNA sequence by a DNA synthesizer;

The nucleic acid fragments are stored in one or more of the following media, the media including gene chips, plasmids or living cells.

According to a sixth aspect of the embodiments of the present disclosure, there is provided an image reading method, including:

Get nucleic acid fragments,

Obtain the DNA base sequence of the nucleic acid fragments by a DNA sequencer;

The image decoding method according to claim 14, wherein the nucleic acid fragment is decoded into image data.

According to a seventh aspect of the embodiments of the present disclosure, there is provided an image encoding device, which is characterized in that it includes:

processor;

A memory for storing processor executable instructions;

Wherein, the processor is configured to execute the image encoding method described in any one of the embodiments of the present disclosure.

According to an eighth aspect of the embodiments of the present disclosure, there is provided an image decoding device, which is characterized in that it includes:

processor;

A memory for storing processor executable instructions;

Wherein, the processor is configured to execute the image decoding method described in any one of the embodiments of the present disclosure.

According to a ninth aspect of the embodiments of the present disclosure, there is provided a non-transitory computer-readable storage medium. When instructions in the storage medium are executed by a processor, the processor can execute the Image coding method.

According to a tenth aspect of the embodiments of the present disclosure, there is provided a non-transitory computer-readable storage medium. When instructions in the storage medium are executed by a processor, the processor can execute the Image decoding method.

The technical solutions provided by the embodiments of the present disclosure may include the following beneficial effects: the present disclosure uses wavelet transform functions to decompose the original image to obtain a series of different frequencies or different components (ie horizontal direction components, vertical direction components or diagonal components). Line direction component), according to the different importance of the sub-image type to the image reconstruction, the sub-image is selectively retained or deleted, and the corresponding wavelet transform coefficient of the retained sub-image is further processed Compression processing obtains the effective value of the wavelet transform coefficient, and encodes the original image into a DNA sequence through the corresponding relationship between the effective value and the DNA base sequence. The image compression rate of the present disclosure is high, and the digital representation can be Including binary numbers or more, such as octal numbers and decimal numbers. When the number of digits is small, such as one digit, two or more base sequences can be used to correspond to it, which can reduce four basic bases The probability of continuous occurrence, thereby reducing the difficulty of DNA synthesis.

It should be understood that the above general description and the following detailed description are only exemplary and explanatory, and cannot limit the present disclosure.

Description of the drawings

The drawings herein are incorporated into the specification and constitute a part of the specification, show embodiments in accordance with the disclosure, and together with the specification are used to explain the principle of the disclosure.

Fig. 1 is a flowchart showing an image coding method according to an exemplary embodiment.

Fig. 2 is a schematic diagram showing a first-level decomposition of an image according to an exemplary embodiment.

Fig. 3 is a schematic diagram showing a three-level decomposition of an image according to an exemplary embodiment.

Fig. 4 is a flowchart showing an image coding method according to an exemplary embodiment.

Fig. 5 is a flowchart showing an image encoding method according to an exemplary embodiment.

Fig. 6 is a flowchart showing an image coding method according to an exemplary embodiment.

Fig. 7 is a flowchart showing an image coding method according to an exemplary embodiment.

Fig. 8 is a flowchart showing an image coding method according to an exemplary embodiment.

Fig. 9 is a flowchart showing an image coding method according to an exemplary embodiment.

Fig. 10 is a flowchart showing an image coding method according to an exemplary embodiment.

Fig. 11 is an original image according to an exemplary embodiment.

Fig. 12 is an original image according to an exemplary embodiment.

Fig. 13 is a flowchart showing an image decoding method according to an exemplary embodiment.

Fig. 14 is a block diagram showing an image encoding device according to an exemplary embodiment.

Fig. 15 is a block diagram showing an image encoding device according to an exemplary embodiment.

Fig. 16 is a block diagram showing an image encoding device according to an exemplary embodiment.

Fig. 17 is a block diagram showing an image encoding device according to an exemplary embodiment.

Fig. 18 is a block diagram showing an image encoding device according to an exemplary embodiment.

Fig. 19 is a block diagram showing an image encoding device according to an exemplary embodiment.

Fig. 20 is a block diagram showing an image encoding device according to an exemplary embodiment.

Fig. 21 is a block diagram showing an image encoding device according to an exemplary embodiment.

Fig. 22 is a block diagram showing an image decoding device according to an exemplary embodiment.

Fig. 23 is a block diagram showing an image encoding device according to an exemplary embodiment, and Fig. 23 is also applicable to an image decoding device.

Fig. 24 is a block diagram showing an image encoding device according to an exemplary embodiment, and Fig. 24 is also applicable to an image decoding device.

detailed description

Here, exemplary embodiments will be described in detail, and examples thereof are shown in the accompanying drawings. When the following description refers to the drawings, unless otherwise indicated, the same numbers in different drawings indicate the same or similar elements. The implementation manners described in the following exemplary embodiments do not represent all implementation manners consistent with the present disclosure. Rather, they are merely examples of devices and methods consistent with some aspects of the present disclosure as detailed in the appended claims.

In order to facilitate those skilled in the art to understand the technical solutions provided by the embodiments of the present disclosure, the following first describes the technical environment implemented by the technical solutions.

As a storage medium, DNA has the advantages of small size, high density and long-term storage, and can be used as a new medium for data storage in the future. In multimedia files, images occupy a very important part. Especially with the development of the Internet, people’s demand for high-definition images has increased, and the amount of image data has also increased. Directly encoding the binary data corresponding to the image into a DNA sequence will produce a lot of Nucleic acid sequence of, resulting in a large workload, and the base sequence corresponding to the binary data will appear repeatedly repeatedly, which can easily cause the failure of DNA synthesis and increase the difficulty of image storage.

Based on the actual technical requirements similar to those described above, it is necessary to perform reasonable data compression processing before image storage, and design effective coding rules, so that images can be efficiently and accurately coded and stored.

The image encoding method described in the present disclosure will be described in detail below with reference to FIG. 1. Fig. 1 is a method flowchart of an embodiment of an image encoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Specifically, an embodiment of an image coding method provided by the present disclosure is shown in FIG. 1. The method can be applied to the coding of a variety of picture formats, including but not limited to BMP format, JPEG format, and GIF format. , PSD format, PNG format, PNG format and TIFF format, etc., can be applied to color pictures and black and white pictures. The method includes:

Step S11: Perform one-level or multi-level decomposition of the original image through a wavelet transform function to obtain wavelet transform coefficients corresponding to pixel data of multiple sub-images and the levels of the sub-images;

Step S12, determining the effective value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image;

Step S13: Determine the coding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value;

Step S14: Connect the coding DNA sequence of the wavelet transform coefficients according to the level of the sub-image to determine the coding DNA sequence of the original image.

In the embodiment of the present disclosure, a wavelet transform function is used to decompose the original image at one or more levels to perform data compression on the original image. The basic idea of wavelet transform for image compression is to decompose the image in multi-resolution, decompose it into sub-images of different spaces and different frequencies, and then perform coefficient coding on the sub-images. In an example, the original image can be decomposed by the Mallat pyramid decomposition algorithm: For example, for an image with m rows and n columns, the decomposition process of the Mallat pyramid decomposition algorithm is as follows: One-dimensional wavelet transform is performed on each row of to obtain low-frequency coefficient L1 and high-frequency coefficient H1, and then one-dimensional wavelet transform is performed on each column of the obtained LH image (the size is still m rows and n columns). The image can be divided into four parts: LL1, HL1, LH1, and HH1. Among them, LL1 is the first-level low-frequency sub-image, HL1 is the first-level high-frequency horizontal sub-image, LH1 is the first-level high-frequency vertical sub-image, and HH1 is one High-frequency diagonal sub-images. As shown in Figure 2, the second-level, third-level, and even higher-level two-dimensional wavelet transforms are performed on the low-frequency sub-image LL1 part of the upper-level wavelet transform image and then the first-level wavelet transform, which is a recursive process. , 1, 2, 3 represent the level of decomposition, that is, the level of the sub-image, L represents the low-frequency coefficient, and H represents the high-frequency coefficient.

In the embodiments of the present disclosure, after the original image is subjected to wavelet transformation, a series of sub-images with different frequencies or different components (ie, horizontal, vertical, or diagonal components) can be obtained. The resolution is also different. The value of most points on the high-resolution (ie, high-frequency) sub-image is close to 0. The higher the resolution, the more obvious this phenomenon is. It should be noted that in the N-level two-dimensional wavelet decomposition, the higher the decomposition level of the sub-image, the lower the frequency. For example, in the schematic diagram of the three-level wavelet transform image structure in FIG. 2, the frequencies of the second-level sub-images HL2, LH2, and HH2 are lower than the frequencies of the first-level sub-images HL1, LH1, and HH1, and the resolution is accordingly lower. According to this hierarchical model of wavelet transform coefficients at different resolutions, we can adopt, but are not limited to, the use of high frequency and low frequency, threshold method and interception method to perform image compression on the sub-image.

In an example, after performing wavelet decomposition on the original image, the low-frequency coefficients remain unchanged, and then a global threshold is selected to process the high-frequency coefficients at all levels, or the high-frequency coefficients at different levels are processed with different thresholds. The high frequency coefficient below the threshold is set to 0, otherwise it is reserved. Use the retained non-zero wavelet coefficients for image reconstruction.

In another example, according to the levels of the sub-images corresponding to the wavelet transform coefficients, for example, in the order of resolution from low to high (that is, the order of sub-image levels from high to low), The wavelet transform coefficients are reserved for valid values to achieve further data compression.

In the embodiment of the present disclosure, the corresponding relationship between the DNA base sequence and the number can be pre-encoded, and the corresponding DNA base sequence is set according to the effective value of the wavelet transform coefficient and the corresponding number. The corresponding relationship between the effective value and the number is used to encode the wavelet transform coefficient into a DNA sequence. The digital representation can include binary numbers or more, such as octal numbers, decimal numbers, and when the number of digits is small, such as one digit, two or more base sequences can be used to correspond to it. Reduce the probability that the four basic bases appear consecutively, thereby reducing the difficulty of DNA synthesis.

In the embodiments of the present disclosure, according to the level of the sub-image, the wavelet transform coefficient corresponding to the pixel data of the sub-image can be used as a unit in a preset order to perform DNA encoding one by one until the original image is decomposed After the encoding of all sub-images is completed, the encoding DNA sequence of the original image is obtained.

The present disclosure uses wavelet transform functions to decompose the original image to obtain a series of sub-images with different frequencies or different components (ie, horizontal, vertical, or diagonal components). The importance of image reconstruction is different, the sub-images are selectively retained or deleted, and the corresponding wavelet transform coefficients of the retained sub-images are subjected to further compression processing to obtain the effective values of the wavelet transform coefficients. According to the corresponding relationship between the effective value and the DNA base sequence, the original image is encoded into a DNA sequence. The image of the present disclosure has a high compression rate, and the digital representation can include numbers above binary, such as octal numbers, decimal numbers, And when the number of digits is small, such as a single digit, two or more base sequences can be used to correspond to it, which can reduce the probability of four basic bases consecutively appearing, thereby reducing the difficulty of DNA synthesis.

The image coding method described in the present disclosure will be described in detail below with reference to FIG. 4. Fig. 4 is a method flowchart of an embodiment of an image encoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Specifically, an embodiment of an image coding method provided by the present disclosure is shown in FIG. 4. The difference from the above-mentioned embodiment is that the step S12 is based on the wavelet transform coefficient and the sub-image corresponding to the wavelet transform coefficient. The determination of the effective value of the wavelet transform coefficient includes: step S121 and step S122:

Step S121, according to the wavelet transform coefficient, divide the wavelet transform coefficient corresponding to the pixel data of the sub-image by the maximum absolute value of the wavelet transform coefficient corresponding to the pixel data of the sub-image to obtain a first value;

Determine the effective value of the wavelet transform coefficient according to the first value and the level of the sub-image.

In the embodiments of the present disclosure, in order to facilitate processing, the wavelet transform coefficients corresponding to the pixel data of the sub-image are decimalized, that is, the maximum absolute value of the wavelet coefficients corresponding to the pixel data of the sub-image (the maximum absolute value is selected) The absolute value of the coefficient of ), the wavelet coefficient corresponding to each pixel data of the sub-image is divided by the maximum absolute value to obtain a first value, and the first value falls within the range of [-1,1]. Correspondingly, in an example, according to the level of the sub-image corresponding to the first value, for example, according to the order of resolution from low to high (ie, the order of sub-image level from high to low), Corresponding wavelet transform coefficients can be kept in the order of the number of effective numerical digits, and the effective numerical value can be retained to achieve further data compression.

The image encoding method described in the present disclosure will be described in detail below with reference to FIG. 5. Fig. 5 is a method flowchart of an embodiment of an image encoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Specifically, an embodiment of an image coding method provided by the present disclosure is shown in FIG. 5. The difference from the above-mentioned embodiment is that in step S122, according to the first value and the level of the sub-image, the The effective value of the wavelet transform coefficient includes: step S1221 and step S1222:

Step S1221: Determine the effective number of digits of the first value according to the corresponding relationship between the level of the sub-image, the pixel information, and the number of significant digits, where the pixel information includes pixel brightness, pixel chroma, and pixel saturation;

Step S1222: Determine the effective value of the wavelet transform coefficient according to the effective number of bits of the first value.

In the embodiments of the present disclosure, in an example, the original image may be obtained in the following manner, including obtaining matrix data of the RGB color space of the original image, and each point value of the matrix data ranges from 0 to 255, Through formula (1), formula (2) and formula (3), the RGB data can be converted to achieve data compression of the original image to obtain the YUV color data of the original image. The formula (1) ), formula (2) and formula (3) include:

Y=0.299R+0.587G+0.114B (1)

U=-0.1687R-0.3313G+0.5B (2)

V=0.5R-0.4187G-0.0813B (3)

Among them, Y represents the brightness, that is, the grayscale value; and U represents the chroma, and V represents the saturation, which is used to describe the color and saturation of the image, and is used to specify the color of the pixel.

In another example, the pixel information of the sub-image can be described by YUV, and the corresponding wavelet transform coefficients of the pixel data of the sub-image are also distinguished by Y, U, and V, that is, the sub-image The Y information of a single pixel corresponds to a Y information wavelet transform coefficient, and U information corresponds to a U information wavelet transform coefficient. V information corresponds to a V information wavelet transform coefficient, so that the pixel information can include pixel brightness, pixel chroma, and pixel saturation. degree. The corresponding relationship between the level of the sub-image, the pixel information, and the number of significant digits is further established. The corresponding relationship may include: the higher the level of the sub-image, the more significant digits can be reserved; Y information wavelet Compared with the U information wavelet transform coefficient and the V information wavelet transform coefficient, the transform coefficient can retain more significant digits.

For example, the highest level of the sub-image is level five, then the Y information wavelet transform coefficients corresponding to the five level sub-images can retain three significant digits, and the U information wavelet coefficients and V information wavelet coefficients can retain three significant digits; The Y information wavelet transform coefficients corresponding to the fourth-level sub-image and the third-level sub-image can retain two significant digits, and the U-information wavelet transform coefficients and the V-information wavelet transform coefficients corresponding to the fourth-level sub-image can retain two significant digits; The Y information wavelet transform coefficient corresponding to the image can retain a significant number, the Y information wavelet transform coefficient corresponding to the first-level sub-image can be removed, and the U-information wavelet corresponding to the third-level sub-image, the second-level sub-image and the first-level sub-image can be removed Transform coefficients and V information wavelet transform coefficients. Therefore, the effective number of the first value is determined according to the corresponding relationship between the level of the sub-image, the pixel information, and the number of significant digits, so as to determine the effective value of the wavelet transform coefficient.

In a possible implementation manner, the wavelet transform coefficients corresponding to the sub-images are reserved with no more than two significant digits, which can achieve a higher compression effect, reduce the number of synthesized encoding DNA sequences, and ensure decoding The image is restored without distortion.

In a possible implementation, the number is a decimal number, because the wavelet coefficients are also expressed in decimal. Therefore, to establish the correspondence between the decimal and the DNA base sequence, the wavelet coefficients can be directly corresponded to the DNA base sequence. Converting wavelet coefficients to other base numbers is beneficial to reduce coding complexity, and decimal numbers have a total of ten digital forms from 0-9, which have more digital expressions than other bases, such as binary and ternary. Corresponding to the expression of more DNA base sequences, the repetition rate of the DNA base sequence after image encoding is greatly reduced, which is conducive to accurate decoding.

The image encoding method described in the present disclosure will be described in detail below with reference to FIG. 6. Fig. 6 is a method flowchart of an embodiment of an image encoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Specifically, an embodiment of an image encoding method provided by the present disclosure is shown in FIG. 6. The difference from the above-mentioned embodiment is that the step S13 is based on the corresponding relationship between the DNA base sequence and the number and the effective value, Determining the coding DNA sequence of the wavelet transform coefficient includes: step S131.

Step S131: Determine the coding DNA of the wavelet transform coefficient according to the number and symbol of the effective value, the corresponding relationship between the DNA base sequence and the number, and the corresponding relationship between the DNA base sequence and the symbol sequence.

In the embodiment of the present disclosure, the corresponding relationship between the sign of the effective value and the DNA base sequence can be established, and the sign of the effective value includes a positive sign and a negative sign. In an example, for example, when the effective value is a positive number, the corresponding base sequence may include "TC"; when the effective value is a negative number, the corresponding base sequence may include "TG". By establishing the corresponding relationship between the symbol of the effective value and the DNA base sequence, when the effective value has the same number and the sign is different, only the base sequence corresponding to the symbol needs to be labeled to distinguish, so that the same The digital part can share a set of corresponding relations, which reduces the coding complexity.

In a possible implementation, the correspondence between the DNA base sequence and the number includes:

When the number of digits of the effective value is less than or equal to the preset value, the DNA base sequence and the number have a one-to-one correspondence;

When the number of digits of the effective value is greater than the preset value, wherein the high-order digits of the effective value that are less than or equal to the preset value have a one-to-one correspondence with the DNA base sequence, which is greater than the preset value. There is a many-to-one correspondence between the low digits of the value and the DNA base sequence.

In the embodiment of the present disclosure, in an example, for example, the preset value of the number of digits of the effective value is set to 2. When the number of digits of the effective value is two or one, the DNA base sequence and the The numbers are in a one-to-one correspondence relationship, and the one-to-one correspondence relationship may be as shown in Table 1. When the number of digits of the effective value is three or more, such as 0.122 and 0.1367, the first two (higher) digits 12 and 13, can be one-to-one correspondence with the DNA base sequence according to Table 1, and 12 corresponds "AAG", 13 corresponds to "ACA"; the lower digits 2 and 67 can be coded according to the many-to-one correspondence.

In a possible implementation manner, the many-to-one correspondence relationship includes: multiple consecutive low-order digits correspond to the same base sequence.

In the embodiment of the present disclosure, for example, the preset value of the number of digits for setting the effective value is 2, the effective value is 0.122 and 0.126, the first two digits 12 can be one-to-one corresponding to the DNA base sequence according to Table 1, and 12 corresponds to "AAG "; The third digit 2 or 6 can be coded according to a many-to-one correspondence, and the many-to-one correspondence may include multiple consecutive low digits corresponding to the same base sequence, such as when the third decimal place is When it is between 1 and 4, it is represented by "TTC". When the third decimal place is between 5 and 9, it is represented by "TTG". Therefore, the effective value of 0.122 is finally expressed as "AAGTTC", and the effective value of 0.126 is finally expressed as "AAGTTG".

In an example, the correspondence between the DNA base sequence and the number may be combined with the correspondence between the DNA base sequence and the symbol. For example, in the above embodiment, when the third decimal place is between 1 and 4 and the effective value is positive, it is represented by "TTC"; when the third decimal place is between 1 and 4, When the valid value is negative, it is represented by "TTT"; when the third decimal place is between 5-9 and the valid value is positive, it is represented by "TTG"; when the third decimal place is between 5 and When it is between 9 and the effective value is negative, it is indicated by "TTA".

The image coding method described in the present disclosure will be described in detail below with reference to FIG. 7. Fig. 7 is a method flowchart of an embodiment of an image encoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Table 1. Correspondence between numbers and DNA base sequences

digital	DNA	digital	DNA	digital	DNA	digital	DNA	digital	DNA
0	TA	20	CAC	40	AACA	60	AGCG	80	CCGC
1	AA	twenty one	CAG	41	AACC	61	AGGA	81	CCGG
2	AC	twenty two	CCA	42	AACG	62	AGGC	82	CGAA
3	AG	twenty three	GCCA	43	AAGA	63	AGGG	83	CGAC
4	CA	twenty four	CCG	44	AAGC	64	CAAA	84	CGAG
5	CC	25	CGA	45	AAGG	65	CAAC	85	CGCA
6	CG	26	CGC	46	ACAA	66	CAAG	86	CGCC
7	GA	27	CGG	47	ACAC	67	CACA	87	CGCG
8	GC	28	GAA	48	ACAG	68	CACC	88	CGGA
9	GG	29	GAC	49	ACCA	69	CACG	89	CGGC
10	AAA	30	GAG	50	ACCC	70	CAGA	90	CGGG
11	AAC	31	GCA	51	ACCG	71	CAGC	91	GAAA
12	AAG	32	GCC	52	ACGA	72	CAGG	92	GAAC
13	ACA	33	GCG	53	ACGC	73	CCAA	93	GAAG
14	ACC	34	GGA	54	ACGG	74	CCAC	94	GACA
15	ACG	35	GGC	55	AGAA	75	CCAG	95	GACC
16	AGA	36	GCCG	56	AGAC	76	GCGA	96	GACG
17	AGC	37	GCAA	57	AGAG	77	GCAC	97	GAGA
18	AGG	38	AAAC	58	AGCA	78	GCGC	98	GAGC
19	CAA	39	AAAG	59	AGCC	79	CCGA	99	GAGG

Note: The integer "1" is represented by "TCGCCA", the integer "-1" is "TGGCCA"

Specifically, an embodiment of an image encoding method provided by the present disclosure is shown in FIG. 7. The difference from the above-mentioned embodiment is that the step S13 is based on the corresponding relationship between the DNA base sequence and the number and the effective value, Determining the coding DNA sequence of the wavelet transform coefficient includes: step S132 and step S133.

Step S132, according to the corresponding relationship between the DNA base sequence and the number and the effective value, sequentially encode the DNA base sequence corresponding to the effective value;

Step S133: When N consecutive identical numbers appear in the effective value, (N≥2), code according to the format "base sequence corresponding to the same number, DNA base sequence corresponding to N" to determine the Coding DNA sequence of wavelet transform coefficients.

In the embodiment of the present disclosure, the corresponding relationship between the DNA base sequence and the number includes the one described in the above embodiment: when the number of digits of the effective value is less than or equal to a preset value, the DNA base sequence is The numbers are in a one-to-one correspondence; when the number of digits of the effective value is greater than the preset value, wherein the high-order digits of the effective value that are less than or equal to the preset value and the DNA base sequence are There is a one-to-one correspondence, and there is a many-to-one correspondence between the low-digit numbers greater than the preset value and the DNA base sequence; the many-to-one correspondence includes: multiple consecutive low-digit numbers correspond to the same base sequence . According to the number of digits of the effective value and the specific number, the corresponding DNA base sequence is found in the corresponding relationship, and the effective value can be coded in sequence from high to low (from left to right).

In an example, since a sub-image contains wavelet transform coefficients corresponding to many pixels, the coding DNA sequence corresponding to the wavelet transform coefficients is very long, and the same number will inevitably appear N consecutive times. However, consecutively encoding the same DNA base sequence will cause difficulty in synthesis, therefore, the following format "the base sequence corresponding to the same number, and the DNA base sequence corresponding to N" can be used for encoding. For example, if there are 3 consecutive 0s in the wavelet coefficient, the corresponding coding DNA sequence of 0 is "TA", and the number 3 can follow the corresponding relationship in Table 1, and the corresponding coding DNA sequence is "AG", which is finally expressed as "TAAG" .

The image encoding method described in the present disclosure will be described in detail below with reference to FIG. 8. Fig. 8 is a method flowchart of an embodiment of an image encoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Specifically, an embodiment of an image coding method provided by the present disclosure is shown in FIG. 8. The difference from the above embodiment is that in step S14, the coding of the wavelet transform coefficients is connected according to the level of the sub-image. DNA sequence, determining the coding DNA sequence of the original image includes: step S141.

Step S141, according to the sub-image level order, sequentially connect the coding DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images to determine the coding DNA sequence of the original image.

In the embodiment of the present disclosure, the order of the sub-image levels includes ascending order and descending order. For example, the highest level of the sub-image is three levels, and the pixel data of the sub-images are sequentially connected according to the ascending order of the sub-images The coding DNA sequence corresponding to the corresponding wavelet transform coefficient includes, the connection sequence may include: the coding DNA sequence corresponding to LL1, the coding DNA sequence corresponding to HL1, the coding DNA sequence corresponding to LH1, the coding DNA sequence corresponding to HH1, and the coding DNA sequence corresponding to LL2. Coding DNA sequence, coding DNA sequence corresponding to HL2, coding DNA sequence corresponding to LH2, coding DNA sequence corresponding to HH2, coding DNA sequence corresponding to LL3, coding DNA sequence corresponding to HL3, coding DNA sequence corresponding to LH3, coding DNA sequence corresponding to HH3 DNA sequence.

For another example, the highest level of the sub-image is five levels. According to the method for retaining valid values in the embodiment of step S1221 and step S1222: two bits can be reserved for the Y information wavelet transform coefficients corresponding to the five-level sub-images Significant digits, U information wavelet transform coefficients and V information wavelet transform coefficients can retain two significant digits; Y information wavelet transform coefficients corresponding to four-level sub-images and three-level sub-images can retain two significant digits, corresponding to four-level sub-images U information wavelet transform coefficients and V information wavelet transform coefficients can retain two significant digits; the Y information wavelet transform coefficients corresponding to the secondary sub-image can retain one significant digit, and the Y information wavelet transform coefficients corresponding to the primary sub-image can be removed. The U information wavelet transform coefficients and V information wavelet transform coefficients corresponding to the third-level sub-image, the second-level sub-image, and the first-level sub-image can be removed. According to the descending order of the sub-images, the coded DNA sequence corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images is sequentially connected, and the connection sequence may include: Y information wavelet transform corresponding to the pixel data of the five-level sub-images The coding DNA sequence of the coefficient, the coding DNA sequence of the U information wavelet transform coefficient corresponding to the pixel data of the fifth-level sub-image, the coding DNA sequence of the V information wavelet transform coefficient corresponding to the pixel data of the fifth-level sub-image, and the pixels of the fourth-level sub-image The coding DNA sequence of the Y wavelet transform coefficient corresponding to the data, the coding DNA sequence of the U information wavelet transform coefficient corresponding to the pixel data of the four-level sub-image, the coding DNA sequence of the V information wavelet transform coefficient corresponding to the pixel data of the four-level sub-image, The coding DNA sequence of Y wavelet transform coefficients corresponding to the pixel data of the three-level sub-image, and the coding DNA sequence of Y wavelet transform coefficients corresponding to the pixel data of the two-level sub-image.

In this embodiment, the wavelet transform coefficients corresponding to the third-level sub-image and the second-level sub-image are only Y-shaped, so they can be alternately arranged according to the corresponding relationship between the wavelet transform coefficients of the third-level sub-image and the second-level sub-image The corresponding encoded DNA sequences can be connected according to the following data format, which includes "wavelet coefficients corresponding to a certain pixel in the third-level sub-image + TT + wavelet coefficients corresponding to the pixel in the second-level sub-image". For example, the position coordinates of the wavelet coefficients corresponding to the three-level sub-image are (i, j), corresponding to the wavelet coefficients (2i, 2j), (2i, 2j+1), (2i+1,2j) corresponding to the two-level sub-image , (2i+1,2j+1), after the wavelet coefficients corresponding to the three-level sub-image, these four wavelet coefficients are sequentially stored. This is because when the wavelet transform coefficient has only one type Y, the wavelet coefficient corresponding to a single pixel in the three-level sub-image after wavelet transform and the wavelet coefficient corresponding to the pixel in the second-level sub-image are adjacent , Encoding using the above format is helpful to reduce the complexity of encoding.

The image encoding method described in the present disclosure will be described in detail below with reference to FIG. 9. FIG. 9 is a method flowchart of an embodiment of an image encoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Specifically, an embodiment of an image coding method provided by the present disclosure is shown in FIG. 9. The difference from the above-mentioned embodiment is that in step S141, the sub-images are sequentially connected according to the order of the sub-image levels. The coding DNA sequence corresponding to the wavelet transform coefficient corresponding to the pixel data of, and determining the coding DNA sequence of the original image includes: step S1411 and step S1412.

Step S1411, in accordance with the format "level number + preset base label + maximum absolute value + level number + preset base label", sequentially place the codes corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-image Adding the DNA base sequence corresponding to the largest absolute value in the wavelet transform coefficient before the DNA sequence to obtain the coding DNA sequence of the sub-image;

Step S1412, according to the sub-image level sequence, sequentially connect the coding DNA sequence of the sub-images to determine the coding DNA sequence of the original image.

In the embodiment of the present disclosure, when the stored wavelet coefficient is not the maximum absolute value, the addition format includes "level number + line number + segment number + base corresponding to the wavelet coefficient + level number + line number + segment number", as described The sub-image level sequence may include ascending order or descending order, and the coding DNA sequence of the sub-images are sequentially connected to determine the coding DNA sequence of the original image.

In the embodiment of the present disclosure, when the sub-image is the maximum absolute value of the corresponding wavelet transform coefficient, the format includes: "level number + preset base label + maximum absolute value + level number + preset base label ", the level number represents the level number of the sub-image, and the preset base mark can be like "GTGTGTTATA". When encoding, the level number and the DNA base sequence corresponding to the maximum absolute value need to be added to The coding DNA sequence corresponding to the sub-image. For example, the maximum absolute value of the five-level low-frequency level sub-image is 7654. The maximum absolute value 7654 can be coded according to the DNA base sequence corresponding to the numbers in Table 2, expressed as "CT+CG+AG+AC", and the first level corresponds to The DNA base sequence of is "AAT", and the preset base label is "GTGTGTTATA". Then, the maximum absolute value of the five-level low-frequency level sub-image is 7654 expressed as: "AATGTGTGTTATACTCGAGACAATGTGTGTTATA". In the embodiment of the present disclosure, the level number and the preset base mark appear at both the front and back ends of the maximum absolute value, which facilitates the verification during decoding. For example, when reading, the level number and the preset base mark are first read. Then, after reading the base sequence corresponding to the maximum absolute value, read the level number and the preset base label again. When it is found that the level number read for the first time and the preset base label are different, the description An error occurred in the coding DNA sequence.

The image encoding method described in the present disclosure will be described in detail below with reference to FIG. 10. Fig. 10 is a method flowchart of an embodiment of an image encoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Specifically, an embodiment of an image coding method provided by the present disclosure is shown in FIG. 10. The difference from the above-mentioned embodiment is that in step S141, the pixels of the sub-images are sequentially connected according to the order of the sub-image levels. The coding DNA sequence corresponding to the wavelet transform coefficient corresponding to the data to determine the coding DNA sequence of the original image includes: step S1413, step S1414, step S1415, and step S1416:

Step S1413, according to the sub-image level order, sequentially connect the coded DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images;

Step S1414, according to the preset length value, cut the ligated coding DNA sequence into M rows of DNA subsequences (M≥1);

Step S1415, cutting the DNA subsequence into X DNA fragments (X≥1) according to the preset width value;

Step S1416: Add the base sequence corresponding to the index mark to the DNA fragment, the index mark including the sub-image information corresponding to the DNA fragment and the line number and segment number of the DNA fragment.

In the embodiments of the present disclosure, the coding DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images may be sequentially connected according to the sub-image level order in the foregoing embodiment, such as ascending order and descending order. The ligated coding DNA sequence contains the information of all the decomposed sub-images. There are many DNA base sequences and it is difficult to synthesize. In order to synthesize the DNA sequence effectively, the ligated coding DNA sequence should be set according to a preset length value, such as 40 ~130nt is cut to obtain M rows of DNA subsequences, and the DNA subsequences are further cut to obtain X DNA fragments. The selection of the preset length value and the preset width value is not limited to the requirements of the DNA synthesis process, but may also be based on the type of the sub-image pixel data, the level of the sub-image, the frequency of the sub-image, etc., the same The DNA base sequence information of the attribute is divided into the same DNA fragment. In an example, the DNA base sequence corresponding to the line number and the segment number needs to be added to the corresponding DNA fragment to facilitate subsequent connection and image decoding. The corresponding relationship between the line number and the DNA base sequence may include the corresponding relationship in Table 2, and the corresponding relationship between the segment number and the DNA base sequence may include the corresponding relationship in Table 3.

Table 2 Encoding of "line number" in index mark

Line number	0	1	2	3	4	5	6	7	8	9
coding	TA	TC	TG	AT	AC	AG	CG	CT	GT	GC

Table 3 Encoding of "Segment Number" in Index Mark

Segment number	0	1	2	3	4	5	6	7	8	9
coding	TA	TC	TG	AT	AC	AG	CG	CT	GT	GC

In the embodiment of the present disclosure, an index mark is added to the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the line number and segment number of the DNA fragment, which is beneficial to accurately identify the location during the later decoding. The content objects contained in the DNA fragments are spliced.

In a possible implementation manner, the sub-image information includes: a level number of the sub-image, pixel information, and a type mark of the sub-image. The level number of the sub-image may include the one-level or multi-level decomposition of the original image using the wavelet transform function in the above-mentioned embodiment, as described in FIG. 3, where 1, 2, and 3 indicate the level of the sub-image Number; the pixel information may include the YUV information of the sub-image pixels in the above-mentioned embodiment; the type mark of the sub-image may include a series of different results obtained after the original image is subjected to wavelet transformation in the above-mentioned example Sub-images of frequency or different components (ie, horizontal component, vertical component or diagonal component), such as HL1, LH1, HH1, HL2, LH2, HH2, etc.

In an example, to add the sub-image information to the DNA fragment, it is necessary to first obtain the DNA base sequence corresponding to the sub-image, which can be achieved by pre-establishing the correspondence between the sub-image information and the DNA base sequence. For example, for a sub-image with the highest level of four, Y represents brightness, U and V represent chroma and saturation, respectively, which may include the correspondence between the following sub-image information and DNA base sequence, refer to Table 4, where : Y0 represents the low-frequency sub-image of brightness, Y10 represents the first-level high-frequency horizontal sub-image of brightness, Y11 represents the first-level high-frequency vertical sub-image of brightness, and Y12 represents the first-level high-frequency diagonal sub-image of brightness , Y20 represents a secondary high-frequency horizontal sub-image of brightness, Y21 represents a secondary high-frequency vertical sub-image of brightness, and Y22 represents a secondary high-frequency diagonal sub-image of brightness. U0 represents the low-frequency sub-image of color, U10 represents the first-level high-frequency horizontal sub-image of color, U11 represents the first-level high-frequency vertical sub-image of color, U12 represents the first-level high-frequency diagonal sub-image of color, and U20 represents the second-level high-frequency diagonal sub-image of color. Level high frequency horizontal sub image, U21 represents the secondary high frequency vertical sub image of color, U22 represents the secondary high frequency diagonal sub image of color. V0 represents the low-frequency sub-image of saturation, V10 represents the first-level high-frequency horizontal sub-image of saturation, V11 represents the first-level high-frequency vertical sub-image of saturation, and V12 represents the first-level high-frequency diagonal sub-image of saturation. The secondary high-frequency horizontal sub-image of V20 saturation, V21 is the secondary high-frequency vertical sub-image of saturation, and V22 is the secondary high-frequency diagonal sub-image of saturation.

Table 4 "Sub-image information" coding in the index mark

In a possible implementation manner, in step S1416, a base sequence corresponding to an index mark is added to the DNA fragment, and the index mark includes sub-image information corresponding to the DNA fragment and the row number of the DNA fragment And segment numbers, including:

The base sequence corresponding to the index mark is added to the front and back ends of the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the line number and segment number of the DNA fragment to determine the original image The coding DNA sequence.

In the embodiment of the present disclosure, the base sequence corresponding to the index mark is added to the front and back ends of the DNA fragment, as shown in Table 4. In this way, when performing image decoding, after reading the index mark at the front end of the DNA fragment for the first time, when reading the index mark at the back end of the DNA fragment again, if the index marks read twice are found to be inconsistent If it is, it means that an error occurred during the synthesis of the DNA fragment.

Table 5 Nucleic acid fragment structure

The beneficial effects of the image encoding method of the present disclosure will be described below in conjunction with FIG. 11 and FIG. 12. After the wavelet transformation of Figure 11, the U information wavelet transform coefficients of the five-level low-frequency level sub-image are shown in Table 6. Table 6 only shows part of the data. For space considerations, only the five-level low-frequency level sub-images are taken here. The first 5 lines of the U information wavelet transform coefficient of the image, each line takes a table of 28 numbers.

Each value in Table 6 is divided by the maximum absolute value of the U information wavelet transform coefficient, and two decimal places are retained to obtain Table 7. The decimal part in Table 7 is coded into a DNA sequence according to the corresponding relationship between the DNA base sequence and the number in the above embodiment, and the first five lines of the DNA sequence are taken as an example as follows:

Count the number of DNAs stored in the coefficients after wavelet transformation: the number of encodings of brightness information Y is as follows: 4598 encoding DNA sequences for secondary sub-image synthesis; 1120 encoding DNA sequences for tertiary sub-image synthesis; fourth-level sub-image synthesis 466 encoding DNA sequences; 172 encoding DNA sequences synthesized from fifth-level sub-image; the number of encodings of color information U is as follows: fourth-level sub-image synthesis 468 encoding DNA sequences; fifth-level sub-image synthesis 168 encoding DNA sequences; saturation The number of codes for the degree information V is as follows: the four-level sub-image synthesizes 459 coding DNA sequences; the fifth-level sub-image synthesizes 166 coding DNA sequences. The total number of synthesized coding DNA sequences in Fig. 11 is 7,617. Compared with the currently recognized better coding technology (fountain code method), the coding efficiency of the present disclosure is 6.3 times that of the fountain code method. Similarly, the number of coefficients stored in DNA after wavelet transformation in Figure 12 is counted: the number of encodings of brightness information Y is as follows: 8906 encoding DNA sequences for secondary sub-image synthesis; 2470 encoding DNA sequences for tertiary sub-image synthesis; Four-level sub-image synthesis 624 encoding DNA sequences; fifth-level sub-image synthesis 260 encoding DNA sequences; the number of encodings of color information U is as follows: fourth-level sub-image synthesis 620 encoding DNA sequences; fifth-level sub-image synthesis 256 Encoding DNA sequence; the number of encodings of saturation information V is as follows: 612 encoding DNA sequences are synthesized from four-level sub-image; 246 encoding DNA sequences are synthesized from fifth-level sub-image. The total number of synthetic coding DNA sequences in Fig. 12 is 13,994. Compared with the currently recognized better coding technology (fountain code method), the coding efficiency of the present disclosure is 6.5 times that of the fountain code method.

Table 6 U information wavelet transform coefficient data of the five-level low-frequency horizontal sub-image

The image decoding method described in the present disclosure will be described in detail below with reference to FIG. 13. Fig. 13 is a method flowchart of an embodiment of an image decoding method provided by the present disclosure. Although the present disclosure provides method operation steps as shown in the following embodiments or drawings, more or less operation steps may be included in the method based on conventional or without creative labor. In steps where there is no necessary causality logically, the execution order of these steps is not limited to the execution order provided by the embodiments of the present disclosure.

Specifically, an embodiment of an image decoding method provided by the present disclosure is shown in FIG. 13, including:

Step S21: Obtain the coding DNA sequence of the original image;

Step S22, extracting the index marker base sequence and the DNA fragment sequence in the coding DNA sequence;

Step S23: Determine the wavelet transform coefficient of the sub-image according to the corresponding relationship between the index mark base sequence and the number and the corresponding relationship between the DNA fragment sequence and the number;

Step S24: Perform inverse wavelet transform on the wavelet transform coefficients to obtain a decoded image.

In the embodiment of the present disclosure, taking into account the influence of the DNA synthesis process, the coding DNA sequence of the original image may include several nucleic acid fragment structures. In an example, the nucleic acid fragment structure is shown in Table 5. For the fragment structure, the number of base sequences can be marked according to a preset index. For example, in Table 5, the first 20 nt is the flanking primer sequence, and 8-15 nt is the index coding sequence.

Table 7 Partial data of U information wavelet transform coefficient processing of five-level low-frequency horizontal sub-image

In the embodiment of the present disclosure, according to the corresponding relationship between the base sequence of the index mark and the number, in an example, the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment number of the DNA fragment, according to The corresponding relationship between the sub-image information and the DNA base sequence in the above embodiment includes the corresponding relationship between the row number of the DNA fragment and the base sequence as shown in Table 4, including the segment of the DNA fragment as shown in Table 2. The corresponding relationship between the number and the base sequence includes the decoding of the index mark into digital information as shown in Table 3. The same as the above embodiment, the sub-image information includes the level number of the sub-image, pixel information, and the sub-image Type tag. In an example, according to the corresponding relationship between the DNA fragment sequence and the number, the corresponding relationship between the DNA fragment sequence and the number is the same as that in the foregoing embodiment, and may include the corresponding relationship as in Table 1. The DNA fragments are decoded into digital information.

In an example, the decoded digital information of the sub-image, that is, the wavelet transform coefficient, is subjected to the inverse transform of the wavelet transform to obtain a decoded image.

Fig. 14 is a block diagram showing an image encoding device according to an exemplary embodiment. Refer to Figure 14, including:

The decomposition module 11 is configured to decompose the original image at one or more levels through a wavelet transform function to obtain wavelet transform coefficients corresponding to pixel data of multiple sub-images and the levels of the sub-images;

The processing module 12 is configured to determine the effective value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image corresponding to the wavelet transform coefficient;

The coding module 13 is used to determine the coding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value;

The connecting module 14 is configured to connect the coding DNA sequence of the wavelet transform coefficients according to the level of the sub-image to determine the coding DNA sequence of the original image.

Fig. 15 is a block diagram showing an encoding device according to an exemplary embodiment. 15, the processing module 12 includes:

The processing sub-module 121 is configured to divide the wavelet transform coefficient corresponding to the pixel data of the sub-image by the maximum absolute value of the wavelet transform coefficient corresponding to the pixel data of the sub-image according to the wavelet transform coefficient to obtain the first Numerical value

The determining sub-module 122 is configured to determine the effective value of the wavelet transform coefficient according to the first value and the level of the sub-image.

Fig. 16 is a block diagram showing an encoding device according to an exemplary embodiment. Referring to FIG. 16, the determining submodule 122 includes:

The first determining unit 1221 is configured to determine the effective number of digits of the first value according to the corresponding relationship between the level of the sub-image, pixel information, and the number of significant digits, where the pixel information includes pixel brightness and pixel chromaticity;

The second determining unit 1222 is configured to determine the effective value of the wavelet transform coefficient according to the effective number of bits of the first value.

In a possible implementation, the number is a decimal number.

Fig. 17 is a block diagram showing an encoding device according to an exemplary embodiment. Referring to FIG. 17, the encoding module 13 includes:

The first encoding sub-module 131 is configured to determine the number and symbol of the effective value, the corresponding relationship between the DNA base sequence and the number, and the corresponding relationship between the DNA base sequence and the symbol. Coding DNA sequence of wavelet transform coefficients.

In a possible implementation, the correspondence between the DNA base sequence and the number includes:

When the number of digits of the effective value is less than or equal to the preset value, the DNA base sequence and the number have a one-to-one correspondence;

When the number of digits of the effective value is greater than the preset value, wherein the high-order digits of the effective value that are less than or equal to the preset value have a one-to-one correspondence with the DNA base sequence, which is greater than the preset value. There is a many-to-one correspondence between the low digits of the value and the DNA base sequence.

In a possible implementation manner, the many-to-one correspondence relationship includes: multiple consecutive low-order digits correspond to the same base sequence.

Fig. 18 is a block diagram showing an encoding device according to an exemplary embodiment. Referring to FIG. 18, the encoding module 13 includes:

The second encoding sub-module 132 is configured to sequentially encode the DNA base sequence corresponding to the effective value according to the corresponding relationship between the DNA base sequence and the number and the effective value;

The third encoding sub-module 133, when N consecutive identical numbers appear in the effective value, (N≥2), encode according to the format "base sequence corresponding to the same number, DNA base sequence corresponding to N" , Determine the coding DNA sequence of the wavelet transform coefficient.

Fig. 19 is a block diagram showing an encoding device according to an exemplary embodiment. 19, the connection module 14 includes:

The connection sub-module 141 is configured to sequentially connect the coding DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images according to the sub-image level order to determine the coding DNA sequence of the original image.

Fig. 20 is a block diagram showing an encoding device according to an exemplary embodiment. 20, the connection sub-module 141 includes:

The first processing unit 1411 is configured to sequentially display the wavelet transform coefficients corresponding to the pixel data of the sub-image according to the format "level number + preset base label + maximum absolute value + level number + preset base label" Adding the DNA base sequence corresponding to the largest absolute value in the wavelet transform coefficient before the corresponding coding DNA sequence to obtain the coding DNA sequence of the sub-image;

The first connecting unit 1412 sequentially connects the coding DNA sequences of the sub-images according to the sub-image level order to determine the coding DNA sequences of the original image.

Fig. 21 is a block diagram showing an encoding device according to an exemplary embodiment. Referring to FIG. 21, the connection sub-module 141 includes:

The second connecting unit 1413 is configured to sequentially connect the encoded DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images in the order of the sub-image levels;

The second processing unit 1414 is configured to cut the linked coding DNA sequence into M rows of DNA subsequences (M≥1) according to the preset length value;

The third processing unit 1415 is configured to cut the DNA subsequence into X DNA fragments (X≥1) according to the preset width value;

The adding unit 1416 is configured to add a base sequence corresponding to an index mark to the DNA fragment, and the index mark includes sub-image information corresponding to the DNA fragment and the line number and segment number of the DNA fragment.

In a possible implementation manner, the sub-image information includes: a level number of the sub-image, pixel information, and a type mark of the sub-image.

In a possible implementation manner, the adding unit 1416 includes:

The adding subunit 1417 is used to add the base sequence corresponding to the index mark at the front and back ends of the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment of the DNA fragment number.

Fig. 22 is a block diagram showing a decoding device according to an exemplary embodiment. Refer to Figure 22, including:

The obtaining module 21 is used to obtain the coding DNA sequence of the original image;

The extraction module 22 is configured to extract the index-mark base sequence and the DNA fragment sequence in the coding DNA sequence according to the preset number of index-mark base sequence bits;

The determining module 23 is configured to determine the wavelet transform coefficient of the sub-image according to the corresponding relationship between the index mark base sequence and the number and the corresponding relationship between the DNA fragment sequence and the number;

The transform module 24 is configured to perform the inverse transform of the wavelet transform on the wavelet transform coefficients to obtain a decoded image.

Regarding the device in the foregoing embodiment, the specific manner in which each module performs the operation has been described in detail in the embodiment of the method, and detailed description will not be given here.

In a possible implementation manner, an image storage method is provided, including:

According to the image encoding method of any embodiment, encoding the original picture into a DNA sequence;

Synthesize nucleic acid fragments from the DNA sequence by a DNA synthesizer;

The nucleic acid fragments are stored in one or more of the following media, the media including gene chips, plasmids or living cells.

In the embodiments of the present disclosure, an oligonucleotide synthesizer can be used to add flanking primer sequences to the front and back ends of the DNA sequence, and to synthesize nucleic acid fragments, and store the nucleic acid fragments in gene chips, plasmids or gene chips by molecular biology means. In living cells, the storage of the image in DNA is completed.

In a possible implementation manner, an image reading method is provided, including:

Get nucleic acid fragments,

Obtain the DNA base sequence of the nucleic acid fragments by a DNA sequencer;

According to the image decoding method according to any embodiment of the present disclosure, the nucleic acid fragment is decoded into image data.

In the embodiments of the present disclosure, the nucleic acid fragments can be extracted from gene chips, plasmids or living cells by means of amplification and sequencing. In one example, if only thumbnails of the images are needed, not all In the case of large image information, the base sequence corresponding to the low-frequency sub-image can be marked with the index to decode and restore to realize random reading of the image.

Fig. 23 is a block diagram showing a device 800 for image encoding according to an exemplary embodiment, and Fig. 23 is also applicable to an image decoding device. For example, the device 800 may be a mobile phone, a computer, a digital broadcasting terminal, a messaging device, a game console, a tablet device, a medical device, a fitness device, a personal digital assistant, etc.

23, the device 800 may include one or more of the following components: a processing component 802, a memory 804, a power supply component 806, a multimedia component 808, an audio component 810, an input/output (I/O) interface 812, a sensor component 814, And the communication component 816.

The processing component 802 generally controls the overall operations of the device 800, such as operations associated with display, telephone calls, data communications, camera operations, and recording operations. The processing component 802 may include one or more processors 820 to execute instructions to complete all or part of the steps of the foregoing method. In addition, the processing component 802 may include one or more modules to facilitate the interaction between the processing component 802 and other components. For example, the processing component 802 may include a multimedia module to facilitate the interaction between the multimedia component 808 and the processing component 802.

The memory 804 is configured to store various types of data to support operations in the device 800. Examples of these data include instructions for any application or method operating on the device 800, contact data, phone book data, messages, pictures, videos, etc. The memory 804 can be implemented by any type of volatile or nonvolatile storage device or a combination thereof, such as static random access memory (SRAM), electrically erasable programmable read-only memory (EEPROM), erasable Programmable Read Only Memory (EPROM), Programmable Read Only Memory (PROM), Read Only Memory (ROM), Magnetic Memory, Flash Memory, Magnetic Disk or Optical Disk.

The power supply component 806 provides power to various components of the device 800. The power supply component 806 may include a power management system, one or more power supplies, and other components associated with generating, managing, and distributing power for the device 800.

The multimedia component 808 includes a screen that provides an output interface between the device 800 and the user. In some embodiments, the screen may include a liquid crystal display (LCD) and a touch panel (TP). If the screen includes a touch panel, the screen may be implemented as a touch screen to receive input signals from the user. The touch panel includes one or more touch sensors to sense touch, sliding, and gestures on the touch panel. The touch sensor may not only sense the boundary of a touch or slide action, but also detect the duration and pressure related to the touch or slide operation. In some embodiments, the multimedia component 808 includes a front camera and/or a rear camera. When the device 800 is in an operation mode, such as a shooting mode or a video mode, the front camera and/or the rear camera can receive external multimedia data. Each front camera and rear camera can be a fixed optical lens system or have focal length and optical zoom capabilities.

The audio component 810 is configured to output and/or input audio signals. For example, the audio component 810 includes a microphone (MIC), and when the device 800 is in an operation mode, such as a call mode, a recording mode, and a voice recognition mode, the microphone is configured to receive external audio signals. The received audio signal may be further stored in the memory 804 or transmitted via the communication component 816. In some embodiments, the audio component 810 further includes a speaker for outputting audio signals.

The I/O interface 812 provides an interface between the processing component 802 and a peripheral interface module. The peripheral interface module may be a keyboard, a click wheel, a button, and the like. These buttons may include but are not limited to: home button, volume button, start button, and lock button.

The sensor component 814 includes one or more sensors for providing the device 800 with various aspects of status assessment. For example, the sensor component 814 can detect the on/off status of the device 800 and the relative positioning of the components. For example, the component is the display and the keypad of the device 800. The sensor component 814 can also detect the position change of the device 800 or a component of the device 800. , The presence or absence of contact between the user and the device 800, the orientation or acceleration/deceleration of the device 800, and the temperature change of the device 800. The sensor component 814 may include a proximity sensor configured to detect the presence of nearby objects when there is no physical contact. The sensor component 814 may also include a light sensor, such as a CMOS or CCD image sensor, for use in imaging applications. In some embodiments, the sensor component 814 may also include an acceleration sensor, a gyroscope sensor, a magnetic sensor, a pressure sensor or a temperature sensor.

The communication component 816 is configured to facilitate wired or wireless communication between the device 800 and other devices. The device 800 can access a wireless network based on a communication standard, such as WiFi, 2G, or 3G, or a combination thereof. In an exemplary embodiment, the communication component 816 receives a broadcast signal or broadcast related information from an external broadcast management system via a broadcast channel. In an exemplary embodiment, the communication component 816 further includes a near field communication (NFC) module to facilitate short-range communication. For example, the NFC module can be implemented based on radio frequency identification (RFID) technology, infrared data association (IrDA) technology, ultra-wideband (UWB) technology, Bluetooth (BT) technology and other technologies.

In an exemplary embodiment, the apparatus 800 may be implemented by one or more application specific integrated circuits (ASIC), digital signal processors (DSP), digital signal processing equipment (DSPD), programmable logic devices (PLD), field programmable A gate array (FPGA), controller, microcontroller, microprocessor, or other electronic components are implemented to implement the above methods.

In an exemplary embodiment, there is also provided a non-transitory computer-readable storage medium including instructions, such as the memory 804 including instructions, which can be executed by the processor 820 of the device 800 to complete the foregoing method. For example, the non-transitory computer-readable storage medium may be ROM, random access memory (RAM), CD-ROM, magnetic tape, floppy disk, optical data storage device, etc.

Fig. 24 is a block diagram showing a device 1900 for image encoding according to an exemplary embodiment, and Fig. 23 is also applicable to an image decoding device. For example, the device 1900 may be provided as a server. 24, the apparatus 1900 includes a processing component 1922, which further includes one or more processors, and a memory resource represented by a memory 1932, for storing instructions that can be executed by the processing component 1922, such as application programs. The application program stored in the memory 1932 may include one or more modules each corresponding to a set of instructions. In addition, the processing component 1922 is configured to execute instructions to perform the above methods.

The device 1900 may also include a power component 1926 configured to perform power management of the device 1900, a wired or wireless network interface 1950 configured to connect the device 1900 to the network, and an input output (I/O) interface 1958. The device 1900 can operate based on an operating system stored in the memory 1932, such as Windows ServerTM, Mac OS XTM, UnixTM, LinuxTM, FreeBSDTM or the like.

In an exemplary embodiment, there is also provided a non-transitory computer-readable storage medium including instructions, such as the memory 1932 including instructions, which may be executed by the processing component 1922 of the device 1900 to complete the foregoing method. For example, the non-transitory computer-readable storage medium may be ROM, random access memory (RAM), CD-ROM, magnetic tape, floppy disk, optical data storage device, etc.

Those skilled in the art will easily think of other embodiments of the present disclosure after considering the specification and practicing the invention disclosed herein. This application is intended to cover any variations, uses, or adaptive changes of the present disclosure, which follow the general principles of the present disclosure and include common knowledge or conventional technical means in the technical field not disclosed in the present disclosure . The description and the embodiments are to be regarded as exemplary only, and the true scope and spirit of the present disclosure are pointed out by the following claims.

It should be understood that the present disclosure is not limited to the precise structure that has been described above and shown in the drawings, and various modifications and changes can be made without departing from its scope. The scope of the present disclosure is limited only by the appended claims.

Claims (34)

1. An image coding method, characterized by comprising:

   The original image is decomposed at one level or multiple levels through the wavelet transform function to obtain wavelet transform coefficients corresponding to the pixel data of multiple sub-images and the levels of the sub-images;

   Determining the effective value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image corresponding to the wavelet transform coefficient;

   Determining the coding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value;

   According to the level of the sub-image, the coding DNA sequence of the wavelet transform coefficient is connected to determine the coding DNA sequence of the original image.
2. The method according to claim 1, wherein the determining the effective value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image corresponding to the wavelet transform coefficient comprises:

   According to the wavelet transform coefficient, dividing the wavelet transform coefficient corresponding to the pixel data of the sub-image by the maximum absolute value of the wavelet transform coefficient corresponding to the pixel data of the sub-image to obtain a first value;

   Determine the effective value of the wavelet transform coefficient according to the first value and the level of the sub-image.
3. The method according to claim 2, wherein the determining the effective value of the wavelet transform coefficient according to the first value and the level of the sub-image comprises:

   Determining the effective number of digits of the first value according to the corresponding relationship between the level of the sub-image, pixel information, and the number of significant digits, where the pixel information includes pixel brightness, pixel chroma, and pixel saturation;

   According to the effective number of digits of the first value, the effective value of the wavelet transform coefficient is determined.
4. The method according to claim 1, wherein the number is a decimal number.
5. The method according to claim 1, wherein the determining the coding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value comprises:

   Determine the coding DNA sequence of the wavelet transform coefficient according to the number and symbol of the effective value, the corresponding relationship between the DNA base sequence and the number, and the corresponding relationship between the DNA base sequence and the symbol.
6. The method of claim 1, wherein the corresponding relationship between the DNA base sequence and the number comprises:

   When the number of digits of the effective value is less than or equal to the preset value, the DNA base sequence and the number have a one-to-one correspondence;

   When the number of digits of the effective value is greater than the preset value, wherein the high-order digits of the effective value that are less than or equal to the preset value have a one-to-one correspondence with the DNA base sequence, which is greater than the preset value. There is a many-to-one correspondence between the low digits of the value and the DNA base sequence.
7. The method according to claim 6, wherein the many-to-one correspondence relationship comprises: a plurality of consecutive low-order digits correspond to the same base sequence.
8. The method according to claim 1, wherein the determining the coding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value comprises:

   According to the corresponding relationship between the DNA base sequence and the number and the effective value, sequentially code the DNA base sequence corresponding to the effective value;

   When N consecutive identical numbers appear in the effective value, (N≥2), code according to the format "base sequence corresponding to the same number, DNA base sequence corresponding to N" to determine the wavelet transform coefficient The coding DNA sequence.
9. The method according to claim 1, wherein, according to the level of the sub-image, connecting the coding DNA sequence of the wavelet transform coefficients to determine the coding DNA sequence of the original image comprises:

   According to the sub-image level sequence, the coding DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images are sequentially connected to determine the coding DNA sequence of the original image.
10. The method according to claim 9, wherein the encoding DNA sequence corresponding to the wavelet transform coefficient corresponding to the pixel data of the sub-image is sequentially connected according to the sub-image level order to determine the original image The coding DNA sequence includes:

    According to the format "level number+preset base label+maximum absolute value+level number+preset base label", in sequence before the coding DNA sequence corresponding to the wavelet transform coefficient corresponding to the pixel data of the sub-image Adding the DNA base sequence corresponding to the largest absolute value in the wavelet transform coefficient to obtain the coding DNA sequence of the sub-image;

    According to the sub-image level sequence, the coding DNA sequences of the sub-images are sequentially connected to determine the coding DNA sequence of the original image.
11. The method according to claim 9, wherein the coding DNA sequence corresponding to the wavelet transform coefficient corresponding to the pixel data of the sub-image is sequentially connected according to the sub-image level order to determine the coding of the original image DNA sequence, including:

    According to the sub-image level order, sequentially connect the coding DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images;

    According to the preset length value, cutting the ligated coding DNA sequence into M rows of DNA subsequences (M≥1);

    According to the preset width value, cut the DNA subsequence into X DNA fragments (X≥1);

    The base sequence corresponding to the index mark is added to the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment number of the DNA fragment.
12. The method according to claim 11, wherein the sub-image information comprises: a level number of the sub-image, pixel information, and a type mark of the sub-image.
13. The method according to claim 11, wherein the base sequence corresponding to an index mark is added to the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number of the DNA fragment. Segment number, including:

    The base sequence corresponding to the index mark is added to the front and back ends of the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment number of the DNA fragment.
14. The method according to claim 1, further comprising: an image decoding method, the image decoding method comprising:

    Acquiring the coding DNA sequence of the original image;

    Extracting the index-marking base sequence and the DNA fragment sequence in the coding DNA sequence according to the preset number of index-marking base sequence bits;

    Determining the wavelet transform coefficient of the sub-image according to the corresponding relationship between the index mark base sequence and the number and the corresponding relationship between the DNA fragment sequence and the number;

    Perform the inverse transform of the wavelet transform on the wavelet transform coefficients to obtain a decoded image.
15. An image coding device, characterized by comprising:

    The decomposition module is used to decompose the original image at one or more levels through a wavelet transform function to obtain wavelet transform coefficients corresponding to pixel data of multiple sub-images and the levels of the sub-images;

    A processing module, configured to determine the effective value of the wavelet transform coefficient according to the wavelet transform coefficient and the level of the sub-image corresponding to the wavelet transform coefficient;

    An encoding module for determining the encoding DNA sequence of the wavelet transform coefficient according to the corresponding relationship between the DNA base sequence and the number and the effective value;

    The connection module is used to connect the coding DNA sequence of the wavelet transform coefficient according to the level of the sub-image to determine the coding DNA sequence of the original image.
16. The device according to claim 15, wherein the processing module comprises:

    The processing sub-module is configured to divide the wavelet transform coefficient corresponding to the pixel data of the sub-image by the maximum absolute value of the wavelet transform coefficient corresponding to the pixel data of the sub-image according to the wavelet transform coefficient to obtain a first value ；

    The determining sub-module is configured to determine the effective value of the wavelet transform coefficient according to the first value and the level of the sub-image.
17. The device according to claim 16, wherein the determining sub-module comprises:

    The first determining unit is configured to determine the effective number of digits of the first value according to the corresponding relationship between the level of the sub-image, pixel information, and the number of significant digits. The pixel information includes pixel brightness, pixel chroma, and pixel saturation;

    The second determining unit is configured to determine the effective value of the wavelet transform coefficient according to the effective number of bits of the first value.
18. The device according to claim 15, wherein the number is a decimal number.
19. The device according to claim 15, wherein the encoding module comprises:

    The first coding sub-module is used to determine the wavelet based on the number and symbol of the effective value, the corresponding relationship between the DNA base sequence and the number, and the corresponding relationship between the DNA base sequence and the symbol The DNA sequence encoding the transformation coefficients.
20. The device according to claim 15, wherein the corresponding relationship between the DNA base sequence and the number comprises:

    When the number of digits of the effective value is less than or equal to the preset value, the DNA base sequence and the number have a one-to-one correspondence;

    When the number of digits of the effective value is greater than the preset value, wherein the high-order digits of the effective value that are less than or equal to the preset value have a one-to-one correspondence with the DNA base sequence, which is greater than the preset value. There is a many-to-one correspondence between the low digits of the value and the DNA base sequence.
21. The device according to claim 20, wherein the many-to-one correspondence relationship comprises: a plurality of consecutive low-order digits correspond to the same base sequence.
22. The device according to claim 15, wherein the encoding module comprises:

    The second encoding sub-module is used to sequentially encode the DNA base sequence corresponding to the effective value according to the corresponding relationship between the DNA base sequence and the number and the effective value;

    The third coding sub-module, when N consecutive identical numbers appear in the effective value, (N≥2), code according to the format "base sequence corresponding to the same number, DNA base sequence corresponding to N", Determine the coding DNA sequence of the wavelet transform coefficients.
23. The device according to claim 15, wherein the connection module comprises:

    The connection sub-module is configured to sequentially connect the coding DNA sequence corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-image according to the sub-image level order to determine the coding DNA sequence of the original image.
24. The device according to claim 23, wherein the connection submodule comprises:

    The first processing unit is configured to sequentially correspond to the wavelet transform coefficients corresponding to the pixel data of the sub-image according to the format "level number + preset base label + maximum absolute value + level number + preset base label" Adding the DNA base sequence corresponding to the largest absolute value in the wavelet transform coefficient before the coding DNA sequence to obtain the coding DNA sequence of the sub-image;

    The first connecting unit sequentially connects the coding DNA sequences of the sub-images according to the sub-image level order to determine the coding DNA sequences of the original image.
25. The device according to claim 23, wherein the connection submodule comprises:

    The second connecting unit is configured to sequentially connect the coded DNA sequences corresponding to the wavelet transform coefficients corresponding to the pixel data of the sub-images in the order of the sub-image levels;

    The second processing unit is configured to cut the linked coding DNA sequence into M rows of DNA subsequences (M≥1) according to the preset length value;

    The third processing unit is configured to cut the DNA subsequence into X DNA fragments (X≥1) according to the preset width value;

    The adding unit is used to add the base sequence corresponding to the index mark to the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment number of the DNA fragment.
26. The device according to claim 25, wherein the sub-image information comprises: a level number of the sub-image, pixel information, and a type mark of the sub-image.
27. The device according to claim 25, wherein the adding unit comprises:

    The adding subunit is used to add the base sequence corresponding to the index mark at the front and back ends of the DNA fragment, and the index mark includes the sub-image information corresponding to the DNA fragment and the row number and segment number of the DNA fragment .
28. The device according to claim 25, further comprising an image decoding device, the image decoding device comprising:

    An acquisition module for acquiring the coding DNA sequence of the original image;

    The extraction module is used to extract the index mark base sequence and the DNA fragment sequence in the coding DNA sequence according to the preset number of index mark base sequence bits;

    The determining module is configured to determine the wavelet transform coefficient of the sub-image according to the corresponding relationship between the index mark base sequence and the number and the corresponding relationship between the DNA fragment sequence and the number;

    The transform module is used to perform the inverse transform of the wavelet transform on the wavelet transform coefficients to obtain a decoded image.
29. An image storage method, characterized in that it comprises:

    The method according to any one of claims 1 to 13, encoding the original picture into a DNA sequence;

    Synthesize nucleic acid fragments from the DNA sequence by a DNA synthesizer;

    The nucleic acid fragments are stored in one or more of the following media, the media including gene chips, plasmids or living cells.
30. An image reading method, characterized by comprising:

    Get nucleic acid fragments,

    Obtain the DNA base sequence of the nucleic acid fragments by a DNA sequencer;

    The image decoding method according to claim 14, wherein the nucleic acid fragment is decoded into image data.
31. An image coding device, characterized by comprising:

    processor;

    A memory for storing processor executable instructions;

    Wherein, the processor is configured to execute the method according to any one of claims 1-13.
32. An image decoding device, characterized by comprising:

    processor;

    A memory for storing processor executable instructions;

    Wherein, the processor is configured to execute the method according to any one of claims 14.
33. A non-transitory computer-readable storage medium, when the instructions in the storage medium are executed by a processor, so that the processor can execute the method according to any one of claims 1 to 13.
34. A non-transitory computer-readable storage medium, when the instructions in the storage medium are executed by a processor, so that the processor can execute the method according to any one of claims 14.

Images