WO2020181180A1 - Éditeurs de base a:t en c:g et leurs utilisations - Google Patents

Éditeurs de base a:t en c:g et leurs utilisations Download PDF

Info

Publication number
WO2020181180A1
WO2020181180A1 PCT/US2020/021362 US2020021362W WO2020181180A1 WO 2020181180 A1 WO2020181180 A1 WO 2020181180A1 US 2020021362 W US2020021362 W US 2020021362W WO 2020181180 A1 WO2020181180 A1 WO 2020181180A1
Authority
WO
WIPO (PCT)
Prior art keywords
fusion protein
cas9
oxidase
sequence
seq
Prior art date
Application number
PCT/US2020/021362
Other languages
English (en)
Inventor
David R. Liu
Jordan Leigh DOMAN
Jaron August McClure MERCER
Original Assignee
The Broad Institute, Inc.
President And Fellows Of Harvard College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Broad Institute, Inc., President And Fellows Of Harvard College filed Critical The Broad Institute, Inc.
Publication of WO2020181180A1 publication Critical patent/WO2020181180A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/11—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/11—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
    • C12Y114/11033—DNA oxidative demethylase (1.14.11.33)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Definitions

  • Targeted editing of nucleic acid sequences is a highly promising approach for the study of gene function and also has the potential to provide new therapies for genetic diseases, including those caused by point mutations.
  • Point mutations represent the majority of known human genetic variants associated with disease. Developing robust methods to introduce and correct point mutations is therefore important in understanding and treating diseases with a genetic component.
  • Base editing involves the conversion of a specific nucleic acid base into another at a targeted genomic locus. For certain approaches, this can be achieved without requiring double-stranded DNA breaks (DSB). Since many genetic diseases arise from point mutations, this technology has important implications in the study of human health and disease. Engineered base editors are capable of editing many targets with high efficiency, often achieving editing of 30-70% of cells following a single treatment, without selective enrichment of the cell population for editing events.
  • DSB double-stranded DNA breaks
  • Base editors are typically fusions of a Cas (“CRISPR-associated”) domain and a nucleobase modification domain (e.g., a natural or evolved deaminase, such as a cytidine deaminase that include APOBEC1 (“apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1”), CDA (“cytidine deaminase”), and ATP (“activation-induced cytidine deaminase”)) domains.
  • base editors may also include proteins or domains that alter cellular DNA repair processes to increase the efficiency and/or stability of the resulting single-nucleotide change.
  • C-to-T base editors use a cytidine deaminase to convert cytidine to uridine in the single-stranded DNA loop created by the Cas9 (“CRISPR- associated protein 9”) domain.
  • the opposite strand is nicked by Cas9 to stimulate DNA repair mechanisms that use the edited strand as a template, while a fused uracil glycosylase inhibitor slows excision of the edited base.
  • DNA repair leads to a C:G to T:A base pair conversion.
  • This class of base editor is described in U.S. Patent Publication No. 2017/0121693, published May 4, 2017, which issued on January 1, 2019 as U.S. Patent No. 10,167,457, which is incorporated by reference in its entirety herein.
  • a major limitation of base editing is the inability to generate transversion (purine ⁇ - pyrimidine) changes, which are needed to correct -38% of known human pathogenic SNPs. See Komor, A.C. et al, Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage, Nature 533, 420-424 (2016) and Landrum, M.J. et al, ClinVar: public archive of relationships among sequence variation and human phenotype, Nucleic Acids Res. 42, D980-985 (2014), each of which is incorporated by reference. Of this -38% of known pathogenic SNPs, about 15% arise from C:G to A:T mutations. Many C:G to A:T point mutations introduce premature stop codons (UAA, UAG, UGA), resulting in nonsense mutations in protein coding regions.
  • transversions can only be repaired by nuclease-mediated formation of a double-stranded break (DSB) followed by homology directed repair (HDR), which is typically inefficient, especially in non-mitotic cells, and leads to undesired by-products, such as indels (insertions and deletions) and translocations.
  • DLB double-stranded break
  • HDR homology directed repair
  • transversion base editors requires the development of a new editing strategy, such as the manipulation of endogenous DNA repair pathways or a different nucleobase chemical transformation.
  • the present disclosure describes novel transversion base editors using an innovative adenine oxidation strategy.
  • the present invention greatly expands the capabilities of base editing.
  • the present disclosure provides transversion base editors which add to the repertoire of base editors that have already been developed.
  • the present disclosure provides for adenine-to-cytosine or“ACBE” (or thymine-to-guanine or“TGBE”)
  • transversion base editors which satisfies the need in the art for the installation of targeted single-base transversion nucleobase changes in a target nucleotide sequence, e.g., a genome.
  • the present disclosure provides for nucleic acid molecules encoding and/or expressing these transversion base editors, as well as expression vectors or constructs for expressing the transversion base editors described herein, host cells comprising said nucleic acid molecules and expression vectors, and compositions for delivering and/or administering nucleic acid-based embodiments described herein.
  • the disclosure provides for compositions comprising these transversion base editors.
  • the present disclosure provides for methods of making adenine-to-cytosine transversion base editors, as well as methods of using adenine-to-cytosine transversion base editors or nucleic acid molecules encoding such transversion base editors in applications including editing a nucleic acid molecule, e.g., a genome.
  • the present inventors have discovered strategies to develop novel transversion base editors. Specifically, the inventors have developed a novel adenine oxidation strategy to install transversion A-to-C and T-to-G nucleobase changes in a targeted manner. This new strategy allows for the efficient and specific transversion of A-to-C or T-to-G using the inventive base editors described herein.
  • 8-oxoA is read by a polymerase as a cytosine and the cell’s mismatch repair machinery converts the base-paired thymine of the non-edited strand to a guanine to correct the apparent mismatch.
  • the resulting base pairing features two three-center hydrogen bonding systems.
  • the cell’s mismatch repair machinery converts the 8-oxoA lesion to a cytosine. A desired A-to-C transversion is thus achieved.
  • Adenine oxidation is achieved by the targeted use of a fusion protein comprising a napDNAbp (e.g., a catalytically dead Cas9 (“dCas9”) or Cas9 nickase (“nCas9”)) domain, an adenine oxidase domain, and optionally a linker connecting these two domains (see FIG. 1).
  • a napDNAbp e.g., a catalytically dead Cas9 (“dCas9”) or Cas9 nickase (“nCas9”)
  • adenine oxidase domain e.g., a catalytically dead Cas9 (“dCas9”) or Cas9 nickase (“nCas9”) domain
  • adenine oxidase domain e.g., a catalytically dead Cas9 (“dCas9”) or Cas9 nickase (“nCas9”) domain
  • the base editor fusion protein comprises (i) a nucleic acid
  • the nucleic acid programmable DNA binding protein (napDNAbp), and (ii) an adenine oxidase may be a Cas9 domain.
  • the napDNAbp may be a CasX, a CasY, a C2cl, a C2c2, a C2c3, a GeoCas9, a CjCas9, a Casl2a (formerly known as Cpfl), a Casl2b, a Casl2g, a Casl2h, a Casl2i, a Casl3b, a Casl3c, a Casl3d, a Casl4, a Csn2, an xCas9, an SpCas9-NG, an LbCasl2a, an AsCasl2a, a Cas9- KKH, a circularly permuted Cas9, an Ar
  • the adenine oxidase is a wild-type oxidase, or a variant thereof, that oxidizes an adenine in DNA to 8-oxoA.
  • the adenine oxidase comprises any one of the amino acid sequences of SEQ ID NOs: 5-8, 10, 15-20, 22-31, and 35-41. In particular embodiments, the adenine oxidase comprises any one of the amino acid sequences of SEQ ID NOs: 5-8, 10, 15- 20, 22-31, and 35-41. In particular embodiments, the adenine oxidase comprises the amino acid sequence of SEQ ID NO: 24.
  • a variant of the wild-type oxidase is produced by evolving an adenine oxidase enzyme using a directed evolution methodology.
  • the directed evolution methodology comprises phage assisted continuous evolution (PACE). In other embodiments, the evolution methodology comprises phage assisted non-continuous evolution (PANCE). In still other embodiments, the evolution methodology comprises other non-continuous evolutions, such as antibiotic or other discrete plate-based selections.
  • the fusion protein further comprises an inhibitor of base excision repair (“iBER”).
  • the iBER is a thymine-DNA glycosylase (TDG) inhibitor (“TDG inhibitor”), uracil-DNA glycosylase (UDG) inhibitor (“UDG inhibitor”), or an 8-oxo-guanine glycosylase (OGG or OGGI) inhibitor (“OGG inhibitor”).
  • TDG thymine-DNA glycosylase
  • UDG inhibitor uracil-DNA glycosylase
  • GOGG or OGGI 8-oxo-guanine glycosylase
  • the iBER comprises a catalytically inactive TDG that binds 8-oxoA to prevent its excision during subsequent mismatch repair.
  • the fusion proteins described herein may comprise any of the following structures: NH2-[adenine oxidase]-[napDNAbp]-COOH; or NH2-[napDNAbp]- [adenine oxidase] -COOH, wherein each instance of“]-[” comprises an optional linker.
  • the base editor fusion proteins described herein may comprise any of the following structures: Eh- [iBER] -[adenine oxidase]-[napDNAbp]-COOH; Nth-fadenine oxidase]-[iBER]- [napDNAbp]-COOH; NH 2 -[adenine oxidase] -[napDNAbp]- [iBER] -COOH; NH 2 -[iBER]- [adenine oxidase] -[napDNAbp] -COOH; NH2-[adenine oxidase]-[iBER]-[napDNAbp]- COOH; or NH2-[iBER]-[napDNAbp]-[adenine oxidase] -COOH, wherein each instance of “]-[” comprises an optional linker.
  • the linker fusing the napDNAbp, oxidase, and optional iBER may be any suitable amino acid linker sequence, polymer, or covalent bond.
  • exemplary linkers include any of the following amino acid sequences: SGGSSGGSSGS ETPGTS ES ATPES SGGSSGGS (SEQ ID NO: 11); SGGSGGSGGS (SEQ ID NO: 12); GGG; GGGS (SEQ ID NO: 1); SGGGS (SEQ ID NO: 2); SGSETPGTSESATPES (SEQ ID NO: 48); or SGGS (SEQ ID NO: 14).
  • the disclosure provides nucleic acid molecules or constructs encoding any of the base editor fusion proteins, or domains thereof.
  • the nucleic acid sequences may be codon-optimized for expression in the cells of any organism of interest. In certain embodiments, the nucleic acid sequence is codon-optimized for expression in human cells.
  • the disclosure provides polynucleotides and/or vectors encoding any of the base editor fusion proteins described herein, or domains thereof.
  • These nucleic acid sequences are typically engineered or modified experimentally.
  • these nucleic acid sequences may be codon-optimized for expression in an organism of interest, e.g., mammalian cells.
  • the nucleic acid sequences are codon-optimized for expression in human cells.
  • cells containing such polynucleotides or constructs are provided.
  • complexes comprising any of the fusion proteins described herein and a guide RNA bound to the napDNAbp domain of the fusion protein are provided.
  • the disclosure provides a pharmaceutical composition comprising any of the fusion proteins described herein and a pharmaceutically acceptable excipient.
  • the pharmaceutical composition further comprises a gRNA.
  • the disclosure provides a kit comprising a nucleic acid construct that includes (i) a nucleic acid sequence encoding any of the fusion proteins described herein; (ii) a heterologous promoter that drives expression of the sequence of (i); and optionally an expression construct encoding a guide RNA backbone and the target sequence.
  • methods for targeted nucleic acid editing typically comprise i) contacting a nucleic acid sequence with a complex comprising any of the fusion proteins described herein and a guide nucleic acid, wherein the double-stranded DNA comprises a target A:T (or T:A) nucleobase pair, and ii) editing the thymine (or adenine) of the A:T (or T:A) nucleobase pair.
  • the methods may further comprise iii) cutting or nicking the non-edited strand of the double- stranded DNA.
  • methods of treatment using the inventive base editors are provided.
  • the methods described herein may comprise treating a subject having or at risk of developing a disease, disorder, or condition, comprising administering to the subject a fusion protein as described herein, a polynucleotide as described herein, a vector as described herein, or a pharmaceutical composition as described herein.
  • FIG. 1 is a schematic illustration showing an exemplary fusion protein of the invention.
  • a fusion protein comprising an nCas9 domain linked to an adenine oxidase enzyme is targeted to the correct adenine nucleobase through the hybridization of a single guide RNA (“sgRNA”) to a complementary sequence of nucleic acid.
  • sgRNA single guide RNA
  • the adenine oxidase oxidizes the adenine to an 8-oxoadenine, and subsequently, the cell’s native replication/repair machinery recognizes the mutated base and effects the desired change to a cytosine nucleobase.
  • 8oA, 8-oxoadenine iBER, inhibitor of base excision repair
  • sgRNA single-guide RNA
  • PAM protospacer adjacent motif.
  • FIG. 2 depicts the chemical conversion of adenine to 8-oxoadenine, which disrupts existing hydrogen bonding with the thymine of the unmutated strand.
  • Steric rotation of the 8- oxoA around the glycosidic bond is induced, presenting the Hoogsteen edge for base pairing.
  • 8-oxoA is read by a polymerase as a cytosine, and the cell’s mismatch repair machinery converts the base-paired thymine of the non-edited strand to a guanine to correct the apparent mismatch.
  • the resulting base pairing features two three-center hydrogen bonding systems.
  • the cell’s mismatch repair machinery converts the 8-oxoA to a cytosine, thereby completing the desired A:T to C:G mutation.
  • FIG. 3 depicts a possible chemical mechanism for the a-ketoglutarate-dependent iron oxidase-mediated conversion of adenine to 8-oxoadenine.
  • An oxo group is transferred from a non-heme Fe(IV) center to the 8 position of adenine.
  • Formation of a 7,8-oxaziridine intermediate is induced, which rearranges spontaneously to the desired 8-oxoadenine.
  • FIG. 4 depicts an exemplary assay for selection of evolved variants of human
  • AlkBH3 a-ketoglutarate-dependent iron oxidase that are highly effective at oxidizing adenine.
  • Plasmids containing mutagenized AlkBH3-dCas9 fusion proteins and targeting guide RNAs (sgRNAs), and selection plasmids containing an inactivated spectinomycin resistance gene with a mutation at the active site that requires A:T to C:G editing to correct, are transformed into E. coli cells, which are plated onto agar media containing spectinomycin and sucrose.
  • Cells harboring plasmids with AlkBH3 mutants that restore antibiotic resistance are isolated and subjected to further rounds of mutation and selection under varying selection stringencies.
  • AlkBH3 variants emerging from each round of selection are then expressed within a fusion construct comprising a Cas9 nickase (nCas9). The resulting fusion proteins are tested for base editing activity in mammalian cells.
  • FIG. 5 depicts the operation of an inhibitor of base excision repair (iBER) domain in exemplary base editor fusion proteins disclosed herein.
  • iBER base excision repair
  • competitive base excision repair may interfere with 8-oxoadenine-mediated base editing.
  • an iBER is fused to to a fusion protein comprising an nCas9 domain and an adenine excision domain.
  • the iBER domain competes for binding of the 8-oxoadenine lesion with active, endogenous excision repair enzymes, preventing or slowing base excision repair.
  • oA oxoadenine
  • TDG thymine-DNA glycosylase
  • Pol d, RCA and RCNF are types of mammalian DNA polymerases.
  • the term“accessory plasmid,” as used herein, refers to a plasmid comprising a gene required for the generation of infectious viral particles under the control of a conditional promoter.
  • transcription from the conditional promoter of the accessory plasmid is typically activated, directly or indirectly, by a function of the gene to be evolved.
  • the accessory plasmid serves the function of conveying a competitive advantage to those viral vectors in a given population of viral vectors that carry a version of the gene to be evolved able to activate the conditional promoter or able to activate the conditional promoter more strongly than other versions of the gene to be evolved.
  • only viral vectors carrying an“activating” version of the gene to be evolved will be able to induce expression of the gene required to generate infectious viral particles in the host cell, and, thus, allow for packaging and propagation of the viral genome in the flow of host cells.
  • Vectors carrying non-activating versions of the gene to be evolved will not induce expression of the gene required to generate infectious viral vectors, and, thus, will not be packaged into viral particles that can infect fresh host cells.
  • Exemplary accessory plasmids have been described, for example in U.S. Application No. 15/567,312, published as U.S. Pub. No. 2018/0087046, filed on April 15, 2016, the entire contents of which is incorporated by reference herein.
  • “Base editing” is a genome editing technology that involves the conversion of a specific nucleic acid base into another at a targeted genomic locus. In certain embodiments, this can be achieved without requiring double- stranded DNA breaks (DSB).
  • DSB double- stranded DNA breaks
  • CRISPR-based systems begin with the introduction of a DSB at a locus of interest. Subsequently, cellular DNA repair enzymes mend the break, commonly resulting in random insertions or deletions (indels) of bases at the site of the DSB.
  • base-to-base changes there are 12 possible base-to-base changes that may occur via individual or sequential use of transition (i.e., a purine-to-purine change or pyrimidine-to- pyrimidine change) or transversion (i.e., a purine-to-pyrimidine or pyrimidine-to-purine) editors. These include:
  • C-to-T base editor (or“CTBE”). This type of editor converts a C:G Watson-Crick nucleobase pair to a T:A Watson-Crick nucleobase pair. Because the corresponding Watson-Crick paired bases are also interchanged as a result of the conversion, this category of base editor may also be referred to as a G-to-A base editor (or“GABE”).
  • A-to-G base editor (or“AGBE”). This type of editor converts a A:T Watson-Crick nucleobase pair to a G:C Watson-Crick nucleobase pair. Because the corresponding Watson-Crick paired bases are also interchanged as a result of the conversion, this category of base editor may also be referred to as a T-to-C base editor (or“TCBE”).
  • CGBE o C-to-G base editor
  • This type of editor converts a C:G Watson-Crick nucleobase pair to a G:C Watson-Crick nucleobase pair. Because the corresponding Watson-Crick paired bases are also interchanged as a result of the conversion, this category of base editor may also be referred to as a G-to-C base editor (or“GCBE”).
  • o G-to-T base editor (or“ACBE”). This type of editor converts a G:C Watson-Crick nucleobase pair to a T:A Watson-Crick nucleobase pair. Because the corresponding Watson-Crick paired bases are also interchanged as a result of the conversion, this category of base editor may also be referred to as a C-to-A base editor (or“CABE”).
  • A-to-T base editor (or“TGBE”). This type of editor converts a A:T Watson-Crick nucleobase pair to a T:A Watson-Crick nucleobase pair. Because the corresponding Watson-Crick paired bases are also interchanged as a result of the conversion, this category of base editor may also be referred to as a T-to-A base editor (or“ACBE”).
  • A-to-C base editor (or“ACBE”). This type of editor converts a A:T Watson-Crick nucleobase pair to a C:G Watson-Crick nucleobase pair. Because the corresponding Watson-Crick paired bases are also interchanged as a result of the conversion, this category of base editor may also be referred to as a T-to-G base editor (or“TGBE”).
  • the term“base editors (BEs)”, as used herein, refers to the Cas-fusion proteins described herein.
  • the fusion protein comprises a nuclease-inactive Cas9 (dCas9) fused to an adenine oxidase which binds a nucleic acid in a guide RNA- programmed manner via the formation of an R-loop but does not cleave the nucleic acid.
  • dCas9 nuclease-inactive Cas9
  • the dCas9 domain of the fusion protein may include a D10A and a H840A mutation (which renders Cas9 capable of cleaving only one strand of a nucleic acid duplex) as described in PCT/US2016/058344 (filed on October 22, 2016 and published as WO
  • the DNA cleavage domain of S. pyogenes Cas9 includes two subdomains, the HNH nuclease subdomain and the RuvCl subdomain.
  • the HNH subdomain cleaves the strand
  • the RuvCl mutant D10A generates a nick on the targeted strand
  • the HNH mutant H840A generates a nick on the non-targeted strand
  • the fusion protein comprises a Cas9 nickase fused to an adenine oxidase, e.g., an adenine oxidase which converts an adenine nucleobase to 8- oxoadenine.
  • base editors encompasses the base editors described herein as well as any base editor known or described in the art at the time of this filing or developed in the future. Reference is made to Rees & Liu, Base editing: precision chemistry on the genome and transcriptome of living cells, Nat Rev Genet. 2018;19(12):770-788; as well as.U.S. Patent Publication No. 2018/0073012, published March 15, 2018, which issued as U.S.
  • Cas9 or“Cas9 nuclease” or“Cas9 domain” refers to a CRISPR associated protein 9, or variant thereof, and embraces any naturally occurring Cas9 from any organism, any naturally-occurring Cas9, any Cas9 homolog, ortholog, or paralog from any organism, and any variant of a Cas9, naturally-occurring or engineered. More broadly, a Cas9 protein, domain, or domain is a type of“nucleic acid programmable DNA binding protein
  • Cas9 is not meant to be limiting and may be referred to as a“Cas9 or variant thereof.” Exemplary Cas9 proteins are described herein and also described in the art. The present disclosure is unlimited with regard to the particular Cas9 that is employed in the base editors of the invention.
  • proteins comprising Cas9 or fragments thereof are referred to as“Cas9 variants.”
  • a Cas9 variant shares homology to Cas9, or a fragment thereof.
  • Cas9 variants include functional fragments of Cas9.
  • a Cas9 variant is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to wild type Cas9.
  • the Cas9 variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32,
  • the Cas9 variant comprises a fragment of Cas9 (e.g., a gRNA binding domain or a DNA-cleavage domain), such that the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the corresponding fragment of wild type Cas9.
  • a fragment of Cas9 e.g., a gRNA binding domain or a DNA-cleavage domain
  • the fragment is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid length of a corresponding wild type Cas9.
  • dCas9 refers to a nuclease-inactive Cas9 or nuclease-dead Cas9, or a functional fragment or variant thereof, and embraces any naturally occurring dCas9 from any organism, any naturally-occurring dCas9 equivalent or functional fragment thereof, any dCas9 homolog, ortholog, or paralog from any organism, and any mutant or variant of a dCas9, naturally-occurring or engineered.
  • dCas9 is not meant to be particularly limiting and may be referred to as a“dCas9 or equivalent.”
  • Exemplary dCas9 proteins and method for making dCas9 proteins are further described herein and/or are described in the art and are incorporated herein by reference.
  • nCas9 or“Cas9 nickase” refers to a Cas9 or a functional fragment or variant thereof, which cleaves or nicks only one of the strands of a target cut site thereby introducing a nick in a double strand DNA molecule rather than creating a double strand break. This can be achieved by introducing appropriate mutations in a wild-type Cas9 which inactives one of the two endonuclease activities of the Cas9.
  • Any suitable mutation which inactivates one Cas9 endonuclease activity but leaves the other intact is contemplated, such as one of D10A or H840A mutations in the wild-type Cas9 amino acid sequence (e.g., SEQ ID NO: 9) may be used to form the nCas9.
  • the term“continuous evolution,” as used herein, refers to an evolution procedure, (e.g., PACE) in which a population of nucleic acids is subjected to multiple rounds of (a) replication, (b) mutation, and (c) selection to produce a desired evolved product, for example, a nucleic acid encoding a protein with a desired activity, wherein the multiple rounds can be performed without investigator interaction and wherein the processes under (a)-(c) can be carried out simultaneously.
  • the evolution procedure is carried out in vitro , for example, using cells in culture as host cells.
  • a continuous evolution process relies on a system in which a gene of interest is provided in a nucleic acid vector that undergoes a life-cycle including replication in a host cell and transfer to another host cell, wherein a critical component of the life-cycle is deactivated and reactivation of the component is dependent upon a desired mutation in the gene of interest.
  • a critical component of the life-cycle is deactivated and reactivation of the component is dependent upon a desired mutation in the gene of interest.
  • the nucleic acid vector comprising the gene of interest is a phage, a viral vector, or naked DNA (e.g., a mobilization plasmid).
  • transfer of the gene of interest from cell to cell is via infection, transfection, transduction, conjugation, or uptake of naked DNA, and efficiency of cell-to-cell transfer (e.g., transfer rate) is dependent on the activity of a product encoded by the gene of interest.
  • the nucleic acid vector is a phage harboring the gene of interest and the efficiency of phage transfer (via infection) is dependent on an activity of the gene of interest in that a protein required for the generation of phage particles (e.g., pill for M13 phage) is expressed in the host cells only in the presence of the desired activity of the gene of interest.
  • a protein required for the generation of phage particles e.g., pill for M13 phage
  • the nucleic acid vector is a retroviral vector, for example, a lentiviral or vesicular stomatitis virus vector harboring the gene of interest, and the efficiency of viral transfer from cell to cell is dependent on an activity of the gene of interest in that a protein required for the generation of viral particles (e.g., an envelope protein, such as VSV- g) is expressed in the host cells only in the presence of the desired activity of the gene of interest.
  • a retroviral vector for example, a lentiviral or vesicular stomatitis virus vector harboring the gene of interest
  • a protein required for the generation of viral particles e.g., an envelope protein, such as VSV- g
  • the nucleic acid vector is a DNA vector, for example, in the form of a mobilizable plasmid DNA, comprising the gene of interest, that is transferred between bacterial host cells via conjugation and the efficiency of conjugation-mediated transfer from cell to cell is dependent on the activity of the gene of interest in that a protein required for conjugation-mediated transfer (e.g., traA or traQ) is expressed in the host cells only in the presence of the desired activity of the gene of interest.
  • Host cells contain F plasmid lacking one or both of those genes.
  • some embodiments provide a continuous evolution system, in which a population of viral vectors comprising a gene of interest to be evolved replicates in a flow of host cells, e.g., a flow through a lagoon, wherein the viral vectors are deficient in a gene encoding a protein that is essential for the generation of infectious viral particles, and wherein that gene is comprised in the host cell under the control of a conditional promoter that can be activated by a gene product encoded by the gene of interest, or a mutated version thereof.
  • the activity of the conditional promoter depends on a desired function of a gene product encoded by the gene of interest.
  • Viral vectors in which the gene of interest has not acquired a mutation conferring the desired function, will not activate the conditional promoter, or only achieve minimal activation, while any mutation in the gene of interest that confers the desired mutation will result in activation of the conditional promoter. Since the conditional promoter controls an essential protein for the viral life cycle, activation of this promoter directly corresponds to an advantage in viral spread and replication for those vectors that have acquired an advantageous mutation.
  • CRISPR is a family of DNA sequences (i.e., CRISPR clusters) in bacteria and archaea that represent snippets of prior infections by a virus that have invaded the prokaryote.
  • the snippets of DNA are used by the prokaryotic cell to detect and destroy DNA from subsequent attacks by similar viruses and effectively constitute, along with an array of CRISPR-associated proteins (including Cas9 and homologs thereof) and CRISPR-associated RNA, a prokaryotic immune defense system.
  • CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA).
  • tracrRNA trans-encoded small RNA
  • me endogenous ribonuclease 3
  • Cas9 protein a trans-encoded small RNA
  • the tracrRNA serves as a guide for ribonuclease 3-aided processing of pre-crRNA.
  • Cas9/crRNA/tracrRNA endonucleolytic ally cleaves linear or circular nucleic acid target complementary to the RNA. Specifically, the target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3 '-5' exonucleolytically.
  • DNA-binding and cleavage typically requires protein and both RNAs.
  • single guide RNAs (“sgRNA”, or simply“gRNA”) can be engineered so as to incorporate embodiments of both the crRNA and tracrRNA into a single RNA species— the guide RNA. See, e.g., Jinek M., el al., Science 337:816-821(2012), the entire contents of which is herein incorporated by reference.
  • Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or protospacer adjacent motif) to help distinguish self versus non-self.
  • CRISPR biology, as well as Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g.,“Complete genome sequence of an Ml strain of Streptococcus pyogenes.” Ferretti J.J., el al, Proc. Natl. Acad. Sci. U.S.A.
  • Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier,“The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems” (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference.
  • an effective amount refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response.
  • an effective amount of a base editor may refer to the amount of the base editor that is sufficient to edit a target site nucleotide sequence, e.g., a genome.
  • an effective amount of a base editor provided herein e.g., of a fusion protein comprising a nuclease-inactive Cas9 domain and a nucleobase modification domain (e.g., an adenine oxidase domain) may refer to the amount of the fusion protein that is sufficient to induce editing of a target site specifically bound and edited by the fusion protein.
  • an effective amount of a base editor provided herein may refer to the amount of the fusion protein sufficient to induce editing having the following characteristics: > 50% product purity, ⁇ 5% indels, and an editing window of 2-8 nucleotides.
  • an agent e.g., a fusion protein, a nuclease, an adenine oxidase, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide
  • an agent e.g., a fusion protein, a nuclease, an adenine oxidase, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide
  • the desired biological response e.g., on the specific allele, genome, or target site to be edited, on the target cell or tissue (i.e., the cell or tissue to be edited)
  • the term“evolved base editor” or“evolved base editor variant” refers to a base editor formed as a result of mutagenizing a reference or starting-point base editor.
  • the term refers to embodiments in which the nucleobase modification domain is evolved or a separate domain is evolved.
  • Mutagenizing a reference or starting-point base editor may comprise mutagenizing an adenine oxidase— by a continuous evolution method (e.g., PACE), wherein the evolved adenine oxidase has one or more amino acid variations introduced into its amino acid sequence relative to the amino acid sequence of the adenine oxidase.
  • PACE continuous evolution method
  • Amino acid sequence variations may include one or more mutated residues within the amino acid sequence of a reference base editor, e.g., as a result of a change in the nucleotide sequence encoding the base editor that results in a change in the codon at any particular position in the coding sequence, the deletion of one or more amino acids (e.g., a truncated protein), the insertion of one or more amino acids, or any combination of the foregoing.
  • the evolved base editor may include variants in one or more components or domains of the base editor (e.g., variants introduced into an adenine oxidase domain, an iBER domain, or a variant introduced into combinations of these domains).
  • fusion protein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins.
  • One protein may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy-terminal (C-terminal) protein thus forming an“amino-terminal fusion protein” or a“carboxy-terminal fusion protein,” respectively.
  • a protein may comprise different domains, for example, a nucleic acid binding domain (e.g., the gRNA binding domain of Cas9 that directs the binding of the protein to a target site) and a nucleic acid cleavage domain or a catalytic domain of a nucleic-acid editing protein.
  • any of the proteins provided herein may be produced by any method known in the art.
  • the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker.
  • Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4 th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference.
  • a suitable host cell refers to a cell that can host, replicate, and transfer a phage vector useful for a continuous evolution process as provided herein.
  • a suitable host cell is a cell that can be infected by the viral vector, can replicate it, and can package it into viral particles that can infect fresh host cells.
  • a cell can host a viral vector if it supports expression of genes of viral vector, replication of the viral genome, and/or the generation of viral particles.
  • One criterion to determine whether a cell is a suitable host cell for a given viral vector is to determine whether the cell can support the viral life cycle of a wild-type viral genome that the viral vector is derived from.
  • a suitable host cell would be any cell that can support the wild-type M13 phage life cycle.
  • Suitable host cells for viral vectors useful in continuous evolution processes are well known to those of skill in the art, and the disclosure is not limited in this respect.
  • the viral vector is a phage and the host cell is a bacterial cell.
  • the host cell is an E. coll cell. Suitable E.
  • coli host strains will be apparent to those of skill in the art, and include, but are not limited to, New England Biolabs (NEB) Turbo, ToplOF’, DH12S, ER2738, ER2267, and XLl-Blue MRF’ . These strain names are art recognized and the genotype of these strains has been well characterized. It should be understood that the above strains are exemplary only and that the invention is not limited in this respect.
  • the host cell is a prokaryotic cell, for example, a bacterial cell.
  • the host cell is an E. coli cell.
  • the host cell is a eukaryotic cell, for example, a yeast cell, an insect cell, or a mammalian cell.
  • the type of host cell will, of course, depend on the viral vector employed, and suitable host cell/viral vector combinations will be readily apparent to those of skill in the art.
  • the host cells are E. coli cells expressing the Fertility factor, also commonly referred to as the F factor, sex factor, or F-plasmid.
  • the F-factor is a bacterial DNA sequence that allows a bacterium to produce a sex pilus necessary for conjugation and is essential for the infection of E. coli cells with certain phage, for example, with M13 phage.
  • the host cells for M13-PACE are of the genotype F'proA + B +
  • AlacIZYA araD139 A(ara,leu)7697 mcrA
  • linker refers to a chemical group or a molecule linking two molecules or domains, e.g., nCas9 and an adenine oxidase or adenine oxidase.
  • a linker joins a dCas9 and modification domain (e.g., an adenine oxidase).
  • the linker is positioned between, or flanked by, two groups, molecules, or other domains and connected to each one via a covalent bond, thus connecting the two.
  • the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein).
  • the linker is an organic molecule, group, polymer, or chemical domain. Chemical domains include, but are not limited to, disulfide, hydrazone, thiol and azo domains.
  • the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated.
  • mutation refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue; a deletion or insertion of one or more residues within a sequence; or a substitution of a residue within a sequence of a genome in a subject to be corrected. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue.
  • Mutations can include a variety of categories, such as single base polymorphisms, microduplication regions, indel, and inversions, and is not meant to be limiting in any way. Mutations can include“loss-of- function” mutations which is the normal result of a mutation that reduces or abolishes a protein activity.
  • loss-of-function mutations are recessive, because in a heterozygote the second chromosome copy carries an unmutated version of the gene coding for a fully functional protein whose presence compensates for the effect of the mutation. There are some exceptions where a loss-of-function mutation is dominant, one example being
  • haploinsufficiency where the organism is unable to tolerate the approximately 50% reduction in protein activity suffered by the heterozygote.
  • Mutations also embrace“gain-of-function” mutations, which is one which confers an abnormal activity on a protein or cell that is otherwise not present in a normal condition.
  • Many gain-of-function mutations are in regulatory sequences rather than in coding regions, and can therefore have a number of consequences. For example, a mutation might lead to one or more genes being expressed in the wrong tissues, these tissues gaining functions that they normally lack. Alternatively the mutation could lead to overexpression of one or more genes involved in control of the cell cycle, thus leading to uncontrolled cell division and hence to cancer. Because of their nature, gain-of-function mutations are usually dominant.
  • nucleic acid molecules or polypeptides e.g., Cas9 or adenine oxidases
  • nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and/or as found in nature (e.g., an amino acid sequence not found in nature).
  • nucleic acid refers to RNA as well as single and/or double-stranded DNA. Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, siRNA, snRNA, a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule.
  • a nucleic acid molecule may be a non-naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA/RNA hybrid, or including non-naturally occurring nucleotides or nucleosides.
  • the terms“nucleic acid,”“DNA,”“RNA,” and/or similar terms include nucleic acid analogs, e.g., analogs having other than a phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc.
  • nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications.
  • a nucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated.
  • a nucleic acid is or comprises natural nucleosides (e.g.
  • nucleoside analogs e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, 2-aminoadenosine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenine, 8-oxoguanosine, 0(6)-methylguanine, and 2-thiocytidine);
  • biologically modified bases e.g., methylated bases
  • intercalated bases modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and/or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages).
  • modified sugars e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose
  • modified phosphate groups e.g., phosphorothioates and 5'-N-phosphoramidite linkages
  • nucleic acid programmable D/RNA binding protein refers to any protein that may associate (e.g., form a complex) with one or more nucleic acid molecules (i.e., which may broadly be referred to as a“napR/DNAbp-programming nucleic acid molecule” and includes, for example, guide RNA in the case of Cas systems) which direct or otherwise program the protein to localize to a specific target nucleotide sequence (e.g., a gene locus of a genome) that is complementary to the one or more nucleic acid molecules (or a portion or region thereof) associated with the protein, thereby causing the protein to bind to the nucleotide sequence at the specific target site.
  • a specific target nucleotide sequence e.g., a gene locus of a genome
  • napR/DNAbp embraces CRISPR Cas9 proteins, as well as Cas9 equivalents, homologs, orthologs, or paralogs, whether naturally occurring or non-naturally occurring (e.g., engineered or modified), and may include a Cas9 equivalent from any type of CRISPR system (e.g., type II, V, VI), including Cpfl (a type-V CRISPR-Cas systems), C2cl (a type V CRISPR-Cas system), C2c2 (a type VI CRISPR-Cas system), C2c3 (a type V CRISPR-Cas system), dCas9, GeoCas9, CjCas9, Casl2a, Casl2b, Casl2c, Casl2d, Casl2g, Casl2h, Casl2i, Casl3b, Casl3c, Casl3d, Casl4, Csn2, Argonaute (Ago), and
  • the term also embraces Cas homologs and variants such as an xCas9, an SpCas9-NG, an LbCasl2a, an AsCasl2a, a Cas9-KKH, a circularly permuted Cas9, a SmacCas9, a Spy-macCas9. Further Cas-equivalents are described in Makarova et al.,“C2c2 is a single-component
  • nucleic acid programmable DNA binding protein that may be used in connection with this invention are not limited to CRISPR-Cas systems.
  • the invention embraces any such programmable protein, such as the Argonaute protein from Natronobacterium gregoryi (NgAgo) which may also be used for DNA-guided genome editing.
  • NgAgo-guide DNA system does not require a PAM sequence or guide RNA molecules, which means genome editing can be performed simply by the expression of generic NgAgo protein and
  • the napR/DNAbp is a RNA-programmable nuclease, when in a complex with an RNA, may be referred to as a nuclease:RNA complex.
  • the bound RNA(s) is referred to as a guide RNA (gRNA).
  • gRNAs can exist as a complex of two or more RNAs, or as a single RNA molecule.
  • gRNAs that exist as a single RNA molecule may be referred to as single-guide RNAs (sgRNAs), though“gRNA” is used interchangeabley to refer to guide RNAs that exist as either single molecules or as a complex of two or more molecules.
  • gRNAs that exist as single RNA species comprise two domains: (1) a domain that shares homology to a target nucleic acid (e.g., and directs binding of a Cas9 (or equivalent) complex to the target); and (2) a domain that binds a Cas9 protein.
  • domain (2) corresponds to a sequence known as a tracrRNA, and comprises a stem-loop structure.
  • domain (2) is homologous to a tracrRNA as depicted in Figure IE of Jinek et al., Science 337:816-821(2012), the entire contents of which is incorporated herein by reference.
  • gRNAs e.g., those including domain 2
  • gRNAs can be found in U.S. Patent No. 9,340,799, entitled“mRNA-Sensing Switchable gRNAs,” and International Patent Application No. PCT/US2014/054247, filed September 6, 2013, published as WO 2015/035136 and entitled“Delivery System For Functional Nucleases,” the entire contents of each are herein incorporated by reference.
  • a gRNA comprises two or more of domains (1) and (2), and may be referred to as an“extended gRNA.”
  • an extended gRNA will, e.g., bind two or more Cas9 proteins and bind a target nucleic acid at two or more distinct regions, as described herein.
  • the gRNA comprises a nucleotide sequence that complements a target site, which mediates binding of the nuclease/RNA complex to said target site, providing the sequence specificity of the nuclease:RNA complex.
  • the RNA- programmable nuclease is the (CRISPR-associated system) Cas9 endonuclease, for example Cas9 (Csnl) from Streptococcus pyogenes (see, e.g.,“Complete genome sequence of an Ml strain of Streptococcus pyogenes.” Ferretti J.J. et al.., Proc. Natl. Acad. Sci. U.S. A.
  • the napR/DNAbp nucleases (e.g., Cas9) use RNA:DNA hybridization to target DNA cleavage sites, these proteins are able to be targeted, in principle, to any sequence specified by the guide RNA.
  • Methods of using napR/DNAbp nucleases, such as Cas9, for site-specific cleavage (e.g., to modify a genome) are known in the art (see e.g., Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823 (2013); Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823-826 (2013); Hwang, W.Y.
  • the term“napR/DNAbp-programming nucleic acid molecule” or equivalently“guide sequence” refers the one or more nucleic acid molecules which associate with and direct or otherwise program a napR/DNAbp protein to localize to a specific target nucleotide sequence (e.g., a gene locus of a genome) that is complementary to the one or more nucleic acid molecules (or a portion or region thereof) associated with the protein, thereby causing the napR/DNAbp protein to bind to the nucleotide sequence at the specific target site.
  • a specific target nucleotide sequence e.g., a gene locus of a genome
  • a non limiting example is a guide RNA of a Cas protein of a CRISPR-Cas genome editing system.
  • a nuclear localization signal or sequence is an amino acid sequence that tags, designates, or otherwise marks a protein for import into the cell nucleus by nuclear transport. Typically, this signal consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface. Different nuclear localized proteins may share the same NLS. An NLS has the opposite function of a nuclear export signal (NES), which targets proteins out of the nucleus. Thus, a single nuclear localization signal can direct the entity with which it is associated to the nucleus of a cell.
  • sequences can be of any size and composition, for example more than 25, 25, 15, 12, 10, 8, 7, 6, 5 or 4 amino acids, but will preferably comprise at least a four to eight amino acid sequence known to function as a nuclear localization signal (NLS).
  • nucleobase modification domain or“modification domain” embraces any protein, enzyme, or polypeptide (or functional fragment thereof) which is capable of modifying a DNA or RNA molecule. Nucleobase modification domains may be naturally occurring, or may be engineered.
  • a nucleobase modification domain can include one or more DNA repair enzymes, for example, and an enzyme or protein involved in base excision repair (BER), nucleotide excision repair (NER), homology- dependnent recombinational repair (HR), non-homologous end-joining repair (NHEJ), microhomology end-joining repair (MMEJ), mismatch repair (MMR), direct reversal repair, or other known DNA repair pathway.
  • a nucleobase modification domain can have one or more types of enzymatic activities, including, but not limited to, endonuclease activity, polymerase activity, ligase activity, replication activity, and proofreading activity.
  • Nucleobase modification domains can also include DNA or RNA-modifying enzymes and/or mutagenic enzymes, such as DNA oxidizing enzymes (i.e., adenine oxidases), which covalently modify nucleobases leading in some cases to mutagenic corrections by way of normal cellular DNA repair and replication processes.
  • DNA oxidizing enzymes i.e., adenine oxidases
  • nucleobase modification domains include, but are not limited to, an adenine oxidase, a nuclease, a nickase, a recombinase, a methyltransferase, a methylase, an acetylase, an acetyltransferase, a transcriptional activator, or a transcriptional repressor domain.
  • the nucleobase modification domain is an adenine oxidase (e.g., AlkBHl).
  • the terms“oligonucleotide” and“polynucleotide” can be used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three
  • phage-assisted continuous evolution refers to continuous evolution that employs phage as viral vectors.
  • PACE phage-assisted continuous evolution
  • PCT/US 2009/056194 filed September 8, 2009, published as WO 2010/028347 on March 11, 2010; International PCT Application, PCT/US2011/066747, filed December 22, 2011, published as WO 2012/088381 on June 28, 2012; U.S. Patent No. 9,023,594, issued May 5, 2015; U.S. Patent No. 9,771,574, issued September 26, 2017; U.S. Patent No. 9,394,537, issued July 19, 2016; International PCT Application, PCT/US2015/012022, filed January 20, 2015, published as WO 2015/134121 on September 11, 2015; U.S. Patent No. 10,179,911, issued January 15, 2019; U.S. Patent No.
  • PANCE phage-assisted non-continuous evolution
  • SP evolving‘selection phage’
  • promoter refers to a nucleic acid molecule with a sequence recognized by the cellular transcription machinery and able to initiate transcription of a downstream gene.
  • a promoter can be constitutively active, meaning that the promoter is always active in a given cellular context, or conditionally active, meaning that the promoter is only active in the presence of a specific condition.
  • conditional promoter may only be active in the presence of a specific protein that connects a protein associated with a regulatory element in the promoter to the basic transcriptional machinery, or only in the absence of an inhibitory molecule.
  • a subclass of conditionally active promoters are inducible promoters that require the presence of a small molecule“inducer” for activity.
  • inducible promoters include, but are not limited to, arabinose-inducible promoters, Tet-on promoters, and tamoxifen-inducible promoters.
  • inducible promoters include, but are not limited to, arabinose-inducible promoters, Tet-on promoters, and tamoxifen-inducible promoters.
  • constitutive, conditional, and inducible promoters are well known to the skilled artisan, and the skilled artisan will be able to ascertain a variety of such promoters useful in carrying out the instant invention, which is not limited in this respect.
  • the specification provides vectors with appropriate promoters for driving expression of the nucleic acid sequences encoding the base editor fusion proteins (or one or more individual components thereof).
  • phage refers to a vims that infects bacterial cells.
  • phages consist of an outer protein capsid enclosing genetic material.
  • the genetic material may be ssRNA, dsRNA, ssDNA, or dsDNA, in either linear or circular form.
  • Phages and phage vectors are well known to those of skill in the art and non-limiting examples of phages that are useful for carrying out the methods provided herein are l, T2, T4, T7, T12, R17, M13, MS2, G4, PI, P2, P4, Phi X174, N4, F6, and F29.
  • the phage utilized in the present invention is M13. Additional suitable phages and host cells will be apparent to those of skill in the art and the invention is not limited in this aspect. For an exemplary description of additional suitable phages and host cells, see Elizabeth Kutter and Alexander Sulakvelidze:
  • Bacteriophages Biology and Applications. CRC Press; 1st edition (December 2004), ISBN: 0849313368; Martha R. J. Clokie and Andrew M.
  • Kropinski Bacteriophages: Methods and Protocols, Volume 1: Isolation, Characterization, and Interactions (Methods in Molecular Biology) Humana Press; 1st edition (December, 2008), ISBN: 1588296822; Martha R. J. Clokie and Andrew M. Kropinski: Bacteriophages: Methods and Protocols, Volume 2:
  • protein refers to a polymer of amino acid residues linked together by peptide (amide) bonds.
  • the terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long.
  • a protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins.
  • One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a famesyl group, an isofamesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc.
  • a protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex.
  • a protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide.
  • a protein, peptide, or polypeptide may be naturally occurring, engineered, or synthetic, or any combination thereof.
  • fusion protein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins.
  • One protein may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy-terminal (C- terminal) protein thus forming an“amino-terminal fusion protein” or a“carboxy-terminal fusion protein,” respectively.
  • a protein may comprise different domains, for example, a nucleic acid binding domain (e.g., the gRNA binding domain of Cas9 that directs the binding of the protein to a target site) and a nucleic acid cleavage domain or a catalytic domain of a recombinase.
  • a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain, and an organic compound, e.g., a compound that can act as a nucleic acid cleavage agent.
  • a protein is in a complex with, or is in association with, a nucleic acid, e.g., RNA.
  • Any of the proteins provided herein may be produced by any method known in the art.
  • the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor
  • recombinant refers to proteins or nucleic acids that do not occur in nature, but are the product of human engineering.
  • a recombinant protein or nucleic acid molecule comprises an amino acid or nucleotide sequence that comprises at least one, at least two, at least three, at least four, at least five, at least six, or at least seven mutations as compared to any naturally occurring sequence.
  • subject refers to an individual organism, for example, an individual mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal.
  • the subject is a non-human primate. In some embodiments, the subject is a rodent. In some embodiments, the subject is a sheep, a goat, a cattle, a cat, or a dog. In some embodiments, the subject is a vertebrate, an amphibian, a reptile, a fish, an insect, a fly, or a nematode. In some embodiments, the subject is a research animal. In some embodiments, the subject is an experimental organism. In some embodiments, the subject is a plant. In some embodiments, the subject is genetically engineered, e.g., a genetically engineered non-human subject. The subject may be of either sex and at any stage of development.
  • target site refers to a sequence within a nucleic acid molecule that is edited by a base editor (e.g., a dCas9-adenine oxidase fusion protein provided herein).
  • the target site further refers to the sequence within a nucleic acid molecule to which a complex of the base editor and gRNA binds.
  • the term“vector,” as used herein, may refer to a nucleic acid that has been modified to encode a gene of interest and that is able to enter into a host cell, mutate and replicate within the host cell, and then transfer a replicated form of the vector into another host cell.
  • the term“vector” as used herein may refer to a nucleic acid that has been modified to encode the base editor.
  • Exemplary suitable vectors include viral vectors, such as retroviral vectors or bacteriophages and filamentous phage, and conjugative plasmids.
  • viral particle refers to a viral genome, for example, a DNA or RNA genome, that is associated with a coat of a viral protein or proteins, and, in some cases, with an envelope of lipids.
  • a phage particle comprises a phage genome packaged into a protein encoded by the wild type phage genome.
  • viral vector refers to a nucleic acid comprising a viral genome that, when introduced into a suitable host cell, can be replicated and packaged into viral particles able to transfer the viral genome into another host cell.
  • the term“viral vector” extends to vectors comprising truncated or partial viral genomes.
  • a viral vector is provided that lacks a gene encoding a protein essential for the generation of infectious viral particles.
  • suitable host cells for example, host cells comprising the lacking gene under the control of a conditional promoter, however, such truncated viral vectors can replicate and generate viral particles able to transfer the truncated viral genome into another host cell.
  • the viral vector is an adeno- associated virus (AAV) vector.
  • AAV adeno-associated virus
  • the terms“treatment,”“treat,” and“treating,” refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease, disorder, or condition, or one or more symptoms thereof, as described herein.
  • the terms “treatment,”“treat,” and“treating” refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease, disorder, or condition, or one or more symptoms thereof, as described herein.
  • treatment may be
  • treatment may be administered after one or more symptoms have developed and/or after a disease has been diagnosed.
  • treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease.
  • treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and/or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to prevent or delay their prevention or recurrence.
  • the term“variant” refers to a protein having characteristics that deviate from what occurs in nature that retains at least one functional i.e. binding, interaction, or enzymatic activity and/or therapeutic property thereof.
  • A“variant” is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the wild type protein.
  • a variant of Cas9 may comprise a Cas9 that has one or more changes in amino acid residues as compared to a wild type Cas9 amino acid sequence.
  • a variant of a deaminase may comprise a deaminase that has one or more changes in amino acid residues as compared to a wild type deaminase amino acid sequence, e.g. following ancestral sequence reconstruction of the deaminase.
  • changes include chemical modifications, substitutions of different amino acid residues truncations, covalent additions (e.g. of a tag), and any other changes.
  • This term also embraces fragments of a wild type protein.
  • the level or degree of which the property is retained may be reduced relative to the wild type protein but is typically the same or similar in kind. Generally, variants are overall very similar, and in many regions, identical to the amino acid sequence of the protein described herein. A skilled artisan will appreciate how to make and use variants that maintain all, or at least some, of a functional ability or property.
  • the variant proteins may comprise, or alternatively consist of, an amino acid sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%, identical to, for example, the amino acid sequence of a wild-type protein, or any protein provided herein.
  • Further polypeptides encompassed by the invention are polypeptides encoded by polynucleotides which hybridize to the complement of a nucleic acid molecule encoding a protein such as a napDNAbp under stringent hybridization conditions (e.g. hybridization to filter bound DNA in 6x Sodium chloride/S odium citrate (SSC) at about 45 degrees Celsius, followed by one or more washes in 0.2. times.
  • stringent hybridization conditions e.g. hybridization to filter bound DNA in 6x Sodium chloride/S odium citrate (SSC) at about 45 degrees Celsius, followed by one or more washes in 0.2. times.
  • SSC 0.1% SDS at about 50-65 degrees Celsius
  • highly stringent conditions e.g. hybridization to filter bound DNA in 6x sodium chloride/S odium citrate (SSC) at about 45 degrees Celsius, followed by one or more washes in O.lxSSC, 0.2% SDS at about 68 degrees Celsius
  • other stringent hybridization conditions which are known to those of skill in the art (see, for example, Ausubel, F. M. el al, eds., 1989 Current Protocol in Molecular Biology , Green publishing associates, Inc., and John Wiley & Sons Inc., New York, at pp. 6.3.1-6.3.6 and 2.10.3).
  • polypeptide having an amino acid sequence at least, for example, 95%
  • amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, or substituted with another amino acid.
  • These alterations of the reference sequence may occur at the amino- or carboxy-terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to, for instance, the amino acid sequence of a protein such as a napDNAbp, can be determined conventionally using known computer programs.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag el al. ⁇ Comp. App. Biosci. 6:237-245 (1990)).
  • the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
  • the result of said global sequence alignment is expressed as percent identity.
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C- terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the reference sequence.
  • wild type is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene or characteristic as it occurs in nature as distinguished from mutant or variant forms.
  • the present disclosure provides adenine-to-cytosine or“ACBE” (or thymine-to- guanine or“TGBE”) transversion base editors which comprise a napDNAbp (e.g., a nCas9 domain) fused to a nucleobase modification domain.
  • the nucleobase modification domain may comprise an adenine oxidase.
  • the disclosed ACBE transversion base editors are capable of converting an A:T nucleobase pair to a C:G nucleobase pair in a target nucleotide sequence of interest, e.g., the genome of a cell.
  • the disclosed base editors comprise an engineered oxidase variant that catalyzes the conversion of a target adenine to a cytosine via an oxidation reaction.
  • the disclosed base editors also comprise TGBE transversion base editors that comprise an engineered oxidase variant that catalyzes the conversion of a target adenine to a cytosine via an oxidation reaction, wherein the base-paired thymine of the non-edited (i.e. non-oxidized) strand is subsequently converted to a guanine by the concerted action of the cell’s mismatch repair factors.
  • 8-oxoadenine oxidation strategy enzyme-catalyzed oxidation of a targeted A in a nucleic acid of interest results in 8-oxoadenine (8-oxoA) formation.
  • 8-oxoA 8-oxoadenine
  • Steric rotation of the 8- oxoA around the glycosidic bond is induced, presenting the Hoogsteen edge for base pairing.
  • 8-oxoA is read by a polymerase as a cytosine and the cell’s mismatch repair machinery converts the base-paired thymine of the non-edited strand to a guanine to correct the apparent mismatch.
  • the cell’s mismatch repair machiner converts the 8-oxoA lesion to a cytosine, thereby completing the desired A:T to C:G mutation.
  • Adenine oxidation is achieved by the targeted use of a fusion protein comprising a napDNAbp (e.g., a Cas9 nickase (“nCas9”)) domain, an adenine oxidase domain, and optionally a linker connecting these two domains (see FIG. 1).
  • the adenine oxidase domains of the disclosed base editors may comprise variants of wild-type oxidase enzymes. These variants may comprise an amino acid sequence that is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the wild type enzyme.
  • the adenine oxidase domains may comprise an amino acid sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more than 30 amino acids that differ relative to the amino acid sequence of the wild type enzyme.
  • the adenine oxidase domains contain stretches of about 50, about 75, about 100, about 125, about 150, about 175, about 200, about 300, about 400, about 500, or more than 500 consecutive amino acids in common with the wild type enzyme.
  • the adenine oxidase domains comprise truncations at the N-terminus or C-terminus relative to the wild-type enzyme.
  • the adenine oxidase domains comprise truncations of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more than 30 amino acids at the N-terminus or C-terminus relative to the wild- type or base sequence.
  • the adenine oxidase is an AlkBH3, or a variant thereof. In certain embodiments, the adenine oxidase is a bacterial AlkB, or a variant thereof. In other embodiments, the adenine oxidase is a human AlkBH, or a variant thereof. In certain embodiments, the adenine oxidase is a human AlkBH 1, AlkBH2, AlkBH3, AlkBH4,
  • the adenine oxidase is a TET-oxidase, or a variant thereof.
  • the oxidase is a human TET1, TET2, TET3, the catalytic domain of a human TET1 (TET1-CD), or other effector domains of human TET1, TET2, or TET3, or a variant thereof.
  • the adenine oxidase is a xanthine dehydrogenase, or a variant thereof.
  • the xanthine dehydrogenase is a human xanthine
  • the xanthine dehydrogenase is a Streptomyces cyanogenus xanthine dehydrogenase (ScXDH), or a variant thereof.
  • the xanthine dehydrogenase or variant thereof is derived from C. capitata, N. crassa, M. hansupus, E. cloacae, S. snoursei, S. albulus, S. himastatinicus , or S. lividans.
  • the adenine oxidase is a cytochrome P450 enzyme, or a variant thereof.
  • the oxidase is a human CYP1A2, CYP2A4, or CYP3A6, or a variant thereof.
  • the oxidase is a molybdopterin-dependent aldehyde oxidase (e.g ., human AOX1).
  • the oxidase is a flavin monooxygenase.
  • the adenine oxidase is a human FTO, or a variant thereof.
  • the instant specification provides for A:T to C:G transversion base editors which overcome a need in the art for installation of targeted transversions into a target or desired nucleotide sequence, e.g., a genome.
  • A:T to C:G base editors e.g., fusion proteins comprising an nCas9 domain and an adenine oxidase domain
  • A:T to C:G trans versions e.g., fusion proteins comprising an nCas9 domain and an adenine oxidase domain
  • compositions comprising the transversion base editors as described herein, e.g., fusion proteins comprising an nCas9 domain and an adenine oxidase domain, and one or more guide RNAs, e.g., a single-guide RNA (“sgRNA”).
  • sgRNA single-guide RNA
  • the instant specification provides for nucleic acid molecules encoding and/or expressing the transversion base editors as described herein, as well as expression vectors or constructs for expressing the transversion base editors described herein and a gRNA, host cells comprising said nucleic acid molecules and expression vectors, and optionally one or more gRNAs, and compositions for delivering and/or administering nucleic acid-based embodiments described herein.
  • the present disclosure provides for methods of making the transversion base editors described herein, as well as methods of using the transversion base editors or nucleic acid molecules encoding the transversion base editors in applications including editing a nucleic acid molecule, e.g., a genome.
  • methods of engineering the transversion base editors provided herein involve a phage-assisted continuous evolution (PACE) system or non-continuous system (e.g., PANCE), which may be utilized to evolve one or more components of a base editor (e.g., an adenine oxidase domain).
  • PACE phage-assisted continuous evolution
  • PANCE non-continuous system
  • methods of making the base editors comprise recombinant protein expression methodologies known to one of ordinary skill in the art.
  • the specification also provides methods for editing a target nucleic acid molecule, e.g., a single nucleobase within a genome, with a base editing system described herein (e.g., in the form of an evolved base editor as described herein, or a vector or construct encoding same).
  • a base editing system described herein e.g., in the form of an evolved base editor as described herein, or a vector or construct encoding same.
  • Such methods involve transducing (e.g., via transfection) cells with a plurality of complexes each comprising a fusion protein (e.g., a fusion protein comprising a Cas9 nickase (nCas9) domain and an adenine oxidase domain) and a gRNA molecule.
  • a fusion protein e.g., a fusion protein comprising a Cas9 nickase (nCas9) domain and an adenine oxidase domain
  • the gRNA is bound to the napDNAbp domain (e.g., nCas9 domain) of the fusion protein.
  • each gRNA comprises a guide sequence of at least 10 contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides) that is complementary to a target sequence.
  • the methods involve the transfection of nucleic acid constructs (e.g., plasmids) that each (or together) encode the components of a complex of fusion protein and gRNA molecule.
  • a nucleic acid construct that encodes the fusion protein is transfected into the cell separately from the plasmid that encodes the gRNA molecule. In certain embodiments, these components are encoded on a single construct and transfected together.
  • the methods disclosed herein involve the introduction into cells of a complex comprising a fusion protein and gRNA molecule that has been expressed and cloned outside of these cells.
  • any fusion protein e.g., any of the fusion proteins provided herein, may be introduced into the cell in any suitable way, either stably or transiently.
  • a fusion protein may be transfected into the cell.
  • the cell may be transduced or transfected with a nucleic acid construct that encodes a fusion protein.
  • a cell may be transduced (e.g., with a virus encoding a fusion protein), or transfected (e.g., with a plasmid encoding a fusion protein) with a nucleic acid that encodes a fusion protein, or the translated fusion protein.
  • transduction may be a stable or transient transduction.
  • cells expressing a fusion protein or containing a fusion protein may be transduced or transfected with one or more gRNA molecules, for example when the fusion protein comprises a Cas9 (e.g., nCas9) domain.
  • a plasmid expressing a fusion protein may be introduced into cells through electroporation, transient (e.g., lipofection) and stable genome integration (e.g., piggybac) and viral transduction or other methods known to those of skill in the art.
  • the methods described above result in a cutting (or nicking) one strand of the double- stranded DNA, for example, the strand that includes the thymine (T) of the target A:T nucleobase pair opposite the strand containing the target adenine (A) that is being oxidized.
  • This nicking result serves to direct mismatch repair machinery to the non- edited strand, ensuring that the chemically modified nucleobase is not interpreted as a lesion by the machinery.
  • This nick may be created by the use of an nCas9.
  • the present specification provides a complex comprising the base editor fusion proteins described herein and an RNA bound to the Cas9 domain of the fusion protein, such as a guide RNA (gRNA), e.g., a single guide RNA.
  • gRNA guide RNA
  • the target nucleotide sequence may comprise a target sequence (e.g., a point mutation) associated with a disease, disorder, or condition, such as congenital deafness, spastic paraplegia, nonsyndromic hearing loss, spinal muscular atrophy, or hypohidrotic ectodermal dysplasia.
  • the target sequence may comprise a C to A point mutation associated with a disease, disorder, or condition, and wherein the oxidation of the mutant A base results in mismatch repair-mediated correction to a sequence that is not associated with a disease, disorder, or condition.
  • the target sequence may comprise a G to T point mutation associated with a disease, disorder, or condition, and wherein the oxidation of the mutant A base results in mismatch repair-mediated correction to a sequence that is not associated with a disease, disorder, or condition.
  • the target sequence may encode a protein, and where the point mutation is in a codon and results in a change in the amino acid encoded by the mutant codon as compared to a wild-type codon.
  • the target sequence may also be at a splice site, and the point mutation results in a change in the splicing of an mRNA transcript as compared to a wild-type transcript.
  • the target may be at a non-coding sequence of a gene, such as a promoter, and the point mutation results in increased or decreased expression of the gene.
  • Exemplary target genes include GJB2, in which a G to T point mutation at residue 139 results in a congenital deafness phenotype; and SPG11, in which a C to A point mutation at residue 2877 results in a apastic paraplegia phenotype.
  • Additional target genes include OTOF (associated with nonsyndromic hearing loss), IGHMBP2 (associated with spinal muscular atrophy), and EDAR (associated with hypohidrotic ectodermal dysplasia), for which the disease phenotype is frequently caused by C:G to A:T point mutations.
  • C:G to A:T point mutations introduce premature stop codons (UAA, UAG, UGA), resulting in nonsense mutations in protein coding regions.
  • UAA premature stop codon
  • UAG UAG
  • UGA premature stop codons
  • exemplary ACBEs disclosed herein correct these disease alleles in somatic cells, reducing or removing morbidity.
  • exemplary ACBEs disclosed herein may install disease-suppressing alleles in somatic cells.
  • the oxidation of a mutant A results in a change of the amino acid encoded by the mutant codon, which in some cases can result in the expression of a wild-type amino acid.
  • the application of the base editors can also result in a change of the mRNA transcript, and even restoring the mRNA transcript to a wild-type state.
  • the methods described herein involving contacting a base editor with a target nucleotide sequence can occur in vitro, ex vivo, or in vivo.
  • the step of contacting occurs in a subject.
  • the subject has been diagnosed with a disease, disorder, or condition, such as, but not limited to, a disease, disorder, or condition associated with a point mutation in the GJB2 gene, the IGHMBP2 gene, the OTOF gene, the EDAR gene, or the SPG11 gene.
  • the specification discloses a pharmaceutical composition comprising any one of the presently disclosed base editor fusion proteins. In one aspect, the specification discloses a pharmaceutical composition comprising any one of the presently disclosed complexes of fusion proteins and gRNA. In one aspect, the specification discloses a pharmaceutical composition comprising polynucleotides encoding the fusion proteins disclosed herein and polynucleotides encoding a gRNA, or polynucleotides encoding both.
  • the specification discloses a pharmaceutical composition comprising any one of the presently disclosed vectors.
  • the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.
  • the pharmaceutical composition further comprises a lipid and/or polymer.
  • the lipid and/or polymer is cationic. The preparation of such lipid particles is well known. See, e.g. U.S. Patent Nos. 4,880,635; 4,906,477;
  • the present disclosure provides A-to-C (or T-to-G) transversion base editor fusion proteins comprising (i) a nucleic acid programmable DNA binding protein (napDNAbp), and (ii) a nucleobase modification domain capable of facilitating the conversion of a A:T nucleobase pair to a C:G nucleobase pair in a target nucleotide sequence, e.g., a genome.
  • napDNAbp nucleic acid programmable DNA binding protein
  • a nucleobase modification domain capable of facilitating the conversion of a A:T nucleobase pair to a C:G nucleobase pair in a target nucleotide sequence, e.g., a genome.
  • the nucleobase modification domain is an adenine oxidase, which enzymatically converts an adenine nucleobase of an A:T nucleobase pair to an 8- oxoadenine, which is subsequently converted by the cell’s DNA repair and replication machinery to a cytosine, ultimately converting the A:T nucleobase pair to a C:G nucleobase pair.
  • the various domains of the transversion fusion proteins described herein may be obtained as a result of mutagenizing a reference or starting-point base editor (or a component or domain thereof) by a directed evolution process, e.g., a continuous evolution method (e.g., PACE) or a non- continuous evolution method (e.g., PANCE or other discrete plate-based selections).
  • a directed evolution process e.g., a continuous evolution method (e.g., PACE) or a non- continuous evolution method (e.g., PANCE or other discrete plate-based selections).
  • PACE continuous evolution method
  • PANCE non- continuous evolution method
  • the disclosure provides a base editor that has one or more amino acid variations introduced into its amino acid sequence relative to the amino acid sequence of the reference or starting-point base editor.
  • the base editor may include variants in one or more components or domains of the base editor (e.g., variants introduced into a Cas9 domain, an adenine oxidase domain, an inhibitor of base excision repair (iBER) domain, or a variant introduced into combinations of these domains).
  • the nucleobase modification domain may be evolved from a reference protein that is an RNA modifying enzyme (e.g., an /Vl-methyladenosine modification enzyme or a 5-methylcytosine modification enzyme) and evolved using PACE, PANCE, or other plate-based evolution methods to obtain a DNA modifying version of the nucleobase modification domain, which can then be used in the fusion proteins described herein.
  • RNA modifying enzyme e.g., an /Vl-methyladenosine modification enzyme or a 5-methylcytosine modification enzyme
  • the base editors described herein comprise a nucleic acid programmable DNA binding (napDNAbp) domain.
  • the napDNAbp is associated with at least one guide nucleic acid (e.g., guide RNA), which localizes the napDNAbp to a DNA sequence that comprises a DNA strand (i.e., a target strand) that is complementary to the guide nucleic acid, or a portion thereof (e.g., the protospacer of a guide RNA).
  • the guide nucleic-acid “programs” the napDNAbp domain to localize and bind to a complementary sequence of the target strand. Binding of the napDNAbp domain to a complementary sequence enables the nucleobase modification domain of the base editor to access and enzymatically deaminate a target adenine base in the target strand.
  • the napDNAbp can be a CRISPR (clustered regularly interspaced short palindromic repeat)-associated nuclease.
  • CRISPR is an adaptive immune system that provides protection against mobile genetic elements (viruses, transposable elements and conjugative plasmids).
  • CRISPR clusters contain spacers, sequences complementary to antecedent mobile elements, and target invading nucleic acids.
  • CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA).
  • crRNA CRISPR RNA
  • type II CRISPR systems correct processing of pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (me) and a Cas9 protein.
  • the tracrRNA serves as a guide for ribonuclease 3- aided processing of pre-crRNA. Subsequently, Cas9/crRNA/tracrRNA endonucleolytically cleaves linear or circular dsDNA target complementary to the spacer. The target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3 '-5'
  • RNA-binding and cleavage typically requires protein and both RNAs.
  • single guide RNAs sgRNA, or simply“gNRA” can be engineered so as to incorporate aspects of both the crRNA and tracrRNA into a single RNA species. See, e.g., Jinek et al, Science 337:816-821(2012), the entire contents of which is hereby incorporated by reference.
  • the binding mechanism of a napDNAbp - guide RNA complex includes the step of forming an R-loop whereby the napDNAbp induces the unwinding of a double-strand DNA target, thereby separating the strands in the region bound by the napDNAbp.
  • the guideRNA protospacer then hybridizes to the“target strand.” This displaces a“non-target strand” that is
  • the napDNAbp includes one or more nuclease activities, which cuts the DNA leaving various types of lesions (e.g., a nick in one strand of the DNA).
  • the napDNAbp may comprises a nuclease activity that cuts the non-target strand at a first location, and / or cuts the target strand at a second location.
  • the target DNA can be cut to form a“double- stranded break” whereby both strands are cut.
  • the target DNA can be cut at only a single site, i.e., the DNA is“nicked” on one strand.
  • the base editors may comprise the canonical SpCas9, or any ortholog Cas9 protein, or any variant Cas9 protein— including any naturally occurring variant, mutant, or otherwise engineered version of Cas9— that is known or which can be made or evolved through a directed evolution or otherwise mutagenic process.
  • the napDNAbp has a nickase activity, i.e., only cleave one strand of the target DNA sequence.
  • the napDNAbp has an inactive nuclease, e.g., are“dead” proteins.
  • Other variant Cas9 proteins that may be used are those having a smaller molecular weight than the canonical SpCas9 (e.g., for easier delivery) or having modified or rearranged primary amino acid sequence (e.g., the circular permutant forms).
  • the base editors described herein may also comprise Cas9 equivalents, including Casl2a/Cpfl and Casl2b proteins.
  • the napDNAbps used herein e.g., an SpCas9 or SpCas9 variant
  • the disclosure contemplates any Cas9, Cas9 variant, or Cas9 equivalent which has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.9% sequence identity to a reference Cas9 sequence, such as a reference SpCas9 canonical sequence (set forth in SEQ ID NO: 9), a reference SaCas9 canonical sequence (set forth in SEQ ID NO: 92) or a reference Cas9 equivalent (e.g., Casl2a/Cpfl).
  • a reference Cas9 sequence such as a reference SpCas9 canonical sequence (set forth in SEQ ID NO: 9), a reference SaCas9 canonical sequence (set forth in SEQ ID NO: 92) or a reference Cas9 equivalent (e.g., Casl
  • the napDNAbp directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the
  • the napDNAbp directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.
  • an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand).
  • mutations that render Cas9 a nickase include, without limitation, H840A, N854A, and N863A in reference to the canonical SpCas9 sequence, or to equivalent amino acid positions in other Cas9 variants or Cas9 equivalents.
  • Cas protein refers to a full-length Cas protein obtained from nature, a recombinant Cas protein having a sequences that differs from a naturally occurring Cas protein, or any fragment of a Cas protein that nevertheless retains all or a significant amount of the requisite basic functions needed for the disclosed methods, i.e., (i) possession of nucleic-acid programmable binding of the Cas protein to a target DNA, and (ii) ability to nick the target DNA sequence on one strand.
  • the Cas proteins contemplated herein embrace CRISPR Cas9 proteins, as well as Cas9 equivalents, variants (e.g., Cas9 nickase (nCas9) or nuclease inactive Cas9 (dCas9)) homologs, orthologs, or paralogs, whether naturally occurring or non-naturally occurring (e.g., engineered or recombinant), and may include a Cas9 equivalent from any type of CRISPR system (e.g., type II, V, VI), including Cpfl (a type-V CRISPR-Cas systems), C2cl (a type V CRISPR-Cas system), C2c2 (a type VI CRISPR-Cas system) and C2c3 (a type V CRISPR-Cas system).
  • Cpfl a type-V CRISPR-Cas systems
  • C2cl a type V CRISPR-Cas system
  • C2c2 a type VI CRISPR-Ca
  • C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector,” Science 2016; 353(6299), the contents of which are incorporated herein by reference.
  • Cas9 or“Cas9 domain” embraces any naturally occurring Cas9 from any organism, any naturally-occurring Cas9 equivalent or functional fragment thereof, any Cas9 homolog, ortholog, or paralog from any organism, and any mutant or variant of a Cas9, naturally-occurring or engineered.
  • the term Cas9 is not meant to be particularly limiting and may be referred to as a“Cas9 or equivalent.”
  • Exemplary Cas9 proteins are further described herein and/or are described in the art and are incorporated herein by reference. The present disclosure is unlimited with regard to the particular napDNAbp that is employed in the base editors of the disclosure.
  • Cas9 and Cas9 equivalents are provided as follows; however, these specific examples are not meant to be limiting.
  • the base editors of the present disclosure may use any suitable napDNAbp, including any suitable Cas9 or Cas9 equivalent.
  • the base editor constructs described herein may comprise the “canonical SpCas9” nuclease from S. pyogenes, which has been widely used as a tool for genome engineering.
  • This Cas9 protein is a large, multi-domain protein containing two distinct nuclease domains. Point mutations can be introduced into Cas9 to abolish one or both nuclease activities, resulting in a nickase Cas9 (nCas9) or dead Cas9 (dCas9), respectively, that still retains its ability to bind DNA in a sgRNA-programmed manner.
  • Cas9 or variant thereof when fused to another protein or domain, Cas9 or variant thereof (e.g., nCas9) can target that protein to virtually any DNA sequence simply by co-expression with an appropriate sgRNA.
  • the canonical SpCas9 protein refers to the wild type protein from
  • Streptococcus pyogenes having the following amino acid sequence:
  • the base editors described herein may include canonical SpCas9, or any variant thereof having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a wild type Cas9 sequence provided above.
  • These variants may include SpCas9 variants containing one or more mutations, including any known mutation reported with the
  • the base editors described herein may include any of the above SpCas9 sequences, or any variant thereof having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.
  • the Cas9 protein can be a wild type Cas9 ortholog from another bacterial species.
  • the following Cas9 orthologs can be used in connection with the base editor constructs described in this disclosure.
  • any variant Cas9 orthologs having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to any of the below orthologs may also be used with the disclosed base editors.
  • the base editors described herein may include any of the above Cas9 ortholog sequences, or any variants thereof having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.
  • the napDNAbp may include any suitable homologs and/or orthologs or naturally occurring enzymes, such as Cas9.
  • Cas9 homologs and/or orthologs have been described in various species, including, but not limited to, S. pyogenes and S. thermophilus .
  • the Cas moiety is configured (e.g, mutagenized, recombinantly engineered, or otherwise obtained from nature) as a nickase, i.e., capable of cleaving only a single strand of the target doubpdditional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier,“The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems” (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference.
  • a Cas9 nuclease has an inactive (e.g., an inactivated) DNA cleavage domain, that is, the Cas9 is a nickase.
  • the Cas9 protein comprises an amino acid sequence that is at least 80% identical to the amino acid sequence of a Cas9 protein as provided by any one of the variants of Table 3.
  • the Cas9 protein comprises an amino acid sequence that is at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a Cas9 protein as provided by any one of the Cas9 orthologs in the above tables.
  • the disclosed base editors may comprise a catalytically inactive, or“dead,” napDNAbp domain.
  • exemplary catalytically inactive domains in the disclosed base editors are dead S. pyogenes Cas9 (dSpCas9) and S. pyogenes Cas9 nickase (SpCas9n).
  • the base editors described herein may include a dead Cas9, e.g., dead SpCas9, which has no nuclease activity due to one or more mutations that inactivate both nuclease domains of SpCas9, namely the RuvC domain (which cleaves the non-protospacer DNA strand) and HNH domain (which cleaves the protospacer DNA strand).
  • the nuclease inactivation may be due to one or mutations that result in one or more substitutions and/or deletions in the amino acid sequence of the encoded protein, or any variants thereof having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.
  • the base editors described herein may include a dead Cas9, e.g., dead SpCas9, which has no nuclease activity due to one or more mutations that inactivate both nuclease domains of SpCas9, namely the RuvC domain (which cleaves the non-protospacer DNA strand) and HNH domain (which cleaves the protospacer DNA strand).
  • the D10A and N580A mutations in the wild-type S. aureus Cas9 amino acid sequence may be used to form a dSaCas9.
  • the napDNAbp domain of the base editors provided herein comprises a dSaCas9 that has D10A and N580A mutations relative to the wild-type SaCas9 sequence (SEQ ID NO: 92).
  • dCas9 refers to a nuclease-inactive Cas9 or nuclease-dead Cas9, or a functional fragment thereof, and embraces any naturally occurring dCas9 from any organism, any naturally-occurring dCas9 equivalent or functional fragment thereof, any dCas9 homolog, ortholog, or paralog from any organism, and any mutant or variant of a dCas9, naturally-occurring or engineered.
  • dCas9 is not meant to be particularly limiting and may be referred to as a“dCas9 or equivalent.”
  • Exemplary dCas9 proteins and method for making dCas9 proteins are further described herein and/or are described in the art and are incorporated herein by reference.
  • dCas9 corresponds to, or comprises in part or in whole, a Cas9 amino acid sequence having one or more mutations that inactivate the Cas9 nuclease activity.
  • Cas9 variants having mutations other than D10A and H840A are provided which may result in the full or partial inactivate of the endogenous Cas9 nuclease activity (e.g., nCas9 or dCas9, respectively).
  • Such mutations include other amino acid substitutions at DIO and H820, or other substitutions within the nuclease domains of Cas9 (e.g., substitutions in the HNH nuclease subdomain and/or the RuvCl subdomain) with reference to a wild type sequence such as Cas9 from Streptococcus pyogenes (NCBI Reference Sequence: NC_017053.1).
  • variants or homologues of Cas9 are provided which are at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to NCBI Reference Sequence: NC_017053.1.
  • variants of dCas9 are provided having amino acid sequences which are shorter, or longer than NC_017053.1 by about 5 amino acids, by about 10 amino acids, by about 15 amino acids, by about 20 amino acids, by about 25 amino acids, by about 30 amino acids, by about 40 amino acids, by about 50 amino acids, by about 75 amino acids, by about 100 amino acids or more.
  • the napDNAbp domain of any of the disclosed base editors comprises a dead S. pyogenes Cas9 (dSpCas9).
  • the napDNAbp domain of any of the disclosed based editors is comprises at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 106.
  • the napDNAbp domain of any of the disclosed base editors comprises the amino acid sequence of SEQ ID NO: 106.
  • the dead Cas9 may be based on the canonical SpCas9 sequence of Q99ZW2 and may have the following sequence, which comprises a D10A and an H810A substitutions (underlined and bolded), or a variant of SEQ ID NO: 106 having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto:
  • the disclosed base editors may comprise a napDNAbp domain that comprises a nickase.
  • the base editors described herein comprise a Cas9 nickase.
  • the term“Cas9 nickase” of“nCas9” refers to a variant of Cas9 which is capable of introducing a single-strand break in a double strand DNA molecule target.
  • the Cas9 nickase comprises only a single functioning nuclease domain.
  • the wild type Cas9 (e.g., the canonical SpCas9) comprises two separate nuclease domains, namely, the RuvC domain (which cleaves the non-protospacer DNA strand) and HNH domain (which cleaves the protospacer DNA strand).
  • the Cas9 nickase comprises a mutation in the RuvC domain which inactivates the RuvC nuclease activity.
  • nickase mutations in the RuvC domain could include D10X, H983X, D986X, or E762X, wherein X is any amino acid other than the wild type amino acid.
  • the nickase could be D10A, of H983A, or D986A, or E762A, or a combination thereof.
  • the napDNAbp domain of any of the disclosed base editors comprises an S. pyogenes Cas9 nickase (SpCas9n).
  • the napDNAbp domain of any of the disclosed based editors is comprises at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 112 or 118.
  • the napDNAbp domain of any of the disclosed base editors comprises the amino acid sequence of SEQ ID NO: 112.
  • the napDNAbp domain of any of the disclosed base editors comprises the amino acid sequence of SEQ ID NO: 118.
  • the napDNAbp domain of any of the disclosed base editors comprises an S. aureus Cas9 nickase (SaCas9n). In some embodiments, the napDNAbp domain of any of the disclosed based editors is comprises at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO: 116. In some embodiments, the napDNAbp domain of any of the disclosed base editors comprises the amino acid sequence of SEQ ID NO: 116.
  • the Cas9 nickase can having a mutation in the RuvC nuclease domain and have one of the following amino acid sequences, or a variant thereof having an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.
  • the Cas9 nickase comprises a mutation in the HNH domain which inactivates the HNH nuclease activity.
  • mutations in histidine (H) 840 or asparagine (R) 863 have been reported as loss-of-function mutations of the HNH nuclease domain and the creation of a functional Cas9 nickase (e.g., Nishimasu el al,“Crystal structure of Cas9 in complex with guide RNA and target DNA,” Cell 156(5), 935-949, which is incorporated herein by reference).
  • nickase mutations in the HNH domain could include H840X and R863X, wherein X is any amino acid other than the wild type amino acid.
  • the nickase could be H840A or R863A or a combination thereof.
  • the Cas9 nickase can have a mutation in the HNH nuclease domain and have one of the following amino acid sequences, or a variant thereof having an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.
  • the N-terminal methionine is removed from a Cas9 nickase, or from any Cas9 variant, ortholog, or equivalent disclosed or contemplated herein.
  • methionine-minus Cas9 nickases include the following sequences, or a variant thereof having an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.
  • the napDNAbp domains used in the base editors described herein may also include other Cas9 variants that area at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about
  • a Cas9 variant may have 1, 2, 3,
  • the Cas9 variant comprises a fragment of a reference Cas9 (e.g., a gRNA binding domain or a DNA-cleavage domain), such that the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the corresponding fragment of wild type Cas9.
  • a reference Cas9 e.g., a gRNA binding domain or a DNA-cleavage domain
  • the fragment is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid length of a corresponding wild type Cas9 (e.g., SEQ ID NO: 9).
  • a corresponding wild type Cas9 e.g., SEQ ID NO: 9
  • the disclosure also may utilize Cas9 fragments which retain their functionality and which are fragments of any herein disclosed Cas9 protein.
  • the Cas9 fragment is at least 100 amino acids in length.
  • the fragment is at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, or at least 1300 amino acids in length.
  • the base editors disclosed herein may comprise one of the Cas9 variants described as follows, or a Cas9 variant thereof having at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to any reference Cas9 variants.
  • the base editors described herein can include any Cas9 equivalent.
  • Cas9 equivalent is a broad term that encompasses any napDNAbp protein that serves the same function as Cas9 in the present base editors despite that its amino acid primary sequence and/or its three-dimensional structure may be different and/or unrelated from an evolutionary standpoint.
  • Cas9 equivalents include any Cas9 ortholog, homolog, mutant, or variant described or embraced herein that are
  • the Cas9 equivalents also embrace proteins that may have evolved through convergent evolution processes to have the same or similar function as Cas9, but which do not necessarily have any similarity with regard to amino acid sequence and/or three dimensional structure.
  • the base editors described here embrace any Cas9 equivalent that would provide the same or similar function as Cas9 despite that the Cas9 equivalent may be based on a protein that arose through convergent evolution.
  • CasX is a Cas9 equivalent that reportedly has the same function as Cas9 but which evolved through convergent evolution.
  • the CasX protein described in Liu et al.,“CasX enzymes comprises a distinct family of RNA-guided genome editors,” Nature , 2019, Vol.566: 218-223, is contemplated to be used with the base editors described herein.
  • Cas9 is a bacterial enzyme that evolved in a wide variety of species.
  • the Cas9 equivalents contemplated herein may also be obtained from archaea, which constitute a domain and kingdom of single-celled prokaryotic microbes different from bacteria.
  • Cas9 equivalents may refer to CasX or CasY, which have been described in, for example, Burstein et ah,“New CRISPR-Cas systems from
  • Cas9 refers to CasX, or a variant of CasX.
  • Cas9 refers to a CasY, or a variant of CasY. It should be appreciated that other RNA-guided DNA binding proteins may be used as a nucleic acid programmable DNA binding protein (napDNAbp), and are within the scope of this disclosure. Also see Liu et ah, “CasX enzymes comprises a distinct family of RNA-guided genome editors,” Nature , 2019, Vol.566: 218-223. Any of these Cas9 equivalents are contemplated.
  • the Cas9 equivalent comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to a naturally-occurring CasX or CasY protein.
  • the napDNAbp is a naturally-occurring CasX or CasY protein.
  • the napDNAbp comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to a wild-type Cas moiety or any Cas moiety provided herein.
  • the nucleic acid programmable DNA binding proteins include, without limitation, Cas9 (e.g ., dCas9 and nCas9), CasX, CasY, Cpfl, C2cl, C2c2, C2C3, Argonaute, Casl2a, and Casl2b.
  • Cas9 e.g ., dCas9 and nCas9
  • CasX CasY
  • Cpfl C2cl
  • C2c2, C2C3, Argonaute Casl2a
  • Casl2b e.g a nucleic acid programmable DNA- binding protein that has different PAM specificity than Cas9 is Clustered Regularly
  • Cpfl Interspaced Short Palindromic Repeats from Prevotella and Francisella 1 (Cpfl). Similar to Cas9, Cpfl is also a class 2 CRISPR effector. It has been shown that Cpfl mediates robust DNA interference with features distinct from Cas9. Cpfl is a single RNA-guided
  • Cpfl cleaves DNA via a staggered DNA double-stranded break.
  • TTN T-rich protospacer-adjacent motif
  • TTTN TTTN
  • YTN T-rich protospacer-adjacent motif
  • Cpfl proteins are known in the art and have been described previously, for example Yamano et al,“Crystal structure of Cpfl in complex with guide RNA and target DNA.” Cell (165) 2016, p. 949-962; the entire contents of which is hereby incorporated by reference. The state of the art may also now refer to Cpfl enzymes as Cas 12a.
  • the Cas protein may include any CRISPR associated protein, including but not limited to Casl2a, Casl2b, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (sometimes referred to as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2.
  • a nickase mutation e.g., a mutation corresponding to the D10A mutation of the wild type SpCas9 polypeptide of SEQ ID NO: 9).
  • the napDNAbp can be any of the following proteins: a Cas9, a Cpfl, a CasX, a CasY, a C2cl, a C2c2, a C2c3, a GeoCas9, a CjCas9, a Casl2a, a Casl2b, a Casl2g, a Casl2h, a Casl2i, a Casl3b, a Casl3c, a Casl3d, a Casl4, a Csn2, an xCas9, an SpCas9-NG, a circularly permuted Cas9, or an Argonaute (Ago), a Cas9-KKH, a SmacCas9, a Spy-macCas9, an SpCas9-VRQR, an SpCas9-NRRH, an SpaCas9-
  • the base editors contemplated herein can include a Cas9 protein that is of smaller molecular weight than the canonical SpCas9 sequence.
  • the smaller-sized Cas9 variants may facilitate delivery to cells, e.g., by an expression vector, nanoparticle, or other means of delivery.
  • the canonical SpCas9 protein is 1368 amino acids in length and has a predicted molecular weight of 158 kilodaltons.
  • small-sized Cas9 variant refers to any Cas9 variant— naturally occurring, engineered, or otherwise— that is less than at least 1300 amino acids, or at least less than 1290 amino acids, or than less than 1280 amino acids, or less than 1270 amino acid, or less than 1260 amino acid, or less than 1250 amino acids, or less than 1240 amino acids, or less than 1230 amino acids, or less than 1220 amino acids, or less than 1210 amino acids, or less than 1200 amino acids, or less than 1190 amino acids, or less than 1180 amino acids, or less than 1170 amino acids, or less than 1160 amino acids, or less than 1150 amino acids, or less than 1140 amino acids, or less than 1130 amino acids, or less than 1120 amino acids, or less than 1110 amino acids, or less than 1100 amino acids, or less than 1050 amino acids, or less than 1000 amino acids, or less than 950 amino acids, or less than 900 amino acids, or less than 850 amino acids, or less than 800 amino acids, or
  • the base editors disclosed herein may comprise one of the small-sized Cas9 variants described as follows, or a Cas9 variant thereof having at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to any reference small-sized Cas9 protein.
  • Exemplary small-sized Cas9 variants include, but are not limited to, SaCas9 and LbCasl2a.
  • the base editors described herein may also comprise
  • Casl2a/Cpfl (dCpfl) variants that may be used as a guide nucleotide sequence- programmable DNA-binding protein domain.
  • the Casl2a/Cpfl protein has a RuvC-like endonuclease domain that is similar to the RuvC domain of Cas9 but does not have a HNH endonuclease domain, and the N-terminal of Cpfl does not have the alpha-helical recognition lobe of Cas9.
  • Additional exemplary Cas9 equivalent protein sequences can include the following:
  • the napDNAbp is a nucleic acid programmable DNA binding protein that does not require a canonical (NGG) PAM sequence.
  • the napDNAbp is an argonaute protein.
  • NgAgo is a ssDNA-guided endonuclease. NgAgo binds 5' phosphorylated ssDNA of ⁇ 24 nucleotides (gDNA) to guide it to its target site and will make DNA double-strand breaks at the gDNA site.
  • NgAgo-gDNA system does not require a protospacer-adjacent motif (PAM).
  • PAM protospacer-adjacent motif
  • the disclosure provides napDNAbp domains that comprise SpCas9 variants that recognize and work best with NRRH, NRCH, and NRTH PAMs. See PCT Application No. PCT/US2019/47996, incorporated by reference herein.
  • the disclosed base editors comprise a napDNAbp domain selected from SpCas9-NRRH, SpCas9-NRTH, and SpCas9-NRCH.
  • the disclosed base editors comprise a napDNAbp domain that has a sequence that is at least 90%, at least 95%, at least 98%, or at least 99% identical to SpCas9-NRRH.
  • the disclosed base editors comprise a napDNAbp domain that comprises SpCas9-NRRH.
  • the SpCas9-NRRH has an amino acid sequence as presented in SEQ ID NO: 141 (underligned residues are mutated relative to SpCas9, as set forth in SEQ ID NO: 9)
  • the disclosed base editors comprise a napDNAbp domain that has a sequence that is at least 90%, at least 95%, at least 98%, or at least 99% identical to
  • the disclosed base editors comprise a napDNAbp domain that comprises SpCas9-NRCH.
  • the SpCas9-NRCH has an amino acid sequence as presented in SEQ ID NO: 142 (underligned residues are mutated relative to SpCas9)
  • the disclosed base editors comprise a napDNAbp domain that has a sequence that is at least 90%, at least 95%, at least 98%, or at least 99% identical to SpCas9-NRTH.
  • the disclosed base editors comprise a napDNAbp domain that comprises SpCas9-NRTH.
  • the SpCas9-NRTH has an amino acid sequence as presented in SEQ ID NO: 143 (underligned residues are mutated relative to SpCas9)
  • the napDNAbp of any of the disclosed base editors comprises a Cas9 derived from a Streptococcus macacae, e.g. Streptococcus macacae NCTC 11558, or
  • the napDNAbp comprises a hybrid variant of SmacCas9 that incorporates an SpCas9 domain with the SmacCas9 domain and is known as Spy-macCas9, or a variant thereof.
  • the napDNAbp comprises a hybrid variant of SmacCas9 that incorporates an increased nucleolytic variant of an SpCas9 (iSpy Cas9) domain and is known as iSpy-macCas9.
  • iSpyMac-Cas9 contains two mutations, R221K and N394K, that were identified by deep mutational scans of Spy Cas9 that raise modification rates of the protein on most targets.
  • Jakimo et al. showed that the hybrids Spy- macCas9 and iSpy-macCas9 recognize a short 5'-NAA-3' PAM and recognized all evaluated adenine dinucleotide PAM sequences and posseseds robust editing efficiency in human cells.
  • Liu et al. engineered base editors containing Spy-mac Cas9, and demonstrated that cytidine and base editors containing Spymac domains can induce efficient C-to-T and A-to-G conversions in vivo.
  • Liu et al. suggested that the PAM scope of Spy-mac Cas9 may be 5 '-T AAA-3', rather than 5'-NAA-3' as reported by Jakimo et al. See Liu et al. Cell Discovery (2019) 5:58, herein incorporated by reference.
  • the disclosed base editors comprise a napDNAbp domain that has a sequence that is at least 90%, at least 95%, at least 98%, or at least 99% identical to iSpyMac-Cas9.
  • the disclosed base editors comprise a napDNAbp domain that comprises iSpyMac-Cas9.
  • the iSpyMac-Cas9 has an amino acid sequence as presented in SEQ ID NO: 144 (R221K and N394K mutations are underlined):
  • the napDNAbp of any of the disclosed base editors is a prokaryotic homolog of an Argonaute protein.
  • Prokaryotic homologs of Argonaute proteins are known and have been described, for example, in Makarova K., el al.,“Prokaryotic homologs of Argonaute proteins are predicted to function as key components of a novel system of defense against mobile genetic elements”, Biol Direct. 2009 Aug 25;4:29. doi:
  • the napDNAbp is a Marinitoga piezophila Argunaute (MpAgo) protein.
  • the CRISPR-associated Marinitoga piezophila Argunaute (MpAgo) protein cleaves single- stranded target sequences using 5'-phosphorylated guides.
  • the 5' guides are used by all known Argonautes.
  • the crystal structure of an MpAgo-RNA complex shows a guide strand binding site comprising residues that block 5' phosphate interactions. This data suggests the evolution of an Argonaute subclass with noncanonical specificity for a 5'-hydroxylated guide.
  • the napDNAbp is a single effector of a microbial CRISPR-Cas system.
  • Single effectors of microbial CRISPR-Cas systems include, without limitation, Cas9, Cpfl, C2cl, C2c2, and C2c3.
  • microbial CRISPR-Cas systems are divided into Class 1 and Class 2 systems. Class 1 systems have multisubunit effector complexes, while Class 2 systems have a single protein effector.
  • Cas9 and Cpfl are Class 2 effectors.
  • three distinct Class 2 CRISPR-Cas systems (C2cl, C2c2, and C2c3) have been described by Shmakov el al.,“Discovery and Functional
  • C2cl and C2c3 contain RuvC-like endonuclease domains related to Cpfl.
  • a third system, C2c2 contains an effector with two predicated HEPN RNase domains.
  • C2cl Production of mature CRISPR RNA is tracrRNA-independent, unlike production of CRISPR RNA by C2cl.
  • C2cl depends on both CRISPR RNA and tracrRNA for DNA cleavage.
  • Bacterial C2c2 has been shown to possess a unique RNase activity for CRISPR RNA maturation distinct from its RNA-activated single- stranded RNA degradation activity. These RNase functions are different from each other and from the CRISPR RNA-processing behavior of Cpfl. See, e.g., East-Seletsky, et al.,“Two distinct RNase activities of CRISPR- C2c2 enable guide-RNA processing and RNA detection”, Nature, 2016 Oct
  • C2c2 is a single-component programmable RNA-guided RNA- targeting CRISPR effector”, Science, 2016 Aug 5; 353(6299), the entire contents of which are hereby incorporated by reference.
  • the napDNAbp may be a C2cl, a C2c2, or a C2c3 protein. In some embodiments, the napDNAbp is a C2cl protein. In some embodiments, the napDNAbp is a C2c2 protein. In some embodiments, the napDNAbp is a C2c3 protein.
  • the napDNAbp comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to a naturally-occurring C2cl, C2c2, or C2c3 protein.
  • the napDNAbp is a naturally-occurring C2cl, C2c2, or C2c3 protein.
  • Cas9 domains that have different PAM specificities.
  • Cas9 proteins such as Cas9 from S. pyogenes (spCas9)
  • spCas9 require a canonical NGG PAM sequence to bind a particular nucleic acid region. This may limit the ability to edit desired bases within a genome.
  • the base editing base editors provided herein may need to be placed at a precise location, for example where a target base is placed within a 4 base region (e.g ., a“editing window” or a“target window”), which is approximately 15 bases upstream of the PAM. See Komor, A.C., et al,
  • any of the base editors provided herein may contain a Cas9 domain that is capable of binding a nucleotide sequence that does not contain a canonical (e.g., NGG) PAM sequence.
  • Cas9 domains that bind to non-canonical PAM sequences have been described in the art and would be apparent to the skilled artisan.
  • Cas9 domains that bind non-canonical PAM sequences have been described in Kleinstiver, B. P., et al.,“Engineered CRISPR-Cas9 nucleases with altered PAM
  • a napDNAbp domain with altered PAM specificity such as a domain with at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with wild type Francisella novicida Cpfl (SEQ ID NO: 145) (D917, E1006, and D1255), which has the following amino acid sequence:
  • An additional napDNAbp domain with altered PAM specificity such as a domain having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with wild type Geobacillus thermodenitrificans Cas9 (SEQ ID NO: 146), which has the following amino acid sequence:
  • the nucleic acid programmable DNA binding protein [0165] In some embodiments, the nucleic acid programmable DNA binding protein
  • napDNAbp is a nucleic acid programmable DNA binding protein that does not require a canonical (NGG) PAM sequence.
  • the napDNAbp is an argonaute protein.
  • One example of such a nucleic acid programmable DNA binding protein is an Argonaute protein from Natronobacterium gregoryi (NgAgo).
  • NgAgo is a ssDNA-guided endonuclease.
  • NgAgo binds 5' phosphorylated ssDNA of ⁇ 24 nucleotides (gDNA) to guide it to its target site and will make DNA double-strand breaks at the gDNA site.
  • the NgAgo-gDNA system does not require a protospacer-adjacent motif (PAM).
  • NgAgo nuclease inactive NgAgo
  • the characterization and use of NgAgo have been described in Gao et al, Nat Biotechnol., 34(7): 768-73 (2016), PubMed PMID: 27136078; Swarts et al., Nature, 507(7491): 258-61 (2014); and Swarts et al., Nucleic Acids Res. 43(10) (2015): 5120-9, each of which is incorporated herein by reference.
  • the sequence of Natronobacterium gregoryi Argonaute is provided in SEQ ID NO: 147.
  • the disclosed base editors may comprise a napDNAbp domain having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with wild type Natronobacterium gregoryi Argonaute (SEQ ID NO: 147), which has the following amino acid sequence:
  • the base editors disclosed herein may comprise a circular permutant of Cas9.
  • the term“circularly permuted Cas9” or“circular permutant” of Cas9 or“CP-Cas9”) refers to any Cas9 protein, or variant thereof, that occurs or has been modify to engineered as a circular permutant variant, which means the N-terminus and the C-terminus of a Cas9 protein (e.g., a wild type Cas9 protein) have been topically rearranged.
  • Such circularly permuted Cas9 proteins, or variants thereof retain the ability to bind DNA when complexed with a guide RNA (gRNA).
  • gRNA guide RNA
  • any of the Cas9 proteins described herein, including any variant, ortholog, or naturally occurring Cas9 or equivalent thereof, may be reconfigured as a circular permutant variant.
  • the circular permutants of Cas9 may have the following structure:
  • the present disclosure contemplates the following circular permutants of canonical S. pyogenes Cas9 (1368 amino acids of UniProtKB - Q99ZW2 (CAS9_STRP1) (numbering is based on the amino acid position in SEQ ID NO: 9)):
  • the circular permuant Cas9 has the following structure (based on S. pyogenes Cas9 (1368 amino acids of UniProtKB - Q99ZW2 (CAS9_STRP1) (numbering is based on the amino acid position in SEQ ID NO: 9):
  • the circular permuant Cas9 has the following structure (based on S. pyogenes Cas9 (1368 amino acids of UniProtKB - Q99ZW2 (CAS9_STRP1) (numbering is based on the amino acid position in SEQ ID NO: 9): N -terminu s- [103-1368] - [optional linker] - [ 1 - 102] -C -terminu s ;
  • the circular permutant can be formed by linking a C-terminal fragment of a Cas9 to an N-terminal fragment of a Cas9, either directly or by using a linker, such as an amino acid linker.
  • the C-terminal fragment may correspond to the C-terminal 95% or more of the amino acids of a Cas9 (e.g., amino acids about 1300-1368), or the C-terminal 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%,
  • the N-terminal portion may correspond to the N-terminal 95% or more of the amino acids of a Cas9 (e.g., amino acids about 1-1300), or the N-terminal 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% or more of a Cas9 (e.g., of SEQ ID NO: 9).
  • a Cas9 e.g., amino acids about 1-1300
  • the N-terminal 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% or more of a Cas9 e.g., of SEQ ID NO: 9).
  • the circular permutant can be formed by linking a C-terminal fragment of a Cas9 to an N-terminal fragment of a Cas9, either directly or by using a linker, such as an amino acid linker.
  • the C-terminal fragment that is rearranged to the N-terminus includes or corresponds to the C-terminal 30% or less of the amino acids of a Cas9 (e.g., amino acids 1012-1368 of SEQ ID NO: 9).
  • the C-terminal fragment that is rearranged to the N-terminus includes or corresponds to the C-terminal 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%,
  • the C-terminal fragment that is rearranged to the N-terminus includes or corresponds to the C-terminal 410 residues or less of a Cas9 (e.g., the Cas9 of SEQ ID NO:
  • the C-terminal portion that is rearranged to the N-terminus includes or corresponds to the C-terminal 410, 400, 390, 380, 370, 360, 350, 340, 330, 320, 310, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140,
  • circular permutant Cas9 variants may be defined as a topological rearrangement of a Cas9 primary structure based on the following method, which is based on S.
  • pyogenes Cas9 of SEQ ID NO: 9 (a) selecting a circular permutant (CP) site corresponding to an internal amino acid residue of the Cas9 primary structure, which dissects the original protein into two halves: an N-terminal region and a C-terminal region; (b) modifying the Cas9 protein sequence (e.g., by genetic engineering techniques) by moving the original C-terminal region (comprising the CP site amino acid) to preceed the original N- terminal region, thereby forming a new N-terminus of the Cas9 protein that now begins with the CP site amino acid residue.
  • CP circular permutant
  • the CP site can be located in any domain of the Cas9 protein, including, for example, the helical-II domain, the RuvCIII domain, or the CTD domain.
  • the CP site may be located (relative the S. pyogenes Cas9 of SEQ ID NO: 9) at original amino acid residue 181, 199, 230, 270, 310, 1010, 1016, 1023, 1029, 1041, 1247, 1249, or 1282.
  • original amino acid 181, 199, 230, 270, 310, 1010, 1016, 1023, 1029, 1041, 1247, 1249, or 1282 would become the new N- terminal amino acid.
  • Nomenclature of these CP-Cas9 proteins may be referred to as Cas9- CP 181 , Cas9-CP 199 , Cas9-CP 230 , Cas9-CP 270 , Cas9-CP 310 , Cas9-CP 1010 , Cas9-CP 1016 , Cas9- CP 1023 , Cas9-CP 1029 , Cas9-CP 1041 , Cas9-CP 1247 , Cas9-CP 1249 , and Cas9-CP 1282 , respectively.
  • This description is not meant to be limited to making CP variants from SEQ ID NO: 9, but may be implemented to make CP variants in any Cas9 sequence, either at CP sites that correspond to these positions, or at other CP sites entireley. This description is not meant to limit the specific CP sites in any way. Virtually any CP site may be used to form a CP-Cas9 variant.
  • Exemplary CP-Cas9 amino acid sequences are provided below in which linker sequences are indicated by underlining and optional methionine (M) residues are indicated in bold. It should be appreciated that the disclosure provides CP-Cas9 sequences that do not include a linker sequence or that include different linker sequences. It should be appreciated that CP-Cas9 sequences may be based on Cas9 sequences other than that of SEQ ID NO: 9 and any examples provided herein are not meant to be limiting. Exemplary CP-Cas9 sequences are as follows:
  • Cas9 circular permutants that may be useful in the base editor constructs described herein.
  • Exemplary C-terminal fragments of Cas9 based on the Cas9 of SEQ ID NO: 9, which may be rearranged to an N-terminus of Cas9, are provided below. It should be appreciated that such C-terminal fragments of Cas9 are exemplary and are not meant to be limiting.
  • These exemplary CP-Cas9 fragments have the following sequences:
  • the base editors of the present disclosure may also comprise Cas9 variants with modified PAM specificities.
  • Some aspects of this disclosure provide Cas9 proteins that exhibit activity on a target sequence that does not comprise the canonical PAM (5'-NGG-3', where N is A, C, G, or T) at its 3 '-end.
  • the Cas9 protein exhibits activity on a target sequence comprising a 5'-NGG-3' PAM sequence at its 3 '-end.
  • the Cas9 protein exhibits activity on a target sequence comprising a 5 -NNG- 3' PAM sequence at its 3 '-end.
  • the Cas9 protein exhibits activity on a target sequence comprising a 5'-NNA-3' PAM sequence at its 3 '-end. In some embodiments, the Cas9 protein exhibits activity on a target sequence comprising a 5'-NNC-3' PAM sequence at its 3 '-end. In some embodiments, the Cas9 protein exhibits activity on a target sequence comprising a 5 -NNT-3' PAM sequence at its 3'-end. In some embodiments, the Cas9 protein exhibits activity on a target sequence comprising a 5 -NGT-3' PAM sequence at its 3'-end.
  • the Cas9 protein exhibits activity on a target sequence comprising a 5 -NGA-3' PAM sequence at its 3'-end. In some embodiments, the Cas9 protein exhibits activity on a target sequence comprising a 5 -NGC-3' PAM sequence at its 3'-end. In some embodiments, the Cas9 protein exhibits activity on a target sequence comprising a 5'- NAA-3' PAM sequence at its 3 -end. In some embodiments, the Cas9 protein exhibits activity on a target sequence comprising a 5 -NAC-3' PAM sequence at its 3 '-end.
  • the Cas9 protein exhibits activity on a target sequence comprising a 5 -NAT-3' PAM sequence at its 3 -end. In still other embodiments, the Cas9 protein exhibits activity on a target sequence comprising a 5 -NAG-3' PAM sequence at its 3 -end.
  • the disclosed base editors comprise a napDNAbp domain comprising a SpCas9-NG, which has a PAM that corresponds to NGN.
  • the disclosed base editors comprise a napDNAbp domain comprising a SpCas9-KKH, which has a PAM that corresponds to NNNRRT (SEQ ID NO: 160).
  • any of the amino acid mutations described herein, (e.g., A262T) from a first amino acid residue (e.g., A) to a second amino acid residue (e.g., T) may also include mutations from the first amino acid residue to an amino acid residue that is similar to (e.g., conserved) the second amino acid residue.
  • mutation of an amino acid with a hydrophobic side chain may be a mutation to a second amino acid with a different hydrophobic side chain (e.g., alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan).
  • alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan may be a mutation to a second amino acid with a different hydrophobic side chain (e.g., alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan).
  • a mutation of an alanine to a threonine may also be a mutation from an alanine to an amino acid that is similar in size and chemical properties to a threonine, for example, serine.
  • mutation of an amino acid with a positively charged side chain e.g., arginine, histidine, or lysine
  • mutation of a second amino acid with a different positively charged side chain e.g., arginine, histidine, or lysine.
  • mutation of an amino acid with a polar side chain may be a mutation to a second amino acid with a different polar side chain (e.g., serine, threonine, asparagine, or glutamine).
  • Additional similar amino acid pairs include, but are not limited to, the following: phenylalanine and tyrosine; asparagine and glutamine; methionine and cysteine; aspartic acid and glutamic acid; and arginine and lysine. The skilled artisan would recognize that such conservative amino acid substitutions will likely have minor effects on protein structure and are likely to be well tolerated without compromising function.
  • any amino of the amino acid mutations provided herein from one amino acid to a threonine may be an amino acid mutation to a serine.
  • any amino of the amino acid mutations provided herein from one amino acid to an arginine may be an amino acid mutation to a lysine.
  • any amino of the amino acid mutations provided herein from one amino acid to an isoleucine may be an amino acid mutation to an alanine, valine, methionine, or leucine.
  • any amino of the amino acid mutations provided herein from one amino acid to a lysine may be an amino acid mutation to an arginine.
  • any amino of the amino acid mutations provided herein from one amino acid to an aspartic acid may be an amino acid mutation to a glutamic acid or asparagine.
  • any amino of the amino acid mutations provided herein from one amino acid to a valine may be an amino acid mutation to an alanine, isoleucine, methionine, or leucine.
  • any amino of the amino acid mutations provided herein from one amino acid to a glycine may be an amino acid mutation to an alanine. It should be appreciated, however, that additional conserved amino acid residues would be recognized by the skilled artisan and any of the amino acid mutations to other conserved amino acid residues are also within the scope of this disclosure.
  • the present disclosure may utilize any of the Cas9 variants disclosed in the SEQUENCES section herein.
  • the Cas9 protein comprises a combination of mutations that exhibit activity on a target sequence comprising a 5 -NAA-3' PAM sequence at its 3 - end.
  • the combination of mutations are present in any one of the clones listed in Table 1.
  • the combination of mutations are conservative mutations of the clones listed in Table 1.
  • the Cas9 protein comprises the combination of mutations of any one of the Cas9 clones listed in Table 1.
  • the Cas9 protein comprises an amino acid sequence that is at least 80% identical to the amino acid sequence of a Cas9 protein as provided by any one of the variants of Table 1. In some embodiments, the Cas9 protein comprises an amino acid sequence that is at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a Cas9 protein as provided by any one of the variants of Table 1.
  • the Cas9 protein exhibits an increased activity on a target sequence that does not comprise the canonical PAM (5'-NGG-3') at its 3' end as compared to Streptococcus pyogenes Cas9 as provided by SEQ ID NO: 9.
  • the Cas9 protein exhibits an activity on a target sequence having a 3' end that is not directly adjacent to the canonical PAM sequence (5'-NGG-3') that is at least 5-fold increased as compared to the activity of Streptococcus pyogenes Cas9 as provided by SEQ ID NO: 9 on the same target sequence.
  • the Cas9 protein exhibits an activity on a target sequence that is not directly adjacent to the canonical PAM sequence (5'-NGG-3') that is at least 10- fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1,000-fold, at least 5,000- fold, at least 10,000-fold, at least 50,000-fold, at least 100,000-fold, at least 500,000-fold, or at least 1,000,000-fold increased as compared to the activity of Streptococcus pyogenes as provided by SEQ ID NO: 9 on the same target sequence.
  • the 3' end of the target sequence is directly adjacent to an AAA, GAA, CAA, or TAA sequence.
  • the Cas9 protein comprises a combination of mutations that exhibit activity on a target sequence comprising a 5 -NAC-3' PAM sequence at its 3 '-end.
  • the combination of mutations are present in any one of the clones listed in Table 2. In some embodiments, the combination of mutations are conservative mutations of the clones listed in Table 2. In some embodiments, the Cas9 protein comprises the combination of mutations of any one of the Cas9 clones listed in Table 2.
  • the Cas9 protein comprises an amino acid sequence that is at least 80% identical to the amino acid sequence of a Cas9 protein as provided by any one of the variants of Table 2. In some embodiments, the Cas9 protein comprises an amino acid sequence that is at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a Cas9 protein as provided by any one of the variants of Table 2.
  • the Cas9 protein comprises a combination of mutations that exhibit activity on a target sequence comprising a 5'-NAT-3' PAM sequence at its 3 '-end.
  • the combination of mutations are present in any one of the clones listed in Table 3.
  • the combination of mutations are conservative mutations of the clones listed in Table 3.
  • the Cas9 protein comprises the combination of mutations of any one of the Cas9 clones listed in Table 3.
  • the above description of various napDNAbps which can be used in connection with the presently disclose base editors is not meant to be limiting in any way.
  • the base editors may comprise the canonical SpCas9, or any ortholog Cas9 protein, or any variant Cas9 protein— including any naturally occurring variant, mutant, or otherwise engineered version of Cas9— that is known or which can be made or evolved through a directed evolutionary or otherwise mutagenic process.
  • the Cas9 or Cas9 varants have a nickase activity, i.e., only cleave of strand of the target DNA sequence.
  • the Cas9 or Cas9 variants have inactive nucleases, i.e., are“dead” Cas9 proteins.
  • Other variant Cas9 proteins that may be used are those having a smaller molecular weight than the canonical SpCas9 (e.g., for easier delivery) or having modified or rearranged primary amino acid structure (e.g., the circular permutant formats).
  • the base editors described herein may also comprise Cas9 equivalents, including Casl2a/Cpfl and Casl2b proteins which are the result of convergent evolution.
  • the napDNAbps used herein may also may also contain various modifications that alter/enhance their PAM specifities.
  • the application contemplates any Cas9, Cas9 variant, or Cas9 equivalent which has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.9% sequence identity to a reference Cas9 sequence, such as a references SpCas9 canonical sequences or a reference Cas9 equivalent (e.g., Casl2a/Cpfl).
  • a reference Cas9 sequence such as a references SpCas9 canonical sequences or a reference Cas9 equivalent (e.g., Casl2a/Cpfl).
  • the Cas9 variant having expanded PAM capabilities is SpCas9 (H840A) VRQR, or SpCas9-VRQR.
  • the disclosed base editors comprise a napDNAbp domain that has a sequence that is at least 90%, at least 95%, at least 98%, or at least 99% identical to SpCas9-VRQR.
  • the disclosed base editors comprise a napDNAbp domain that comprises SpCas9-VRQR.
  • the SpCas9- VRQR comprises the following amino acid sequence (with the V, R, Q, R substitutions relative to the SpCas9 (H840A) of SEQ ID NO: 158 show, in bold underline.
  • the methionine residue in SpCas9 (H840) was removed for SpCas9 (H840A) VRQR):
  • the Cas9 variant having expanded PAM has expanded PAM
  • SpCas9 (H840A) VRER having the following amino acid sequence (with the V, R, E, R substitutions relative to the SpCas9 (H840A) of SEQ ID NO: 159 are shown in bold underline. In addition, the methionine residue in SpCas9 (H840) was removed for SpCas9 (H840A) VRER):
  • any available methods may be utilized to obtain or construct a variant or mutant Cas9 protein.
  • the term“mutation,” as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue.
  • Mutations can include a variety of categories, such as single base polymorphisms, microduplication regions, indel, and inversions, and is not meant to be limiting in any way. Mutations can include“loss-of-function” mutations which is the normal result of a mutation that reduces or abolishes a protein activity.
  • Gain-of-function mutations are recessive, because in a heterozygote the second chromosome copy carries an unmutated version of the gene coding for a fully functional protein whose presence compensates for the effect of the mutation. Mutations also embrace“gain-of-function” mutations, which is one which confers an abnormal activity on a protein or cell that is otherwise not present in a normal condition. Many gain-of-function mutations are in regulatory sequences rather than in coding regions, and can therefore have a number of consequences. For example, a mutation might lead to one or more genes being expressed in the wrong tissues, these tissues gaining functions that they normally lack. Because of their nature, gain-of-function mutations are usually dominant.
  • Mutations can be introduced into a reference Cas9 protein using site-directed mutagenesis.
  • Older methods of site-directed mutagenesis known in the art rely on sub cloning of the sequence to be mutated into a vector, such as an M13 bacteriophage vector, that allows the isolation of single-stranded DNA template.
  • a mutagenic primer i.e., a primer capable of annealing to the site to be mutated but bearing one or more mismatched nucleotides at the site to be mutated
  • a mutagenic primer i.e., a primer capable of annealing to the site to be mutated but bearing one or more mismatched nucleotides at the site to be mutated
  • PCR-based site-directed mutagenesis has employed PCR methodologies, which have the advantage of not requiring a single-stranded template.
  • methods have been developed that do not require sub-cloning.
  • Several issues must be considered when PCR-based site-directed mutagenesis is performed. First, in these methods it is desirable to reduce the number of PCR cycles to prevent expansion of undesired mutations introduced by the polymerase. Second, a selection must be employed in order to reduce the number of non-mutated parental molecules persisting in the reaction. Third, an extended-length PCR method is preferred in order to allow the use of a single PCR primer set. And fourth, because of the non-template-dependent terminal extension activity of some thermostable polymerases it is often necessary to incorporate an end-polishing step into the procedure prior to blunt-end ligation of the PCR-generated mutant product.
  • the ACBE and TGBE transversion base editors provided herein comprise an adenine oxidase nucleobase modification domain (FIG. 1).
  • An adenine oxidase is an enzyme that has catalytic activity in oxidizing an adenosine nucleobase substrate.
  • Exemplary oxidases of this disclosure catalyze oxidation reactions at the 8 position of adenosine.
  • the adenine oxidases of the present disclosure may be modified from wild-type reference proteins, which include 5-methylcytosine, L0 -mcthyladcnosinc and xanthine modification enzymes.
  • Other modification enzymes that may serve as reference proteins are N 4 -acetylcytosine- and 2-thiocytosine-installing RNA-modification enzymes. See Ito, S. et al. Human NAT 10 Is an ATP-dependent RNA Acetyltransferase responsible for N4- Acetylcytidine Formation in 18 S Ribosomal RNA (rRNA). J. Biol. Chem. 2014, 289, 35724-35730; and Cavuzic, V.; Liu, Y., Biosynthesis of Sulfur-Containing tRNA
  • Wild-type reference proteins may be those from E. coli, S. cyanogenus, yeast, mouse, human, or another organism, including other bacteria. See also Falnes, P. 0.; Rognes, T. DNA repair by bacterial AlkB proteins, Res. Microbiol. (2003) 154(8): 531-538; Ito, S. et al, Tet proteins can convert 5- methylcytosine to 5-formylcytosine and 5-carboxylcytosine, Science (2011) 333(6047):
  • Modified adenine oxidases include variants with at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to a wild-type adenine oxidase.
  • modified adenine oxidases may be obtained by altering or evolving a reference protein using a continuous evolution process (e.g., PACE) or non-continuous evolution process (e.g., PANCE or discrete plate -based selections) described herein so that the oxidase is effective on a nucleic acid target.
  • a continuous evolution process e.g., PACE
  • non-continuous evolution process e.g., PANCE or discrete plate -based selections
  • 8-oxopurines common products of oxidative DNA damage, tend to rotate around the glycosidic bond to adopt the syn conformation, presenting the Hoogsteen edge for base pairing.
  • the Hoogsteen edge of 8-oxoA and the Watson-Crick edge of G form a base pair featuring two three-center hydrogen bonding systems (FIG. 2).
  • the 8-oxoA:G pair makes a minimal perturbation to the DNA double helix. Consequently, polymerases misread 8-oxoA and pair it with G, eventually resulting in an A:T to C:G transversion mutation. See Kamiya, H.
  • Exemplary adenine oxidases include, but are not limited to, a-ketoglutarate-dependent iron oxidases, molybdopterin-dependent oxidases, heme iron oxidases, and flavin
  • Exemplary a-ketoglutarate-dependent iron oxidases include AlkbH (ABH) family oxidases, which include human AlkBH3, is to clear /Vl-methylation from adenine in DNA and RNA. These non-heme enzymes perform methyl group C-H hydroxylation on DNA and RNA via an active Fe(IV)-oxo intermediate formed through an iron cofactor. The resulting hemiaminal breaks down to release formaldehyde and the demethylated adenine base.
  • ABH3 is selective for ssDNA over dsDNA, a characteristic of exocyclic amine hydrolyzing enzymes that likely contributes to the selective modification of bases in the targeted ssDNA loop of the ternary Cas9-sgRNA-DNA complex.
  • the TET oxidases are structurally related a-ketoglutarate-dependent iron oxidases and perform C-H hydroxylation on 5-methylcytosine as the first step in removing this important epigenetic marker. Oxidized forms of 5-methylcytosine are recognized by DNA glycosylases and hydrolytically removed, to be replaced eventually by unmethylated cytosine.
  • the Fe(IV)-oxo species of the cofactor- enzyme may be induced to transfer the oxo group from the non-heme Fe(IV) center to the 8 position of adenine.
  • This potential mechanism involves the formation of a 7,8-oxaziridine intermediate, which rearranges spontaneously to the desired 8-oxoadenine (FIG. 3).
  • Exemplary molybdopterin-dependent oxidases that selectively oxidize adenine at the 8 position include xanthine dehydrogenases and aldehyde oxidases. In eukaryotes, these enzymes utilize a monophosphate pyranopterin cofactor, which complexes with a
  • molybdenum to form molybdenum cofactor may effect alkene/arene epoxidation reactions in natural product biosynthesis pathways via similar oxo group transfer mechanisms as those of the non-heme ABH and TET iron oxidases.
  • Exemplary heme iron oxidases that selectively oxidize adenine at the 8 position include cytochrome P450 enzymes.
  • exemplary adenine oxidase domains that can be fused to napDNAbp domains according to embodiments of this disclosure are provided below.
  • Exemplary adenine oxidase domains include variants with at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to the following wild-type enzymes:
  • Cytochrome P 1A2 (“CYP1A2”) (human):
  • TET1-CD (“Catalytic domain”) (human):
  • the disclosed fusion proteins comprise an adenine oxidase domain that does not comprise a variant of an alkB dehydrogenase or alkA dehydrogenase. In some embodiments, the disclosed fusion proteins comprise an adenine oxidase domain that does not comprise a TET family dioxygenase, such as TET1. In some embodiments, the disclosed fusion proteins comprise an adenine oxidase domain that does not comprise a variant of a TET family dioxygenase. In some embodiments, the disclosed fusion proteins do not comprise an alkA dehydrogenase, an alkB dehydrogenase, or a TET family dioxygenase, or a variant thereof.
  • the base editors disclosed herein further comprise one or more additional base editor elements, e.g., a nuclear localization signal(s), an inhibitor of base excision repair, and/or a heterologous protein domain.
  • additional base editor elements e.g., a nuclear localization signal(s), an inhibitor of base excision repair, and/or a heterologous protein domain.
  • the base editors disclosed herein further comprise one or more, preferably, at least two nuclear localization signals.
  • the base editors comprise at least two NLSs.
  • the NLSs can be the same NLSs, or they can be different NLSs.
  • the NLSs may be expressed as part of a fusion protein with the remaining portions of the base editors.
  • one or more of the NLSs are bipartite NLSs (“bpNLS”).
  • bpNLS bipartite NLSs
  • the disclosed fusion proteins comprise two bipartite NLSs. In some embodiments, the disclosed fusion proteins comprise more than two bipartite NLSs.
  • the location of the NLS fusion can be at the N-terminus, the C-terminus, or within a sequence of a base editor (e.g., inserted between the encoded napDNAbp domain (e.g., Cas9) and a DNA nucleobase modification domain (e.g., an adenine oxidase)).
  • a base editor e.g., inserted between the encoded napDNAbp domain (e.g., Cas9) and a DNA nucleobase modification domain (e.g., an adenine oxidase)).
  • the NLSs may be any known NLS sequence in the art.
  • the NLSs may also be any future-discovered NLSs for nuclear localization.
  • the NLSs also may be any naturally- occurring NLS, or any non-naturally occurring NLS (e.g., an NLS with one or more desired mutations).
  • nuclear localization sequence refers to an amino acid sequence that promotes import of a protein into the cell nucleus, for example, by nuclear transport. Nuclear localization sequences are known in the art and would be apparent to the skilled artisan. Lor example, NLS sequences are described in Plank et al., International PCT application PCT/EP2000/011690, filed November 23, 2000, published as WO/2001/038547 on May 31, 2001, the contents of which are incorporated herein by reference.
  • an NLS comprises the amino acid sequence PKKKRKV (SEQ ID NO: 51), MDSLLMNRRKFLY QFKNVRWAKGRRETYLC (SEQ ID NO: 52),
  • NLS comprises the amino acid sequences
  • a base editor may be modified with one or more nuclear localization signals (NLS), preferably at least two NLSs.
  • the base editors are modified with two or more NLSs.
  • the invention contemplates the use of any nuclear localization signal known in the art at the time of the invention, or any nuclear localization signal that is identified or otherwise made available in the state of the art after the time of the instant filing.
  • a representative nuclear localization signal is a peptide sequence that directs the protein to the nucleus of the cell in which the sequence is expressed.
  • a nuclear localization signal is predominantly basic, can be positioned almost anywhere in a protein's amino acid sequence, generally comprises a short sequence of four amino acids (Autieri & Agrawal, (1998) J.
  • Nuclear localization signals often comprise proline residues.
  • a variety of nuclear localization signals have been identified and have been used to effect transport of biological molecules from the cytoplasm to the nucleus of a cell. See, e.g., Tinland et al., (1992) Proc. Natl. Acad. Sci. U.S.A. 89:7442-46; Moede et al., (1999) FEBS Lett. 461:229-34, which is incorporated by reference. Translocation is currently thought to involve nuclear pore proteins.
  • NLSs can be classified in three general groups: (i) a monopartite NLS exemplified by the SV40 large T antigen NLS (PKKKRKV (SEQ ID NO: 51)); (ii) a bipartite motif consisting of two basic domains separated by a variable number of spacer amino acids and exemplified by the Xenopus nucleoplasmin NLS (KRXXXXXXXXXKKKL (SEQ ID NO: 50)); and (iii) noncanonical sequences such as M9 of the hnRNP Al protein, the influenza virus nucleoprotein NLS, and the yeast Gal4 protein NLS (Dingwall and Laskey 1991).
  • NLS nuclear localization signals appear at various points in the amino acid sequences of proteins.
  • NLS have been identified at the N-terminus, the C-terminus, and in the central region of proteins.
  • the specification provides base editors that may be modified with one or more NLSs at the C -terminus, the N-terminus, as well as at in internal region of the base editor.
  • the residues of a longer sequence that do not function as component NLS residues should be selected so as not to interfere, for example tonically or sterically, with the nuclear localization signal itself. Therefore, although there are no strict limits on the composition of an NLS -comprising sequence, in practice, such a sequence can be
  • the present disclosure contemplates any suitable means by which to modify a base editor to include one or more NLSs.
  • the base editors can be engineered to express a base editor protein that is translationally fused at its N-terminus or its C-terminus (or both) to one or more NLSs, i.e., to form a base editor-NLS fusion construct.
  • the base editor-encoding nucleotide sequence can be genetically modified to incorporate a reading frame that encodes one or more NLSs in an internal region of the encoded base editor.
  • the NLSs may include various amino acid linkers or spacer regions encoded between the base editor and the N-terminally, C-terminally, or internally- attached NLS amino acid sequence, e.g, and in the central region of proteins.
  • the present disclosure also provides for nucleotide constructs, vectors, and host cells for expressing fusion proteins that comprise a base editor and one or more NLSs.
  • the base editors described herein may also comprise nuclear localization signals which are linked to a base editor through one or more linkers, e.g., and polymeric, amino acid, nucleic acid, polysaccharide, chemical, or nucleic acid linker element.
  • linkers within the contemplated scope of the disclosure are not intented to have any limitations and can be any suitable type of molecule (e.g., polymer, amino acid, polysaccharide, nucleic acid, lipid, or any synthetic chemical linker domain) and be joined to the base editor by any suitable strategy that effectuates forming a bond (e.g., covalent linkage, hydrogen bonding) between the base editor and the one or more NLSs.
  • the base editors described herein also may include one or more additional elements.
  • an additional element may comprise an effector of base repair.
  • the base editors described herein may comprise an inhibitor of base excision repair.
  • the term“inhibitor of base excision repair” or“iBER” refers to a protein that is capable of inhibiting the activity of a nucleic acid repair enzyme, for example a base excision repair enzyme.
  • Mammalian cells clear 8-oxoadenine lesions that arise naturally from oxidative DNA damage by action of thymine-DNA glycosylase (TDG), which hydrolytically cleaves the glycosidic bond of the damaged base, leaving behind an abasic site (FIG. 5). Abasic sites are excised by AP lyase during the base excision repair process, introducing a break in the modified DNA strand.
  • TDG thymine-DNA glycosylase
  • an iBER is fused to to the fusion proteins disclosed herein, to compete for binding of the 8-oxoadenine lesion with active, endogenous excision repair enzymes, preventing or slowing base excision repair.
  • the iBER is an inhibitor of 8-oxoadenine base excision repair.
  • Exemplary iBERs include OGG inhibitors, MUG inhibitors, and TDG inhibitors.
  • Exemplary iBERs include inhibitors of hOGGl, hTDG, ecMUG, APE1, Endo III, Endo IV, Endo V, Endo VIII, Fpg, hNEILl, T7 Endol, T4PDG, UDG, hSMUGl, and hAAG.
  • the iBER may be a catalytically inactive OGG, a catalytically inactive TDG, a catlytically inactive MUG, or small molecule or peptide inhibitor of OGG, TDG, or MUG, or a variant threreof.
  • the iBER is a catalytically inactive TDG.
  • exemplary catalytically inactive TDGs include mutagenized variants of wild-type TDG (SEQ ID NO:
  • Exemplary catalytically inactive MUGs include mutagenized variants of wild-type MUG (SEQ ID NO: 44) that bind DNA nucleobases, including 8-oxoadenine, but lack DNA glycosylase activity.
  • An exemplary catalytically inactive hTDG is an N140A mutant of SEQ ID NO: 43, shown below as SEQ ID NO: 46.
  • an exemplary catalytically inactive ecMUG is an N18A mutant of SEQ ID NO: 44, shown below as SEQ ID NO: 47.
  • exemplary iBERs comprise variants with at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to wild-type hTDG and ecMUG, above.
  • Other exemplary iBERs comprise variants with at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to wild-type hOGGl, UDG, hSMUGl, and hAAG.
  • the fusion proteins described herein may comprise one or more heterologous protein domains (e.g., about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the base editor components).
  • a fusion protein may comprise any additional protein sequence, and optionally a linker sequence between any two domains.
  • localization sequences such as cytoplasmic localization sequences, export sequences, such as nuclear export sequences, or other localization sequences, as well as sequence tags.
  • protein domains that may be fused to a fusion protein or component thereof (e.g., the napDNAbp domain, the nucleobase modification domain, or the NLS domain) include, without limitation, epitope tags and reporter gene sequences.
  • epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
  • reporter genes include, but are not limited to, glutathione-5-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta- glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP).
  • GST glutathione-5-transferase
  • HRP horseradish peroxidase
  • CAT chloramphenicol acetyltransferase
  • beta-galactosidase beta-galactosidase
  • beta-glucuronidase beta-galactosidase
  • luciferase green fluorescent protein
  • GFP green fluorescent protein
  • HcRed HcRed
  • DsRed cyan fluorescent protein
  • YFP
  • a base editor may be fused to a gene sequence encoding a protein or a fragment of a protein that bind DNA molecules or bind other cellular molecules, including, but not limited to, maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP 16 protein fusions. Additional domains that may form part of a base editor are described in US Patent Publication No. 2011/0059502, published March 10, 2011, and incorporated herein by reference in its entirety.
  • a reporter gene which includes, but is not limited to, glutathione-5-transferase (GST), horseradish peroxidase (HRP), chloramphenicol
  • acetyltransferase beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP), may be introduced into a cell to encode a gene product which serves as a marker by which to measure the alteration or modification of expression of the gene product.
  • the gene product is luciferase.
  • the expression of the gene product is decreased.
  • Suitable protein tags include, but are not limited to, biotin carboxylase carrier protein (BCCP) tags, myc- tags, calmodulin-tags, FLAG-tags, hemagglutinin (HA)-tags, bgh-PolyA tags, polyhistidine tags, and also referred to as histidine tags or His-tags, maltose binding protein (MBP)-tags, nus-tags, glutathione-S-transferase (GST)-tags, green fluorescent protein (GFP)-tags, thioredoxin-tags, S-tags, Softags (e.g., Softag 1, Softag 3), strep-tags , biotin ligase tags, FlAsH tags, V5 tags, and SBP-tags. Additional suitable sequences will be apparent to those of skill in the art.
  • the fusion protein comprises one or more His tags. IV. Linkers
  • linkers may be used to link any of the peptides or peptide domains or domains of the base editor (e.g., domain A covalently linked to domain B which is covalently linked to domain C).
  • the term“linker,” as used herein, refers to a chemical group or a molecule linking two molecules or domains, e.g., a binding domain and a cleavage domain of a nuclease.
  • a linker joins a gRNA binding domain of a napDNAbp and the catalytic domain of a recombinase.
  • a linker joins a dCas9 and base editor domain (e.g., an adenine oxidase).
  • the linker is positioned between, or flanked by, two groups, molecules, or other domains and connected to each one via a covalent bond, thus connecting the two.
  • the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein).
  • the linker is an organic molecule, group, polymer, or chemical domain. Chemical domains include, but are not limited to, disulfide, hydrazone, thiol and azo domains.
  • the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
  • the linker is a molecule in length. Longer or shorter linkers are also contemplated.
  • the linker may be as simple as a covalent bond, or it may be a polymeric linker many atoms in length.
  • the linker is a polpeptide or based on amino acids. In other embodiments, the linker is not peptide-like.
  • the linker is a covalent bond (e.g., a carbon-carbon bond, disulfide bond, carbon-heteroatom bond, etc.).
  • the linker is a carbon-nitrogen bond of an amide linkage.
  • the linker is a cyclic or acyclic, substituted or unsubstituted, branched or unbranched aliphatic or hetero aliphatic linker.
  • the linker is polymeric (e.g., polyethylene, polyethylene glycol, polyamide, polyester, etc.). In certain embodiments, the linker comprises a monomer, dimer, or polymer of aminoalkanoic acid. In certain embodiments, the linker comprises an aminoalkanoic acid (e.g., glycine, ethanoic acid, alanine, beta-alanine, 3-aminopropanoic acid, 4-aminobutanoic acid, 5- pentanoic acid, etc.). In certain embodiments, the linker comprises a monomer, dimer, or polymer of aminohexanoic acid (Ahx).
  • Ahx aminohexanoic acid
  • the linker is based on a carbocyclic domain (e.g., cyclopentane, cyclohexane). In other embodiments, the linker comprises a polyethylene glycol domain (PEG). In other embodiments, the linker comprises amino acids. In certain embodiments, the linker comprises a peptide. In certain embodiments, the linker comprises an aryl or heteroaryl domain. In certain embodiments, the linker is based on a phenyl ring. The linker may included funtionalized domains to facilitate attachment of a nucleophile (e.g., thiol, amino) from the peptide to the linker. Any electrophile may be used as part of the linker. Exemplary electrophiles include, but are not limited to, activated esters, activated amides, Michael acceptors, alkyl halides, aryl halides, acyl halides, and isothiocyanates.
  • electrophile include, but are not limited to, activated
  • the linker comprises the amino acid sequence (GGGGS) n (SEQ ID NO: 78), (G) context (SEQ ID NO: 79), (EAAAK) meaning (SEQ ID NO: 80), (GGS) friendship (SEQ ID NO: 81), (SGGS) n (SEQ ID NO: 82), (XP) n (SEQ ID NO: 83), or any combination thereof, wherein n is independently an integer between 1 and 30, and wherein X is any amino acid.
  • the linker comprises the amino acid sequence (GGS) n (SEQ ID NO: 70), wherein n is 1, 3, or 7.
  • the linker comprises the amino acid sequence SGSETPGTSESATPES (SEQ ID NO: 48). In some embodiments, the linker comprises the amino acid sequence SGGSSGGSSGS ETPGT S ES ATPES SGGSSGGS (SEQ ID NO: 11), also known as XTEN linker. In some embodiments, the linker comprises the amino acid sequence SGGSGGSGGS (SEQ ID NO: 12). In some embodiments, the linker comprises the amino acid sequence SGGS (SEQ ID NO: 14).
  • the fusion protein comprises the structure [adenine oxidase] - [optional linker sequence] -[dCas9 or Cas9 nickase]- [optional linker sequence], or [dCas9 or Cas9 nickase] -[optional linker sequence] -[adenine oxidase].
  • the fusion protein comprises the structure [adenine oxidase] - [optional linker sequence] -[dCas9 or Cas9 nickase] -[optional linker sequence] -[iBER];
  • the fusion protein comprises one or more nuclear localization sequences, and comprises the structure [adenine oxidase] -[optional linker sequence]-[dCas9 or Cas9 nickase] -[optional linker sequence] -[iBER] -[optional linker sequence] -[NLS];
  • the target nucleotide sequence is a DNA sequence in a genome, e.g. a eukaryotic genome.
  • the target nucleotide sequence is in a mammalian (e.g. a human) genome.
  • the target nucleotide sequence is in a human genome.
  • the target nucleotide sequence is in the genome of a rodent, such as a mouse or rate.
  • the target nucleotide sequence is in the genome of a domesticated animal, such as a horse, cat, dog, or rabbit.
  • Some embodiments of the disclosure are based on the recognition that any of the fusion proteins provided herein are capable of modifying a specific nucleobase without generating a significant proportion of indels.
  • An“indel”, as used herein, refers to the insertion or deletion of a nucleobase within a nucleic acid. Such insertions or deletions can lead to frame shift mutations within a coding region of a gene.
  • any of the fusion proteins provided herein are capable of generating a greater proportion of intended modifications (e.g., point mutations) versus indels.
  • the fusion proteins provided herein are capable of generating a ratio of intended point mutations to indels that is greater than 1:1.
  • the fusion proteins provided herein are capable of generating a ratio of intended point mutations to indels that is at least 1.5:1, at least 2:1, at least 2.5:1, at least 3:1, at least 3.5:1, at least 4:1, at least 4.5:1, at least 5:1, at least 5.5:1, at least 6:1, at least 6.5:1, at least 7:1, at least 7.5:1, at least 8:1, at least 10:1, at least 12:1, at least 15:1, at least 20:1, at least 25:1, at least 30:1, at least 40:1, at least 50:1, at least 100:1, at least 200:1, at least 300:1, at least 400:1, at least 500:1, at least 600:1, at least 700:1, at least 800:1, at least 900:1, or at least 1000:1, or more.
  • the number of intended mutations and indels may be determined using any suitable method, for example the methods used in the below Examples.
  • sequencing reads are scanned for exact matches to two 10-bp sequences that flank both sides of a window in which indels might occur. If no exact matches are located, the read is excluded from analysis. If the length of this indel window exactly matches the reference sequence the read is classified as not containing an indel. If the indel window is two or more bases longer or shorter than the reference sequence, then the sequencing read is classified as an insertion or deletion, respectively.
  • the fusion proteins provided herein are capable of limiting formation of indels in a region of a nucleic acid.
  • the region is at a nucleotide targeted by a fusion protein or a region within 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of a nucleotide targeted by a fusion protein.
  • any of the fusion proteins provided herein are capable of limiting the formation of indels at a region of a nucleic acid to less than 1%, less than 1.5%, less than 2%, less than 2.5%, less than 3%, less than 3.5%, less than 4%, less than 4.5%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, less than 10%, less than 12%, less than 15%, or less than 20%.
  • the number of indels formed at a nucleic acid region may depend on the amount of time a nucleic acid (e.g., a nucleic acid within the genome of a cell) is exposed to a fusion protein.
  • an number or proportion of indels is determined after at least 1 hour, at least 2 hours, at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 3 days, at least 4 days, at least 5 days, at least 7 days, at least 10 days, or at least 14 days of exposing a nucleic acid (e.g., a nucleic acid within the genome of a cell) to a fusion protein.
  • a nucleic acid e.g., a nucleic acid within the genome of a cell
  • an intended mutation such as a point mutation
  • a nucleic acid e.g. a nucleic acid within a genome of a subject
  • an intended mutation is a mutation that is generated by a specific fusion protein bound to a gRNA, specifically designed to generate the intended mutation.
  • the intended mutation is a mutation associated with a disease, disorder, or condition.
  • the intended mutation is the correction of a cytosine (C) to adenine (A) point mutation associated with a disease, disorder, or condition. In some embodiments, the intended mutation is the correction of a guanine (G) to thymine (T) point mutation associated with a disease, disorder, or condition. In some embodiments, the intended mutation is the correction of a cytosine (C) to adenine (A) point mutation within the coding region of a gene. In some embodiments, the intended mutation is the correction of a guanine (G) to thymine (T) point mutation within the coding region of a gene.
  • the intended mutation is a point mutation that generates a stop codon, for example, a premature stop codon within the coding region of a gene. In some embodiments, the intended mutation is a mutation that eliminates a stop codon. In some embodiments, the intended mutation is a mutation that alters the splicing of a gene. In some embodiments, the intended mutation is a mutation that alters the regulatory sequence of a gene (e.g., a gene promotor or gene repressor).
  • any of the fusion proteins provided herein are capable of generating a ratio of intended mutations to unintended mutations (e.g., intended point m utati o n s : u n i n t c n dcd point mutations) that is greater than 1: 1. In some embodiments, any of the fusion proteins provided herein are capable of generating a ratio of intended mutations to unintended mutations (e.g., intended point
  • Some embodiments of the disclosure are based on the recognition that the formation of indels in a region of a nucleic acid may be limited by nicking the non-edited strand opposite to the strand in which edits are introduced.
  • This nick serves to direct mismatch repair machinery to the non-edited strand, ensuring that the chemically modified nucleobase is not interpreted as a lesion by the machinery.
  • This nick may be created by the use of an nCas9.
  • the methods provided in this disclosure comprise cutting (or nicking) the non-edited strand of the double-stranded DNA, for example, wherein the one strand comprises the A of the target T: A nucleobase pair, or the T of the T:A nucleobase pair.
  • Guide sequences e.g., guide RNAs
  • the present disclosure further provides guide RNAs for use in accordance with the disclosed methods of editing.
  • the disclosure provides guide RNAs that are designed to recognize target sequences.
  • Such gRNAs may be designed to have guide sequences (or “spacers”) having complementarity to a protospacer within the target sequence.
  • Guide RNAs are also provided for use with one or more of the disclosed fusion proteins, e.g., in the disclosed methods of editing a nucleic acid molecule.
  • Such gRNAs may be designed to have guide sequences having complementarity to a protospacer within a target sequence to be edited, and to have backbone sequences that interact specifically with the napDNAbp domains of any of the disclosed base editors, such as Cas9 nickase domains of the disclosed base editors.
  • the ACBEs may be complexed, bound, or otherwise associated with (e.g., via any type of covalent or non-covalent bond) one or more guide sequences, i.e., the sequence which becomes associated or bound to the base editor and directs its localization to a specific target sequence having complementarity to the guide sequence or a portion thereof.
  • a guide sequence will depend upon the nucleotide sequence of a genomic target site of interest (i.e., the desired site to be edited) and the type of napDNAbp (e.g., type of Cas protein) present in the base editor, among other factors, such as PAM sequence locations, percent G/C content in the target sequence, the degree of microhomology regions, secondary structures, etc.
  • a genomic target site of interest i.e., the desired site to be edited
  • type of napDNAbp e.g., type of Cas protein
  • a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a napDNAbp (e.g., a Cas9, Cas9 homolog, or Cas9 variant) to the target sequence.
  • a napDNAbp e.g., a Cas9, Cas9 homolog, or Cas9 variant
  • the degree of complementarity between a guide sequence and its corresponding target sequence when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%,
  • Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith- Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).
  • a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length.
  • a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length.
  • the ability of a guide sequence to direct sequence- specific binding of a base editor to a target sequence may be assessed by any suitable assay.
  • the components of a base editor, including the guide sequence to be tested may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of a base editor disclosed herein, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein.
  • cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a base editor, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions.
  • Other assays are possible, and will occur to those skilled in the art.
  • a guide sequence may be selected to target any target sequence. In some embodiments,
  • the target sequence is a sequence within a genome of a cell.
  • Exemplary target sequences include those that are unique in the target genome. For example, for the S.
  • a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGG (SEQ ID NO: 58) where
  • a unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGG (SEQ ID NO: 60) where NNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) (SEQ ID NO: 61) has a single occurrence in the genome.
  • S. thermophilus CRISPRlCas9 a unique target sequence in a genome may include a Cas9 target site of the form
  • a unique target sequence in a genome may include an S. thermophilus CRISPR 1 Cas9 target site of the form
  • N is A, G, T, or C; X can be anything; and W is A or T
  • SEQ ID NO: 65 has a single occurrence in the genome.
  • a unique target sequence in a genome may include a Cas9 target site of the form
  • a unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGGXG (SEQ ID NO: 68) where NNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) (SEQ ID NO: 69) has a single occurrence in the genome.
  • sequences“M” may be A, G, T, or C, and need not be considered in identifying a sequence as unique.
  • a guide sequence is selected to reduce the degree of secondary structure within the guide sequence.
  • Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker & Stiegler ⁇ Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online Webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see, e.g., A. R.
  • a tracr mate sequence includes any sequence that has sufficient
  • complementarity with a tracr sequence to promote one or more of: (1) excision of a guide sequence flanked by tracr mate sequences in a cell containing the corresponding tracr sequence; and (2) formation of a complex at a target sequence, wherein the complex comprises the tracr mate sequence hybridized to the tracr sequence.
  • degree of complementarity is with reference to the optimal alignment of the tracr mate sequence and tracr sequence, along the length of the shorter of the two sequences.
  • Optimal alignment may be determined by any suitable alignment algorithm, and may further account for secondary structures, such as self-complementarity within either the tracr sequence or tracr mate sequence.
  • the degree of complementarity between the tracr sequence and tracr mate sequence along the length of the shorter of the two when optimally aligned is about or more than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher.
  • the tracr sequence is about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, or more nucleotides in length.
  • the tracr sequence and tracr mate sequence are contained within a single transcript, such that hybridization between the two produces a transcript having a secondary structure, such as a hairpin.
  • Preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA. However, longer or shorter loop sequences may be used, as may alternative sequences.
  • the sequences preferably include a nucleotide triplet (for example, AAA), and an additional nucleotide (for example C or G). Examples of loop forming sequences include CAAA and AAAG.
  • the transcript or transcribed polynucleotide sequence has at least two or more hairpins. In certain embodiments, the transcript has two, three, four or five hairpins. In a further embodiment of the invention, the transcript has at most five hairpins.
  • the single transcript further includes a transcription termination sequence; preferably this is a polyT sequence, for example six T nucleotides.
  • a transcription termination sequence preferably this is a polyT sequence, for example six T nucleotides.
  • single polynucleotides comprising a guide sequence, a tracr mate sequence, and a tracr sequence are as follows (listed 5' to 3'), where“N” represents a base of a guide sequence, the first block of lower case letters represent the tracr mate sequence, and the second block of lower case letters represent the tracr sequence, and the final poly-T sequence represents the transcription terminator:
  • sequences (1) to (3) are used in combination with Cas9 from S. thermophilus CRISPR1.
  • sequences (4) to (6) are used in combination with Cas9 from S. pyogenes.
  • the tracr sequence is a separate transcript from a transcript comprising the tracr mate sequence.
  • a guide RNA typically comprises a tracrRNA framework allowing for Cas9 binding, and a guide sequence, which confers sequence specificity to the Cas9:nucleic acid editing enzyme/domain fusion protein.
  • the guide RNAs for use in accordance with the disclosed methods of editing comprise a backbone structure that is recognized by an S. pyogenes Cas9 protein or domain, such as an SpCas9 domain of the disclosed base editors.
  • the backbone structure recognized by an SpCas9 protein may comprise the sequence 5'-[guide sequence]- guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaaguggcaccgagucggugcuuuu u-3' (SEQ ID NO: 77), wherein the guide sequence comprises a sequence that is complementary to the protospacer of the target sequence. See U.S. Publication No.
  • the guide sequence is typically 20 nucleotides long.
  • the guide RNAs for use in accordance with the disclosed methods of editing comprise a backbone structure that is recognized by an S. aureus Cas9 protein.
  • the backbone structure recognized by an SaCas9 protein may comprise the sequence 5 '-[guide sequence] - guuuuaguacucuguaaugaaaauuacagaaucuacuaaaacaaggcaaaaugccguguuuaucucgucaacuuguugg cgagauuuuuuuuu-3' (SEQ ID NO: 161).
  • suitable guide RNAs for targeting the disclosed fusion proteins to specific genomic target sites will be apparent to those of skill in the art based on the instant disclosure.
  • Such suitable guide RNA sequences typically comprise guide sequences that are complementary to a nucleic sequence within 50 nucleotides upstream or downstream of the target nucleotide to be edited.
  • Some exemplary guide RNA sequences suitable for targeting any of the provided fusion proteins to specific target sequences are provided herein.
  • Additional guide sequences are are well known in the art and can be used with the base editors described herein. Additional exemplary guide sequences are disclosed in, for example, Jinek M., et al., Science 337:816-821(2012); Mali P, Esvelt KM & Church GM (2013) Cas9 as a versatile tool for engineering biology, Nature Methods , 10, 957-963; Li JF et al, (2013) Multiplex and homologous recombination-mediated genome editing in
  • the disclosure further relates in various aspects to methods of making the disclosed fusion proteins by various modes of manipulation that include, but are not limited to, codon optimization to achieve greater expression levels in a cell, and the use of nuclear localization sequences (NLSs), preferably at least two NLSs, e.g., two bipartite NLSs, to increase the localization of the expressed fusion proteins into a cell nucleus.
  • NLSs nuclear localization sequences
  • fusion proteins contemplated herein can include modifications that result in increased expression, for example, through codon optimization.
  • the fusion proteins (or a component thereof) is codon optimized for expression in particular cells, such as eukaryotic cells.
  • the eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including, but not limited to, human, mouse, rat, rabbit, dog, or non-human primate.
  • codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence.
  • Codon bias differences in codon usage between organisms
  • mRNA messenger RNA
  • tRNA transfer RNA
  • Codon usage tables are readily available, for example, at the“Codon Usage Database”, and these tables can be adapted in a number of ways. See Nakamura, Y., et al.“Codon usage tabulated from the international DNA sequence databases: status for the year 2000” Nucl. Acids Res. 28:292 (2000).
  • codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available.
  • one or more codons e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons
  • one or more codons in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.
  • Directed evolution methods e.g., PACE or PANCE
  • Various embodiments of the disclosure relate to providing directed evolution methods and systems (e.g., appropriate vectors, cells, phage, flow vessels, etc.) for engineering of the base editors or base editor domains of the present disclosure.
  • the disclosure provides vector systems for the disclosed directed evolution methods to engineer any of the disclosed base editors or base editor domains.
  • the directed evolution vector systems and methods provided herein allow for a gene of interest (e.g., a base editor- or adenine oxidase-encoding gene) in a viral vector to be evolved over multiple generations of viral life cycles in a flow of host cells to acquire a desired function or activity.
  • a gene of interest e.g., a base editor- or adenine oxidase-encoding gene
  • the gene under selection is encoded on the M13 bacteriophage genome. Its activity is linked to M13 propagation by controlling expression of gene III so that only active variants produce infectious progeny phage. Phage are continuously propagated and mutagenized, but mutations accumulate only in the phage genome, not the host or its selection circuit, because fresh host cells are continually flowed into (and out of) the growth vessel, effectively resetting the selection background.
  • PACE enables the rapid continuous evolution of biomolecules through many generations of mutation, selection, and replication per day.
  • host E. coli cells continuously dilute a population of bacteriophage (selection phage, SP) containing the gene of interest.
  • the gene of interest replaces gene III on the SP, which is required for progeny phage infectivity.
  • SP containing desired gene variants trigger host-cell gene III expression from an accessory plasmid (AP).
  • AP accessory plasmid
  • Host-cell DNA plasmids encode a genetic circuit that links the desired activity of the protein encoded in the SP to the expression of gene III on the AP.
  • SP variants containing desired gene variants can propagate, while phage encoding inactive variants do not generate infectious progeny and are rapidly diluted out of the culture vessel (or lagoon).
  • An arabinose-inducible mutagenesis plasmid (MP) controls the phage mutation rate.
  • the viral vector or the phage is a filamentous phage, for example, an M13 phage, such as an M13 selection phage as described in more detail elsewhere herein.
  • the gene required for the production of infectious viral particles is the M13 gene III (gill).
  • the viral vector infects mammalian cells. In some embodiments, the viral vector infects mammalian cells. In some embodiments, the viral vector infects mammalian cells.
  • the viral vector is a retroviral vector.
  • the viral vector is a vesicular stomatitis virus (VSV) vector.
  • VSV vesicular stomatitis virus
  • VSV vesicular stomatitis virus
  • VSV-G a viral glycoprotein that mediates phosphatidylserine attachment and cell entry.
  • VSV can infect a broad spectrum of host cells, including mammalian and insect cells. VSV is therefore a highly suitable vector for continuous evolution in human, mouse, or insect host cells.
  • other retroviral vectors that can be pseudotyped with VSV-G envelope protein are equally suitable for continuous evolution processes as described herein.
  • VSV-G packagable vectors are adapted for use in a continuous evolution system in that the native envelope (env) protein (e.g., VSV-G in VSVS vectors, or env in MLV vectors) is deleted from the viral genome, and a gene of interest is inserted into the viral genome under the control of a promoter that is active in the desired host cells.
  • the host cells express the VSV-G protein, another env protein suitable for vector
  • pseudotyping or the viral vector’s native env protein, under the control of a promoter the activity of which is dependent on an activity of a product encoded by the gene of interest, so that a viral vector with a mutation leading to increased activity of the gene of interest will be packaged with higher efficiency than a vector with baseline or a loss-of-function mutation.
  • mammalian host cells are subjected to infection by a continuously evolving population of viral vectors, for example, VSV vectors comprising a gene of interest and lacking the VSV-G encoding gene, wherein the host cells comprise a gene encoding the VSV-G protein under the control of a conditional promoter.
  • viral vectors for example, VSV vectors comprising a gene of interest and lacking the VSV-G encoding gene, wherein the host cells comprise a gene encoding the VSV-G protein under the control of a conditional promoter.
  • retrovirus-bases system could be a two-vector system (the viral vector and an expression construct comprising a gene encoding the envelope protein), or, alternatively, a helper virus can be employed, for example, a VSV helper vims.
  • a helper virus typically comprises a truncated viral genome deficient of structural elements required to package the genome into viral particles, but including viral genes encoding proteins required for viral genome processing in the host cell, and for the generation of viral particles.
  • the viral vector-based system could be a three-vector system (the viral vector, the expression construct comprising the envelope protein driven by a conditional promoter, and the helper vims comprising viral functions required for viral genome propagation but not the envelope protein).
  • expression of the five genes of the VSV genome from a helper vims or expression constmct in the host cells allows for production of infectious viral particles carrying a gene of interest, indicating that unbalanced gene expression permits viral replication at a reduced rate, suggesting that reduced expression of VSV-G would indeed serve as a limiting step in efficient viral production.
  • helper vims One advantage of using a helper vims is that the viral vector can be deficient in genes encoding proteins or other functions provided by the helper vims, and can, accordingly, carry a longer gene of interest.
  • the helper vims does not express an envelope protein, because expression of a viral envelope protein is known to reduce the infectability of host cells by some viral vectors via receptor interference.
  • Viral vectors for example retroviral vectors, suitable for continuous evolution processes, their respective envelope proteins, and helper vimses for such vectors, are well known to those of skill in the art.
  • helper vimses for continuous evolution procedures as described herein, see Coffin et al., Retroviruses, CSHL Press 1997, ISBN0-87969-571-4, incorporated herein in its entirety.
  • the incubating of the host cells is for a time sufficient for at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 300, at least 400, at least, 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1250, at least 1500, at least 1750, at least 2000, at least 2500, at least 3000, at least 4000, at least 5000, at least 7500, at least 10000, or more consecutive viral life cycles.
  • the viral vector is an M13 phage, and the length of a single viral life cycle is about 10-20 minutes.
  • a viral vector/host cell combination is chosen in which the life cycle of the viral vector is significantly shorter than the average time between cell divisions of the host cell.
  • Average cell division times and viral vector life cycle times are well known in the art for many cell types and vectors, allowing those of skill in the art to ascertain such host cell/vector combinations.
  • host cells are being removed from the population of host cells contacted with the viral vector at a rate that results in the average time of a host cell remaining in the host cell population before being removed to be shorter than the average time between cell divisions of the host cells, but to be longer than the average life cycle of the viral vector employed.
  • the host cells on average, do not have sufficient time to proliferate during their time in the host cell population while the viral vectors do have sufficient time to infect a host cell, replicate in the host cell, and generate new viral particles during the time a host cell remains in the cell population.
  • the average time a host cell remains in the host cell population is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 70, about 80, about 90, about 100, about 120, about 150, or about 180 minutes.
  • the average time a host cell remains in the host cell population depends on how fast the host cells divide and how long infection (or conjugation) requires.
  • the flow rate should be faster than the average time required for cell division, but slow enough to allow viral (or conjugative) propagation.
  • the former will vary, for example, with the media type, and can be delayed by adding cell division inhibitor antibiotics (FtsZ inhibitors in E. coli, etc.). Since the limiting step in continuous evolution is production of the protein required for gene transfer from cell to cell, the flow rate at which the vector washes out will depend on the current activity of the gene(s) of interest. In some embodiments, titratable production of the protein required for the generation of infectious particles, as described herein, can mitigate this problem.
  • an indicator of phage infection allows computer-controlled optimization of the flow rate for the current activity level in real-time.
  • the fresh host cells comprise the accessory plasmid required for selection of viral vectors, for example, the accessory plasmid comprising the gene required for the generation of infectious phage particles that is lacking from the phages being evolved.
  • the host cells are generated by contacting an uninfected host cell with the relevant vectors, for example, the accessory plasmid and, optionally, a mutagenesis plasmid, and growing an amount of host cells sufficient for the replenishment of the host cell population in a continuous evolution experiment.
  • Methods for the introduction of plasmids and other gene constructs into host cells are well known to those of skill in the art and the invention is not limited in this respect.
  • such methods include, but are not limited to, electroporation and heat-shock of competent cells.
  • the accessory plasmid comprises a selection marker, for example, an antibiotic resistance marker, and the fresh host cells are grown in the presence of the respective antibiotic to ensure the presence of the plasmid in the host cells.
  • a selection marker for example, an antibiotic resistance marker
  • different markers are typically used. Such selection markers and their use in cell culture are known to those of skill in the art, and the invention is not limited in this respect.
  • the selection marker is a spectinomycin antibiotic resistance marker.
  • Cells are transformed with a selection plasmid containing an inactivated
  • spectinomycin resistance gene with a mutation at an active site that requires A:T to C:G editing to correct. Cells that fail to install the correct transversion mutation in the
  • spectinomycin resistance gene will die, while cells that make the correction will survive.
  • E. coli cells expressing an sgRNA targeting the active site mutation in the spectinomycin resistance gene and a nucleobase modification domain-dCas9 fusion protein are plated onto 2xYT agar with 256 pg/mL of spectinomycin. Surviving colonies (measured through CFUs) were sequenced to find consensus mutations in the fusion proteins expressed in the evolved survivors (FIG. 4).
  • a similar selection assay was used to evolve adenine deaminase activity in DNA during adenine base editor development, as described in Gaudelli, N. M. el al, Programmable base editing of A ⁇ T to G*C in genomic DNA without DNA cleavage. Nature 551, 464-471 (2017), herein incorporated in its entirety by reference.
  • the selection marker is a chloramphenicol antibiotic resistance marker.
  • Cells are transformed with a selection plasmid containing an inactivated
  • chloramphenicol resistance gene with a mutation at an active site that requires A:T to C:G editing to correct. Cells that fail to install the correct transversion mutation in the spectinomycin resistance gene will die, while cells that make the correction will survive.
  • E. coli cells expressing an sgRNA targeting the active site mutation in the chloramphenicol resistance gene and a nucleobase modification domain-dCas9 fusion protein are plated onto 2xYT agar with 256 pg/mL of chloramphenicol. Surviving colonies (measured through CFUs) were sequenced to find consensus mutations in the fusion proteins expressed in the evolved survivors.
  • the selection marker is a carbenicillin antibiotic resistance marker.
  • Cells are transformed with a selection plasmid containing an inactivated
  • carbenicillin resistance gene with a mutation at an active site that requires A:T to C:G editing to correct. Cells that fail to install the correct transversion mutation in the spectinomycin resistance gene will die, while cells that make the correction will survive.
  • E. coli cells expressing an sgRNA targeting the active site mutation in the carbenecillin resistance gene and a nucleobase modification domain-dCas9 fusion protein are plated onto 2xYT agar with 256 pg/mL of carbenicillin. Surviving colonies (measured through CFUs) were sequenced to find consensus mutations in the fusion proteins expressed in the evolved survivors.
  • mismatch-specific uracil-DNA glycosylase (MUG) knockout E. coli cells are used during the above spectinomycin, carbencillin, and/or chloramphenicol screening experiments to avoid excision of the target 8-oxoadenine before the full base editing process can be completed.
  • the host cell population in a continuous evolution experiment is replenished with fresh host cells growing in a parallel, continuous culture.
  • the cell density of the host cells in the host cell population contacted with the viral vector and the density of the fresh host cell population is substantially the same.
  • the cells being removed from the cell population contacted with the viral vector comprise cells that are infected with the viral vector and uninfected cells.
  • cells are being removed from the cell populations continuously, for example, by effecting a continuous outflow of the cells from the population.
  • cells are removed semi-continuously or intermittently from the population.
  • the replenishment of fresh cells will match the mode of removal of cells from the cell population, for example, if cells are continuously removed, fresh cells will be continuously introduced.
  • the modes of replenishment and removal may be mismatched, for example, a cell population may be continuously replenished with fresh cells, and cells may be removed semi-continuously or in batches.
  • the rate of fresh host cell replenishment and/or the rate of host cell removal is adjusted based on quantifying the host cells in the cell population. For example, in some embodiments, the turbidity of culture media comprising the host cell population is monitored and, if the turbidity falls below a threshold level, the ratio of host cell inflow to host cell outflow is adjusted to effect an increase in the number of host cells in the population, as manifested by increased cell culture turbidity. In other embodiments, if the turbidity rises above a threshold level, the ratio of host cell inflow to host cell outflow is adjusted to effect a decrease in the number of host cells in the population, as manifested by decreased cell culture turbidity.
  • Maintaining the density of host cells in the host cell population within a specific density range ensures that enough host cells are available as hosts for the evolving viral vector population, and avoids the depletion of nutrients at the cost of viral packaging and the accumulation of cell-originated toxins from overcrowding the culture.
  • the cell density in the host cell population and/or the fresh host cell density in the inflow is about 102 cells/ml to about 1012 cells/ml.
  • the host cell density is about 102 cells/ml, about 103 cells/ml, about 104 cells/ml, about 105 cells/ml, about 5- 105 cells/ml, about 106 cells/ml, about 5- 106 cells/ml, about 107 cells/ml, about 5- 107 cells/ml, about 108 cells/ml, about 5- 108 cells/ml, about 109 cells/ml, about 5- 109 cells/ml, about 1010 cells/ml, or about 5- 1010 cells/ml.
  • the host cell density is more than about 1010 cells/ml.
  • the host cell population is contacted with a mutagen.
  • the cell population contacted with the viral vector e.g., the phage
  • the mutagen is continuously exposed to the mutagen at a concentration that allows for an increased mutation rate of the gene of interest, but is not significantly toxic for the host cells during their exposure to the mutagen while in the host cell population.
  • the host cell population is contacted with the mutagen intermittently, creating phases of increased mutagenesis, and accordingly, of increased viral vector diversification.
  • the host cells are exposed to a concentration of mutagen sufficient to generate an increased rate of mutagenesis in the gene of interest for about 10%, about 20%, about 50%, or about 75% of the time.
  • selection of the mutagen is guided by crystallographic structural information about the wild-type oxidase to be evolved, for instance information about a binding pocket within the oxidase.
  • mutations are targeted to residues in the active site of a wild-type iron-dependent oxidase with the goal of affecting the relative orientation of the target adenine and the non-heme Fe(IV) center.
  • mutations are targeted to the DNA binding interface of a wild-type iron- dependent oxidase with the goal of affecting the relative orientation of the target adenine and the non-heme Fe(IV) center.
  • variants of AlkBH3 were evolved using continuous evolution systems to form a large library of AlkBH3 mutants, wherein mutations were targeted to residue in the active site and/or DNA binding interface of AlkBH3.
  • the host cells comprise a mutagenesis expression construct, for example, in the case of bacterial host cells, a mutagenesis plasmid.
  • the mutagenesis plasmid comprises a gene expression cassette encoding a mutagenesis- promoting gene product, for example, a proofreading-impaired DNA polymerase.
  • the mutagenesis plasmid including a gene involved in the SOS stress response, (e.g., UmuC, UmuD', and/or RecA).
  • the mutagenesis- promoting gene is under the control of an inducible promoter.
  • Suitable inducible promoters are well known to those of skill in the art and include, for example, arabinose-inducible promoters, tetracycline or doxycyclin-inducible promoters, and tamoxifen-inducible promoters.
  • the host cell population is contacted with an inducer of the inducible promoter in an amount sufficient to effect an increased rate of mutagenesis.
  • a bacterial host cell population is provided in which the host cells comprise a mutagenesis plasmid in which a dnaQ926, UmuC, UmuD', and RecA expression cassette is controlled by an arabinose-inducible promoter.
  • the population of host cells is contacted with the inducer, for example, arabinose in an amount sufficient to induce an increased rate of mutation.
  • diversifying the viral vector population is achieved by providing a flow of host cells that does not select for gain-of-function mutations in the gene of interest for replication, mutagenesis, and propagation of the population of viral vectors.
  • the host cells are host cells that express all genes required for the generation of infectious viral particles, for example, bacterial cells that express a complete helper phage, and, thus, do not impose selective pressure on the gene of interest.
  • the host cells comprise an accessory plasmid comprising a conditional promoter with a baseline activity sufficient to support viral vector propagation even in the absence of significant gain-of-function mutations of the gene of interest.
  • the disclosure provides vectors for the continuous evolution processes.
  • phage vectors for phage-assisted continuous evolution are provided.
  • a selection phage is provided that comprises a phage genome deficient in at least one gene required for the generation of infectious phage particles and a gene of interest to be evolved.
  • the disclosure provides viral vectors for the continuous evolution processes.
  • phage vectors for phage-assisted continuous evolution are provided.
  • a selection phage is provided that comprises a phage genome deficient in at least one gene required for the generation of infectious phage particles and a gene of interest to be evolved.
  • the selection phage comprises an M13 phage genome deficient in a gene required for the generation of infectious M13 phage particles, for example, a full-length gill.
  • the selection phage comprises a phage genome providing all other phage functions required for the phage life cycle except the gene required for generation of infectious phage particles.
  • an M13 selection phage is provided that comprises a gl, gll, gIV, gV, gVI, gVII, gVIII, glX, and a gX gene, but not a full-length gill.
  • the selection phage comprises a 3'- fragment of gill, but no full-length gill.
  • the 3 '-end of gill comprises a promoter (see Figure 16) and retaining this promoter activity is beneficial, in some embodiments, for an increased expression of gVI, which is immediately downstream of the gill 3 '-promoter, or a more balanced (wild-type phage-like) ratio of expression levels of the phage genes in the host cell, which, in turn, can lead to more efficient phage production.
  • the 3'- fragment of gill gene comprises the 3 '-gill promoter sequence.
  • the 3'- fragment of gill comprises the last 180 bp, the last 150 bp, the last 125 bp, the last 100 bp, the last 50 bp, or the last 25 bp of gill. In some embodiments, the 3'- fragment of gill comprises the last 180 bp of gin.
  • M13 selection phage comprises a gene of interest in the phage genome, for example, inserted downstream of the gVIII 3 '-terminator and upstream of the gIII-3 '-promoter.
  • an M13 selection phage is provided that comprises a multiple cloning site for cloning a gene of interest into the phage genome, for example, a multiple cloning site (MCS) inserted downstream of the gVIII 3 '-terminator and upstream of the gill- 3 '-promoter.
  • MCS multiple cloning site
  • a vector system for continuous evolution procedures comprising of a viral vector, for example, a selection phage, and a matching accessory plasmid.
  • a vector system for phage-based continuous directed evolution comprises (a) a selection phage comprising a gene of interest to be evolved, wherein the phage genome is deficient in a gene required to generate infectious phage; and (b) an accessory plasmid comprising the gene required to generate infectious phage particle under the control of a conditional promoter, wherein the conditional promoter is activated by a function of a gene product encoded by the gene of interest.
  • the selection phage is an M 13 phage as described herein.
  • the selection phage comprises an M13 genome including all genes required for the generation of phage particles, for example, gl, gll, gIV, gV, gVI, gVII, gVIII, glX, and gX gene, but not a full-length gill gene.
  • the selection phage genome comprises an FI or an M 13 origin of replication.
  • the selection phage genome comprises a 3 '-fragment of gill gene.
  • the selection phage comprises a multiple cloning site upstream of the gill 3 '-promoter and downstream of the gVIII 3 '-terminator.
  • Some embodiments of this disclosure provide a method of non-continuous evolution of a gene of interest.
  • the method of non-continuous evolution is PANCE.
  • the method of non-continuous evolution is an antibiotic or plate-based selection method.
  • the cells are re-transformed with the mutagenesis plasmid regularly to ensure the plasmid has not been inactivated.
  • An aliquot of a desired concentration, often 2 mL, is then transferred to a smaller flask, supplemeted with inducing agent arabinose (Ara) for the mutagenesis plasmid, and infected with the selection phage (SP).
  • a drift plasmid can also be provided that enables phage to propagate without passing the selection.
  • Expression is under the control of an inducible promoter and can be turned on with 50 ng/mL of anhydrotetracycline. This culture is incubated at 37 °C for 8-12 h to facilitate phage growth, which is confirmed by determination of the phage titer. Following phage growth, an aliquot of infected cells is used to transfect a subsequent flask containing host E. coli. This process is continued until the desired phenotype is evolved for as many transfers as required, while increasing the stringency in stepwise fashion by decreasing the incubation time or titer of phage with which the bacteria is infected. Reference is made to Suzuki T. et ah, Crystal structures reveal an elusive functional domain of pyrrolysyl-tRNA synthetase, Nat Chem Biol. 13(12): 1261-1266 (2017), incorporated herein in its entirety.
  • negative selection is applied during a non-continuous evolution method as described herein, by penalizing undesired activities.
  • this is achieved by causing the undesired activity to interfere with pill production.
  • expression of an antisense RNA complementary to the gill RBS and/or start codon is one way of applying negative selection, while expressing a protease (e.g., TEV) and engineering the protease recognition sites into pill is another.
  • a protease e.g., TEV
  • Vectors can be designed to clone and/or express the base editors of the disclosure.
  • Vectors may also be designed to transfect the base editors of the disclosure into one or more cells, e.g., a target diseased eukaryotic cell for treatment with the base editor systems and methods disclosed herein.
  • Vectors may be designed for expression of base editor transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells.
  • base editor transcripts may be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovims expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods In Enzymology 185, Academic Press. San Diego, Calif. (1990).
  • expression vectors encoding one or more base editors described herein may be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • Vectors for rational mutagenesis methods such as PACE may be introduced and propagated in a prokaryotic cells.
  • a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g., amplifying a plasmid as part of a viral vector packaging system).
  • a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism.
  • Fusion expression vectors also may be used to express the base editors of the disclosure. Such vectors generally add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein. Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of a recombinant protein; (ii) to increase the solubility of a recombinant protein; and (iii) to aid in the purification of a recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion domain and the
  • recombinant protein to enable separation of the recombinant protein from the fusion domain subsequent to purification of the fusion protein.
  • enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988. Gene 67: 31-40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) that fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.
  • GST glutathione S-transferase
  • E. coli expression vectors examples include pTrc (Amrann et al., (1988) Gene 69:301-315) and pET l id (Studier et al., Gene Expression Technology: Methods In Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89).
  • a vector is a yeast expression vector for expressing the base editors described herein.
  • yeast Saccharomyces cerivisae examples include pYepSecl (Baldari, et al., 1987. EMBO J. 6: 229-234), pMFa (Kuijan and Herskowitz, 1982. Cell 30: 933-943), pJRY88 (Schultz et al., 1987. Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif.).
  • a vector drives protein expression in insect cells using baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith, et al., 1983. Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989. Virology 170: 31-39).
  • a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195).
  • the expression vector's control functions are typically provided by one or more regulatory elements.
  • commonly used promoters are derived from polyoma, adenovirus 2,
  • cytomegalovirus simian virus 40, and others disclosed herein and known in the art.
  • suitable expression systems for both prokaryotic and eukaryotic cells see, e.g., Chapters 16 and 17 of Sambrook, et al., Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.
  • the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements are known in the art.
  • suitable tissue-specific promoters include the albumin promoter (liver- specific; Pinkert, et al., 1987. Genes Dev. 1: 268-277), lymphoid- specific promoters (Calame and Eaton, 1988. Adv. Immunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989. EMBO J.
  • promoters are also encompassed, e.g., the murine hox promoters (Kessel and Gruss, 1990. Science 249: 374-379) and the a-fetoprotein promoter (Campes and Tilghman, 1989. Genes Dev. 3: 537-546).
  • Some embodiments of the disclosure provide methods for editing a nucleic acid using the base editors described herein to effectuate substitution of an A:T base pair to a C:G base pair.
  • the method is a method for editing a nucleobase of a nucleic acid (e.g., a base pair of a double- stranded DNA sequence).
  • the method comprises the steps of: a) contacting a target region of a nucleic acid (e.g., a double- stranded DNA sequence) with a complex comprising a fusion protein (e.g., a Cas9 domain fused to an adenine oxidase domain) and a guide nucleic acid (e.g., gRNA), wherein the target region comprises a targeted nucleobase pair.
  • a target region of a nucleic acid e.g., a double- stranded DNA sequence
  • a complex comprising a fusion protein (e.g., a Cas9 domain fused to an adenine oxidase domain) and a guide nucleic acid (e.g., gRNA), wherein the target region comprises a targeted nucleobase pair.
  • strand separation of said target region is induced, a first nucleobase of said target nucleobase pair in a single strand of the target region is converted to a second nucleobase, and no more than one strand of said target region is cut (or nicked), wherein a third nucleobase complementary to the first nucleobase base is replaced by a fourth nucleobase complementary to the second nucleobase.
  • the first nucleobase is an adenine (of the target A:T nucleobase pair).
  • the second nucleobase is the intermediate 8-oxoadenine.
  • the third nucleobase is a thymine (of the target A:T base pair).
  • the fourth nucleobase is a guanine.
  • the method further comprises replacing the second nucleobase with a fifth nucleobase (cytosine) that is complementary to the fourth nucleobase, thereby generating an intended edited base pair (e.g., A:T pair to a C:G pair).
  • an intended edited base pair e.g., A:T pair to a C:G pair.
  • at least 5% of the intended base pairs are edited.
  • at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the intended base paires are edited.
  • the ratio of intended products to unintended products in the target nucleotide is at least 2:1, 5:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, or 200:1, or more. In some embodiments, the ratio of intended point mutation to indel formation is greater than 1:1, 10:1, 50:1, 100:1, 500:1, or 1000:1, or more.
  • the cut single strand (nicked strand) is hybridized to the guide nucleic acid. In some embodiments, the cut single strand is opposite to the strand comprising the first nucleobase.
  • the base editor comprises nickase activity. In some embodiments, the intended edited base pair is upstream of a PAM site. In some
  • the intended edited base pair is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
  • the intended edited basepair is downstream of a PAM site.
  • the intended edited base pair is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides downstream stream of the PAM site.
  • the method does not require a canonical (e.g., NGG) PAM site.
  • the base editor comprises a linker.
  • the linker is 1-25 amino acids in length.
  • the linker is 5-20 amino acids in length.
  • linker is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids in length.
  • the target region comprises a target window, wherein the target window comprises the target nucleobase pair.
  • the target window comprises 1-10 nucleotides. In some embodiments, the target window is 1-9, 1-8, 1- 7, 1-6, 1-5, 1-4, 1-3, 1-2, or 1 nucleotides in length. In some embodiments, the target window is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the intended edited base pair is within the target window. In some embodiments, the target window comprises the intended edited base pair. In some embodiments, the method is performed using any of the base editors provided herein. In some embodiments, a target window is a editing window.
  • the disclosure provides methods for editing a nucleotide.
  • the disclosure provides a method for editing a nucleobase pair of a double-stranded DNA sequence.
  • the method comprises a) contacting a target region of the double-stranded DNA sequence with a complex comprising a base editor and a guide nucleic acid (e.g., gRNA), where the target region comprises a target nucleobase pair (e.g., A:T target base pair), b) converting a first nucleobase (e.g., the A base) of said target nucleobase pair in a single strand of the target region to a second nucleobase (e.g., converted to an intermediate, such as 8-oxoadenine, which is then replaced with a C through DNA replication/repair processes), c) cutting (or nicking) no more than one strand of said target region, wherein a third nucleobase complementary to the first
  • the method causes less than 19%, 18%, 16%, 14%, 12%, 10%, 8%, 6%, 4%, 2%, 1%, 0.5%, 0.2%, or less than 0.1% indel formation. In some embodiments, the method results in less than 19%, 18%, 16%, 14%, 12%, 10%, 8%, 6%, 4%, 2%, 1%, 0.5%, 0.2%, or less than 0.1% indel formation. In some embodiments, the method results in less than 20% indel formation in the nucleic acid. In other embodiments, the method results in less than 35% indel formation in the nucleic acid. In some
  • the method results in less than 20% indel formation in the nucleic acid. In other embodiments, the method results in less than 35% indel formation in the nucleic acid.
  • the ratio of intended product to unintended products at the target nucleotide is at least 2:1, 5:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, or 200:1, or more. In some embodiments, the ratio of intended point mutation to indel formation is greater than 1:1, 10:1, 50:1, 100:1, 500:1, or 1000:1, or more.
  • the cut single strand is hybridized to the guide nucleic acid. In some embodiments, the cut single strand is opposite to the strand comprising the first nucleobase.
  • the base editor comprises adenine oxidation and/or DNA glycosylase inhibition activity. In some embodiments, the base editor comprises nickase activity. In some embodiments, the intended edited base pair is upstream of a PAM site. In some embodiments, the intended edited base pair is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
  • the intended edited basepair is downstream of a PAM site.
  • the intended edited base pair is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides downstream stream of the PAM site.
  • the method does not require a canonical (e.g., NGG) PAM site.
  • the base editor comprises a linker. In some embodiments, the linker is 1-25 amino acids in length. In some
  • the linker is 5-20 amino acids in length. In some embodiments, the linker is
  • the target region comprises a target window, wherein the target window comprises the target nucleobase pair.
  • the target window comprises 1-10 nucleotides.
  • the target window is 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, or 1 nucleotides in length.
  • the target window is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
  • the intended edited base pair occurs within the target window.
  • the target window comprises the intended edited base pair.
  • the base editor is any one of the base editors provided herein.
  • the disclosure provides editing methods comprising contacting a DNA, or RNA molecule with any of the base editors provided herein, and with at least one guide nucleic acid (e.g., guide RNA), wherein the guide nucleic acid, (e.g., guide RNA) is about 15-100 nucleotides long and comprises a sequence of at least 10 contiguous nucleotides that is complementary to a target sequence.
  • the 3' end of the target sequence is immediately adjacent to a canonical PAM sequence (NGG).
  • NGS canonical PAM sequence
  • the 3' end of the target sequence is not immediately adjacent to a canonical PAM sequence (NGG). In some embodiments, the 3' end of the target sequence is immediately adjacent to an AGC, GAG, TTT, GTG, or CAA sequence.
  • the target nucleic acid sequence comprises a sequence associated with a disease, disorder, or condition. In some embodiments, the target nucleic acid sequence comprises a point mutation associated with a disease, disorder, or condition.
  • the activity of the fusion protein results in a correction of the point mutation.
  • the target nucleic acid sequence comprises an C A point mutation associated with a disease, disorder, or condition, and wherein the conversion of the mutant A to a C results in a sequence that is not associated with a disease, disorder, or condition.
  • the target sequence may comprise a G T point mutation associated with a disease, disorder, or condition, and wherein the conversion of the mutant T to a G results in a sequence that is not associated with a disease, disorder, or conditionr.
  • the target nucleic acid sequence encodes a protein
  • the point mutation is in a codon and results in a change in the amino acid encoded by the mutant codon as compared to the wild-type codon.
  • the transversion of the mutant A (or mutant T) results in a change of the amino acid encoded by the mutant codon.
  • the transversion of the mutant A (or mutant T) results in the codon encoding the wild-type amino acid.
  • the contacting is in vivo in a subject.
  • the subject has or has been diagnosed with a disease, disorder, or condition.
  • the disease, disorder, or condition is congenital deafness, spastic paraplegia, nonsyndromic hearing loss, spinal muscular atrophy, or hypohidrotic ectodermal dysplasia.
  • the base editors are used to introduce a point mutation into a nucleic acid by oxidizing a target A nucleobase.
  • the oxidation of the target nucleobase results in the correction of a genetic defect, e.g., in the correction of a point mutation that leads to a loss of function in a gene product.
  • the genetic defect is associated with a disease, disorder, or condition, e.g., a lysosomal storage disorder or a metabolic disease, such as, for example, type I diabetes.
  • the methods provided herein are used to introduce a deactivating point mutation into a gene or allele that encodes a gene product that is associated with a disease, disorder, or condition.
  • methods are provided herein that employ a DNA editing fusion protein to introduce a deactivating point mutation into an oncogene (e.g., in the treatment of a proliferative disease).
  • a deactivating mutation may, in some embodiments, generate a premature stop codon in a coding sequence, which results in the expression of a truncated gene product, e.g., a truncated protein lacking the function of the full-length protein.
  • the purpose of the methods provided herein is to restore the function of a dysfunctional gene via genome editing.
  • the base editor proteins provided herein can be validated for gene editing-based human therapeutics in vitro , e.g., by correcting a disease-associated mutation in human cell culture. It will be understood by the skilled artisan that the base editors provided herein, e.g., the fusion proteins comprising a nucleic acid programmable DNA binding protein (e.g., Cas9) and a nucleobase modification domain can be used to correct any single point A to C or T to G mutation. Oxidation of the mutant A that is base-paired with the mutant T, followed by a round of replication, corrects the mutation.
  • a nucleic acid programmable DNA binding protein e.g., Cas9
  • the instant disclosure provides methods for the treatment of a subject diagnosed with a disease associated with or caused by a point mutation that can be corrected by a DNA editing fusion protein provided herein.
  • a method comprises administering to a subject having such a disease, e.g., a cancer associated with a point mutation as described above, an effective amount of an adenine oxidase fusion protein and a gRNA that forms a complex with the fusion protein, that corrects the point mutation or introduces a deactivating mutation into a disease-associated gene.
  • a method comprises administering to a subject having such a disease, e.g., a cancer associated with a point mutation as described above, an effective amount of an adenine oxidase fusion protein-gRNA complex that corrects the point mutation or introduces a deactivating mutation into a disease-associated gene.
  • a subject having such a disease e.g., a cancer associated with a point mutation as described above
  • an effective amount of an adenine oxidase fusion protein-gRNA complex that corrects the point mutation or introduces a deactivating mutation into a disease-associated gene.
  • methods comprising administering to a subject one or more vectors that contains a nucleotide sequence that expresses the fusion protein and gRNA that forms a complex with the fusion protein.
  • the disease is a proliferative disease.
  • the disease is a genetic disease.
  • the disease is a neoplastic disease.
  • the disease is a metabolic disease.
  • the disease is a lysosomal storage disease.
  • Other diseases that can be treated by correcting a point mutation or introducing a deactivating mutation into a disease-associated gene will be known to those of skill in the art, and the disclosure is not limited in this respect.
  • the instant disclosure provides methods for the treatment of additional diseases or disorders, e.g., diseases or disorders that are associated or caused by a point mutation that can be corrected by adenine oxidase-mediated gene editing.
  • additional diseases or disorders e.g., diseases or disorders that are associated or caused by a point mutation that can be corrected by adenine oxidase-mediated gene editing.
  • Some such diseases are described herein, and additional suitable diseases that can be treated with the strategies and fusion proteins provided herein will be apparent to those of skill in the art based on the instant disclosure.
  • Exemplary suitable diseases and disorders are listed below. It will be understood that the numbering of the specific positions or residues in the respective sequences depends on the particular protein and numbering scheme used. Numbering might be different, e.g., in precursors of a mature protein and the mature protein itself, and differences in sequences from species to species may affect numbering.
  • Suitable diseases and disorders include, without limitation: Non-Bruton type Agammaglobulinemia, Hypomyelinating Leukodystrophy, 21 -hydroxylase deficiency, familial Breast-ovarian cancer, Immunodeficiency with basal ganglia
  • Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart is a neurodevelopmental disorder with or without anomalies of the brain, eye, or heart.
  • Immunodeficiency Leber congenital amaurosis, Amyotrophic lateral sclerosis type 10, Motor neuron disease, Malignant melanoma of skin, Focal cortical dysplasia type II, papillary Renal cell carcinoma, Glioblastoma, Colorectal Neoplasms, Uterine cervical neoplasms, sporadic Papillary renal cell carcinoma, Malignant neoplasm of body of uterus, Kidney Carcinoma, Neoplasm of the breast, Glioblastoma, Smith-Kingsmore syndrome, Homocysteinemia due to MTHFR deficiency, type 2A2A Charcot-Marie-Tooth disease, Bartter syndrome type 3, Cataract, multiple types, Gastrointestinal stroma tumor, Paragangliomas, Pheochromocytoma, Hereditary cancer-predisposing syndrome, Paragangliomas, Hereditary cancer-predisposing syndrome, Gastrointestinal stroma tumor, Paragan
  • Hereditary neutrophilia Ceroid lipofuscinosis neuronal, Neuronal ceroid lipofuscinosis, Lethal tight skin contracture syndrome, DFNA 2 Nonsyndromic Hearing Loss, Osteogenesis imperfecta type 8, GLUT1 deficiency syndrome, autosomal recessive, Glucose transporter type 1 deficiency syndrome, Congenital amegakaryocytic thrombocytopenia, Myelofibrosis with myeloid metaplasia, somatic, Myelofibrosis with myeloid metaplasia,
  • Thrombocythemia somatic, Hematologic neoplasm, Early infantile epileptic encephalopathy, Mental retardation, autosomal recessive, Familial porphyria cutanea tarda, MYH-associated polyposis, Hereditary cancer-predisposing syndrome, MUTYH- associated polyposis, Hereditary cancer-predisposing syndrome, Methylmalonic acidemia with homocystinuria, Methylmalonic aciduria and homocystinuria, cblC type, digenic, Muscle eye brain disease, Congenital Muscular Dystrophy, alpha-dystroglycan related, Limb-Girdle Muscular
  • Dystrophy Recessive, Muscle eye brain disease, Congenital muscular dystrophy- dystroglycanopathy with brain and eye anomalies, type A3, Adenocarcinoma of the colon, Congenital primary aphakia, Hepatic failure, early-onset, and neurologic disorder due to cytochrome C oxidase deficiency, Carnitine palmitoyltransferase II deficiency, infantile, Carnitine palmitoyltransferase II deficiency, myopathic, stress-induced, Carnitine
  • palmitoyltransferase II deficiency Carnitine palmitoyltransferase II deficiency, myopathic, stress-induced, Sensorineural deafness with mild renal dysfunction, Bartter syndrome type 4, Hypercholesterolemia, autosomal dominant, Low density lipoprotein cholesterol level quantitative trait locus, Familial hypercholesterolemia, Hypocholesterolemia,
  • Hypercholesterolemia autosomal dominant, Familial hypercholesterolemia, Low density lipoprotein cholesterol level quantitative trait locus, Hypocholesterolemia, Lattice corneal dystrophy Type III, Epileptic encephalopathy, early infantile, Hypobetalipoproteinemia, familial, Congenital disorder of glycosylation type It, Leber congenital amaurosis, Retinitis pigmentosa, Medium-chain acyl-coenzyme A dehydrogenase deficiency, Dilated
  • cardiomyopathy ICC Venous malformation, Aase syndrome, Stargardt disease, Cone-rod dystrophy, Retinitis pigmentosa, Stargardt disease, Congenital stationary night blindness, Retinal dystrophy, Nonsyndromic cleft lip with or without cleft palate, Glycogen storage disease type III, Glycogen storage disease Ilia, Intermediate maple syrup urine disease type 2, Maple syrup urine disease, Chorea, childhood-onset, with psychomotor retardation, Marshall syndrome, Stickler syndrome, type 2, Marshall/Stickler syndrome, Chudley-McCullough syndrome, Auriculocondylar syndrome, Pontocerebellar hypoplasia, type 9, Epileptic encephalopathy, early infantile, Spinocerebellar ataxia, Muscle AMP deaminase deficiency, Congenital giant melanocytic nevus, Liver cancer, Chronic lymphocytic leukemia,
  • Neurocutaneous melanosis Malignant melanoma of skin, Multiple myeloma, Neuroblastoma, Lung adenocarcinoma, Non-small cell lung cancer, Acute myeloid leukemia, Renal cell carcinoma, papillary, Neoplasm of brain, Cutaneous melanoma, Glioblastoma, Hepatocellular carcinoma, Transitional cell carcinoma of the bladder, Colorectal Neoplasms,
  • Ovarian Serous Cystadenocarcinoma Malignant neoplasm of body of uterus, RAS Inhibitor response, Malignant lymphoma, non-Hodgkin, Medulloblastoma, Malignant melanoma of skin, Multiple myeloma, Acute myeloid leukemia, Myelodysplastic syndrome, Cutaneous melanoma, Transitional cell carcinoma of the bladder, Neoplasm, Colorectal Neoplasms, Adenocarcinoma of stomach, Cutaneous melanoma, Malignant melanoma of skin, Multiple myeloma, Acute myeloid leukemia, Noonan syndrome, Myelodysplastic syndrome,
  • Hereditary insensitivity to pain with anhidrosis Hereditary insensitivity to pain with anhidrosis, Familial medullary thyroid carcinoma, Hereditary insensitivity to pain with anhidrosis Spherocytosis, type 3, autosomal recessive, Spherocytosis, Recessive, Elliptocytosis, Hereditary pyropoikilocytosis,
  • Mitochondrial complex I deficiency Charcot-Marie-Tooth disease, demyelinating, type lb, Charcot-Marie-Tooth disease, type I, Roussy-Levy syndrome, Neuropathy, congenital hypomyelinating, autosomal dominant, Charcot-Marie-Tooth disease, demyelinating, type lb, Charcot-Marie-Tooth disease type 2J, Charcot-Marie-Tooth disease dominant intermediate, Charcot-Marie-Tooth disease, type I, Gastrointestinal stroma tumor, Paragangliomas, Hereditary cancer-predisposing syndrome, Achromatopsia, Thrombophilia due to activated protein C resistance, Geroderma osteodysplastica, Trimethylaminuria, FM03 activity, decreased, Trimethylaminuria, Primary open angle glaucoma juvenile onset, Glaucoma, open angle, digenic, Glaucoma, primary congenital, digenic, MYOC-Related Disorders,
  • Hereditary nephrotic syndrome Nephrotic syndrome, idiopathic, steroid-resistant, Pituitary hormone deficiency, combined, Glutamine deficiency, congenital, Prostate cancer, hereditary, Junctional epidermolysis bullosa gravis of Herlitz, Hyperparathyroidism, Factor H
  • scapulohumeroperoneal Nemaline myopathy, autosomal dominant or recessive, Myopathy, actin, congenital, with cores, Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency, Chediak-Higashi syndrome, Familial hypertrophic cardiomyopathy, Methylcobalamin deficiency, cblG type, Catecholaminergic polymorphic ventricular tachycardia, Catecholaminergic polymorphic ventricular tachycardia type 1,
  • hypobetalipoproteinemia familial
  • Hypobetalipoproteinemia familial
  • Proopiomelanocortin deficiency Acute myeloid leukemia
  • Shashi-Pena syndrome Primary pulmonary
  • Pheochromocytoma Hereditary cancer-predisposing syndrome, Retinitis pigmentosa, Cone- rod dystrophy amelogenesis imperfecta, Cd8 deficiency, familial, Severe combined immunodeficiency, atypical, Achromatopsia, Monochromacy, Ectodermal dysplasia, hypohidrotic/hair/tooth type, autosomal dominant, Autosomal recessive hypohidrotic ectodermal dysplasia syndrome, Autosomal dominant hypohidrotic ectodermal dysplasia, Colorectal cancer with chromosomal instability, Retinitis pigmentosa, Osteomyelitis, sterile multifocal, with periostitis and pustulosis, Hypochromic microcytic anemia with iron overload, Culler-Jones syndrome, Autosomal recessive centronuclear myopathy,
  • Thrombophilia hereditary, due to protein C deficiency, autosomal dominant, Congenital disorders of glycosylation type II, Congenital disorder of glycosylation, type IIo, Warburg micro syndrome, Hypomyelination with brainstem and spinal cord involvement and leg spasticity, Warts, hypogammaglobulinemia, infections, and myelokathexis, Congenital NAD deficiency disorder, Vertebral, cardiac, renal, and limb defects syndrome, Mowat-Wilson syndrome, Homocystinuria, cblD type, variant 1, Nemaline myopathy, Nemaline myopathy, Idiopathic generalized epilepsy, Epilepsy, idiopathic generalized, Juvenile myoclonic epilepsy, Episodic ataxia, type 5, Progressive myositis ossificans, Amelogenesis imperfecta, type IH, Benign familial neonatal-infantile seizures, Early infantile epileptic
  • Brachydactyly-syndactyly-oligodactyly syndrome Brachydactyl-syndactyly-oligodactyly syndrome (1 patient), immunodeficiency, developmental delay, and hypohomocysteinemia
  • Hereditary myopathy with early respiratory failure Familial dilated cardiomyopathy, Dilated cardiomyopathy, Primary dilated cardiomyopathy, Limb-girdle muscular dystrophy, type 2J, Primary dilated cardiomyopathy, Familial dilated cardiomyopathy, Familial hypertrophic cardiomyopathy, Diabetes mellitus type 2, Ehlers-Danlos syndrome, type 4, Cardiovascular phenotype, Ehlers-Danlos syndrome, type 2, Ehlers-Danlos syndrome, classic type,
  • hyperammonemia type I, Hereditary cancer-predisposing syndrome, Familial cancer of breast, Hereditary cancer-predisposing syndrome, Hereditary cancer-predisposing syndrome, Spondylometaphyseal dysplasia - Sutcliffe type, Spondylometaphyseal dysplasia, Short stature, Focal segmental glomerulosclerosis, Microcephaly, Small for gestational age, Disproportionate short-trunk short stature, Decreased body weight, Atrioventricular canal defect, Congenital microcephaly, Steroid-resistant nephrotic syndrome, Schimke
  • immunoosseous dysplasia Short stature, Focal segmental glomerulosclerosis, Microcephaly, Small for gestational age, Disproportionate short-trunk short stature, Decreased body weight, Atrioventricular canal defect, Congenital microcephaly, Steroid-resistant nephrotic syndrome, Gracile syndrome, Cholestanol storage disease, Odontoonychodermal dysplasia, Schopf- Schulz-Passarge syndrome, Tooth agenesis, selective, Type A1 brachydactyly,
  • Dyschromatosis universalis hereditaria Charcot-Marie-Tooth disease, axonal, type 2T, Myopathy, centronuclear, Three M syndrome, Waardenburg syndrome type 1, Alport syndrome, autosomal recessive, Benign familial hematuria, Basal ganglia disease, biotin- responsive, ARMC9-related Joubert syndrome, ARMC9-related Joubert syndrome, Jourbert syndrome, Arthrogryposis, distal, type 5d, Microphthalmia, isolated, Myasthenic syndrome, congenital, fast-channel, Congenital myasthenic syndrome, fast-channel, Oguchi's disease, Crigler Najjar syndrome, type 1, Crigler-Najjar syndrome, type II, Crigler-Najjar syndrome, Crigler-Najjar syndrome, type II, Gilbert's syndrome, Crigler Najjar syndrome, type 1, Hyperbilirubinemia, Ullrich congenital muscular dystrophy, Bethlem myopathy, Ullrich congenital muscular
  • Microphthalmia Microphthalmia, syndromic, Congenital disorder of deglycosylation, Cardiovascular phenotype, Loeys-Dietz syndrome, Thoracic aortic aneurysm and aortic dissection,
  • Osteogenesis imperfecta type 7 Lynch syndrome I, Hereditary cancer-predisposing syndrome, Turcot syndrome, Hereditary nonpolyposis colon cancer, Atrial fibrillation, Atrial fibrillation, familial, Atrial fibrillation, Brugada syndrome, Congenital long QT syndrome, Cardiac arrhythmia, Sudden infant death syndrome, Long qt syndrome, acquired,
  • Medulloblastoma Malignant melanoma of skin, Squamous cell carcinoma of the head and neck, Malignant tumor of prostate, Lung adenocarcinoma, Hepatoblastoma, Cutaneous melanoma, Hepatocellular carcinoma, Craniopharyngioma, Adrenocortical carcinoma, Adenocarcinoma of stomach, Malignant neoplasm of body of uterus, Liver cancer,
  • Medulloblastoma Lung adenocarcinoma, Neoplasm of stomach, Cutaneous melanoma, Hepatocellular carcinoma, Transitional cell carcinoma of the bladder, Carcinoma of esophagus, Uterine cervical neoplasms, Adenocarcinoma of stomach, Malignant neoplasm of body of uterus, Adenocarcinoma of prostate, Liver cancer, Malignant melanoma of skin,
  • Lung adenocarcinoma Cutaneous melanoma, Hepatocellular carcinoma, Transitional cell carcinoma of the bladder, Colorectal Neoplasms, Adrenocortical carcinoma, Malignant neoplasm of body of uterus, Adenocarcinoma of prostate, Nemaline myopathy,
  • Hepatocellular carcinoma Pancreatic adenocarcinoma, Transitional cell carcinoma of the bladder, Brainstem glioma, Carcinoma of esophagus, PIK3CA related overgrowth spectrum, Colorectal Neoplasms, Uterine cervical neoplasms, Papillary renal cell carcinoma, sporadic, Nasopharyngeal Neoplasms, Adenocarcinoma of stomach, Ovarian Serous
  • Cystadenocarcinoma Malignant neoplasm of body of uterus, Adenocarcinoma of prostate, Uterine Carcinosarcoma, Carcinoma of gallbladder, Lung cancer, Medulloblastoma, Malignant melanoma of skin, Squamous cell carcinoma of the head and neck, Malignant tumor of prostate, Ovarian epithelial cancer, Carcinoma of colon, Neoplasm of brain, Neoplasm of the breast, Glioblastoma, Transitional cell carcinoma of the bladder, PIK3CA related overgrowth spectrum, Ovarian Neoplasms, Colorectal Neoplasms, Uterine cervical neoplasms, Adenocarcinoma of stomach, Malignant neoplasm of body of uterus, Adenocarcinoma of prostate, Uterine Carcinosarcoma, Cowden syndrome, PIK3CA related overgrowth spectrum, Colorectal Neoplasms, Ciliary dyskinesia, Ciliary dyskinesi
  • Maldergem syndrome short-rib thoracic dysplasia with polydactyly, Ceroid lipofuscinosis neuronal, Macular dystrophy with central cone involvement, Ceroid lipofuscinosis neuronal, Methylmalonic aciduria cblA type, Pseudohypoaldosteronism type 1 autosomal dominant, Pseudohypoaldosteronism, Common variable immunodeficiency, with autoimmunity, Afibrinogenemia, congenital, Familial visceral amyloidosis, Ostertag type,
  • cardiomyopathy 1A Limb-girdle muscular dystrophy, type 2S, Mitochondrial myopathy, Myopia, Mitochondrial DNA depletion syndrome (cardiomyopathic type), autosomal recessive, Progressive sensorineural hearing impairment, Hypertrophic cardiomyopathy, Left ventricular hypertrophy, Vertigo, Abnormality of mitochondrial metabolism, Mitochondrial respiratory chain defects, Bietti crystalline corneoretinal dystrophy, Comeal Dystrophy, Recessive, Bietti crystalline corneoretinal dystrophy, Hereditary factor XI deficiency disease, Mitochondrial complex II deficiency, Paragangliomas, Hereditary cancer-predisposing syndrome, Mitochondrial complex II deficiency, Dyskeratosis congenita autosomal dominant, Ciliary dyskinesia, Mental retardation, autosomal dominant, Chondrocalcinosis, Oculocutaneous albinism type 4, Inherited bone marrow failure syndrome,
  • adenomatous polyposis Familial adenomatous polyposis, Hereditary cancer-predisposing syndrome, Familial adenomatous polyposis, Colorectal cancer, susceptibility to, Familial adenomatous polyposis, Hereditary cancer-predisposing syndrome, Familial adenomatous polyposis, Hereditary cancer-predisposing syndrome, Familial adenomatous polyposis, Hereditary cancer-predisposing syndrome, Familial adenomatous polyposis, Hereditary cancer-predisposing syndrome, Familial adenomatous polyposis, Anencephalus, Aortic aneurysm, familial thoracic, Pyridoxine-dependent epilepsy, Seizures,
  • Ventriculomegaly, Pyridoxine-dependent epilepsy, Myopathy areflexia, respiratory distress, and dysphagia, early-onset, Congenital contractural arachnodactyly, Neuro myotonia and axonal neuropathy, autosomal recessive, Renal carnitine transport defect, Hereditary cancer- predisposing syndrome, Chylomicron retention disease, Groenouw comeal dystrophy type I, Reis-Bucklers' corneal dystrophy, Lattice corneal dystrophy type 3A, Lattice corneal dystrophy Type I, Pseudohypoaldosteronism, type 2, Pseudohypoaldosteronism type 2D, Myotilinopathy, Charcot-Marie-Tooth disease, axonal, type 2w, Leber congenital amaurosis, Retinitis pigmentosa, Diastrophic dysplasia, de la Chapelle dysplasia, Achondro
  • Cardiomyopathy Abnormality of cardiovascular system morphology, Malformation of the heart and great vessels, Cardiovascular phenotype, Congenital heart disease, Atrial septal defect with or without atrioventricular conduction defects, Hypothyroidism, congenital, nongoitrous, Cardiovascular phenotype, Congenital heart disease, Craniosynostosis, Lewy body dementia, Sotos syndrome, Hypercalcemia, infantile, Hereditary angioneurotic edema with normal C 1 esterase inhibitor activity, Hereditary angioneurotic edema, Acute myeloid leukemia, Myelodysplasia, Ehlers-Danlos syndrome progeroid type, Axenfeld-Rieger syndrome type 3, Polymicrogyria, asymmetric, Combined oxidative phosphorylation deficiency, Combined oxidative phosphorylation deficiency, Factor XIII subunit A deficiency, Cardiovascular phenotype, Bicuspid aortic valve,
  • Osteopetrosis autosomal recessive, Amyotrophic lateral sclerosis type, Progressive pseudorheumatoid dysplasia, Metaphyseal chondrodysplasia, Schmid type, Ovarian dysgenesis, Alopecia congenita keratosis palmoplantaris, Oculodentodigital dysplasia, Merosin deficient congenital muscular dystrophy, Laminin alpha 2-related dystrophy, Merosin deficient congenital muscular dystrophy, Arginase deficiency, Arterial calcification of infancy, Hypophosphatemic rickets, autosomal recessive, Arterial calcification of infancy, Hypophosphatemic Rickets, Recessive, Arterial calcification of infancy, Joubert syndrome, Leber congenital amaurosis, Disseminated atypical mycobacterial infection,
  • Neoplasms Multiple myeloma, Squamous cell carcinoma of the head and neck, Lung adenocarcinoma, Non-small cell lung cancer, Squamous cell lung carcinoma, Colorectal Neoplasms, Non small cell lung cancer, Rasopathy, Neoplasm of the breast, Neoplasm, Carcinoma of colon, Noonan syndrome, Cataract and cardiomyopathy, Myotonia congenital, Congenital myotonia, autosomal recessive form, Premature ovarian failure, Cortical dysplasia-focal epilepsy syndrome, Rolandic epilepsy, Pitt-Hopkins-like syndrome, Rolandic epilepsy, Long QT syndrome, Congenital long QT syndrome, Short QT syndrome, Cardiovascular phenotype, Long QT syndrome, Glaucoma, open angle, F, Glycogen storage disease of heart, lethal congenital, Familial hypertrophic cardiomyopathy, Primary familial hypertrophic cardiomyopathy, Holoprosencephaly, Currarino
  • Hyperlipoproteinemia type I, lipoprotein lipase (Olbia), Surfactant metabolism dysfunction, pulmonary, Osteogenesis imperfecta, type xiii, Hypermanganesemia with dystonia, Charcot- Marie-Tooth disease, demyelinating, type If, Charcot-Marie-Tooth disease type 2E, Charcot- Marie-Tooth disease, demyelinating, type If, Trichothiodystrophy 6, nonphotosensitive, Cholesterol monooxygenase (side-chain cleaving) deficiency, Kallmann syndrome, Hartsfield syndrome, Medulloblastoma, Neuroblastoma, Encephalocraniocutaneous lipomatosis, Astrocytoma, Brainstem glioma, Adenocarcinoma of stomach, Rosette-forming glioneuronal tumor, Hypogonadotropic hypogonadism with anosmia, Spherocytosis type 1, Mental retardation, autosomal dominant, Idiopathic basal gangli
  • Ataxia with vitamin E deficiency nocturnal frontal lobe epilepsy
  • Joubert syndrome Melnick-Fraser syndrome
  • Osteopetrosis with renal tubular acidosis carbonic anhydrase II variant
  • Achromatopsia Hereditary cancer-predisposing syndrome
  • Trichorhinophalangeal dysplasia type I Multiple congenital exostosis, Dandy-Walker like malformation with atrioventricular septal defect, Benign familial neonatal seizures, Ciliary dyskinesia, primary, Iodotyrosyl coupling defect, Mental retardation, autosomal recessive, Deficiency of steroid 11 -beta-monooxygenase, Corticosterone methyloxidase type 1 deficiency, Hyperlipoproteinemia, type ID, Amelogenesis imperfecta, hypocalcification type, 5-Oxoprolinase deficiency, Mitochondrial complex III deficiency, nuclear type 6, Brown- Vialetto-Van Laere syndrome, Hereditary acrodermatitis enteropathica, Rothmund-Thomson syndrome, Baller-Gerold syndrome, Hyperimmunoglobulin E recurrent infection syndrome, autosomal recessive, Nicolaides-Baraitser
  • encephalopathy 59 Foeys-Dietz syndrome, Thoracic aortic aneurysm and aortic dissection, Foeys-Dietz syndrome, Congenital disorder of glycosylation type 1, Hereditary fmctosuria, Familial hypoalphalipoproteinemia, Tangier disease, Fimb-girdle muscular dystrophy- dystroglycanopathy, type C4, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A4, Primary autosomal recessive microcephaly, Meretoja syndrome, adrenal insufficiency, NR5A1 -related, 46, XY sex reversal, type 3, Nail-patella syndrome, Early infantile epileptic encephalopathy 4, Epileptic encephalopathy, Primary pulmonary hypertension, Osier hemorrhagic telangiectasia syndrome, Coenzyme Q10 deficiency, primary, Ichthyosis prematurity
  • hypomyelinating neuropathy Neuropathy, congenital hypomyelinating, autosomal dominant, Shprintzen-Goldberg syndrome, Goldberg-Shprintzen megacolon syndrome, Shprintzen- Goldberg syndrome, Diarrhea, malabsorptive, congenital, Aplastic anemia, Hemophagocytic lymphohistiocytosis, familial, nephrotic syndrome, Hyperphenylalaninemia, BH4 -deficient, D, Histiocytosis-lymphadenopathy plus syndrome, Usher syndrome, type ID, pituitary adenoma, multiple types, Usher syndrome, type ID, Usher syndrome, type ID, Gaucher disease, atypical, due to saposin C deficiency, Krabbe disease atypical due to Saposin A deficiency, Combined saposin deficiency, Sphingolipid activator protein deficiency, Gaucher disease, atypical, due to saposin C deficiency, Spondylo
  • Genitopatellar syndrome Young Simpson syndrome, Hypomyelinating leukodystrophy, Idiopathic fibrosing alveolitis, chronic form, Hepatic methionine adenosyltransferase deficiency, Hereditary cancer-predisposing syndrome, Juvenile polyposis syndrome, Juvenile polyposis syndrome, Hereditary cancer-predisposing syndrome, Hyperinsulinism- hyperammonemia syndrome, Spondyloepimetaphyseal dysplasia, pakistani type,
  • Neoplasm of the breast PTEN hamartoma tumor syndrome, Malignant melanoma of skin, Squamous cell carcinoma of the head and neck, Small cell lung cancer, Squamous cell lung carcinoma, Renal cell carcinoma, papillary, Neoplasm of the breast, Glioblastoma, Hereditary cancer-predisposing syndrome, Colorectal Neoplasms, Uterine cervical neoplasms, Adenocarcinoma of stomach, Malignant neoplasm of body of uterus, Adenocarcinoma of prostate, Uterine
  • Carcinosarcoma PTEN hamartoma tumor syndrome, Cowden syndrome, Hereditary cancer- predisposing syndrome, Hereditary cancer-predisposing syndrome, Lhermitte-Duclos disease, Neoplasm of the breast, Colorectal Neoplasms, Hereditary cancer-predisposing syndrome, Macrocephaly/autism syndrome, Hereditary cancer-predisposing syndrome, PTEN
  • hamartoma tumor syndrome Cutaneous melanoma, Hereditary cancer-predisposing syndrome, PTEN hamartoma tumor syndrome, Hereditary cancer-predisposing syndrome, Autoimmune lymphoproliferative syndrome, type la, Lysosomal acid lipase deficiency, Microcephaly with or without chorioretinopathy, lymphedema, or mental retardation, Hydranencephaly with renal aplasia-dysplasia, Spastic paraplegia, Cutis laxa, autosomal dominant, Primary hyperoxaluria, type III, Spastic tetraparesis, Hermansky-Pudlak syndrome, Dubin-Johnson syndrome, Renal coloboma syndrome, Autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions, Mitochondrial diseases, Autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions, Mitochondrial diseases, Kallmann syndrome,
  • adenocarcinoma Acute myeloid leukemia, Myelodysplastic syndrome, Nevus sebaceous, Nevus sebaceous, somatic, Rasopathy, Neoplasm of the breast, Glioblastoma, Bladder carcinoma, Hepatocellular carcinoma, Pancreatic adenocarcinoma, Squamous cell carcinoma of the skin, Transitional cell carcinoma of the bladder, Carcinoma of esophagus, Colorectal Neoplasms, Uterine cervical neoplasms, Neoplasm of the thyroid gland, Papillary renal cell carcinoma, sporadic, Adenoid cystic carcinoma, Nasopharyngeal Neoplasms,
  • Adenocarcinoma of stomach Ovarian Serous Cystadenocarcinoma, Malignant neoplasm of body of uterus, Adenocarcinoma of prostate, Uterine Carcinosarcoma, Early myoclonic encephalopathy, Neutral lipid storage disease with myopathy, Ceroid lipofuscinosis neuronal, Growth restriction, severe, with distinctive facies, Hyperproinsulinemia, Permanent neonatal diabetes mellitus, Hyperproinsulinemia, Segawa syndrome, autosomal recessive, Dystonia, Segawa syndrome, autosomal recessive, Jervell and Lange-Nielsen syndrome, Long QT syndrome, Cardiovascular phenotype, Congenital long QT syndrome, Long QT syndrome, Congenital long QT syndrome, Long QT syndrome, Long QT syndrome 1/2, digenic, Long QT syndrome, Congenital long QT syndrome, Cardiovascular phenotype, Long QT syndrome, Congenital long QT syndrome, Long QT syndrome, Cardiovascular pheno
  • Gnathodiaphyseal dysplasia Limb-girdle muscular dystrophy, type 2L, Gnathodiaphyseal dysplasia, Limb-girdle muscular dystrophy, type 2L, Miyoshi muscular dystrophy, AN05- Related Disorders, Limb-girdle muscular dystrophy, type 2L, Elevated serum creatine phosphokinase, Myopathy, Distal muscle weakness, Fatty replacement of skeletal muscle, Limb-girdle muscular dystrophy, type 2L, Follicle-stimulating hormone deficiency, isolated, Aniridia, Irido-corneo-trabecular dysgenesis, Foveal hypoplasia with cataract, Irido-comeo- trabecular dysgenesis, Anophthalmia - microphthalmia, Aniridia, Irido-corneo-trabecular dysgenesis, Wilms tumor, Combined cellular and humoral immune defects with granulomas, Severe combined immunodefici
  • Thrombophilia Hereditary factor II deficiency disease, Xeroderma pigmentosum, group E, Left ventricular noncompaction, Hypertrophic cardiomyopathy, Primary familial
  • hypertrophic cardiomyopathy Hypertrophic cardiomyopathy, Cardiovascular phenotype, Primary familial hypertrophic cardiomyopathy, Cardiovascular phenotype, Familial hypertrophic cardiomyopathy, Primary familial hypertrophic cardiomyopathy, Hypertrophic, Primary familial hypertrophic cardiomyopathy, Cardiovascular phenotype, Familial hypertrophic cardiomyopathy, Familial hypertrophic cardiomyopathy, Primary familial hypertrophic cardiomyopathy, Hypertrophic cardiomyopathy, Cardiovascular phenotype, Primary familial hypertrophic cardiomyopathy, Hypertrophic cardiomyopathy, Primary familial hypertrophic cardiomyopathy, Primary familial hypertrophic cardiomyopathy, Hypertrophic cardiomyopathy, Hypertrophic cardiomyopathy, Primary familial hypertrophic cardiomyopathy, Cardiovascular phenotype, Familial hypertrophic cardiomyopathy,
  • Cardiovascular phenotype Primary familial hypertrophic cardiomyopathy, Familial hypertrophic cardiomyopathy, Hypertrophic cardiomyopathy, Myasthenic syndrome, congenital, associated with acetylcholine receptor deficiency, Pena-Shokeir syndrome type I, Myasthenic syndrome, congenital, associated with acetylcholine receptor deficiency, Congenital myasthenic syndrome, Myopathy, Myasthenic syndrome, congenital, associated with acetylcholine receptor deficiency, Congenital Myasthenic Syndrome, Recessive, Myasthenic syndrome, congenital, associated with acetylcholine receptor deficiency, Hereditary angioedema type 1, Hereditary Cl esterase inhibitor deficiency - dysfunctional factor, Poikiloderma, hereditary fibrosing, with tendon contractures, myopathy, and pulmonary fibrosis, Gracile bone dysplasia, Joubert syndrome, Joubert syndrome,
  • Encephalopathy progressive, with or without lipodystrophy, Familial renal hypouricemia, Platelet-type bleeding disorder, Glycogen storage disease, type V, Hereditary cancer- predisposing syndrome, Multiple endocrine neoplasia, type 1, Hereditary cancer-predisposing syndrome, Hereditary cancer-predisposing syndrome, Multiple endocrine neoplasia, type 1, Multiple endocrine neoplasia, type 1, Hereditary cancer-predisposing syndrome, Coffin-Siris syndrome, Calfan syndrome, Verloes Bourguignon syndrome, Bardet-Biedl syndrome, Bardet-Biedl syndrome, Spinocerebellar ataxia, autosomal recessive, Pyruvate carboxylase deficiency, Cold-induced sweating syndrome, Crisponi/Cold-induced sweating syndrome, Somatotroph adenoma, Pituitary adenoma predisposition, Mitochondrial complex I de
  • LAMM labyrinthine aplasia microtia and microdontia
  • LAMM labyrinthine aplasia microtia and microdontia
  • LAMM labyrinthine aplasia microtia and microdontia
  • Smith-Lemli-Opitz syndrome Cerebral folate deficiency
  • Opsismodysplasia 3-methylglutaconic aciduria with cataracts, neurologic involvement
  • neutropenia Joubert syndrome
  • Vitreoretinopathy neovascular inflammatory, Usher syndrome, type 1, Usher syndrome, type 1, Usher syndrome, type IB, Usher syndrome, type 1, MY07A-Related Disorders
  • polycystic liver disease with or without kidney cysts Tremor, hereditary essential, Mitochondrial complex I deficiency, Mitochondrial diseases, Tyrosinase-negative oculocutaneous albinism,
  • Tyrosinase-negative oculocutaneous albinism Oculocutaneous albinism type IB, Albinism, ocular, with sensorineural deafness, Skin/hair/eye pigmentation, variation in, Oculocutaneous albinism, Hereditary cancer-predisposing syndrome, Ataxia-telangiectasia-like disorder, Charcot-Marie-Tooth disease, type 4B1, Focal segmental glomerulosclerosis, Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation, Metaphyseal chondrodysplasia, Spahr type, Short-rib polydactyly syndrome type III, Jeune thoracic dystrophy, Short-rib thoracic dysplasia with or without polydactyly, Short-rib polydactyly syndrome type I, Short-rib polydactyly syndrome type III, Deficiency of acetyl- CoA acetyltransferase,
  • Paragangliomas Hereditary Paraganglioma-Pheochromocytoma Syndromes, Cowden syndrome, Paraganglioma and gastric stromal sarcoma, Pheochromocytoma, Mitochondrial complex II deficiency, Paragangliomas, Hereditary Paraganglioma-Pheochromocytoma Syndromes, Cowden syndrome 3, Apolipoprotein A-IV polymorphism,
  • APOA4* l/APOA4*2 Hyperalphalipoproteinemia, Coronary heart disease, Apolipoprotein A-I (Baltimore), Immunodeficiency, Kabuki syndrome, Wiedemann-Steiner syndrome, Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay, Glucose-6- phosphate transport defect, Acute intermittent porphyria, Congenital myasthenic syndrome, Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia, Microphthalmia, isolated, Gaze palsy, familial horizontal, with progressive scoliosis, Megalencephalic leukoencephalopathy with subcortical cysts 2a, Deficiency of isobutyryl- CoA dehydrogenase, Cone dystrophy, Retinal cone dystrophy, Megalencephaly- polymicrogyria-polydactyly-hydrocephalus syndrome, Tumoral
  • cardiomyopathy Primary familial hypertrophic cardiomyopathy, Familial hypertrophic cardiomyopathy, Death in infancy, Ventricular extrasystoles, Cardiovascular phenotype, Noonan syndrome, Noonan syndrome, Rasopathy, Juvenile myelomonocytic leukemia, Noonan syndrome, Leopard syndrome, Rasopathy, Metachondromatosis, Noonan syndrome with multiple lentigines, Noonan syndrome 1, LEOPARD syndrome, Scoliosis, Rasopathy, Abnormal facial shape, cafe-au-lait spot, Specific learning disability, Intellectual disability, mild, Aortic valve disease, Holt-Oram syndrome, Mental retardation and distinctive facial features with or without cardiac defects, Charcot-Marie-Tooth disease, type 2L,
  • Medulloblastoma Wilms tumor, Malignant tumor of prostate, Tracheoesophageal fistula, Pancreatic cancer, Glioma susceptibility, Hereditary breast and ovarian cancer syndrome, Hereditary cancer-predisposing syndrome, BRCA2-Related Disorders, Breast-ovarian cancer, familial, Fanconi anemia, complementation group Dl, Fanconi anemia, Hereditary breast and ovarian cancer syndrome, Hereditary cancer-predisposing syndrome, Primary pulmonary hypertension, Congenital disorder of glycosylation type 2L, Hyperornithinemia- hyperammonemia-homocitrullinuria syndrome, Retinoblastoma, Retinoblastoma, Neoplasm, Small cell lung cancer, Neoplasm, Retinitis pigmentosa, Retinal dystrophy with or without extraocular anomalies, Retinitis pigmentosa, Retinal dystrophy with extraocular anomalies, Aicardi Goutieres
  • cardiomyopathy Wolff-Parkinson-White pattern
  • Dilated cardiomyopathy 1EE Familial hypertrophic cardiomyopathy
  • Primary familial hypertrophic cardiomyopathy Sudden cardiac death
  • Cardiovascular phenotype Hypertrophic cardiomyopathy
  • Primary familial hypertrophic cardiomyopathy Primary familial hypertrophic cardiomyopathy
  • Cardiovascular phenotype Familial hypertrophic
  • cardiomyopathy Primary familial hypertrophic cardiomyopathy, Cardiovascular phenotype, Familial hypertrophic cardiomyopathy, Familial cardiomyopathy, Hypertrophic cardiomyopathy, Cardiomyopathy, Hypertrophic cardiomyopathy, Dyskeratosis congenita, Dyskeratosis congenita autosomal dominant, Dyskeratosis congenita autosomal dominant, Dyskeratosis congenita, autosomal dominant, Revesz syndrome, Dyskeratosis congenita autosomal dominant, Dyskeratosis congenita, Dyskeratosis Congenita, Dominant, Autosomal recessive congenital ichthyosis, Rett syndrome, congenital variant, Mitochondrial complex I deficiency, Ectodermal dysplasia, anhidrotic, with T-cell immunodeficiency, autosomal dominant, Benign hereditary chorea, Choreoathetosis, hypothyroid
  • Kartagener syndrome L-2-hydroxyglutaric aciduria, Penetrating foot ulcers, Distal sensory impairment, Osteomyelitis leading to amputation due to slow healing fractures, Distal lower limb muscle weakness, Glycogen storage disease, type VI, Dystonia, Dopa-responsive type, Microphthalmia syndromic, Anophthalmia, combined immunodeficiency and megaloblastic anemia, Hereditary cancer-predisposing syndrome, congential disorder of glycosylation with defective fucosylation, Leber congenital amaurosis, Platelet-type bleeding disorder,
  • Alzheimer disease type 3, Alzheimer disease, type 3, Pick's disease, Alzheimer disease, type 3, Frontotemporal dementia, Pick's disease, Acne inversa, familial, Coenzyme Q10 deficiency, primary, Methylmalonate semialdehyde dehydrogenase deficiency, Niemann-Pick disease type C2, Niemann-Pick disease, type C, Leukoencephalopathy with vanishing white matter, Carcinoma of colon, Endometrial carcinoma, Hereditary nonpolyposis colorectal cancer type 7, Lynch syndrome, MLH3-Related Lynch Syndrome, Nevus comedonicus, Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, Cone-rod dystrophy, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A2, Congenital muscular dystrophy-dystroglycanopathy with mental retardation, type B2, Limb-girdle muscular dystrophy-dystrogly
  • pleuropulmonary blastoma cancer predisposition syndrome Hereditary cancer-predisposing syndrome, Gabriele-De Vries Syndrome, Spinal muscular atrophy, SMA, Spinal muscular atrophy, lower extremity predominant, autosomal dominant, Mental retardation, autosomal dominant, Mental retardation, autosomal dominant, Charcot-Marie-Tooth disease, dominant intermediate E, cerebellar-facial-dental syndrome, Cerebellofaciodental syndrome,
  • cardiomyopathy Familial pulmonary capillary hemangiomatosis, Isovaleric acidemia, type I, Adams-Oliver syndrome, Limb-girdle muscular dystrophy, type 2A, Spherocytosis type 5, Peeling skin syndrome, Peeling skin syndrome, acral type, Microcephaly and
  • chorioretinopathy autosomal recessive, Hypoproteinemia, hypercatabolic, Arginine: glycine amidinotransferase deficiency, Bartter syndrome, type 1, antenatal, Marfan syndrome,
  • Marfan lipodystrophy syndrome Cardiovascular phenotype, Marfan syndrome, Thoracic aortic aneurysm and aortic dissection, Thoracic aortic Aneurysm and dissection (TAAD), Cardiovascular phenotype, Stiff skin syndrome, Marfan syndrome, Thoracic aortic aneurysm and aortic dissection, Thoracic aortic Aneurysm and dissection (TAAD), Marfan
  • Cardiovascular phenotype Seckel syndrome, Aromatase deficiency, Lethal congenital contracture syndrome, Intellectual developmental disorder with cardiac arrhythmia, Primary ciliary dyskinesia, Craniosynostosis, Parkinson disease, age at onset, susceptibility to, Parkinson disease, Parkinson disease, autosomal recessive early-onset, Hyperchlorhidrosis, isolated, Nemaline myopathy, Congenital stationary night blindness, type ID, Lung adenocarcinoma, Non-small cell lung cancer, Cutaneous melanoma, Cardio-facio-cutaneous syndrome, Cardiofaciocutaneous syndrome, Cardio-facio-cutaneous syndrome, Aortic valve disease, Thoracic aortic aneurysm and aortic dissection, Cardiovascular phenotype, Loeys- Dietz syndrome, Ceroid lipofuscinosis neurode
  • Camptocormia Acrocallosal syndrome, Schinzel type, Spondylocostal dysostosis, Liver cancer, Acute myeloid leukemia, Neoplasm of brain, Hepatocellular carcinoma, Brainstem glioma, Colorectal Neoplasms, Multiple myeloma, Squamous cell carcinoma of the head and neck, Acute myeloid leukemia, Myelodysplastic syndrome, Colorectal Neoplasms, Bloom syndrome, Bloom syndrome, Hereditary cancer-predisposing syndrome, Arthrogryposis renal dysfunction cholestasis syndrome, Epileptic encephalopathy, childhood-onset, Congenital heart defects, multiple types, Weill-Marchesani-like syndrome, Autosomal recessive congenital ichthyosis, Microphthalmia, isolated, Osteosclerotic metaphyseal dysplasia, alpha Thalassemia, Hemoglobin Loire, Erythrocytosis, Hemoglobin Chesa
  • Mucolipidosis III Gamma You-Hoover-Fong syndrome, Renal dysplasia, retinal pigmentary dystrophy, cerebellar ataxia and skeletal dysplasia, Joubert syndrome with Jeune asphyxiating thoracic dystrophy, Renal dysplasia, retinal pigmentary dystrophy, cerebellar ataxia and skeletal dysplasia, Retinis pigmentosa, Leigh syndrome, Combined oxidative
  • Lymphangiomyomatosis Tuberous sclerosis syndrome, Polycystic kidney disease, adult type, Digitorenocerebral syndrome, Early infantile epileptic encephalopathy, Myoclonic epilepsy, familial infantile, Digitorenocerebral syndrome, Progressive myoclonus epilepsy with ataxia, Familial Mediterranean fever, Rubinstein-Taybi syndrome, Nephronophthisis, Congenital disorder of glycosylation type IK, Carbohydrate-deficient glycoprotein syndrome type I, Carbohydrate-deficient glycoprotein syndrome type I, Congenital disorder of glycosylation, Epilepsy, focal, with speech disorder and with or without mental retardation, Rolandic epilepsy, Bare lymphocyte syndrome type 2, complementation group A, Charcot-Marie- Tooth disease, type 1C, Fanconi anemia, complementation group Q, Dyskeratosis congenita, Dyskeratosis congenita, autosomal recessive, Lissencephaly
  • Bile acid synthesis defect congenital, Generalized epilepsy with febrile seizures plus, type 9, Warfarin response, warfarin response - Dosage, Warfarin response, Familial renal glucosuria, Glycogen storage disease IXb, Behcet's syndrome, Cylindromatosis, familial, Townes-Brocks syndrome, Joubert syndrome, Hamamy syndrome, Multicentric osteolysis, nodulosis and arthropathy, Bardet-Biedl syndrome, Retinitis pigmentosa, Nephrotic syndrome, type 12, Familial hypokalemia-hypomagnesemia, Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type, Polymicrogyria, bilateral frontoparietal, Lissencephaly, with microcephaly, Retinitis pigmentosa, Poikiloderma with neutropenia, Brachioskeletogenital syndrome, Mitochondrial DNA depletion syndrome, Lamella
  • Hyperlipidemia Short metacarpal, Intellectual disability, severe, Short stature, brachydactyly, intellectual developmental disability, and seizures, Acanthosis nigricans, Skeletal dysplasia, Insulin resistance, Short stature, Self-injurious behavior, Abnormal facial shape,
  • Brachydactyly Renal hypoplasia, Abnormality of the dentition, Hepatic steatosis, Obesity, Lumbar hyperlordosis, Hyperlipidemia, Short metacarpal, Intellectual disability, severe, Hereditary diffuse gastric cancer, Hereditary cancer-predisposing syndrome, Ectropion inferior cleft lip and or palate, Breast cancer, lobular, Hereditary diffuse gastric cancer, Hereditary cancer-predisposing syndrome, Ectropion inferior cleft lip and or palate,
  • Medulloblastoma Malignant melanoma of skin, Multiple myeloma, Squamous cell carcinoma of the head and neck, Small cell lung cancer, Lung adenocarcinoma, Squamous cell lung carcinoma, Acute myeloid leukemia, Neoplasm of brain, Neoplasm of the breast, Glioblastoma, Hepatocellular carcinoma, Hereditary cancer-predisposing syndrome,
  • Pancreatic adenocarcinoma Transitional cell carcinoma of the bladder, Brainstem glioma, Carcinoma of esophagus, Colorectal Neoplasms, Adrenocortical carcinoma, Adenocarcinoma of stomach, Ovarian Serous Cystadenocarcinoma, Malignant neoplasm of body of uterus, Adenocarcinoma of prostate, Uterine Carcinosarcoma, Metastatic pancreatic neuroendocrine tumours, Liver cancer, Chronic lymphocytic leukemia, Medulloblastoma, Malignant melanoma of skin, Multiple myeloma, Squamous cell carcinoma of the head and neck, Small cell lung cancer, Lung adenocarcinoma, Squamous cell lung carcinoma, Acute myeloid leukemia, Neoplasm of brain, Neoplasm of the breast, Glioblastoma, Hepatocellular carcinoma, Hereditary cancer-predisposing syndrome, Pancreatic a
  • Transitional cell carcinoma of the bladder Brainstem glioma, Carcinoma of esophagus, Colorectal Neoplasms, Adrenocortical carcinoma, Adenocarcinoma of stomach, Ovarian Serous Cystadenocarcinoma, Malignant neoplasm of body of uterus, Adenocarcinoma of prostate, Uterine Carcinosarcoma, Medulloblastoma, Multiple myeloma, Squamous cell carcinoma of the head and neck, Li-Fraumeni syndrome, Lung adenocarcinoma, Renal cell carcinoma, papillary, Neoplasm of the breast, Hereditary cancer-predisposing syndrome, Pancreatic adenocarcinoma, Squamous cell carcinoma of the skin, Transitional cell carcinoma of the bladder, Colorectal Neoplasms, Adenocarcinoma of stomach, Ovarian Serous Cystadenocarcinoma, Malignant neoplasm of body of uterus, Heredit
  • Hepatocellular carcinoma Hereditary cancer-predisposing syndrome, Liver cancer,
  • adenocarcinoma Li-Fraumeni syndrome, Squamous cell lung carcinoma, Neoplasm of brain, Neoplasm of the breast, Glioblastoma, Hepatocellular carcinoma, Hereditary cancer- predisposing syndrome, Pancreatic adenocarcinoma, Transitional cell carcinoma of the bladder, Brainstem glioma, Carcinoma of esophagus, Colorectal Neoplasms,
  • Adenocarcinoma of stomach Ovarian Serous Cystadenocarcinoma, Adenocarcinoma of prostate, Uterine Carcinosarcoma, Liver cancer, Chronic lymphocytic leukemia, Multiple myeloma, Squamous cell carcinoma of the head and neck, Lung adenocarcinoma, Li- Fraumeni syndrome, Neoplasm of brain, Neoplasm of the breast, Glioblastoma,
  • Hepatocellular carcinoma Pancreatic adenocarcinoma, Transitional cell carcinoma of the bladder, Carcinoma of esophagus, Colorectal Neoplasms, Uterine cervical neoplasms, Adenocarcinoma of stomach, Ovarian Serous Cystadenocarcinoma, Malignant neoplasm of body of uterus, Uterine Carcinosarcoma, Li-Fraumeni syndrome, Liver cancer,
  • Hepatocellular carcinoma Hereditary cancer-predisposing syndrome, Liver cancer,
  • Malignant melanoma of skin Multiple myeloma, Squamous cell carcinoma of the head and neck, Lung adenocarcinoma, Breast cancer, somatic, Squamous cell lung carcinoma, Neoplasm of brain, Neoplasm of the breast, Hepatocellular carcinoma, Breast
  • adenocarcinoma Hereditary cancer-predisposing syndrome, Pancreatic adenocarcinoma, Transitional cell carcinoma of the bladder, Carcinoma of esophagus, Colorectal Neoplasms, Adenoid cystic carcinoma, Adenocarcinoma of stomach, Ovarian Serous
  • Cystadenocarcinoma Malignant neoplasm of body of uterus, Uterine Carcinosarcoma, Carcinoma of pancreas, Dyskeratosis congenita, autosomal recessive, Leber congenital amaurosis, Cone-rod dystrophy, Autosomal recessive congenital ichthyosis, Ichthyosis, Autosomal recessive congenital ichthyosis, Spondylocostal dysostosis, Inclusion Body Myopathy, Dominant, Hepatic failure, early-onset, and neurologic disorder due to
  • cytochrome C oxidase deficiency Charcot-Marie-Tooth disease and deafness, Dejerine- Sottas disease, Dejerine- Sottas disease, Dejerine- Sottas syndrome, autosomal dominant, Charcot-Marie-Tooth disease, type IA, Dejerine- Sottas syndrome, autosomal dominant, Charcot-Marie-Tooth disease, type I, Mitochondrial complex III deficiency, nuclear type 2, Common variable immunodeficiency, Immunoglobulin A deficiency, Common Variable Immune Deficiency, Dominant, Common variable immunodeficiency, Hereditary cancer- predisposing syndrome, Multiple fibrofolliculomas, Hereditary cancer-predisposing syndrome, Hereditary cancer-predisposing syndrome, Multiple fibrofolliculomas, Hereditary cancer-predisposing syndrome, Smith-Magenis syndrome, Joubert syndrome, Meckel-Gruber syndrome, Sjogren-L
  • ophthalmoplegia Frontotemporal dementia, Progressive supranuclear ophthalmoplegia, Muscular dystrophy, Epilepsy, progressive myoclonic 6, Glanzmann thrombasthenia, Amelogenesis imperfecta, type IV, Tricho-dento-osseous syndrome, Osteogenesis imperfecta type I, Osteogenesis imperfecta type 2, thin-bone, Osteogenesis imperfecta with normal sclerae, dominant form, Osteogenesis imperfecta type I, Osteogenesis imperfecta type IIC, Osteogenesis imperfecta, recessive perinatal lethal, Osteogenesis imperfecta type I,
  • Hyperkalemic Periodic Paralysis Type 1 Hypokalemic periodic paralysis, Hypokalemic periodic paralysis, type 2, Hyperkalemic Periodic Paralysis Type 1, Carcinoma of colon, Oligodontia-colorectal cancer syndrome, Carney complex, type 1, Andersen Tawil syndrome, Familial periodic paralysis, Andersen Tawil syndrome, Andersen Tawil syndrome, Congenital long QT syndrome, Acampomelic campomelic dysplasia, Camptomelic dysplasia, Striatal necrosis, bilateral, and progressive polyneuropathy, Pontocerebellar hypoplasia type 4, Pontocerebellar hypoplasia type 2A, Pontocerebellar hypoplasia type 4, Pontocerebellar hypoplasia type 2A,
  • adrenoleukodystrophy Epidermodysplasia verruciformis, Desbuquois dysplasia, Rolandic epilepsy, Ciliary dyskinesia, Ciliary dyskinesia, primary, Glycogen storage disease, type II, Glycogen storage disease type II, infantile, Glycogen storage disease, type II, Baraitser- Winter Syndrome, Nephrotic syndrome, type 8, Autosomal recessive cutis laxa type 2B, Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, Arhinia choanal atresia microphthalmia, Oculomelic amyoplasia, Dystonia, Spinocerebellar ataxia, ACTH resistance, Glucocorticoid Deficiency, Renal hypodysplasia/aplasia, Left ventricular noncompaction, Pancreatic agenesis and congenital heart disease, Abnormality of cardiovascular system morphology, Con
  • Spondyloenchondrodysplasia with immune dysregulation Deficiency of alpha-mannosidase, Aicardi Goutieres syndrome, Blood group - Lutheran inhibitor, Glutaric aciduria, type 1, Marshall-Smith syndrome, Epileptic encephalopathy, early infantile, Lamilial hemiplegic migraine type 1, Episodic ataxia type 2, Epileptic encephalopathy, early infantile, Lamilial hemiplegic migraine type 1, Autosomal recessive non-syndromic intellectual disability, Lehman syndrome, Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, Combined oxidative phosphorylation deficiency, Severe combined immunodeficiency, autosomal recessive, T cell-negative, B cell-positive, NK cell-negative, Thyroid dyshormonogenesis, Cold-induced sweating syndrome, Pseudoachondroplastic spondyloepiphys
  • Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies type A5 Muscle weakness, Headache, Gait imbalance, Difficulty walking, Paresthesia, Difficulty climbing stairs, Scapular winging, Difficulty standing, Muscular dystrophy- dystroglycanopathy, Walker- Warburg congenital muscular dystrophy, Congenital muscular dystrophy-dystroglycanopathy with mental retardation, type B5, Fimb-girdle muscular dystrophy-dystroglycanopathy, type C5, Walker- Warburg congenital muscular dystrophy, Walker-Warburg congenital muscular dystrophy, Congenital muscular dystrophy- dystroglycanopathy without mental retardation, type B5, Walker-Warburg congenital muscular dystrophy, Congenital muscular dystrophy-dystroglycanopathy with mental retardation, type B5, Fimb-girdle muscular dystrophy-dystroglycanopathy, type C5,
  • Congenital muscular dystrophy-dystroglycanopathy with mental retardation type B5, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies type A5, Walker-Warburg congenital muscular dystrophy, Hypocalciuric hypercalcemia, familial, type III, Mental retardation, autosomal recessive, Hyperferritinemia cataract syndrome, F-ferritin deficiency, autosomal recessive, Isolated lutropin deficiency, Autistic disorder of childhood onset, Motor delay, Iris coloboma, Autism, Delayed speech and language development, Abnormality of vision, Early infantile epileptic encephalopathy, Ataxia-oculomotor apraxia, Early infantile epileptic encephalopathy, Peripheral neuropathy, myopathy, hoarseness, and hearing loss, Spinocerebellar ataxia, Spinocerebellar ataxia, Retinitis pigmentosa, Nemaline myopathy, Polygluco
  • Cardiomyopathy hypertrophic, midventricular, digenic, Dowling-Degos disease, C-like syndrome, Multiple synostoses syndrome, Symphalangism, proximal, Fibular hypoplasia and complex brachydactyly, schizophrenia, Aicardi Goutieres syndrome, Severe combined immunodeficiency due to ADA deficiency, Partial adenosine deaminase deficiency, Multiple congenital anomalies-hypotonia-seizures syndrome, Primary autosomal recessive
  • microcephaly Galloway-Mowat Syndrome, Arterial tortuosity syndrome, Epileptic encephalopathy, early infantile, Helsmoortel-van der aa syndrome, Congenital disorder of glycosylation type IE, Idiopathic hypercalcemia of infancy, Cushing's syndrome, McCune- Albright syndrome, Polyostotic fibrous dysplasia, somatic, mosaic, Pituitary Tumor, Growth Hormone- Secreting, Somatic, Liver cancer, McCune- Albright syndrome, Malignant melanoma of skin, Squamous cell carcinoma of the head and neck, Lung adenocarcinoma, Neoplasm of the breast, Hepatocellular carcinoma, Pancreatic adenocarcinoma, Neoplasm, Colorectal Neoplasms, Uterine cervical neoplasms, Adrenocortical carcinoma,
  • Congenital cataract Klippel-feil syndrome, autosomal recessive, with nemaline myopathy and facial dysmorphism
  • Hermansky-Pudlak syndrome Cataract, congenital nuclear, autosomal recessive, Cataract, multiple types, Familial cancer of breast, Hereditary cancer- predisposing syndrome, Hereditary cancer-predisposing syndrome, Familial cancer of breast, Prostate cancer, somatic, Hereditary cancer-predisposing syndrome, Osteosarcoma,
  • Neurofibromatosis type 2
  • Epilepsy familial focal, with variable foci, Rolandic epilepsy, Parkinson disease, Sorsby fundus dystrophy, Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss, Microcytic anemia, Peripheral demyelinating neuropathy, central dysmyelination, Waardenburg syndrome, and Hirschsprung disease, Waardenburg syndrome type 4C, Parkinson disease, Infantile neuroaxonal dystrophy, Adenylosuccinate lyase deficiency, Nephronophthisis-like nephropathy, Carcinoma of colon, Rubinstein-Taybi syndrome, Carcinoma of colon, Kanzaki disease, Methemoglobinemia type 2, Autosomal recessive syndrome of syndactyly, undescended testes and central nervous system defects, Megalencephalic
  • leukoencephalopathy with subcortical cysts Microcephaly with chorioretinopathy, autosomal recessive, Mitochondrial DNA depletion syndrome (MNGIE type), Muscular dystrophy, congenital, megaconial type, Metachromatic leukodystrophy, juvenile type, Metachromatic leukodystrophy, late infantile, Metachromatic leukodystrophy, Metachromatic
  • leukodystrophy severe, Metachromatic leukodystrophy, Short stature, idiopathic, X-linked, Leri Weill dyschondrosteosis, Chondrodysplasia punctata, X-linked recessive, Kallmann syndrome, Ocular albinism, type I, Opitz-Frias syndrome, Amelogenesis imperfecta, type IE, Spondyloepiphyseal dysplasia tarda, Oral-facial-digital syndrome, Joubert syndrome, Joubert syndrome, Oral-facial-digital syndrome, Paroxysmal nocturnal hemoglobinuria 1, Multiple congenital anomalies-hypotonia-seizures syndrome, Pettigrew syndrome, Nance-Horan syndrome, Congenital cataract, Early infantile epileptic encephalopathy, Early infantile epileptic encephalopathy, Atypical Rett syndrome, Early infantile epileptic encephalopathy, Angelman syndrome-like, Early infantile epil
  • Phosphoribosylpyrophosphate synthetase superactivity Charcot-Marie-Tooth disease, X- linked recessive, type 5, Alport syndrome, X-linked recessive, Microscopic hematuria, Elevated mean arterial pressure, Chronic kidney disease, Mental retardation, X-linked, Megalocornea, Mental retardation, X-linked, Heterotopia, Lissencephaly, X-linked,
  • Fucosidosis Lissencephaly, X-linked, Subcortical laminar heterotopia, X-linked, Danon disease, Syndromic X-linked mental retardation, Cabezas type, Mental retardation, X-linked, syndromic, wu type, Lymphoproliferative syndrome, X-linked, Lymphoproliferative syndrome, X-linked, Simpson-Golabi-Behmel syndrome, Borjeson-Forssman-Lehmann syndrome, Lesch-Nyhan syndrome, Lesch-Nyhan syndrome, HPRT Flint, Partial
  • Frontometaphyseal dysplasia Cardiac valvular dysplasia, X-linked, Periventricular nodular heterotopia, Oto-palato-digital syndrome, type II, Oto-palato-digital syndrome, type I, Emery-Dreifuss muscular dystrophy, X-linked, 3-Methylglutaconic aciduria type 2,
  • Galloway-Mowat Syndrome X-Linked, Glucose 6 phosphate dehydrogenase deficiency, G6pd a-, G6PD Canton, G6PD GIFU, G6PD Agrigento, G6PD Taiwan-Hakka, Anemia, nonspherocytic hemolytic, due to G6PD deficiency, G6PD LOMA Linda, Anemia, nonspherocytic hemolytic, due to G6PD deficiency, Glucose phosphate dehydrogenase deficiency, G6pd a-G6PD Gastonia, G6PD Marion, G6PD Minnesota, Anemia,
  • nonspherocytic hemolytic due to G6PD deficiency, Hypohidrotic ectodermal dysplasia with immune deficiency, Dyskeratosis congenita X-linked, Hereditary factor VIII deficiency disease, Parkinsonism, early onset with mental retardation, Mental retardation, X-linked, Leri Weill dyschondrosteosis, XY sex reversal, type 1, Leigh syndrome, Chloramphenicol resistance, nonsyndromic sensorineural, mitochondrial, Leber's optic atrophy, Cytochrome c oxidase i deficiency, Leigh syndrome, Mitochondrial complex I deficiency, Leigh syndrome, Retinitis pigmentosa-deafness syndrome, Cerebellar ataxia, cataract, and diabetes mellitus.
  • the present disclosure provides uses of any one of the fusion proteins described herein and a guide RNA targeting this fusion protein to a target A:T base pair in a nucleic acid molecule in the manufacture of a kit for nucleic acid editing, wherein the nucleic acid editing comprises contacting the nucleic acid molecule with the fusion protein and guide RNA under conditions suitable for the substitution of the adenine (A) of the A:T nucleobase pair with a cytosine (C).
  • the nucleic acid molecule is a double-stranded DNA molecule.
  • the step of contacting of induces separation of the double- stranded DNA at a target region.
  • the step of contacting further comprises nicking one strand of the double-stranded DNA, wherein the one strand comprises an unmutated strand that comprises the T of the target A:T nucleobase pair.
  • the step of contacting is performed in vitro. In other embodiments, the step of contacting is performed in vivo. In some
  • the step of contacting is performed in a subject (e.g., a human subject or a non human animal subject). In some embodiments, the step of contacting is performed in a cell, such as a human or non-human animal cell.

Abstract

La présente invention concerne des éditeurs de base qui satisfont un besoin dans l'état de la technique pour l'installation de transversions ciblées d'adénine (A) en cytosine (C) ou, de manière correspondante, de transversions de thymine (T) en guanine (G). Les domaines d'éditeur de base comprennent une protéine de liaison à l'ADN programmable par un acide nucléique et une adénine-oxydase. Les éditeurs de base peuvent être modifiés au moyen de systèmes d'évolution continue ou non continue, tels qu'une évolution continue assistée par des phages. En particulier, la présente invention concerne des variants d'éditeur de base d'adénine-en-cytosine (ou thymine-en-guanine) qui surmontent les déficiences de l'état de la technique pour des éditeurs de base qui peuvent installer des mutations de transversion à base unique. Dans certains modes de réalisation, l'invention porte sur des méthodes d'édition ciblée d'acides nucléiques. Dans certains modes de réalisation, l'invention concerne des compositions pharmaceutiques comprenant des éditeurs de base ciblés et des vecteurs et des kits utiles pour la génération de ceux-ci. Dans certains modes de réalisation, l'invention concerne des cellules comportant de tels vecteurs. Dans certains modes de réalisation, l'invention concerne des procédés de traitement comprenant l'administration des éditeurs de base.
PCT/US2020/021362 2019-03-06 2020-03-06 Éditeurs de base a:t en c:g et leurs utilisations WO2020181180A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962814766P 2019-03-06 2019-03-06
US62/814,766 2019-03-06

Publications (1)

Publication Number Publication Date
WO2020181180A1 true WO2020181180A1 (fr) 2020-09-10

Family

ID=70166147

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/021362 WO2020181180A1 (fr) 2019-03-06 2020-03-06 Éditeurs de base a:t en c:g et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2020181180A1 (fr)

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021108717A2 (fr) 2019-11-26 2021-06-03 The Broad Institute, Inc Systèmes et procédés pour l'évaluation d'édition hors cible indépendante de cas9 d'acides nucléiques
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
WO2021158921A2 (fr) 2020-02-05 2021-08-12 The Broad Institute, Inc. Éditeurs de base d'adénine et leurs utilisations
WO2021222318A1 (fr) 2020-04-28 2021-11-04 The Broad Institute, Inc. Édition de base ciblée du gène ush2a
EP3922719A1 (fr) 2020-06-12 2021-12-15 Eligo Bioscience Décolonisation spécifique des bactéries résistantes aux antibiotiques à des fins prophylactiques
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
WO2022003209A1 (fr) 2020-07-03 2022-01-06 Eligo Bioscience Procédé de confinement de vecteurs d'acide nucléique introduits dans une population de microbiome
US11224621B2 (en) 2020-04-08 2022-01-18 Eligo Bioscience Modulation of microbiota function by gene therapy of the microbiome to prevent, treat or cure microbiome-associated diseases or disorders
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
WO2022096590A1 (fr) 2020-11-04 2022-05-12 Eligo Bioscience Particules dérivées de phages pour l'administration in situ de charge utile d'adn dans une population de c. acnes
WO2022144382A1 (fr) 2020-12-30 2022-07-07 Eligo Bioscience Protéines de liaison au récepteur chimérique résistantes à la dégradation protéolytique
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2022238555A1 (fr) 2021-05-12 2022-11-17 Eligo Bioscience Production de phages lytiques
WO2022261509A1 (fr) 2021-06-11 2022-12-15 The Broad Institute, Inc. Éditeurs de bases cytosine à guanine améliorés
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11584781B2 (en) 2019-12-30 2023-02-21 Eligo Bioscience Chimeric receptor binding proteins resistant to proteolytic degradation
US11617773B2 (en) 2020-04-08 2023-04-04 Eligo Bioscience Elimination of colonic bacterial driving lethal inflammatory cardiomyopathy
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11746352B2 (en) 2019-12-30 2023-09-05 Eligo Bioscience Microbiome modulation of a host by delivery of DNA payloads with minimized spread
WO2023196802A1 (fr) 2022-04-04 2023-10-12 The Broad Institute, Inc. Variantes de cas9 ayant des spécificités pam non canoniques et leurs utilisations
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
WO2023212715A1 (fr) 2022-04-28 2023-11-02 The Broad Institute, Inc. Vecteurs aav codant pour des éditeurs de base et utilisations associées
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
WO2024047151A1 (fr) 2022-08-31 2024-03-07 Snipr Biome Aps Nouveau type de système crispr/cas

Citations (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4186183A (en) 1978-03-29 1980-01-29 The United States Of America As Represented By The Secretary Of The Army Liposome carriers in chemotherapy of leishmaniasis
US4217344A (en) 1976-06-23 1980-08-12 L'oreal Compositions containing aqueous dispersions of lipid spheres
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4261975A (en) 1979-09-19 1981-04-14 Merck & Co., Inc. Viral liposome particle
US4485054A (en) 1982-10-04 1984-11-27 Lipoderm Pharmaceuticals Limited Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV)
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
EP0264166A1 (fr) 1986-04-09 1988-04-20 Genzyme Corporation Animaux transformés génétiquement sécrétant une protéine désirée dans le lait
US4774085A (en) 1985-07-09 1988-09-27 501 Board of Regents, Univ. of Texas Pharmaceutical administration systems containing a mixture of immunomodulators
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
US4880635A (en) 1984-08-08 1989-11-14 The Liposome Company, Inc. Dehydrated liposomes
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4906477A (en) 1987-02-09 1990-03-06 Kabushiki Kaisha Vitamin Kenkyusyo Antineoplastic agent-entrapping liposomes
US4911928A (en) 1987-03-13 1990-03-27 Micro-Pak, Inc. Paucilamellar lipid vesicles
US4917951A (en) 1987-07-28 1990-04-17 Micro-Pak, Inc. Lipid vesicles formed of surfactants and steroids
US4920016A (en) 1986-12-24 1990-04-24 Linear Technology, Inc. Liposomes with enhanced circulation time
US4921757A (en) 1985-04-26 1990-05-01 Massachusetts Institute Of Technology System for delayed and pulsed release of biologically active substances
US4946787A (en) 1985-01-07 1990-08-07 Syntex (U.S.A.) Inc. N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5049386A (en) 1985-01-07 1991-09-17 Syntex (U.S.A.) Inc. N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor
WO1991016024A1 (fr) 1990-04-19 1991-10-31 Vical, Inc. Lipides cationiques servant a l'apport intracellulaire de molecules biologiquement actives
WO1991017424A1 (fr) 1990-05-03 1991-11-14 Vical, Inc. Acheminement intracellulaire de substances biologiquement actives effectue a l'aide de complexes de lipides s'auto-assemblant
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1993024641A2 (fr) 1992-06-02 1993-12-09 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Virus adeno-associe a sequences terminales inversees utilisees comme promoteur
WO2001038547A2 (fr) 1999-11-24 2001-05-31 Mcs Micro Carrier Systems Gmbh Polypeptides comprenant des multimeres de signaux de localisation nucleaire ou de domaines de transduction de proteine et utilisations de ces derniers pour transferer des molecules dans des cellules
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
US7013219B2 (en) 1999-01-12 2006-03-14 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US20070015238A1 (en) 2002-06-05 2007-01-18 Snyder Richard O Production of pseudotyped recombinant AAV virions
WO2010028347A2 (fr) 2008-09-05 2010-03-11 President & Fellows Of Harvard College Evolution dirigée continue de protéines et d'acides nucléiques
US20110059502A1 (en) 2009-09-07 2011-03-10 Chalasani Sreekanth H Multiple domain proteins
WO2011053982A2 (fr) 2009-11-02 2011-05-05 University Of Washington Compositions thérapeutiques à base de nucléases et méthodes
WO2012088381A2 (fr) 2010-12-22 2012-06-28 President And Fellows Of Harvard College Évolution dirigée continue
US20120322861A1 (en) 2007-02-23 2012-12-20 Barry John Byrne Compositions and Methods for Treating Diseases
US8871445B2 (en) 2012-12-12 2014-10-28 The Broad Institute Inc. CRISPR-Cas component systems, methods and compositions for sequence manipulation
WO2015035136A2 (fr) 2013-09-06 2015-03-12 President And Fellows Of Harvard College Système d'administration pour des nucléases fonctionnelles
US20150166980A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Fusions of cas9 domains and nucleic acid-editing domains
WO2015134121A2 (fr) 2014-01-20 2015-09-11 President And Fellows Of Harvard College Sélection négative et modulation de la stringence dans des systèmes à évolution continue
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US9405700B2 (en) 2010-11-04 2016-08-02 Sonics, Inc. Methods and apparatus for virtualization in an integrated circuit
WO2016168631A1 (fr) 2015-04-17 2016-10-20 President And Fellows Of Harvard College Système de mutagénèse à base de vecteurs
WO2016205764A1 (fr) 2015-06-18 2016-12-22 The Broad Institute Inc. Nouvelles enzymes crispr et systèmes associés
US20170044520A1 (en) 2015-07-22 2017-02-16 President And Fellows Of Harvard College Evolution of site-specific recombinases
WO2017070633A2 (fr) 2015-10-23 2017-04-27 President And Fellows Of Harvard College Protéines cas9 évoluées pour l'édition génétique
US20170233708A1 (en) 2014-10-22 2017-08-17 President And Fellows Of Harvard College Evolution of proteases
WO2017208247A1 (fr) * 2016-06-02 2017-12-07 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Essai pour l'élimination de résidus de méthyle-cytosine de l'adn
WO2018027078A1 (fr) 2016-08-03 2018-02-08 President And Fellows Of Harard College Éditeurs de nucléobases d'adénosine et utilisations associées
WO2018071868A1 (fr) 2016-10-14 2018-04-19 President And Fellows Of Harvard College Administration d'aav d'éditeurs de nucléobases
WO2018152197A1 (fr) * 2017-02-15 2018-08-23 Massachusetts Institute Of Technology Éléments d'écriture d'adn, enregistreurs moléculaires et leurs utilisations
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
WO2018176009A1 (fr) 2017-03-23 2018-09-27 President And Fellows Of Harvard College Éditeurs de nucléobase comprenant des protéines de liaison à l'adn programmable par acides nucléiques
WO2019023680A1 (fr) 2017-07-28 2019-01-31 President And Fellows Of Harvard College Procédés et compositions pour l'évolution d'éditeurs de bases à l'aide d'une évolution continue assistée par phage (pace)
WO2019079347A1 (fr) 2017-10-16 2019-04-25 The Broad Institute, Inc. Utilisations d'éditeurs de bases adénosine
WO2019226593A1 (fr) 2018-05-24 2019-11-28 Aqua-Aerobic Systems, Inc. Système et procédé de traitement de matières solides dans un système de filtration
WO2019241649A1 (fr) 2018-06-14 2019-12-19 President And Fellows Of Harvard College Évolution de cytidine désaminases

Patent Citations (81)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4217344A (en) 1976-06-23 1980-08-12 L'oreal Compositions containing aqueous dispersions of lipid spheres
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4186183A (en) 1978-03-29 1980-01-29 The United States Of America As Represented By The Secretary Of The Army Liposome carriers in chemotherapy of leishmaniasis
US4261975A (en) 1979-09-19 1981-04-14 Merck & Co., Inc. Viral liposome particle
US4485054A (en) 1982-10-04 1984-11-27 Lipoderm Pharmaceuticals Limited Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV)
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4880635B1 (en) 1984-08-08 1996-07-02 Liposome Company Dehydrated liposomes
US4880635A (en) 1984-08-08 1989-11-14 The Liposome Company, Inc. Dehydrated liposomes
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5049386A (en) 1985-01-07 1991-09-17 Syntex (U.S.A.) Inc. N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4946787A (en) 1985-01-07 1990-08-07 Syntex (U.S.A.) Inc. N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4921757A (en) 1985-04-26 1990-05-01 Massachusetts Institute Of Technology System for delayed and pulsed release of biologically active substances
US4774085A (en) 1985-07-09 1988-09-27 501 Board of Regents, Univ. of Texas Pharmaceutical administration systems containing a mixture of immunomodulators
EP0264166A1 (fr) 1986-04-09 1988-04-20 Genzyme Corporation Animaux transformés génétiquement sécrétant une protéine désirée dans le lait
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4920016A (en) 1986-12-24 1990-04-24 Linear Technology, Inc. Liposomes with enhanced circulation time
US4906477A (en) 1987-02-09 1990-03-06 Kabushiki Kaisha Vitamin Kenkyusyo Antineoplastic agent-entrapping liposomes
US4911928A (en) 1987-03-13 1990-03-27 Micro-Pak, Inc. Paucilamellar lipid vesicles
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
US4917951A (en) 1987-07-28 1990-04-17 Micro-Pak, Inc. Lipid vesicles formed of surfactants and steroids
WO1991016024A1 (fr) 1990-04-19 1991-10-31 Vical, Inc. Lipides cationiques servant a l'apport intracellulaire de molecules biologiquement actives
WO1991017424A1 (fr) 1990-05-03 1991-11-14 Vical, Inc. Acheminement intracellulaire de substances biologiquement actives effectue a l'aide de complexes de lipides s'auto-assemblant
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1993024641A2 (fr) 1992-06-02 1993-12-09 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Virus adeno-associe a sequences terminales inversees utilisees comme promoteur
US6607882B1 (en) 1999-01-12 2003-08-19 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US20030087817A1 (en) 1999-01-12 2003-05-08 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US7013219B2 (en) 1999-01-12 2006-03-14 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US7163824B2 (en) 1999-01-12 2007-01-16 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6824978B1 (en) 1999-01-12 2004-11-30 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6933113B2 (en) 1999-01-12 2005-08-23 Sangamo Biosciences, Inc. Modulation of endogenous gene expression in cells
US6979539B2 (en) 1999-01-12 2005-12-27 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
WO2001038547A2 (fr) 1999-11-24 2001-05-31 Mcs Micro Carrier Systems Gmbh Polypeptides comprenant des multimeres de signaux de localisation nucleaire ou de domaines de transduction de proteine et utilisations de ces derniers pour transferer des molecules dans des cellules
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
US20070015238A1 (en) 2002-06-05 2007-01-18 Snyder Richard O Production of pseudotyped recombinant AAV virions
US20120322861A1 (en) 2007-02-23 2012-12-20 Barry John Byrne Compositions and Methods for Treating Diseases
WO2010028347A2 (fr) 2008-09-05 2010-03-11 President & Fellows Of Harvard College Evolution dirigée continue de protéines et d'acides nucléiques
US9771574B2 (en) 2008-09-05 2017-09-26 President And Fellows Of Harvard College Apparatus for continuous directed evolution of proteins and nucleic acids
US9023594B2 (en) 2008-09-05 2015-05-05 President And Fellows Of Harvard College Continuous directed evolution of proteins and nucleic acids
US20110059502A1 (en) 2009-09-07 2011-03-10 Chalasani Sreekanth H Multiple domain proteins
WO2011053982A2 (fr) 2009-11-02 2011-05-05 University Of Washington Compositions thérapeutiques à base de nucléases et méthodes
US9405700B2 (en) 2010-11-04 2016-08-02 Sonics, Inc. Methods and apparatus for virtualization in an integrated circuit
US9394537B2 (en) 2010-12-22 2016-07-19 President And Fellows Of Harvard College Continuous directed evolution
WO2012088381A2 (fr) 2010-12-22 2012-06-28 President And Fellows Of Harvard College Évolution dirigée continue
US20130345064A1 (en) 2010-12-22 2013-12-26 President And Fellows Of Harvard College Continuous directed evolution
US8871445B2 (en) 2012-12-12 2014-10-28 The Broad Institute Inc. CRISPR-Cas component systems, methods and compositions for sequence manipulation
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
WO2015035136A2 (fr) 2013-09-06 2015-03-12 President And Fellows Of Harvard College Système d'administration pour des nucléases fonctionnelles
US20150166980A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Fusions of cas9 domains and nucleic acid-editing domains
US20150166981A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Methods for nucleic acid editing
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
WO2015134121A2 (fr) 2014-01-20 2015-09-11 President And Fellows Of Harvard College Sélection négative et modulation de la stringence dans des systèmes à évolution continue
US10179911B2 (en) 2014-01-20 2019-01-15 President And Fellows Of Harvard College Negative selection and stringency modulation in continuous evolution systems
US20160348096A1 (en) 2014-01-20 2016-12-01 President And Fellows Of Harvard College Negative selection and stringency modulation in continuous evolution systems
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US20170233708A1 (en) 2014-10-22 2017-08-17 President And Fellows Of Harvard College Evolution of proteases
WO2016168631A1 (fr) 2015-04-17 2016-10-20 President And Fellows Of Harvard College Système de mutagénèse à base de vecteurs
US20180087046A1 (en) 2015-04-17 2018-03-29 President And Fellows Of Harvard College Vector-based mutagenesis system
WO2016205764A1 (fr) 2015-06-18 2016-12-22 The Broad Institute Inc. Nouvelles enzymes crispr et systèmes associés
US20170044520A1 (en) 2015-07-22 2017-02-16 President And Fellows Of Harvard College Evolution of site-specific recombinases
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US20170121693A1 (en) 2015-10-23 2017-05-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
WO2017070632A2 (fr) 2015-10-23 2017-04-27 President And Fellows Of Harvard College Éditeurs de nucléobases et leurs utilisations
WO2017070633A2 (fr) 2015-10-23 2017-04-27 President And Fellows Of Harvard College Protéines cas9 évoluées pour l'édition génétique
WO2017208247A1 (fr) * 2016-06-02 2017-12-07 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Essai pour l'élimination de résidus de méthyle-cytosine de l'adn
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
WO2018027078A1 (fr) 2016-08-03 2018-02-08 President And Fellows Of Harard College Éditeurs de nucléobases d'adénosine et utilisations associées
US20180073012A1 (en) 2016-08-03 2018-03-15 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
WO2018071868A1 (fr) 2016-10-14 2018-04-19 President And Fellows Of Harvard College Administration d'aav d'éditeurs de nucléobases
US20180127780A1 (en) 2016-10-14 2018-05-10 President And Fellows Of Harvard College Aav delivery of nucleobase editors
WO2018152197A1 (fr) * 2017-02-15 2018-08-23 Massachusetts Institute Of Technology Éléments d'écriture d'adn, enregistreurs moléculaires et leurs utilisations
WO2018176009A1 (fr) 2017-03-23 2018-09-27 President And Fellows Of Harvard College Éditeurs de nucléobase comprenant des protéines de liaison à l'adn programmable par acides nucléiques
WO2019023680A1 (fr) 2017-07-28 2019-01-31 President And Fellows Of Harvard College Procédés et compositions pour l'évolution d'éditeurs de bases à l'aide d'une évolution continue assistée par phage (pace)
WO2019079347A1 (fr) 2017-10-16 2019-04-25 The Broad Institute, Inc. Utilisations d'éditeurs de bases adénosine
WO2019226593A1 (fr) 2018-05-24 2019-11-28 Aqua-Aerobic Systems, Inc. Système et procédé de traitement de matières solides dans un système de filtration
WO2019241649A1 (fr) 2018-06-14 2019-12-19 President And Fellows Of Harvard College Évolution de cytidine désaminases

Non-Patent Citations (129)

* Cited by examiner, † Cited by third party
Title
A. R. GRUBER ET AL., CELL, vol. 106, no. 1, 2008, pages 23 - 24
ABUDAYYEH ET AL.: "C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector", SCIENCE, vol. 353, no. 6299, 5 August 2016 (2016-08-05), XP055407082, DOI: 10.1126/science.aaf5573
AHMAD ET AL., CANCER RES., vol. 52, 1992, pages 4817 - 4820
AMRANN ET AL., GENE, vol. 69, 1988, pages 301 - 315
ANDERSON, SCIENCE, vol. 256, 1992, pages 808 - 813
AURICCHIO ET AL., HUM. MOLEC. GENET., vol. 10, 2001, pages 3075 - 3081
AUTIERIAGRAWAL, J. BIOL. CHEM., vol. 273, 1998, pages 14731 - 37
BADRAN, A.H.LIU, D.R.: "In vivo continuous directed evolution", CURR. OPIN. CHEM. BIOL., vol. 24, 2015, pages 1 - 10, XP055350566, DOI: 10.1016/j.cbpa.2014.09.040
BANEIJEE, A.SANTOS, W. L.VERDINE, G. L.: "Structure of a DNA glycosylase searching for lesions", SCIENCE, vol. 311, 2006, pages 1153 - 1157
BLAESE ET AL., CANCER GENE THER., vol. 2, 1995, pages 291 - 297
BRINER AE ET AL.: "Guide RNA functional modules direct Cas9 activity and orthogonality", MOL CELL, vol. 56, 2014, pages 333 - 339, XP055376599, DOI: 10.1016/j.molcel.2014.09.019
BRUTLAG ET AL., COMP. APP. BIOSCI., vol. 6, 1990, pages 237 - 245
BUCHSCHER ET AL., J. VIROL., vol. 66, 1992, pages 1635 - 1640
BURSTEIN ET AL.: "New CRISPR-Cas systems from uncultivated microbes", CELL RES., 21 February 2017 (2017-02-21)
BYRNERUDDLE, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 5473 - 5477
CALAMEEATON, ADV. IMMUNOL., vol. 43, 1988, pages 235 - 275
CAMPESTILGHMAN, GENES DEV., vol. 3, 1989, pages 537 - 546
CAVUZIC, V.LIU, Y.: "Biosynthesis of Sulfur-Containing tRNA Modifications: A Comparison of Bacterial, Archaeal, and Eukaryotic Pathways", BIOMOLECULES, vol. 7, 2017, pages 27
CHANG, W.-C. ET AL.: "Mechanistic Investigation of a Non-Heme Iron Enzyme Catalyzed Epoxidation in (-)-4'-Methoxycyclopenin Biosynthesis", J. AM. CHEM. SOC., vol. 138, no. 33, 2016, pages 10390 - 10393
CHO SW ET AL.: "Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease", NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 230 - 232
CHUAI, G. ET AL.: "DeepCRISPR: optimized CRISPR guide RNA design by deep learning", GENOME BIOL., vol. 19, no. 80, 2018
CHYLINSKI, RHUNCHARPENTIER: "The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems", RNA BIOLOGY, vol. 10, no. 5, 2013, pages 726 - 737, XP055116068, DOI: 10.4161/rna.24321
COFFIN ET AL.: "Retroviruses", 1997, CSHL PRESS
CONG L ET AL.: "Multiplex genome engineering using CRIPSR/Cas systems", SCIENCE, vol. 339, 2013, pages 819 - 823
CONG, L. ET AL.: "Multiplex genome engineering using CRISPR/Cas systems", SCIENCE, vol. 339, 2013, pages 819 - 823, XP055458249, DOI: 10.1126/science.1231143
COON, M. J.: "Cytochrome P450: nature's most versatile biological catalyst", ANNU. REV. PHARMACOL. TAXICOL., vol. 45, 2005, pages 1 - 25, XP002545171, DOI: 10.1146/ANNUREV.PHARMTOX.45.120403.100030
CRYSTAL, SCIENCE, vol. 270, 1995, pages 404 - 410
DELTCHEVA E.CHYLINSKI K.SHARMA C.M.GONZALES K.CHAO Y.PIRZADA Z.A.ECKERT M.R.VOGEL J.CHARPENTIER E.: "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III", NATURE, vol. 471, 2011, pages 602 - 607, XP055619637, DOI: 10.1038/nature09886
DICARLO, J.E. ET AL.: "Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems", NUCLEIC ACID RES., 2013
DICKINSON, B.C.PACKER, M.S.BADRAN, A.H.LIU, D.R.: "A system for the continuous directed evolution of proteases rapidly reveals drug-resistance mutations", NAT. COMMUN., vol. 5, 2014, pages 5352
DUAN ET AL., J. VIROL., vol. 75, 2001, pages 7662 - 7671
EAST-SELETSKY ET AL.: "Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection", NATURE, vol. 538, no. 7624, 13 October 2016 (2016-10-13), pages 270 - 273, XP055407060, DOI: 10.1038/nature19802
EDLUND ET AL., SCIENCE, vol. 230, 1985, pages 912 - 916
ELIZABETH KUTTERALEXANDER SULAKVELIDZE: "Bacteriophages: Biology and Applications", December 2004, CRC PRESS
ESWARAMOORTHY, S. ET AL.: "Mechanism of action of a flavin-containing monooxygenase", PROC. NATL. ACAD. SCI., vol. 103, no. 26, 2006, pages 9832 - 9837
FALNES, P. 0.ROGNES, T.: "DNA repair by bacterial AlkB proteins", RES. MICROBIOL., vol. 154, no. 8, 2003, pages 531 - 538
FERRETTIMCSHAN W.M.AJDIC D.J.SAVIC D.J.SAVIC G.LYON K.PRIMEAUX C.SEZATE S.SUVOROV A.N.KENTON S.: "Complete genome sequence of an M 1 strain of Streptococcus pyogenes", PROC. NATL. ACAD. SCI. U.S.A., vol. 98, 2001, pages 4658 - 4663
FORTINI, P. ET AL.: "8-Oxoguanine DNA damage: at the crossroad of alternative repair pathways", MUTAT. RES., vol. 531, no. 1-2, 2003, pages 127 - 39, XP001182325, DOI: 10.1016/j.mrfmmm.2003.07.004
GAO ET AL., GENE THERAPY, vol. 2, 1995, pages 710 - 722
GAO ET AL., NAT BIOTECHNOL., vol. 34, no. 7, 2016, pages 768 - 73
GAO ET AL., NAT BIOTECHNOL., vol. 34, no. 7, July 2016 (2016-07-01), pages 768 - 73
GAO ET AL.: "DNA-guided genome editing using the Natronobacterium gregoryi Argonaute", NATURE BIOTECHNOLOGY, vol. 34, no. 7, 2016, pages 768 - 73, XP055518128, DOI: 10.1038/nbt.3547
GAUDELLI, N. M. ET AL.: "Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage", NATURE, vol. 551, 2017, pages 464 - 471
GAUDELLI, N.M. ET AL.: "Programmable base editing of A:T to G:C in genomic DNA without DNA cleavage", NATURE, vol. 551, 2017, pages 464 - 471
HALBERT ET AL., J. VIROL., vol. 74, 2000, pages 1524 - 1532
HERMONATMUZYCZKA, PNAS, vol. 81, 1984, pages 6466 - 6470
HUANG, T.P. ET AL.: "Circularly permuted and PAM-modified Cas9 variants broaden the targeting scope of base editors", NAT. BIOTECHNOL., vol. 37, 2019, pages 626 - 631, XP036900674, DOI: 10.1038/s41587-019-0134-y
HUBBARD, B.P. ET AL.: "Continuous directed evolution of DNA-binding proteins to improve TALEN specificity", NAT. METHODS, vol. 12, 2015, pages 939 - 942, XP055548970, DOI: 10.1038/nmeth.3515
HWANG, W.Y. ET AL.: "Efficient genome editing in zebrafish using a CRISPR-Cas system", NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 227 - 229, XP055086625, DOI: 10.1038/nbt.2501
ITO, S. ET AL.: "Human NAT 10 Is an ATP-dependent RNA Acetyltransferase Responsible for N4-Acetylcytidine Formation in 18 S Ribosomal RNA (rRNA", J. BIOL. CHEM., vol. 289, 2014, pages 35724 - 35730
ITO, S. ET AL.: "Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine", SCIENCE, vol. 333, no. 6047, 2011, pages 1300 - 1303, XP055101432, DOI: 10.1126/science.1210597
JAKIMO ET AL.: "A Cas9 with Complete PAM Recognition for Adenine Dinucleotides", BIORXIV, September 2018 (2018-09-01)
JIANG, W. ET AL.: "RNA-guided editing of bacterial genomes using CRISPR-Cas systems", NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 233 - 239, XP055249123, DOI: 10.1038/nbt.2508
JINEK M.CHYLINSKI K.FONFARA I.HAUER M.DOUDNA J.A.CHARPENTIER E.: "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", SCIENCE, vol. 337, 2012, pages 816 - 821, XP055549487, DOI: 10.1126/science.1225829
JINEK, M. ET AL.: "RNA-programmed genome editing in human cells", ELIFE, vol. 2, 2013, pages e00471, XP002699851, DOI: 10.7554/eLife.00471
KAMIYA, H. ET AL.: "8-Hydroxyadenine (7,8-dihydro-8-oxoadenine) induces misincorporation in in vitro DNA synthesis and mutations in NIH 3T3 cells", NUCLEIC ACIDS RES., vol. 23, no. 15, 1995, pages 2893 - 2895
KAUFMAN ET AL., EMBO J., vol. 6, 1987, pages 187 - 195
KAYA ET AL.: "A bacterial Argonaute with noncanonical guide RNA specificity", PROC NATL ACAD SCI U S A., vol. 113, no. 15, 12 April 2016 (2016-04-12), pages 4057 - 62, XP055482683, DOI: 10.1073/pnas.1524385113
KESSELGRUSS, SCIENCE, vol. 249, 1990, pages 374 - 379
KLEINSTIVER, B. P. ET AL.: "Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition", NATURE BIOTECHNOLOGY, vol. 33, 2015, pages 1293 - 1298, XP055309933, DOI: 10.1038/nbt.3404
KLEINSTIVER, B. P. ET AL.: "Engineered CRISPR-Cas9 nucleases with altered PAM specificities", NATURE, vol. 523, 2015, pages 481 - 485, XP055293257, DOI: 10.1038/nature14592
KOMOR, A. C.BADRAN, A. H.LIU, D. R.: "CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes", CELL, vol. 168, 2017, pages 20 - 36, XP002781814, DOI: 10.1016/j.cell.2016.10.044
KOMOR, A.C. ET AL.: "Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity", SCI ADV, vol. 3, 2017, XP055453964, DOI: 10.1126/sciadv.aao4774
KOMOR, A.C. ET AL.: "Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage", NATURE, vol. 533, 2016, pages 420 - 424, XP055551781, DOI: 10.1038/nature17946
KOTIN, HUMAN GENE THERAPY, vol. 5, 1994, pages 793 - 801
KREMERPERRICAUDET, BRITISH MEDICAL BULLETIN, vol. 51, no. 1, 1995, pages 31 - 44
KUIJANHERSKOWITZ, CELL, vol. 30, 1982, pages 933 - 943
LANDRUM, M.J. ET AL.: "ClinVar: public archive of relationships among sequence variation and human phenotype", NUCLEIC ACIDS RES., vol. 42, 2014, pages D980 - 985
LEONARD, G. A. ET AL.: "Conformation of guanine-8-oxoadenine base pairs in the crystal structure of d(CGCGAATT(08A)GCG", BIOCHEM., vol. 31, no. 36, 1992, pages 8415 - 8420
LI JF ET AL.: "Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9", NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 688 - 691, XP055129103, DOI: 10.1038/nbt.2654
LIU ET AL., CELL DISCOVERY, vol. 5, 2019, pages 58
LIU ET AL.: "C2cl-sgRNA Complex Structure Reveals RNA-Guided DNA Cleavage Mechanism", MOL. CELL, vol. 65, no. 2, 19 January 2017 (2017-01-19), pages 310 - 322, XP029890333, DOI: 10.1016/j.molcel.2016.11.040
LIU ET AL.: "CasX enzymes comprises a distinct family of RNA-guided genome editors", NATURE, vol. 566, 2019, pages 218 - 223
LUCKLOWSUMMERS, VIROLOGY, vol. 170, 1989, pages 6.3.1 - 6.3.6,2.10.3
MAGIN ET AL., VIROLOGY, vol. 274, 2000, pages 11 - 16
MAKAROVA ET AL.: "C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector", SCIENCE, vol. 353, no. 6299, 2016, XP055407082, DOI: 10.1126/science.aaf5573
MAKAROVA K. ET AL.: "Prokaryotic homologs of Argonaute proteins are predicted to function as key components of a novel system of defense against mobile genetic elements", BIOL DIRECT., vol. 4, 25 August 2009 (2009-08-25), pages 29, XP021059840, DOI: 10.1186/1745-6150-4-29
MALI PESVELT KMCHURCH GM: "Cas9 as a versatile tool for engineering biology", NATURE METHODS, vol. 10, 2013, pages 957 - 963, XP002718606, DOI: 10.1038/nmeth.2649
MALI, P. ET AL.: "RNA-guided human genome engineering via Cas9", SCIENCE, vol. 339, 2013, pages 823 - 826, XP055469277, DOI: 10.1126/science.1232033
MARTHA R. J. CLOKIEANDREW M. KROPINSKI: "Bacteriophages: Methods and Protocols", vol. 2, December 2008, HUMANA PRESS, article "Isolation, Characterization, and Interactions (Methods in Molecular Biology"
MILLER ET AL., J. VIROL., vol. 65, 1991, pages 2220 - 2224
MILLER, NATURE, vol. 357, 1992, pages 455 - 460
MITANICASKEY, TIBTECH, vol. 11, 1993, pages 167 - 175
MOEDE ET AL., FEBS LETT., vol. 461, 1999, pages 229 - 34
MOL THER., vol. 20, no. 4, April 2012 (2012-04-01), pages 699 - 708
MUZYCZKA, J. CLIN. INVEST., vol. 94, 1994, pages 1351
NAKAMURA, Y. ET AL.: "Codon usage tabulated from the international DNA sequence databases: status for the year 2000", NUCL. ACIDS RES., vol. 28, 2000, pages 292, XP002941557, DOI: 10.1093/nar/28.1.292
NISHIMASU ET AL.: "Crystal structure of Cas9 in complex with guide RNA and target DNA", CELL, vol. 156, no. 5, pages 935 - 949, XP028667665, DOI: 10.1016/j.cell.2014.02.001
NORMAN, D. P.CHUNG, S. J.VERDINE, G. L.: "Structural and biochemical exploration of a critical amino acid in human 8-oxo-guanine glycosylase", BIOCHEMISTRY, vol. 42, 2003, pages 1564 - 1572
OAKES ET AL.: "CRISPR-Cas9 Circular Permutants as Programmable Scaffolds for Genome Modification", CELL, vol. 176, 10 January 2019 (2019-01-10), pages 254 - 267
OAKES ET AL.: "Protein Engineering of Cas9 for enhanced function", METHODS ENZYMOL, vol. 546, 2014, pages 491 - 511, XP008176614, DOI: 10.1016/B978-0-12-801185-0.00024-6
OHE, T.WATANABE, Y.: "Purification and Properties of Xanthine Dehydrogenase from Streptomyces cyanogenus", J. BIOCHEM., vol. 86, 1979, pages 45 - 53
PA CARRGM CHURCH, NATURE BIOTECHNOLOGY, vol. 27, no. 12, 2009, pages 1151 - 62
PINKERT ET AL., GENES DEV., vol. 1, 1987, pages 268 - 277
QI ET AL., CELL, vol. 152, no. 5, 2013, pages 1173 - 83
QUEENBALTIMORE, CELL, vol. 33, 1983, pages 741 - 748
RASHIDI, M. R.SOLTANI, S.: "An overview of aldehyde oxidase: an enzyme of emerging importance in novel drug discovery", EXPERT OPIN. DRUG DISCOV., vol. 12, no. 3, 2017, pages 305 - 316
REES, H.A. ET AL.: "Improving the DNA specificity and applicability of base editing through protein engineering and protein delivery", NAT. COMMUN., vol. 8, 2017, pages 15790, XP055597104, DOI: 10.1038/ncomms15790
REESLIU: "Base editing: precision chemistry on the genome and transcriptome of living cells", NAT REV GENET., vol. 19, no. 12, 2018, pages 770 - 788, XP036637441, DOI: 10.1038/s41576-018-0068-0
REMY ET AL., BIOCONJUGATE CHEM., vol. 5, 1994, pages 647 - 654
SALADINO, R. ET AL.: "A new and efficient synthesis of 8-hydroxypurine derivatives by dimethyldioxirane oxidation", TET. LETT., vol. 36, 1995, pages 2665 - 2668, XP004028277, DOI: 10.1016/0040-4039(95)00328-A
SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 03822 - 3828
SCHULTZ ET AL., GENE, vol. 54, 1987, pages 113 - 123
SEED, NATURE, vol. 329, 1987, pages 840
SHMAKOV ET AL.: "Discovery and Functional Characterization of Diverse Class 2 CRISPR Cas Systems", MOL. CELL, vol. 60, no. 3, 5 November 2015 (2015-11-05), pages 385 - 397, XP055482679, DOI: 10.1016/j.molcel.2015.10.008
SMITH ET AL., MOL. CELL. BIOL., vol. 3, 1983, pages 2156 - 2165
SOMMNERFELT ET AL., VIROL., vol. 176, 1990, pages 58 - 59
SUZUKI T. ET AL.: "Crystal structures reveal an elusive functional domain of pyrrolysyl-tRNA synthetase", NAT CHEM BIOL., vol. 13, no. 12, 2017, pages 1261 - 1266
SWARTS ET AL., NATURE, vol. 507, no. 7491, 2014, pages 258 - 61
SWARTS ET AL., NUCLEIC ACIDS RES., vol. 43, no. 10, 2015, pages 5120 - 9
TAN, X.GROLLMAN, A. P.SHIBUTANI, S.: "Comparison of the mutagenic properties of 8-oxo-7,8-dihydro-2'-deoxyadenosine and 8-oxo-7,8-dihydro-2'-deoxyguanosine DNA lesions in mammalian cells", CARCINOGENESIS, vol. 20, no. 12, 1999, pages 2287 - 2292
THURONYI, B.W. ET AL.: "Continuous evolution of base editors with expanded target compatibility and improved activity", NAT. BIOTECHNOL., 2019, pages 1070 - 1079, XP036878165, DOI: 10.1038/s41587-019-0193-0
TINLAND ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 89, 1992, pages 7442 - 46
TRATSCHIN ET AL., MOL. CELL. BIOL., vol. 4, 1984, pages 2072 - 2081
TRATSCHIN ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 3251 - 3260
TSAI, S. Q. ET AL.: "GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases", NATURE BIOTECHNOLOGY, vol. 33, 2015, pages 187 - 197, XP055555627, DOI: 10.1038/nbt.3117
VAN BRUNT, BIOTECHNOLOGY, vol. 6, no. 10, 1988, pages 1149 - 1154
VIDALLEGRAIN: "Yeast n-hybrid review", NUCLEIC ACID RES., vol. 27, 1999, pages 919
VIGNE, RESTORATIVE NEUROLOGY AND NEUROSCIENCE, vol. 8, 1995, pages 35 - 36
WANG, T.BADRAN, A.H.HUANG, T.P.LIU, D.R.: "Continuous directed evolution of proteins with improved soluble expression", NAT. CHEM. BIOL., vol. 14, 2018, pages 972 - 980, XP036592855, DOI: 10.1038/s41589-018-0121-5
WEST ET AL., VIROLOGY, vol. 160, 1987, pages 38 - 47
WINOTOBALTIMORE, EMBO J., vol. 8, 1989, pages 729 - 733
YAMANO ET AL.: "Crystal structure of Cpfl in complex with guide RNA and target DNA", CELL, vol. 165, 2016, pages 949 - 962
YANG ET AL.: "PAM-dependent Target DNA Recognition and Cleavage by C2C1 CRISPR-Cas endonuclease", CELL, vol. 167, no. 7, 15 December 2016 (2016-12-15), pages 1814 - 1828, XP029850724, DOI: 10.1016/j.cell.2016.11.053
YU ET AL., GENE THERAPY, vol. 1, 1994, pages 13 - 26
ZETSCHE ET AL., CELL, vol. 163, 2015, pages 759 - 771
ZHANG Y. P. ET AL., GENE THER., vol. 6, 1999, pages 1438 - 47
ZOLOTUKHIN ET AL.: "Production and purification of serotype 1,2, and 5 recombinant adeno-associated viral vectors", METHODS, vol. 28, 2002, pages 158 - 167, XP002256404, DOI: 10.1016/S1046-2023(02)00220-7
ZUKERSTIEGLER, NUCLEIC ACIDS RES., vol. 9, 1981, pages 133 - 148

Cited By (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2021108717A2 (fr) 2019-11-26 2021-06-03 The Broad Institute, Inc Systèmes et procédés pour l'évaluation d'édition hors cible indépendante de cas9 d'acides nucléiques
US11746352B2 (en) 2019-12-30 2023-09-05 Eligo Bioscience Microbiome modulation of a host by delivery of DNA payloads with minimized spread
US11584781B2 (en) 2019-12-30 2023-02-21 Eligo Bioscience Chimeric receptor binding proteins resistant to proteolytic degradation
WO2021158921A2 (fr) 2020-02-05 2021-08-12 The Broad Institute, Inc. Éditeurs de base d'adénine et leurs utilisations
US11376286B2 (en) 2020-04-08 2022-07-05 Eligo Bioscience Modulation of microbiota function by gene therapy of the microbiome to prevent, treat or cure microbiome-associated diseases or disorders
US11534467B2 (en) 2020-04-08 2022-12-27 Eligo Bioscience Modulation of microbiota function by gene therapy of the microbiome to prevent, treat or cure microbiome-associated diseases or disorders
US11617773B2 (en) 2020-04-08 2023-04-04 Eligo Bioscience Elimination of colonic bacterial driving lethal inflammatory cardiomyopathy
US11224621B2 (en) 2020-04-08 2022-01-18 Eligo Bioscience Modulation of microbiota function by gene therapy of the microbiome to prevent, treat or cure microbiome-associated diseases or disorders
US11690880B2 (en) 2020-04-08 2023-07-04 Eligo Bioscience Modulation of microbiota function by gene therapy of the microbiome to prevent, treat or cure microbiome-associated diseases or disorders
WO2021222318A1 (fr) 2020-04-28 2021-11-04 The Broad Institute, Inc. Édition de base ciblée du gène ush2a
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
WO2021250284A1 (fr) 2020-06-12 2021-12-16 Eligo Bioscience Décolonisation spécifique de bactéries résistantes aux antibiotiques à des fins prophylactiques
EP3922719A1 (fr) 2020-06-12 2021-12-15 Eligo Bioscience Décolonisation spécifique des bactéries résistantes aux antibiotiques à des fins prophylactiques
WO2022003209A1 (fr) 2020-07-03 2022-01-06 Eligo Bioscience Procédé de confinement de vecteurs d'acide nucléique introduits dans une population de microbiome
WO2022096596A1 (fr) 2020-11-04 2022-05-12 Eligo Bioscience Phages recombinants de cutibacterium acnes, leur procédé de production et leurs utilisations
US11820989B2 (en) 2020-11-04 2023-11-21 Eligo Bioscience Phage-derived particles for in situ delivery of DNA payload into C. acnes population
US11473093B2 (en) 2020-11-04 2022-10-18 Eligo Bioscience Cutibacterium acnes recombinant phages, method of production and uses thereof
US11840695B2 (en) 2020-11-04 2023-12-12 Eligo Bioscience Recombinant C. acnes phages comprising transgenes
WO2022096590A1 (fr) 2020-11-04 2022-05-12 Eligo Bioscience Particules dérivées de phages pour l'administration in situ de charge utile d'adn dans une population de c. acnes
WO2022144382A1 (fr) 2020-12-30 2022-07-07 Eligo Bioscience Protéines de liaison au récepteur chimérique résistantes à la dégradation protéolytique
WO2022144381A1 (fr) 2020-12-30 2022-07-07 Eligo Bioscience Modulation du microbiome d'un hôte par administration de charges utiles d'adn à étalement réduit à un minimum
US11739304B2 (en) 2021-05-12 2023-08-29 Eligo Bioscience Production of lytic phages
WO2022238552A1 (fr) 2021-05-12 2022-11-17 Eligo Bioscience Cellules bactériennes de production et leur utilisation dans des procédés de production
WO2022238555A1 (fr) 2021-05-12 2022-11-17 Eligo Bioscience Production de phages lytiques
US11697802B2 (en) 2021-05-12 2023-07-11 Eligo Bioscience Production bacterial cells and use thereof in production methods
US11939598B2 (en) 2021-05-12 2024-03-26 Eligo Bioscience Production bacterial cells and use thereof in production methods
US11952595B2 (en) 2021-05-12 2024-04-09 Eligo Bioscience Production of lytic phages
WO2022261509A1 (fr) 2021-06-11 2022-12-15 The Broad Institute, Inc. Éditeurs de bases cytosine à guanine améliorés
WO2023196802A1 (fr) 2022-04-04 2023-10-12 The Broad Institute, Inc. Variantes de cas9 ayant des spécificités pam non canoniques et leurs utilisations
WO2023212715A1 (fr) 2022-04-28 2023-11-02 The Broad Institute, Inc. Vecteurs aav codant pour des éditeurs de base et utilisations associées
WO2024047151A1 (fr) 2022-08-31 2024-03-07 Snipr Biome Aps Nouveau type de système crispr/cas

Similar Documents

Publication Publication Date Title
WO2020181180A1 (fr) Éditeurs de base a:t en c:g et leurs utilisations
US20220170013A1 (en) T:a to a:t base editing through adenosine methylation
US20230272425A1 (en) Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace)
US20230086199A1 (en) Systems and methods for evaluating cas9-independent off-target editing of nucleic acids
US20220307003A1 (en) Adenine base editors with reduced off-target effects
WO2021030666A1 (fr) Édition de bases par transglycosylation
US20230235309A1 (en) Adenine base editors and uses thereof
WO2020181202A1 (fr) Édition de base a:t en t:a par déamination et oxydation d'adénine
WO2020181178A1 (fr) Édition de base t:a à a:t par alkylation de thymine
US20220282275A1 (en) G-to-t base editors and uses thereof
WO2020181195A1 (fr) Édition de base t : a à a : t par excision d'adénine
US20220380740A1 (en) Constructs for improved hdr-dependent genomic editing
US11912985B2 (en) Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US20230357766A1 (en) Prime editing guide rnas, compositions thereof, and methods of using the same
US11702651B2 (en) Adenosine nucleobase editors and uses thereof
US20220204975A1 (en) System for genome editing
US20210198330A1 (en) Base editors and uses thereof
WO2021072328A1 (fr) Procédés et compositions pour le prime editing d'arn
US20230123669A1 (en) Base editor predictive algorithm and method of use
EP4100032A1 (fr) Procédés d'édition génomique pour le traitement de l'amyotrophie musculaire spinale
WO2022261509A1 (fr) Éditeurs de bases cytosine à guanine améliorés
WO2023288304A2 (fr) Éditeurs de base adénine spécifiques au contexte et leurs utilisations
WO2023240137A1 (fr) Variants de cas14a1 évolués, compositions et méthodes de fabrication et d'utilisation de ceux-ci dans l'édition génomique

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20717012

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20717012

Country of ref document: EP

Kind code of ref document: A1