WO2020177397A1 - Respiratory syncytial virus universal rapid detection primer set and kit - Google Patents

Abstract

The invention provides a respiratory syncytial virus (RSV) universal rapid detection primer set and a kit. The respiratory syncytial virus universal rapid detection primer set comprises upstream and downstream primers and probes capable of simultaneously detecting an F gene sequence of respiratory syncytial virus type A and type B. The primer set comprises 1 upstream primer, 2 downstream primers, and 1 probe.

Description

Respiratory syncytial virus universal rapid detection primer set and kit Technical field

The invention relates to the field of biotechnology, in particular to a universal rapid detection primer set and kit for respiratory syncytial virus.

Background technique

Respiratory syncytial virus (RSV) is a single-stranded, negative-stranded, enveloped RNA virus, and a member of the genus Paramyxoviridae. It is named for its cell fusion lesions in tissue culture. It is divided into two subtypes, A and B, and is generally susceptible to the population. It mainly spreads through droplets. It has obvious seasonal epidemic characteristics. The two subtypes can alternately become epidemic dominant strains. The pathogenesis of RSV is complicated, mainly manifested by bronchiolitis and pneumonia. The main symptoms are cough, shortness of breath, fever, fatigue, headache, muscle aches and so on. RSV is the most important viral pathogen causing acute lower respiratory tract infections in infants and young children worldwide, and its pathogenicity is second only to Streptococcus pneumoniae and Haemophilus influenzae. RSV also has a higher morbidity rate in the elderly and high-risk populations with low immune function, and can cause serious complications leading to prolonged hospitalization and high mortality. At present, there is a lack of specific etiological treatment for RSV infection, and support and symptomatic treatment are the main ones. The curative effects of bronchodilators, hormones and antiviral drugs are not satisfactory. In addition, the protective immunity generated after RSV infection cannot protect the body for a long time, and repeated infections are very common. Therefore, RSV infection usually continues to have a serious impact on a global scale in the form of high hospitalization rate, high hospitalization cost, and long hospital stay.

At present, the detection of RSV mainly includes virus culture method, molecular biology method and serological detection method. Among them, molecular biology methods are more and more widely used in clinical diagnosis because of their high sensitivity and high specificity. These methods include fluorescence quantitative PCR, loop-mediated isothermal amplification (LAMP), etc. However, there are still difficulties in designing RSV primers using these methods. Because RSV is divided into two genotypes A and B, F gene is a specific gene of RSV, but in the two genotypes A and B, the homology rate of F gene is 91%, and 8% of the mutations are evenly dispersed in F In the gene sequence, this creates certain difficulties for universal primer design.

Summary of the invention

In view of the above problems, the present invention provides a universal rapid detection primer set and kit for respiratory syncytial virus. The present invention includes one upstream primer and two downstream primers, which are used in the amplification system together, and there is no competition between the primers. , Can effectively detect syncytial virus type A and B, high sensitivity, strong specificity, simple operation, short time-consuming, low production cost, not easy to be polluted, and can quickly and accurately detect respiratory syncytial virus type A and B Virus strain.

In order to achieve the above objective, the technical solution of the present invention is: Respiratory Syncytial Virus Rapid Detection Primer Set, which includes the upstream and downstream primers and probes for detecting the conservative sequence of F gene, that is, it can simultaneously detect Respiratory Syncytial Virus Type A and Type B The primers and probes of F gene sequence; the primers include 1 upstream primer and 2 downstream primers; the upstream primer is: 5'-AGTGAGTTATTATCATTAATCAATG-3'; the downstream primer is 2 primers, the downstream primer 1 is: 5'-TTTCCAACAAGGAGTATCTATTACA-3', the downstream primer 2 is: 5'-ATTATAGACATGATAGAATAACTTTG-3'; the probe is

5’-ATCATTAATCAATGATATGCC/i6-FAMdT//idSp//iBHQ1dT/AA CAAATGAT-3’C3 Spacer. Among them: "i6-FAMdT" refers to 6-FAM (6-carboxyfluorescein) fluorescently labeled dT nucleotides, "idSp" refers to base deletions, and "iBHQ1dT" refers to dT nucleosides labeled with a BHQ1 quenching group Acid, "C3 Spacer" refers to the 3'hydroxyl block.

Further, the upstream primer can be the 5', 3'end of the upstream primer sequence of claim 1 extended or shortened by 10 bp, and the downstream primer can be the 5', 3'end of the downstream primer sequence of claim 1 Extend or shorten by 10bp, the probe can be extended or shortened by 10bp at the 5', 3'end of the probe sequence of claim 1; or, the upstream and downstream primers and probes can be the same as those described in claim 1 respectively. The sequence homology of the upper and downstream primers and probes is greater than 85%; or, the upper and downstream primers and probes may be the bases of the sequence of the upper and downstream primers and probes of claim 1, respectively. Complementary sequence; or, the 6-FAM, deletion, and BHQ1 modification of the probe are at positions 22-24 of the sequence; or, the 6-FAM, deletion, or BHQ1 label of the probe is in the forward or reverse complementarity Position 18-29 of the sequence.

The present invention also provides a universal rapid detection kit for respiratory syncytial virus, which includes the following contents:

(1) Lysis solution;

(2) Reconstituted solution;

(3) EMA reaction tube containing primer probe; said primer contains upstream and downstream primers and probe; said upstream primer is: 5'-AGTGAGTTATTATCATTAATCAATG-3'; said downstream primer is 2 primers, said downstream Primer 1 is: 5'-TTTCCAACAAGGAGTATCTATTACA-3'; the downstream primer 2 is: 5'-ATTATAGACATGATAGAATAACTTTG-3'; the probe is 5'-ATCATTAATCAATGATATGCC/i6-FAMdT//idSp//iBHQ1dT/AACAAATGAT-3 'C3 Spacer;

(3) Positive control substance;

(4) Negative control substance.

Further, the upstream primer can be the 5', 3'end of the upstream primer sequence of claim 1 extended or shortened by 10 bp, and the downstream primer can be the 5', 3'end of the downstream primer sequence of claim 1 Extend or shorten by 10bp, the probe can be extended or shortened by 10bp at the 5', 3'end of the probe sequence of claim 1; or, the upstream and downstream primers and probes can be the same as those described in claim 1 respectively. The sequence homology of the upper and downstream primers and probes is greater than 85%; or, the upper and downstream primers and probes may be the bases of the sequence of the upper and downstream primers and probes of claim 1, respectively. Complementary sequence; or, the 6-FAM, deletion, and BHQ1 modification of the probe are at positions 22-24 of the sequence; or, the 6-FAM, deletion, or BHQ1 label of the probe is in the forward or reverse complementarity Position 18-29 of the sequence.

Preferably, the lysate contains NP-40 (v/v) at a final concentration of 2-5%, chelex-100 at 20-50 mg/mL, 10-20 mM Tris-Ac at pH 8.0 and DEPC treated water .

Preferably, the compound solution contains a final concentration of 20-30 mM MgAc2, 90-100 mM Tris-Ac (pH 8.0), 55-60 mM KAc, 10-15% PEG20000 (W/V) and DEPC treatment water.

Preferably, the composition of the EMA reaction tube containing primer probes is as follows: each reaction tube contains M-MLV reverse transcriptase at a final concentration of 4.5-7.5ng/μl and Rnase inhibitor at a final concentration of 1.5-2ng/μl, 24-27ng/μl single-stranded DNA binding protein, 62-125pg/μl ATP regeneration protein, 6-7.5ng/μl DNA helicase, 2-3ng/μl DNA polymerase, 90-120pg/μl DNA restriction endonuclease, 300-400pg/μl accessory protein, 200-300nM upstream primer, 200-300nM downstream primer 1, 200-300nM downstream primer 2, 30-40nM probe, 20-30mM Creatine sodium phosphate, 2-3mM ATP, 100-150μM dNTP, 50-60mM Tris-Ac (pH8.0), 35-50μg/μl trehalose, 100-120mM KAc, 7.5-10ng/μl Mannitol, 1-5% PEG20000 (W/V).

Preferably, the negative control substance is a DEPC treated water blank control.

Preferably, the positive control substance is a pseudovirus containing the target sequence, and the concentration is 1 μg/mL.

The invention also provides the application of the rapid detection primer set for respiratory syncytial virus in the preparation of a universal rapid detection kit for respiratory syncytial virus.

The present invention also provides a method for detecting respiratory syncytial virus, which uses the universal rapid detection kit for respiratory syncytial virus, and the detection method does not aim at the diagnosis and treatment of diseases. The method includes the following steps:

(1) Using the universal rapid detection kit for respiratory syncytial virus, put the sample swab into 500μl lysate and cut it, vortex and shake for 30 seconds, centrifuge at 5000rpm for 1 minute, take 100μl of supernatant and transfer to the new In a 1.5mL centrifuge tube, heat and lyse in a metal bath at 90°C for 10 minutes, then cool to room temperature, and take the supernatant for detection;

(2) Take 10μl of positive control substance and negative control substance and operate according to step (1);

(3) Using the universal rapid detection kit for respiratory syncytial virus, take 10 μl of the reconstituted solution and 10 μl of the supernatant obtained from sample lysis, add them to the EMA reaction tube containing the primer probe, mix well, and set the positive and Negative control

(4) Put the reconstituted EMA reaction tube into the Click i nucleic acid fluorescence detector, amplify at 37-45°C for 10-30 minutes, scan fluorescence once every 30 seconds, collect fluorescence data, and draw time-fluorescence signal diagram;

(5) Result quality control: the positive control product has a Ct value of <20, the fluorescence curve is a typical "S" type, and the negative control product has no Ct value. All the above conditions are met. This experiment is valid, otherwise it is invalid. You need to investigate the cause and re-check test;

(6) Judgment of results: If the scanning fluorescence curve of the sample is a typical "S" type and the Ct value is less than 30, it is judged as a positive result; otherwise, the scanning fluorescence curve is a horizontal straight line, and there is no Ct value, it is a negative result.

The present invention uses EMA technology, through M-MLV reverse transcriptase and multiple enzymatic reactions of EMA, the target RNA can be reverse transcribed into cDNA and amplified within 10-30 minutes at a relatively low temperature of 37-45°C Millions of times, combined with fluorescence detection technology, can achieve rapid detection of RNA in the sample to be tested.

The primer sequence of the present invention is obtained by comparing and screening the respiratory syncytial virus gene sequence through domestic and foreign literature and Genebank database, finally confirming the F gene as the target gene, and downloading the respiratory syncytial virus F gene sequence (type A sequence number) from Genebank NC_001803.1, B type sequence number KY296697.1), the gene sequence is specific in the two syncytial virus genotypes, but there are mutations. First, design primers and universal probes for the type A gene, and screen out the best pairs of type A primers by amplifying the plasmid containing the sequence of the type A F gene. Since there will always be B-type mutant bases on primers, these mutant bases are changed to B-type bases to form B-type primers. Try to add an upstream or downstream B-type primer when using A-type primers to increase the tolerance of detection. It can detect RSV A and B without affecting the sensitivity.

Thus, the primer pair and probe contained in the present invention are obtained:

Upstream primer: 5’-AGTGAGTTATTATCATTAATCAATG-3’;

Downstream primer 1: 5'-TTTCCAACAAGGAGTATCTATTACA-3';

Downstream primer 2: 5’-ATTATAGACATGATAGAATAACTTTG-3’;

The probe is

5’-ATCATTAATCAATGATATGCC/i6-FAMdT//idSp//iBHQ1dT/AACAAATGAT-3’C3 Spacer.

The EMA (Enzymes Mediated Amplification, multi-enzyme-mediated nucleic acid amplification technology, that is, room temperature nucleic acid amplification technology) system of the present invention (including multiple solutions and EMA reaction tubes containing primer probes) compares primer concentration, probe concentration, Ion concentration, etc. determine the final reaction system.

The beneficial effects of the present invention include:

1. In the present invention, there are 1 upstream primer and 2 downstream primers, and the 2 downstream primers are at different positions of the F gene. This combination can detect the A and B genotypes of respiratory syncytial virus without competition. Therefore, the whole system has strong adaptability, even if there are 3-5 mutations in the target sequence in the sample, it can be amplified normally, thereby increasing the sensitivity of the present invention.

2. In the present invention, the probe sequence is relatively long, FAM and BHQ1 are labeled inside the sequence and two bases apart. This design increases the adaptability of the amplification system and reduces the background fluorescence at the same time. If there are mutations in the target sequence in the sample, the annealing of the fluorescent probe to the target sequence and the generation and release of fluorescent signals can also be ensured, thereby helping to increase the sensitivity and specificity of the present invention.

3. The reagents in the EMA reaction tube in this kit are freeze-dried and can be stored and transported at 2-8°C, which reduces the equipment requirements for storage and cold chain transportation, and at the same time extends the validity period.

4. The kit of the present invention contains a lysis solution, which can quickly extract the nucleic acid of the respiratory syncytial virus in the sample without the need for an additional extraction kit, which reduces costs and improves efficiency.

5. The nucleic acid amplification conditions of the present invention are 37°C to 45°C, which has low temperature requirements and low requirements on machines, while reducing aerosols and reducing the risk of pollution.

6. The nucleic acid amplification time of the present invention is short, and the results can be reported within 30 minutes.

The present invention takes the conservative sequence of the F gene of respiratory syncytial virus as the target gene, screens the best primers and probes, and cooperates with the universal EMA enzyme, which can be used within 30 minutes under low constant temperature conditions of 37°C to 45°C Complete the detection of RSV virus RNA. The system of the present invention contains 1 upstream primer and 2 downstream primers, which are used in the amplification system together. Thanks to the enzymatic action of multiple enzymes of EMA technology, there is no competition between the primers, which can effectively detect RSV type A The two genotypes of type B and type B form a universal detection kit, so that the present invention has the advantages and characteristics of detection ability, not only the detection is simple and easy, the production cost is reduced, but also the accuracy, precision, and specificity are higher. And repeatability.

Description of the drawings

Figure 1 and Figure 2 are the results of screening of RSV type A primers in Example 1

Figures 3 to 8 are the results of screening of RSV type B primers in Example 2

Figure 9 is the detection result of the cross reaction of Example 4

detailed description

The present invention will be further described in detail below in conjunction with specific embodiments. The selected formula is a preferred formula of the kit, but it is not used to limit the scope of the present invention.

The primer set for rapid detection of respiratory syncytial virus provided by the present invention includes upstream and downstream primers and probes that can simultaneously detect respiratory syncytial virus type A and type B F gene sequences; the upstream primer is: 5'-AGTGAGTTATTATCATTAATCAATG-3 '; The downstream primers are 2 downstream primers; the downstream primer 1 is: 5'-TTTCCAACAAGGAGTATCTATTACA-3'; the downstream primer 2 is: 5'-ATTATAGACATGATAGAATAACTTTG-3'; the probe is 5'- ATCATTAATCAATGATATGCC/i6-FAMdT//idSp//iBHQ1dT/AACAAATGAT-3'C3 Spacer.

Further, the upstream primer can be the 5', 3'end of the upstream primer sequence of claim 1 extended or shortened by 10 bp, and the downstream primer can be the 5', 3'end of the downstream primer sequence of claim 1 Extend or shorten by 10bp, the probe can be extended or shortened by 10bp at the 5', 3'end of the probe sequence of claim 1; or, the upstream and downstream primers and probes can be the same as those described in claim 1 respectively. The sequence homology of the upper and downstream primers and probes is greater than 85%; or, the upper and downstream primers and probes may be complementary to the sequence of the upstream and downstream primers and probes of claim 1 respectively. Or, the 6-FAM, deletion, and BHQ1 modification of the probe are in positions 22-24 of the sequence; or, the 6-FAM, deletion, or BHQ1 tag of the probe is in the forward or reverse complementary sequence The 18th-29th.

The present invention also provides a universal rapid detection kit for respiratory syncytial virus, which includes the following contents:

(1) Lysis solution;

(2) Reconstituted solution;

(3) EMA reaction tube containing primer probe; said primer probe includes upstream and downstream primers and probes; said upstream primer is: 5'-AGTGAGTTATTATCATTAATCAATG-3'; said downstream primer 1 is: 5'- TTTCCAACAAGGAGTATCTATTACA-3'; the downstream primer 2 is: 5'-ATTATAGACATGATAGAATAACTTTG-3'; the probe is 5'-ATCATTAATCAATGATATGCC/i6-FAMdT//idSp//iBHQ1dT/AACAAATGAT-3'C3 Spacer;

(4) Positive control substance;

(5) Negative control substance.

Preferably, the lysate contains NP-40 (v/v) at a final concentration of 2-5%, chelex-100 at 20-50 mg/mL, 10-20 mM Tris-Ac at pH 8.0 and DEPC treated water .

Preferably, the compound solution contains a final concentration of 20-30 mM MgAc2, 90-100 mM Tris-Ac (pH 8.0), 55-60 mM KAc, 10-15% PEG20000 (W/V) and DEPC treatment water.

Preferably, the composition of the EMA reaction tube containing primer probes is as follows: each reaction tube contains M-MLV reverse transcriptase at a final concentration of 4.5-7.5ng/μl and Rnase inhibitor at a final concentration of 1.5-2ng/μl, 24-27ng/μl single-stranded DNA binding protein, 62-125pg/μl ATP regeneration protein, 6-7.5ng/μl DNA helicase, 2-3ng/μl DNA polymerase, 90-120pg/μl DNA restriction endonuclease, 300-400pg/μl accessory protein, 200-300nM upstream primer, 200-300nM downstream primer 1, 200-300nM downstream primer 2, 30-40nM probe, 20-30mM Creatine sodium phosphate, 2-3mM ATP, 100-150μM dNTP, 50-60mM Tris-Ac (pH8.0), 35-50μg/μl trehalose, 100-120mM KAc, 7.5-10ng/μl Mannitol, 1-5% PEG20000 (W/V).

Preferably, the negative control substance is a DEPC treated water blank control.

Preferably, the positive control substance is a pseudovirus containing the target sequence, and the concentration is 1 μg/mL.

The upstream primer can be the 5', 3'end extension or shortening of the upstream primer sequence of claim 1 by 10 bp, and the downstream primer can be the 5', 3'end extension or shortening of the downstream primer sequence of claim 1 10bp, the probe can be the 5', 3'end of the probe sequence of claim 1 extended or shortened by 10bp; or, the upstream and downstream primers and probes can be the same as those of claim 1, respectively. The sequence homology of the downstream primers and probes is greater than 85%; or, the upstream and downstream primers and probes may be sequences that are complementary to the sequences of the upstream and downstream primers and probes of claim 1; Alternatively, the 6-FAM, deletion, and BHQ1 modification of the probe is at positions 22-24 of the sequence; or, the 6-FAM, deletion, or BHQ1 label of the probe is at the 18th position of the forward or reverse complementary sequence. -29.

The present invention also provides a method for detecting respiratory syncytial virus, which uses the universal rapid detection kit for respiratory syncytial virus, and the detection method does not aim at the diagnosis and treatment of diseases; The method includes the following steps:

(1) Using the universal rapid detection kit for respiratory syncytial virus, put the sample swab into 500μl lysate and cut it, vortex and shake for 30 seconds, centrifuge at 5000rpm for 1 minute, take 100μl of supernatant and transfer to the new In a 1.5mL centrifuge tube, heat and lyse in a metal bath at 90°C for 10 minutes, then cool to room temperature, and take the supernatant for detection;

(2) Take 10μl of positive control substance and negative control substance and operate according to step (1);

(3) Using the universal rapid detection kit for respiratory syncytial virus, take 10 μl of the reconstituted solution and 10 μl of the supernatant from sample lysis, add them to the EMA reaction tube containing the primer probe, mix well, and set the positive and Negative control

(4) Put the reconstituted EMA reaction tube into the Click i nucleic acid fluorescence detector, amplify at 37-45°C for 10-30 minutes, scan fluorescence once every 30 seconds, collect fluorescence data, and draw time-fluorescence signal diagram;

(5) Result quality control: the positive control product has a Ct value of <20, the fluorescence curve is a typical "S" type, and the negative control product has no Ct value. All the above conditions are met. This experiment is valid, otherwise it is invalid. You need to investigate the cause and re-check test;

(6) Judgment of results: If the scanning fluorescence curve of the sample is a typical "S" type and the Ct value is less than 30, it is judged as a positive result; otherwise, the scanning fluorescence curve is a horizontal straight line, and there is no Ct value, it is a negative result.

Example 1. Screening of RSV type A primers

Download the Respiratory Syncytial Virus F gene sequence (Type A sequence number NC_001803.1, Type B sequence number KY296697.1) from Genebank. The gene sequence is specific in the two syncytial virus genotypes, but there are mutations. First, design primers and universal probes for the type A gene (Table 1), and screen out the best pairs of type A primers by amplifying the plasmid containing the A type F gene sequence (1×10 ⁴ copies/μl). Screening criteria: the positive amplification curve is a typical "S" curve, the Ct value is the smallest, and the negative amplification curve is a horizontal straight line.

Table 1 Sequences of Type A primers and universal probes

The final results of the screening of different primer pairs are shown in Figure 1 and Figure 2: According to the “S-shaped” shape of the curve, the fluorescence value is high, and the amplification Ct value is small. The five primers AF3, AF4, AR1, AR3, and AR4 are comprehensively considered. The amplification effect is better, the best primer pair AF3-AR4 is selected as the main primer pair for type A gene, and other primers are used as candidates, and subsequent screening is continued. According to the corresponding positions of the three primers AF4, AR1 and AR3 on the B-type gene, the sequence of the same position was cut to form the B-type primer. The primer list is shown in Table 2.

Table 2 Type B primer sequence

Sequence name	sequence
BF4	TTTAGTGTCAATGCAGGTGTAACRACAC
BR1	ATTATAGACATGATAGAATAACTTTG
BR3	GATGTGTGTAATTTCCAGCAAGGTGTATC

Example 2: Screening of RSV Type B primers

Use Example 1 to screen A-type primer AF3-AR4 as the main amplification primer of the system. Add primers BF4, BR1, BR3 of the same concentration to the system to amplify the plasmid containing the target gene, the concentration is 1×10 ⁴ copies /μl, repeat two duplicate wells to check the amplification effect. (1) Amplify the type A gene plasmid, and check whether the addition of primers has any effect on the amplification of the type A gene; (2) Amplify the type B gene plasmid and check whether the primers can normally amplify the type B gene. In the experiment, a system without B-type primer was set as a control. The experimental results are shown in Figure 3 to Figure 8. Among them, Figure 3 is the result of adding BF4 primer to type A gene plasmid, Figure 4 is the result of adding BR1 primer to type A gene plasmid, Figure 5 is the result of adding BR3 primer to type A gene plasmid, and Figure 6 is the result of adding BF4 to type B gene plasmid. The results of the primers. Fig. 7 shows the result of adding the BR1 primer to the B gene plasmid, and Fig. 8 shows the result of adding the BR3 primer to the B gene plasmid. When amplifying type A and type B genes, the addition of BF4 and BR3 reduced the amplification efficiency of the system and the fluorescence value. BR1 has no effect on the amplification efficiency, so BR1 was added to the system.

Example 3. Rapid detection of RSV clinical samples

The detection kit provided by the present invention is used to perform rapid detection of 36 clinical samples. The clinical samples this time came from a hospital in Shanghai, and they were all calibrated positive samples. The nucleic acid concentration is shown in Table 3. The detection process is as follows:

(1) Using the detection kit provided by the present invention, put 10μl of positive control substance or negative control substance into 500μl lysate, vortex for 30 seconds, centrifuge at 5000rpm for 1 minute, take 100μl of supernatant and transfer to a new 1.5mL centrifuge In the tube, heat and crack the metal bath at 90°C for 10 minutes, then cool to room temperature, take the supernatant for detection;

(2) Take 10μl of the compound solution and 10μl of sample nucleic acid, add them to the EMA reaction tube containing primer probes, mix well, and set up positive and negative controls;

(3) Put the reconstituted EMA reaction tube into the Click i nucleic acid fluorescence detector, amplify at 37-45°C for 10-30 minutes, scan fluorescence once every 30 seconds, collect fluorescence data, and draw time-fluorescence signal diagram;

(5) Result quality control: the positive control product has a Ct value of <20, the fluorescence curve is a typical "S" type, and the negative control product has no Ct value. All the above conditions are met. This experiment is valid, otherwise it is invalid. You need to investigate the cause and re-check test;

(6) Judgment of results: If the scanning fluorescence curve of the sample is a typical "S" type and the Ct value is less than 30, it is judged as a positive result; otherwise, the scanning fluorescence curve is a horizontal straight line, and there is no Ct value, it is a negative result.

The amplification results are shown in Table 3. The detection rate of 36 cases of RSV positive samples was 100%, which was consistent with the clinical diagnosis results, and the accuracy was 100%.

Table 3 Rapid test results of RSV clinical samples

Sample number	Hospital calibration concentration	Test results	Sample number	Hospital calibration concentration	Test results
Sample 1	1.49×10 3 copies/μl	15.35	Sample 19	7.19×10 3 copies/μl	14.35
Sample 2	9.57×10 2 copies/μl	25.02	Sample 20	7.60×10 3 copies/μl	14.48
Sample 3	1.44×10 3 copies/μl	15.17	Sample 21	4.99×10 3 copies/μl	15.9
Sample 4	1.27×10 3 copies/μl	15.32	Sample 22	2.48×10 5 copies/μl	6.81
Sample 5	2.28×10 4 copies/μl	10.12	Sample 23	3.56×10 3 copies/μl	15.86
Sample 6	2.93×10 4 copies/μl	10.91	Sample 24	2.21×10 3 copies/μl	15.73
Sample 7	3.96×10 4 copies/μl	9.76	Sample 25	1.04×10 3 copies/μl	16.05
Sample 8	9.13×10 1 copies/μl	28.01	Sample 26	7.66×10 2 copies/μl	20.28
Sample 9	4.59×10 3 copies/μl	14.32	Sample 27	1.20×10 3 copies/μl	16.99
Sample 10	3.27×10 3 copies/μl	14.28	Sample 28	1.15×10 3 copies/μl	15.93
Sample 11	3.34×10 3 copies/μl	14.19	Sample 29	2.93×10 2 copies/μl	18.62
Sample 12	2.56×10 3 copies/μl	15.17	Sample 30	1.98×10 5 copies/μl	5.68
Sample 13	5.24×10 3 copies/μl	14.88	Sample 31	8.63×10 4 copies/μl	10.49
Sample 14	3.59×10 3 copies/μl	14.06	Sample 32	3.24×10 3 copies/μl	15.15
Sample 15	3.40×10 3 copies/μl	15.91	Sample 33	1.06×10 3 copies/μl	16.32
Sample 16	1.16×10 3 copies/μl	15.87	Sample 34	1.56×10 3 copies/μl	16.02
Sample 17	1.55×10 3 copies/μl	16.01	Sample 35	9.87×10 3 copies/μl	13.15
Sample 18	1.03×10 4 copies/μl	10.15	Sample 36	9.75×10 2 copies/μl	19.79

Example 4: Detection of cross reaction:

Select nucleic acid extracts from some common pathogens of human infection, including Chlamydia pneumoniae, influenza virus H1N1, adenovirus type 3, adenovirus type 7, Mycobacterium tuberculosis, Streptococcus pneumoniae, Staphylococcus aureus, Escherichia coli, Candida albicans, As well as Respiratory Syncytial Virus Type A and Type B Plasmids, the concentration is 1×10 ⁴ copies/μl. The cross-reaction test was carried out. The results showed that except for the positive sample of RSV, the results of other samples were all negative. It is proved that the present invention has no cross-reactivity with other pathogen nucleic acids in this example. (Figure 9)

Table 5 List of cross-reaction samples

sample	Numbering	concentration	Remarks
Chlamydia pneumoniae	/	1.06×10 4 copies/μl	Clinical sample
Flu H1N1	/	8.17×10 4 copies/μl	Clinical sample
Adenovirus type 3	/	8.49×10 5 copies/μl	Clinical sample
Adenovirus 7	/	7.56×10 4 copies/μl	Clinical sample
Mycobacterium tuberculosis	/	6.82×10 4 copies/μl	Clinical sample
Streptococcus pneumoniae	ATCC49619	7.24×10 7 ng/μl	/
Staphylococcus aureus	ATCC25923	3.66×10 6 ng/μl	/
Escherichia coli	ATCC25923	7.25×10 7 ng/μl	/
Candida albicans	ATCC10231	9.28×10 6 ng/μl	/

It can be seen that the primer set and kit for rapid detection of respiratory syncytial virus of the present invention have high sensitivity, accuracy and specificity.

The present invention takes the F gene of respiratory syncytial virus as the target gene, screens one upstream primer and two downstream primers, and cooperates with the universal EMA enzyme, which can be used within 30 minutes under the low constant temperature condition of 37°C to 45°C Complete the detection of RSV virus RNA.

The kit can detect two genotypes of RSV type A and type B, so that the present invention has the advantages and characteristics of detection ability, not only the detection is simple and easy, the production cost is low, but also it has high accuracy, precision, and specificity. It is highly suitable for early and rapid diagnosis of respiratory syncytial virus.

The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the inventive concept of the present invention, a number of modifications and improvements can be made, which belong to the present invention. The scope of protection of the invention.

Claims (10)

1. A rapid detection primer set for respiratory syncytial virus, characterized in that the rapid detection primer set for respiratory syncytial virus includes upstream and downstream primers and probes that can simultaneously detect respiratory syncytial virus type A and type B F gene sequences; The upstream primer is: 5'-AGTGAGTTATTATCATTAATCAATG-3'; the downstream primer is 2 primers, and the downstream primer 1 is: 5'-TTTCCAACAAGGAGTATCTATTACA-3'; the downstream primer 2 is: 5'-ATTATAGACATGATAGAATAACTTTG-3' ; The probe is

   5’-ATCATTAATCAATGATATGCC/i6-FAMdT//idSp//iBHQ1dT/AACAAATGAT-3’C3 Spacer.
2. The rapid detection primer set for respiratory syncytial virus according to claim 1, wherein the upstream primer can be extended or shortened by 10 bp at the 5', 3'end of the upstream primer sequence according to claim 1, and the downstream primer The 5', 3'end of the downstream primer sequence of claim 1 can be extended or shortened by 10 bp, and the probe can be the 5', 3'end of the probe sequence of claim 1 extended or shortened by 10 bp; or, The upstream and downstream primers and probes may be sequences with greater than 85% sequence homology with the upstream and downstream primers and probes of claim 1; or, the upstream and downstream primers and probes may be respectively Sequences that are complementary to the bases of the upstream and downstream primers and probe sequences of claim 1; or, the 6-FAM, deletion, and BHQ1 modification of the probe are at positions 22-24 of the sequence; or, the probe The 6-FAM, deletion, or BHQ1 tag is at positions 18-29 of the forward or reverse complementary sequence.
3. The universal rapid detection kit for respiratory syncytial virus is characterized in that the kit includes the following contents:

   (1) Lysis solution;

   (2) Reconstituted solution;

   (3) EMA reaction tube containing primer probes; the EMA reaction tube contains upstream and downstream primers and probes, the upstream primer is: 5'-AGTGAGTTATTATCATTAATCAATG-3'; the downstream primer is 2 primers, so The downstream primer 1 is: 5'-TTTCCAACAAGGAGTATCTATTACA-3' The downstream primer 2 is: 5'-ATTATAGACATGATAGAATAACTTTG-3'; the probe is

   5’-ATCATTAATCAATGATATGCC/i6-FAMdT//idSp//iBHQ1dT/AACAAATGAT-3’C3 Spacer;

   (4) Positive control substance;

   (5) Negative control substance.
4. The universal rapid detection kit for respiratory syncytial virus according to claim 3, wherein the lysate contains 1-10% NP-40, 1-100 mg/mL chelex-100, 1 -20mM Tris-Ac pH8.0 and DEPC treated water.
5. The universal rapid detection kit for respiratory syncytial virus according to claim 3, wherein the reconstituted solution contains a final concentration of 10-50mM MgAc2, 80-100mM Tris-Ac, 55-70mM KAc, 5-15% PEG20000 and DEPC treat water.
6. The universal rapid detection kit for respiratory syncytial virus according to claim 3, wherein the composition of the EMA reaction tube containing the primer probe is as follows: each reaction tube contains a final concentration of 0.75-7.5ng/ μl M-MLV reverse transcriptase, 0.25-2.5ng/μl RNase inhibitor, 6-60ng/μl single-stranded DNA binding protein, 16-160pg/μl ATP regeneration protein, 1-10ng/μl DNA helicase , 1-5ng/μl DNA polymerase, 5-150pg/μl DNA restriction endonuclease, 200-500pg/μl accessory protein, 200-500nM upstream primer, 200-500nM downstream primer 1, 200- 500nM downstream primer 2, 1-50nM probe, 1-50mM creatine phosphate sodium, 1-10mM ATP, 50-150μM dNTP, 50-100mM Tris-Ac, 5-50μg/μl trehalose , 100-500mM KAc, 1-10ng/μl mannitol, 1-10% PEG20000.
7. The universal rapid detection kit for respiratory syncytial virus according to claim 3, wherein the negative control substance is a DEPC treated water blank control.
8. The universal rapid detection kit for respiratory syncytial virus according to claim 3, wherein the positive control substance is a pseudovirus containing the target sequence and the concentration is 1 μg/mL.
9. The use of the rapid detection primer set for respiratory syncytial virus according to claims 1 and 2 in the preparation of a universal rapid detection kit for respiratory syncytial virus.
10. A detection method of respiratory syncytial virus, characterized in that the detection method adopts the universal rapid detection kit for respiratory syncytial virus according to claim 3, and the detection method is not for the purpose of diagnosis and treatment of diseases, The detection method includes the following steps:

    (1) Using the detection kit of claim 3, put the sample swab into 500μl lysate and cut it, vortex for 30 seconds, centrifuge at 5000rpm for 1 minute, take 100μl of supernatant and transfer to a new 1.5mL centrifuge In the tube, heat and crack the metal bath at 90°C for 10 minutes, then cool to room temperature, and take the supernatant for detection;

    (2) Take 10μl of positive control substance and negative control substance and operate according to step (1);

    (3) Using the detection kit of claim 3, take 10 μl of the reconstituted solution and 10 μl of the supernatant obtained from the sample lysis, add them to the EMA reaction tube containing primer probes, mix well, and set up positive and negative controls;

    (4) Put the reconstituted EMA reaction tube into the Click i nucleic acid fluorescence detector, amplify at 37-45°C for 10-30 minutes, scan fluorescence once every 30 seconds, collect fluorescence data, and draw time-fluorescence signal diagram;

    (5) Result quality control: the positive control product has a Ct value of <20, the fluorescence curve is a typical "S" type, and the negative control product has no Ct value. All the above conditions are met. This experiment is valid, otherwise it is invalid. You need to investigate the cause and re-check test;

    (6) Judgment of results: If the scanning fluorescence curve of the sample is a typical "S" type and the Ct value is less than 30, it is judged as a positive result; otherwise, the scanning fluorescence curve is a horizontal straight line, and there is no Ct value, it is a negative result.

Images