WO2020176771A1

WO2020176771A1 - Modulators of malat1 expression

Info

Publication number: WO2020176771A1
Application number: PCT/US2020/020169
Authority: WO
Inventors: Susan M. Freier; Youngsoo Kim; Robert Macleod
Original assignee: Ionis Pharmaceuticals, Inc.
Priority date: 2019-02-27
Filing date: 2020-02-27
Publication date: 2020-09-03
Also published as: CN113544271A; EP3931328A4; SG11202108450SA; EP3931328A1; US20200277604A1; US20220243205A1; CA3131700A1; JP2022523214A; US11279932B2; IL285333A; AU2020227824A1; KR20210134686A; JP7492526B2; BR112021015323A2; TW202045724A; MX2021010152A

Abstract

The present embodiments provide methods, compounds, and compositions useful for inhibiting MALAT1 expression, which may be useful for treating, preventing, or ameliorating a cancer associated with MALAT1.

Description

MODULATORS OF MALAT1 EXPRESSION

Sequence Listing

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL00359WOSEQ_ST25.txt created February 20, 2020 which is 596 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field

The present embodiments provide methods, compounds, and compositions useful for inhibiting MAFAT1 expression, which can be useful for treating, preventing, or ameliorating a cancer associated with MALAT1.

Background

Metastasis associated lung adenocarcinoma transcript 1 (MALAT1) is anon-coding IncRNA expressed in many human cell types and is highly conserved across mammalian species. MALAT1 was initially identified from metastatic NSCLC patients and is upregulated in multiple types of cancer (Zhang X. et al., RNA Biol. 2017, Ping J et al., 2003).

Certain embodiments provided herein are directed to potent and tolerable compounds and compositions useful for inhibiting MALAT1 expression, which can be useful for treating, preventing, ameliorating, or slowing progression of cancer associated with MALAT1.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of“or” means “and/or” unless stated otherwise. Furthermore, the use of the term“including” as well as other forms, such as “includes” and“included”, is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety. It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Compounds described by ION number indicate a combination of nucleobase sequence, chemical modification, and motif.

Unless otherwise indicated, the following terms have the following meanings:

“2’-deoxynucleoside” means a nucleoside comprising 2 - H ( H ) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

‘ -O-methoxyethyl” (also 2’-MOE and 2’-0(CH₂)₂-0CH₃) refers to an O-methoxy -ethyl modification at the 2’ position of a furanosyl ring. A 2’-0-methoxyethyl modified sugar is a modified sugar.

“2 -MOE nucleoside” (also 2 O-mcthoxycthyl nucleoside) means a nucleoside comprising a 2 -MOE modified sugar moiety.

“2’-substituted nucleoside” or“2 -modified nucleoside” means a nucleoside comprising a 2’-substituted or 2’-modified sugar moiety. As used herein,“2’-substituted” or“2 -modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.

“3’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3’-most nucleotide of a particular compound.

“5’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5’ -most nucleotide of a particular compound.

“5-methylcytosine” means a cytosine with a methyl group attached to the 5 position.

“About” means within ±10% of a value. For example, if it is stated,“the compounds affected about 70% inhibition of MALATl”, it is implied that MALAT1 levels are inhibited within a range of 60% and 80%.

“Administration” or“administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

“Administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.

“Amelioration’' refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severit of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

“Antibody,” as used in this disclosure, refers to an immunoglobulin or a fragment or a derivative thereof, and encompasses any polypeptide comprising an antigen-binding site, regardless of whether it is produced in vitro or in vivo. The term includes, but is not limited to, polyclonal, monoclonal, monospecific, polyspecific, non-specific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutated, and grafted antibodies. Unless otherwise modified by the term“intact,” as in“intact antibodies,” for the purposes of this disclosure, the term“antibody” also includes antibody fragments such as Fab, F(ab')2, Fv, scFv, Fd, dAb, and other antibody fragments that retain antigen-binding function, i.e., the ability to bind, for example, CTLA-4 or PD-Ll specifically. Typically, such fragments would comprise an antigen-binding domain.

“Anti-CTLA-4 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a CTLA-4 polypeptide. Exemplary anti-CTLA-4 antibodies are described for example at U.S. Patent Nos. 6,682,736; 7,109,003; 7,123,281; 7,411,057; 7,824,679; 8,143,379; 7,807,797; and 8,491,895 (Tremelimumab is 11.2.1, therein), which are herein incorporated by reference. Tremelimumab (U.S. Patent No. 6,682,736) is an exemplary anti-CTLA-4 antibody. Tremelimumab VL, VH, and CDR amino acid sequences are provided at SEQ ID NOs: 1-8, herein.

“Anti-OX40 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds 0X40. 0X40 antibodies include monoclonal and polyclonal antibodies that are specific for 0X40 and antigen binding fragments thereof. In certain aspects, anti-OX40 antibodies as described herein are monoclonal antibodies (or antigen-binding fragments thereof), e g., munne, humanized, or fully human monoclonal antibodies. In one particular embodiment, the 0X40 antibody is an 0X40 receptor agonist, such as the mouse anti-human 0X40 monoclonal antibody (9B12) described by Weinberg et ah, J Immunother 29, 575-585 (2006). In another embodiment, an 0X40 antibody is MEDI0562 as described in US 2016/0137740, incorporated herein by reference. MEDI0562 VH and VL amino acid sequences are provided at SEQ ID NOs: 25- 26, herein. In other embodiments, the antibody which specifically binds to 0X40, or an antigen-binding fragment thereof, binds to the same 0X40 epitope as mAb 9B12.

“Anti-PD-Ll antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a PD-L1 polypeptide. Exemplar_}' anti-PD-Ll antibodies are described for example at US2013/0034559, U.S. Pat. Nos. 8.779,108 and 9,493,565 which are herein incorporated by reference. Durvalumab (MEDI4736) is an exemplary anti-PD-Ll antibody. Durvalumab VL, VH, and CDR amino acid sequences are provided at SEQ ID NOs: 9-16, herein. Other anti-PD-Ll antibodies include BMS-936559 (Bristol-Myers Squibb) and MPDL3280A (atezolizumab) (Roche).

“Anti-PD-1 antibody” refers to an antibody or antigen binding fragment thereof that specifically binds a PD-1 polypeptide. Exemplary anti-PD-1 antibodies are described for example at U.S. Pat. Nos. 7,521,051; 8,008,449; 8,354,509; 9,073,994; 9,393,301; 9402899; and 9,439,962, which are herein incorporated by reference Exemplary anti-PD-1 antibodies include, without limitation, nivolumab, pembrolizumab, pidilizumab, and AMP-514.

“Antigen-binding domain,”“antigen-bindmg fragment,” and“binding fragment” refer to a part of an antibody molecule that comprises amino acids responsible for the specific binding between the antibody and the antigen. In instances, where an antigen is large, the antigen-binding domain may only bind to a part of the antigen. A portion of the antigen molecule that is responsible for specific interactions with the antigen-binding domain is referred to as“epitope” or“antigenic determinant.” An antigen-bindmg domain typically comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH), however, it does not necessarily have to comprise both. For example, a so-called Fd antibody fragment consists only of a VH domain, but still retains some antigen-binding function of the intact antibody. Binding fragments of an antibody are produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies. Binding fragments include Fab, Fab', F(ab')2, Fv, and single-chain antibodies. An antibody other than a "bispecific" or "bifunctional" antibody is understood to have each of its binding sites identical. Digestion of antibodies with the enzyme, papain, results in two identical antigen-binding fragments, known also as "Fab" fragments, and a "Fc" fragment, having no antigen-binding activity but having the ability to crystallize. Digestion of antibodies with the enzyme, pepsin, results in the a F(ab')2 fragment in which the two arms of the antibody molecule remain linked and comprise two-antigen binding sites. The F(ab')2 fragment has the ability to crosslink antigen. "Fv" when used herein refers to the minimum fragment of an antibody that retains both antigen-recognition and antigen-binding sites "Fab" when used herein refers to a fragment of an antibody that comprises the constant domain of the light chain and the CHI domain of the heavy chain.

“mAb” refers to monoclonal antibody. Antibodies of the present disclosure comprise without limitation whole native antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab', single chain V region fragments (scFv), fusion polypeptides, and unconventional antibodies.

“Antisense activity” means any detectable and/or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target. “Antisense compound” means a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds

“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

“Antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

“Antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or region or segment thereof. In certain embodiments, an antisense oligonucleotide is specifically hybndizable to a target nucleic acid or region or segment thereof.

“Bicyclic nucleoside” or“BNA” means a nucleoside comprising a bicyclic sugar moiety.“Bicyclic sugar” or“bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

“Branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups . In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.

“Cell-targeting moiety” means a conjugate group or portion of a con_jugate group that is capable of binding to a particular cell type or particular cell types.

“cEt” or“constrained ethyl” means a bicyclic furanosyl sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH₃)-0-2’.

“cEt nucleoside” means a nucleoside comprising a cEt modified sugar moiety.

“Chemical modification” in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound relative to the original state of such unit.“Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified intemucleoside linkage, a modified sugar, and/or a modified nucleobase. “Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2’-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2^'-0-methoxyethyl modifications.

“Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.

“Chirally ennched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

“Cleavable bond” means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.

“Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

“Complementary” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5- methyl cytosine (^mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or“100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.

“Conjugate group” means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

“Conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

“Conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker. “Contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other. For example,“contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

“Designing” or“Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

“Differently modified” means chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are“differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are“differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2’-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2’-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.

“Dose” means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.

“Dosing regimen” is a combination of doses designed to achieve one or more desired effects.

“Double -stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an oligonucleotide.

“Effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the compound. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual’s medical condition, and other relevant factors. “Efficacy” means the ability to produce a desired effect.

“Expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.

“Gapmer” means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the“gap” and the external regions may be referred to as the“wings.”

“Hybridization” means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).

“Immune checkpoint inhibitor” means an agent that inhibits the expression or activity of a protein that inhibits an immune response. In one embodiment, an immune checkpoint inhibitor is an agent that inhibits the CTLA-4 or PD-1 pathways. Particular checkpoint inhibitors include antibodies that inhibit PD-1, PD-L1 or CTLA-4.

“Immunomodulatory agent” means an agent that enhances an immune response (e.g., anti-tumor immune response). Exemplary immunomodulatory agents of the present disclosure include antibodies, such as an anti-CTLA-4 antibody, an anti-PD-Ll antibody, an anti -PD-1 antibody and antigenic fragments of any of these, and 0X40 agonists, including proteins, such as 0X40 ligand fusion protein, 0X40 antibody, or fragments thereof. In one embodiment, the immunomodulatory agent is an immune checkpoint inhibitor.

“Individual” means a human or non-human animal selected for treatment or therapy.

“Inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

“Intemucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide.“Modified intemucleoside linkage” means any intemucleoside linkage other than a naturally occurring, phosphate intemucleoside linkage. Non-phosphate linkages are referred to herein as modified intemucleoside linkages.

“Lengthened oligonucleotides” are those that have one or more additional nucleosides relative to an oligonucleotide disclosed herein, e.g. a parent oligonucleotide.

“Linked nucleosides” means adjacent nucleosides linked together by an intemucleoside linkage.

“Linker-nucleoside” means a nucleoside that links an oligonucleotide to a conjugate moiety. Linker- nucleosides are located within the conjugate linker of a compound. Linker-nucleosides are not considered part of the oligonucleotide portion of a compound even if they are contiguous with the oligonucleotide.

“Mismatch” or“non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthme, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.

“Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating MALAT1 RNA can mean to increase or decrease the level of MAT, ATI RNA and/or MALAT1 protein in a cell, tissue, organ or organism. A“modulator” effects the change in the cell, tissue, organ or organism For example, a MALAT1 compound can be a modulator that decreases the amount of MALAT1 RNA and/or MALAT1 protein in a cell, tissue, organ or organism.

“MOE” means methoxyethyl.

“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

“Motif’ means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.

“Natural” or“naturally occurring” means found in nature.

“Non-bicyclic modified sugar” or“non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second nng. “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single -stranded nucleic acids, and double-stranded nucleic acids.

“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a“naturally occurring nucleobase” is adenine (A), thymine (T). cytosine (C), uracil (U), and guanine (G). A“modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or“universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.

“Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or mtemucleoside linkage.

“Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.“Modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

“Oligomeric compound” means a compound comprising a single oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.

“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides.“Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or intemucleoside linkage is modified.“Unmodified oligonucleotide” means an oligonucleotide that does not comprise any sugar, nucleobase, or intemucleoside modification.

“Parent oligonucleotide” means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.

“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intrapentoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

“Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administenng to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection. “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

“Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual.

“Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.

“Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate intemucleoside linkage is a modified intemucleoside linkage.

“Phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

“Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely

“Prodrug” means a compound in a form outside the body which, when administered to an individual, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (e.g., drug). Typically conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.

“Reduce” means to bring down to a smaller extent, size, amount, or number.

“RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene) Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).

“Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. “RNAi compound” means an antisense compound that acts at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.

“Segments” are defined as smaller or sub-portions of regions within a nucleic acid.

“Side effects” means physiological disease and or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

“Single-stranded” in reference to a compound means the compound has only one oligonucleotide. “Self-complementary” means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.

“Sites” are defined as unique nucleobase positions within a target nucleic acid.

“Specifically hybridizable” refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

“Specifically inhibit” with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid’s expression.

“Standard cell assay” means assay(s) described in the Examples and reasonable variations thereof.

“Standard in vivo experiment” means the procedure(s) described in the Example(s) and reasonable variations thereof.

“Stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.

“Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety.“Unmodified sugar moiety” or“unmodified sugar” means a 2’-OH(H) furanosyl moiety, as found in RNA (an“unmodified RNA sugar moiety”), or a 2’-H(H) moiety, as found in DNA (an“unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1% 3% and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.“Modified sugar moiety” or“modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.“Modified furanosyl sugar moiety” means a furanosyl sugar comprising a nonhydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2’-substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

“Sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary compounds or nucleic acids.

“Synergy” or“synergize” refers to an effect of a combination that is greater than additive of the effects of each component alone at the same doses

“MALAT1” means any nucleic acid or protein of MALAT1. “MALAT1 nucleic acid” means any nucleic acid encoding MALAT1. For example, in certain embodiments, a MALAT1 nucleic acid includes a DNA sequence encoding MALAT1, an RNA sequence transcribed from DNA encoding MALAT1 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding MALAT1.“MALAT1 mRNA” means an mRNA encoding a MAI ATI protein. The target may be referred to in either upper or lower case.

“MALAT1 specific inhibitor” refers to any agent capable of specifically inhibiting MALAT1 RNA and/or MALAT1 protein expression or activity at the molecular level. For example, MALAT1 specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of MALATl RNA and/or MALAT1 protein.

“Target gene” refers to a gene encoding a target.

“Targeting” means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.

“Target nucleic acid,”“target RNA,”“target RNA transcript” and“nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein. “Target region” means a portion of a target nucleic acid to which one or more compounds is targeted.

“Target segment” means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. “5’ target site” refers to the 5’ -most nucleotide of a target segment. “3’ target site” refers to the 3’- most nucleotide of a target segment.

“Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

“Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.

“Treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.

Certain Embodiments

Certain embodiments provide methods, compounds and compositions for inhibiting MALAT1 expression.

Certain embodiments provide compounds targeted to a MALAT1 nucleic acid. In certain embodiments, the MALAT1 nucleic acid has the sequence set forth in RefSeq or GENBANK Accession No. XR 001309.1 (SEQ ID NO: 1) (which is incorporated by reference in its entirety), or GENBANK Accession No. EF 177381.1 (SEQ ID NO: 2824) (which is incorporated by reference in its entirety). In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound compnsing a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is smgle-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound compnsing a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or oligomenc compound. In certain embodiments, the compound is smgle-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 11 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 11 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is smgle-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double- stranded. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides

Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded. In certain embodiments, the compound is double-stranded.

Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is smgle- stranded. In certain embodiments, the compound is double-stranded.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide comprises an at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 1535-1550, 2034-2049, 2341-2356, 4821-4836, 4840-4855, 4931-4946, 5049-5064, 5494-5509, or 5495-5510 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary within nucleotides 1535-1550, 2034-2049, 2341-2356, 4821-4836, 4840-4855, 4931-4946, 5049-5064, 5494-5509, or 5495-5510 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10.

In certain embodiments, at least one mtemucleoside linkage of any of the foregoing modified oligonucleotides is a modified intemucleoside linkage, at least one sugar of any of the foregoing modified oligonucleotides is a modified sugar, and/or at least one nucleobase of any of the foregoing modified oligonucleotides is a modified nucleobase.

In certain embodiments, at least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar. In certain embodiments, the modified sugar comprises a 2’-0-methoxyethyl group. In certain embodiments, the modified sugar is a bicyclic sugar, such as a 4’-CH(CH3)-0-2’ group, a 4’- CH₂-O-2’ group, or a 4’-(CH₂)₂-0-2’group.

In certain embodiments, at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage, such as a phosphorothioate intemucleoside linkage. In certain embodiments, at least one nucleobase of any of the foregoing modified oligonucleotides is a modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the foregoing modified oligonucleotides has:

a gap segment consisting of linked 2^'-dcoxynuclcosidcs:

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5’ wmg segment and the 3’ wing segment and wherein each nucleoside of each wing segment compnses a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2- 10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of the nucleobase sequence recited in any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of the nucleobase sequence recited m any one of SEQ ID NOs: 2-10.

In certain embodiments, a compound compnses or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10 or 36-2813, wherein the modified oligonucleotide has:

a gap segment consisting of linked 2^'-dcoxynuclcosidcs:

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5’ wmg segment and the 3’ wmg segment and wherein each nucleoside of each wing segment compnses a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound compnses or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides;

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment compnses a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 36-2646 or 2664-2813, wherein the modified oligonucleotide has:

a gap segment consisting of ten linked 2’-deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and

a 3’ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5’ w ing segment and the 3’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-7, wherein the modified oligonucleotide has:

a gap segment consisting of ten linked 2’-deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and

a 3^: wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of a modified oligonucleotide having a nucleobase sequence comprising the nucleobase sequence recited in any of SEQ ID NOs: 8-10; wherein the modified oligonucleotide comprises the sugar motif kkk-d-y-d(8)-kkk, wherein k indicates a cEt modified sugar moiety “d” indicates an unmodified 2’-deoxyribosyl sugar moiety, and“y” indicates a 2’-0-methyl modified sugar moiety; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is 5-methylcytosine. In certain embodiments, the modified oligonucleotide consisting of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 1304884 having the nucleobase sequence and chemical motif: GksGksAksTdsUysAdsAdsTdsGdsTdsAdsGdsTdsGksTksAk (SEQ ID NO: 8), wherein“d” represents a 2’-deoxyribose sugar,“k” represents a cEt modified sugar, y represents a 2'-0- ethyl modified sugar,“s” represents a phosphorothioate intemucleoside linkage, and mC refers to 5- methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 1304890 having the nucleobase sequence and chemical motif: GksGksTksTdsAysTdsAdsGdsmCdsTdsTdsGdsAdsmCksAksAk (SEQ ID NO: 9), wherein“d” represents a 2’-deoxynbose sugar,“k” represents a cEt modified sugar,“y” represents a 2'-0- methyl modified sugar,“s” represents a phosphorothioate intemucleoside linkage, and mC^” refers to a 5- methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In certain embodiments, a compound comprises or consists of ION 1304906 having the nucleobase sequence and chemical motif: GksmCksAksGdsAysTdsAdsAdsTdsGdsTdsTdsmCdsTksmCksAk (SEQ ID NO: 10), wherein“d” represents a 2’-deoxyribose sugar, k^" represents a cEt modified sugar,“y” represents a 2'-0-methyl modified sugar,“s” represents a phosphorothioate intemucleoside linkage, and mC refers to 5- methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

Certain embodiments provide a modified oligonucleotide according to the following chemical structure:

(SEQ ID NO: 6), or a salt thereof. In certain embodiments, the modified oligonucleotide is the sodium salt or potassium salt.

(SEQ ID NO: 6).

Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibnum among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibnum. Unless otherwise indicated, an oligonucleotide described herein and the term“oligonucleotide” are intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term“or a salt thereof’ expressly includes all such forms that may be fully or partially protonated/de- protonated/in association with a cation. In certain instances, one or more specific cation is identified. In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding MALAT1.

In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing embodiments, the compound can consisting of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In certain embodiments, the compound comprises or consists of an oligonucleotide.

In certain embodiments, compounds or compositions provided herein comprise a salt of the modified oligonucleotide. In certain embodiments, the salt is a sodium salt. In certain embodiments, the salt is a potassium salt.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an alanine transaminase (ALT) or aspartate transaminase (AST) value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% compared to control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over control treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over control animals.

Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 centipose (cP), less than about 20 centipose (cP), less than about 15 centipose (cP), or less than about 10 centipose (cP). In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/mL, about 125 mg/niL, about 150 mg/mL, about 175 mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275 mg/mL, or about 300 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C. Non-limiting numbered embodiments include:

El. A compound comprising a modified oligonucleotide 8 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10.

E2. A compound comprising a modified oligonucleotide 9 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10.

E3. A compound comprising a modified oligonucleotide 10 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10.

E4. A compound comprising a modified oligonucleotide 11 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10.

E5. A compound comprising a modified oligonucleotide 12 to 80 linked nucleosides in length and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10.

E6. A compound comprising a modified oligonucleotide 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10.

E7. A compound comprising a modified oligonucleotide 16 linked nucleosides in length and having a nucleobase sequence consisting of any one of SEQ ID NOs: 2-10.

E8. A compound comprising a modified oligonucleotide 8 to 80 linked nucleosides in length and complementary within nucleotides 1535-1550, 2034-2049, 2341-2356, 4821-4836, 4840-4855, 4931-4946, 5049-5064, 5494-5509, or 5495-5510 of SEQ ID NO: 1.

E9. The compound of any one of embodiments E1-E8, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar, or at least one modified nucleobase.

E10. The compound of embodiment E9, wherein the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.

El l. The compound of embodiments E9 or E10, wherein the modified sugar is a bicyclic sugar.

E12. The compound of embodiment El l, wherein the bicyclic sugar is selected from the group consisting of: 4'-(CH₂)-0-2' (LNA); 4'-(CH₂)₂-0-2' (ENA); and 4'-CH(CH₃)-0-2' (cEt). E13. The compound of embodiments E9 or E10, wherein the modified sugar is 2’-0-methoxyethyl.

E14. The compound of any one of embodiments E9-E13, wherein the modified nucleobase is a 5- methylcytosine.

E15. The compound of any one of embodiments E I -E I 4. wherein the modified oligonucleotide comprises:

a gap segment consisting of linked 2’-deoxynucleosides;

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

E16. A compound comprising a modified oligonucleotide 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 2-10, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked 2^'-deoxynucleosides:

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3 wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

E17. A compound comprising a modified oligonucleotide 16-80 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in any one of SEQ ID NOs: 2-7, wherein the modified oligonucleotide comprises:

a gap segment consisting of ten linked 2^,-deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and

a 3’ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

E18. The compound of any one of embodiments E1-E17, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to SEQ ID NO: 1.

E19. The compound of any one of embodiments E1-E18, wherein the compound is single-stranded.

E20. The compound of any one of embodiments E 1 -E 18, wherein the compound is double-stranded. E21. The compound of any one of embodiments E I-E20. wherein the compound comprises ribonucleotides.

E22. The compound of any one of embodiments E1-E20, wherein the compound comprises deoxyribonucleotides.

E23. The compound of any one of embodiments E1-E22, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.

E24. The compound of any preceding embodiments, wherein the compound consists of the modified oligonucleotide.

E25. A compound consisting of a pharmaceutically acceptable salt of any of the compounds of embodiments E 1 -E24.

E26. The compound of embodiment 25, wherein the pharmaceutically acceptable salt is a sodium salt.

E27. The compound of embodiment 26, wherein the pharmaceutically acceptable salt is a potassium salt.

E28. A modified oligonucleotide according to the following chemical structure:

(SEQ ID NO: 6), or a salt thereof.

E29. The modified oligonucleotide of embodiment E28, wherein the modified oligonucleotide is the sodium salt or the potassium salt.

E30. A modified oligonucleotide according to the following chemical structure:

(SEQ ID NO: 6).

E31. A composition comprising the compound of any one of embodiments E1-E27 or the modified oligonucleotide of any one of embodiments E28-E30 and a pharmaceutically acceptable diluent or carrier.

E32. A composition comprising the compound of any one of embodiments E1-E27 or the modified oligonucleotide of any one of embodiments E28-E30 and water.

E33. A composition comprising the compound of any one of embodiments E1-E27 orthe modified oligonucleotide of any one of embodiments E28-E30 for use in therapy.

E34. A method of treating or ameliorating cancer in an individual compnsing administering to the individual a compound targeted to MALAT1. thereby treating or ameliorating the cancer

E35. The method of embodiment E34, wherein the compound is an antisense compound targeted to

MALAT1.

E36. The method of embodiments E34 or E35, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal -like breast cancer; HER 2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER- , PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer: prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

E37. The method of any of embodiments E34-E36, wherein administering the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis.

E38. The method of any of embodiments E34-E37, wherein administering the compound increases or induces cancer cell differentiation, cancer cell adhesion, or tumor differentiation.

E39. The method of any of embodiments E34-E38, wherein administering the compound induces a cancer cell or tumor to have a cystic, ductular, or acinar phenotype or morphology.

E40. The method of any of embodiments E34-E39, wherein administering the compound induces a cancer cell or tumor to have a more differentiated phenotype or structure.

E41. The method of embodiment E40, wherein the more differentiated phenotype or structure comprises presence of secretor lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of E-cadherin or casein.

E42. A method of inhibiting expression of MALAT1 in a cancer cell comprising contacting the cancer cell with a compound targeted to MALAT1, thereby inhibiting expression of MALAT1 in the cancer cell.

E43. The method of embodiment E42, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER- , PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer: prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

E44. A method of reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in an individual having cancer comprising administering a compound targeted to MALATl to the individual, thereby reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in the individual.

E45. A method of increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in an individual having cancer comprising administenng a compound targeted to MALATl to the individual, thereby increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in the individual.

E46. A method of inducing a cancer cell or tumor to have a cystic, ductular, or acinar phenotype or morphology in an individual having cancer comprising administenng a compound targeted to MALATl to the individual, thereby inducing the cancer cell or tumor to have a cystic, ductular, or acinar phenotype or morphology.

E47. A method of inducing a cancer cell or tumor to have a more differentiated phenotype or structure comprising administering a compound targeted to MALATl to the individual, thereby inducing the cancer cell or tumor to have a more differentiated phenotype or structure.

E48. The method of embodiment E47, wherein the more differentiated phenotype or structure comprises presence of secretory lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of E-cadherin or casein. E49. The method of any of embodiments E44-E48, wherein the individual has breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC): sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

E50. The method of any one of embodiments E34-E49, wherein the compound is an antisense compound targeted to MALATl .

E51. The method of any one of embodiments E34-E49, wherein the compound is the compound of any one of embodiments E1-E27, the modified oligonucleotide of any one of embodiments E28-E30, or the composition of embodiment E31 or E32.

E52. The method of any of embodiments E34-E51, wherein the compound is administered parenterally.

E53. Use of a compound targeted to MALATl for treating, preventing, or ameliorating a cancer associated with MALATl

E54. The use of embodiment E53, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-. PR-. HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

E55. The use of embodiment E53 or E54, wherein the compound is an antisense compound targeted to MALAT1.

E56. The use of any one of embodiments E53-E55, wherein the compound is the compound of any one of embodiments E1-E27, the modified oligonucleotide of any one of embodiments E28-E30, or the composition of embodiment E31 or E32.

E57. Use of a compound targeted to MALAT1 in the manufacture of a medicament for treating or ameliorating a cancer associated with MALAT1.

E58. The use of embodiment E57, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-. and EIER2- triple negative breast cancer (ER-. PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

E59. The use of embodiment E57 or E58, wherein the compound is an antisense compound targeted to MALATL

E60. The use of any one of embodiments E57-E59, wherein the compound is the compound of any one of embodiments E1-E27, the modified oligonucleotide of any one of embodiments E28-E30, or the composition of embodiment E31 or E32.

E61. Use of a compound targeted to MALATl in the preparation of a medicament for treating or ameliorating a cancer associated with MALATL

E62. The use of embodiment E61, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-. PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-): ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

E63. The use of embodiment E61 or E62, wherein the compound is an antisense compound targeted to MALATL

E64. The use of any one of embodiments E61-E63, wherein the compound is the compound of any one of embodiments E1-E27, the modified oligonucleotide of any one of embodiments E28-E30, or the composition of embodiment E31 or E32.

Certain Indications Certain embodiments provided herein relate to methods of inhibiting MALAT1 expression, which can be useful for treating, preventing, or ameliorating a cancer associated with MALAT1 in an individual, by administration of a compound that targets MALAT1. In certain embodiments, the compound can be a MALAT1 specific inhibitor. In certain embodiments, the compound can be an antisense compound, oligomeric compound, or oligonucleotide targeted to MALAT1.

Examples of cancers associated with MALAT1 treatable, preventable, and/or ameliorable with the compounds and methods provided herein include breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal -like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

In certain embodiments, the breast cancer has one or more of the following characteristics: Androgen Receptor positive, dependent on androgen for growth; Estrogen Receptor (ER) negative, independent of estrogen for growth; Progesterone Receptor (PR) negative, independent of progesterone for growth; or Her2/neu negative. In certain embodiments, the breast cancer is ER, PR, and HER2 triple negative (ER-, PR- , HER2-) In certain embodiments, the breast cancer is triple negative and AR positive (ER-, PR-, HER2-, AR+). In certain embodiments, the breast cancer is ER negative and AR positive (ER-, AR+). In certain embodiments, the breast cancer is ER positive and AR positive (ER+, AR+). In certain embodiments, the breast cancer is apocrine. Apocrine breast cancers are often“triple negative”, meaning that the cells do not express ER, PR, or HER2 receptors, and usually, but not necessarily, AR positive. In certain embodiments, an apocrine breast cancer is ER, PR, and HER2 triple negative and AR positive (ER-, PR-, HER2-, AR+). In certain embodiments, an apocrine breast cancer is ER negative and AR positive (ER-, AR+). In certain embodiments, an apocrine breast cancer originates from the sweat gland of the breast. In certain embodiments, an apocrine breast cancer is a ductal cancer or cancer cell of the breast. In certain embodiments, an apocrine breast cancer can have any one or more of the following features: a large amount of eosinophilic granular cytoplasm, well-defined margins, large vesicular nuclei, a nuclear to cytoplasmic ratio of about 1 :2, and/or accumulations of secreted granules in the apical cytoplasm known as apical snouts. In certain embodiments, the breast cancer is an ER negative and AR positive (ER-, AR+) molecular apocrine breast cancer. In certain aspects, an ER negative and AR positive (ER-, AR+) molecular apocrine breast cancer can further be PR positive, PR negative, HER2 negative, or HER2 positive. In certain embodiments, the breast cancer is HER2 positive. In certain embodiments, the breast cancer is PR positive. In certain embodiments, the breast cancer is ER positive. Breast cancer can be identified as positive or negative with respect to hormone receptors, such as ER, PR, or HER2 by standard histological techniques. For example, in some embodiments histological breast cancer samples can be classified as“triple negative” (ER-, PR-, HER2-) when less than 1% of cells demonstrate nuclear staining for estrogen and progesterone receptors, and immunohistochemical staining for HER2 shows a 0, 1-fold, or a 2-fold positive score and a FISH ratio (HER2 gene signals to chromosome 17 signals) of less than 1.8 according to the relevant ASCO and CAP guidelines. (Meyer, P. et al., PLoS ONE 7(5): e38361 (2012)).

In certain embodiments, the B-cell lymphoma is a non-Hodgkin’s B-cell lymphoma. Examples of non- Hodgkin’s B-cell lymphoma of certain embodiments that can be treated with compounds provided herein include, but are not limited to, diffuse large B cell lymphoma (DLBCL), activated B-cell lymphoma (ABC- DLBCL), germinal center B-cell lymphoma (GCB DLBCL), follicular lymphoma, mucosa-associated lymphatic tissue lymphoma (MALT), small cell lymphocytic lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma (MCL), Burkitt lymphoma, mediastinal large B cell lymphoma, Waldenstrom macroglobulinemia, nodal marginal zone B cell lymphoma (NMZL), splenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, and lymphomatoid granulomatosis.

In certain embodiments, the T-cell lymphoma that can be treated with compounds provided herein include, but are not limited to, peripheral T-cell lymphoma, and anaplastic large cell lymphoma (ALCL).

In certain embodiments, the leukemia that can be treated with compounds provided herein includes, but is not limited to, acute lymphocytic leukemia (ALL).

In certain embodiments, a method of treating, preventing, or ameliorating a cancer associated with MALAT1 in an individual comprises administering to the individual a compound comprising a MALAT1 specific inhibitor, thereby treating, preventing, or ameliorating the cancer. In certain embodiments, the compound comprises an antisense compound targeted to MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeted to MALAT1. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis. In certain embodiments, administering the compound increases or induces cancer cell differentiation, cancer cell adhesion, or tumor differentiation. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a cystic, ductular, or acinar phenotype or morphology. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a more differentiated phenotype or structure. In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, presence of secretory lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of differentiation markers such as E-cadherin or milk proteins such as casein.

In certain embodiments, a method of treating or ameliorating caner comprises administering to the individual a compound comprising a MALAT1 specific inhibitor, thereby treating or ameliorating the cancer. In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (E1NSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeted to MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeted to MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis. In certain embodiments, administering the compound increases or induces cancer cell differentiation, cancer cell adhesion, or tumor differentiation. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a cystic, ductular, or acinar phenotype or morphology. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a more differentiated phenotype or structure. In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, presence of secretory lipid droplets, increased desmosomal stmctures, polarized ductal structures, or increased levels of differentiation markers such as E-cadherin or milk proteins such as casein.

In certain embodiments, the individual is identified as having or at risk of having a cancer associated with MALAT1.

In certain embodiments, a method of inhibiting expression of MALAT1 in an individual having, or at risk of having, a cancer associated with MALAT1 comprises administering to the individual a compound comprising a MALAT1 specific inhibitor, thereby inhibiting expression of MALAT1 in the individual. In certain embodiments, administering the compound inhibits expression of MALAT1 in the breast. In certain embodiments, the individual has, or is at risk of having breast cancer; inflammatoiy breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal -like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeted to MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeted to MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2- 10. In certain embodiments, the compound comprises amodified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double- stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, administering the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis. In certain embodiments, administering the compound increases or induces cancer cell differentiation, cancer cell adhesion, or tumor differentiation. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a cystic, ductular, or acinar phenotype or morphology. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a more differentiated phenotype or structure. In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, presence of secretory lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of differentiation markers such as E-cadherin or milk proteins such as casein.

In certain embodiments, a method of inhibiting expression of MALAT1 in a cell comprises contacting the cell with a compound comprising a MALAT1 specific inhibitor, thereby inhibiting expression of MALAT1 in the cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a breast cell. In certain embodiments, the cell is in the breast. In certain embodiments, the cell is in the breast of an individual who has, or is at risk of having cancer, such as breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal -like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeted to MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeted to MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2- 10. In certain embodiments, the compound comprises amodified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double- stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, a method of reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis of an individual having, or at risk of having, a cancer associated with MALAT1 comprises administering to the individual a compound comprising a MALAT1 specific inhibitor, thereby reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in the individual. In certain embodiments, a method of increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation of an individual having, or at risk of having, a cancer associated with MALAT1 comprises administering to the individual a compound comprising a MALAT1 specific inhibitor, thereby increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in the individual. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a cystic, ductular, or acinar phenotype or morphology. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a more differentiated phenotype or structure. In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, presence of secretory lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of differentiation markers such as E-cadherin or milk proteins such as casein. In certain embodiments, the individual has, or is at risk of having, breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER- , PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovanan cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeted to MALATl . In certain embodiments, the compound comprises an oligonucleotide targeted to MALATL In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence composing the nucleobase sequence of any one of SEQ ID NOs: 2-10 In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the individual is identified as having or at risk of having a cancer associated with MALAT1.

Certain embodiments are drawn to a compound comprising a MALAT1 specific inhibitor for use in treating cancer. In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal -like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeted to MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeted to MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2- 10. In certain embodiments, the compound comprises amodified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double- stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to a compound comprising a MALAT1 specific inhibitor for use in reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in an individual having cancer. Certain embodiments are drawn to a compound comprising a MALAT1 specific inhibitor for use in increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in an individual having cancer. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a cystic, ductular, or acinar phenotype or morphology. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a more differentiated phenotype or structure . In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, presence of secretory lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of differentiation markers such as E-cadherin or milk proteins such as casein. In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeted to MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeted to MALATl In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound. Certain embodiments are drawn to use of a compound comprising a MALAT1 specific inhibitor for the manufacture or preparation of a medicament for treating cancer. Certain embodiments are drawn to use of a compound comprising a MALAT1 specific inhibitor for the preparation of a medicament for treating a cancer associated with MALATl. In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeted to MALATl. In certain embodiments, the compound comprises an oligonucleotide targeted to MALATl . In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2- 10. In certain embodiments, the compound compnses amodified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double- stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

Certain embodiments are drawn to use of a compound comprising a MALAT1 specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in an individual having cancer. Certain embodiments are drawn to use of a compound comprising a MALAT1 specific inhibitor for the manufacture or preparation of a medicament for increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in an individual having cancer. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a cystic, ductular, or acinar phenotype or morphology. In certain embodiments, administering the compound induces a breast cancer cell or breast tumor to have a more differentiated phenotype or structure . In certain embodiments, the more differentiated phenotype or structure includes, but is not limited to, presence of secretory lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of differentiation markers such as E-cadherin or milk proteins such as casein. In certain embodiments, the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC): sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphoc tic leukemia (ALL). In certain embodiments, the compound comprises an antisense compound targeted to MALAT1. In certain embodiments, the compound comprises an oligonucleotide targeted to MALAT1. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, a compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: SEQ ID NOs: 36-2646 or 2664-2813. In any of the foregoing embodiments, the modified oligonucleotide can consist of 10 to 30 linked nucleosides. In certain embodiments, the compound is ION 1157034, 1157111, 1157190, 1157929, 1158161, 1158162, 1304884, 1304890, or 1304906. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense compound or oligomeric compound.

In any of the foregoing methods or uses, the compound can be targeted to MALAT1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide can consist of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar and/or at least one modified nucleobase. In certain embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the modified sugar is a bicyclic sugar or a 2’-0-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wmg segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing embodiments, the modified oligonucleotide can consist of 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 17 or 20 linked nucleosides. In certain embodiments, the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to SEQ ID NO: 1. In certain embodiments, at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage, at least one sugar of the modified oligonucleotide is a modified sugar and/or at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the modified sugar is a bicyclic sugar or a 2^,-0-methoxyethyl sugar, and the modified nucleobase is 5- methylcytosine. In certain embodiments, the modified oligonucleotide has a gap segment consisting of linked 2 -dcoxynuclcosidcs: a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide having:

a gap segment consisting of linked 2 -dcoxymicleosidcs:

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment composes a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2- 10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of the nucleobase sequence recited in any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of the nucleobase sequence recited in any one of SEQ ID NOs: 2-10.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10 or36-2813, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides;

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-10, wherein the modified oligonucleotide has:

a gap segment consisting of linked 2’-deoxynucleosides;

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 36-2646 or 2664-2813, wherein the modified oligonucleotide has:

a gap segment consisting of ten linked 2’-deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and

a 3^: wing segment consisting of three linked nucleosides;

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 2-7, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2 -dcoxynuclcosidcs;

a 5’ wing segment consisting of three linked nucleosides; and

a 3^: wing segment consisting of three linked nucleosides;

In any of the foregoing methods or uses, the compound can comprise or consist of a modified oligonucleotide having a nucleobase sequence comprising the nucleobase sequence recited in any of SEQ ID NOs: 8-10; wherein the modified oligonucleotide comprises the sugar motif kkk-d-y-d(8)-kkk, wherein“k” indicates a cEt modified sugar moiety,“d” indicates an unmodified 2’-deoxyribosyl sugar moiety, and“y” indicates a 2’-0-methyl modified sugar moiety; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is 5-methylcytosme. In certain embodiments, the modified oligonucleotide consisting of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any ofthe foregoing methods or uses, the compound can comprise or consist of ION 1304884 having the nucleobase sequence and chemical motif: GksGksAksTdsUysAdsAdsTdsGdsTdsAdsGdsTdsGksTksAk (SEQ ID NO: 8), wherein“d” represents a 2’-deoxynbose sugar,“k” represents a cEt modified sugar,“y” represents a 2'-0-methyl modified sugar,“s” represents a phosphorothioate intemucleoside linkage, and“mC” refers to 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of ION 1304890 having the nucleobase sequence and chemical motif:

GksGksTksTdsAysTdsAdsGdsmCdsTdsTdsGdsAdsmCksAksAk (SEQ ID NO: 9), wherein“d^,: represents a 2 -dcoxyribosc sugar,“k” represents a cEt modified sugar,“y” represents a 2'-0-methyl modified sugar, '‘s” represents a phosphorothioate intemucleoside linkage, and“mC” refers to a 5-methylcytosme. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can comprise or consist of ION 1304906 having the nucleobase sequence and chemical motif:

GksmCksAksGdsAysTdsAdsAdsTdsGdsTdsTdsmCdsTksmCksAk (SEQ ID NO: 10), wherein“d” represents a 2’-deoxyribose sugar,“k” represents a cEt modified sugar, y^" represents a 2'-0-methyl modified sugar, s^" represents a phosphorothioate intemucleoside linkage, and mC^" refers to 5-methylcytosine. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

In any of the foregoing methods or uses, the compound can be a modified oligonucleotide according to the following chemical structure:

(SEQ ID NO: 6).

In any of the foregoing methods or uses, the compound can be administered parenterally. For example, in certain embodiments the compound can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intrapentoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. Certain Combinations and Combination Therapies

In certain embodiments, a first agent comprising a compound described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.

In certain embodiments, one or more compounds or compositions provided herein are co administered with one or more secondary agents. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more secondary agents, are prepared separately. In certain embodiments, a secondary agent is selected from: a chemotherapeutic agent including, but not limited to, capecitabine (Xeloda), carboplatin, cisplatin, cyclophosphamide, docetaxel (Taxotere), doxorubicin, epirubicin (Ellence), eribulin (Halaven), fluorouracil (5-FU, Efudex), gemcitabine (Gemzar), ixabepilone (Ixempra), methotrexate (Rheumatrex, Trexall), paclitaxel (Taxol), or vinorelbine (Navelbine); a combination regiment including, but not limited to, AC (doxorubicin and cyclophosphamide), EC (epirubicin, cyclophosphamide), AC or EC (epirubicin and cyclophosphamide) followed by T (doxorubicin and cyclophosphamide, followed by paclitaxel or docetaxel), CAF (cyclophosphamide, doxorubicin, and 5-FU), CEF (cyclophosphamide, epirubicin, and 5- FU), CMF (cyclophosphamide, methotrexate, and 5-FU), TAC (docetaxel, doxorubicin, and cyclophosphamide), TC (docetaxel and cyclophosphamide), AC-TH (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab), AC-THP (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab, pertuzumab), TCHP (docetaxel, carboplatin, trastuzumab, pertuzumab), TCH (docetaxel, carboplatin, trastuzumab), or TH (paclitaxel, trastuzumab); hormone therapy including, but not limited to, selective estrogen receptor modulators, tamoxifen, toremifene (Fareston), fulvestrant (Faslodex), goserelin (Zoladex), or leuprolide (Eligard, Lupron); aromatase inhibitors (AIs) including, but not limited to, anastrozole (Anmidex), exemestane (Aromasin), or letrozole (Femara); HER2-targeted therapy including, but not limited to, trastuzumab (Herceptin), lapatinib (TYKERB), pertuzumab (Peijeta), or neratimb (Nerlynx).

Certain embodiments are directed to the use of a compound targeted to MALAT1 as described herein in combination with a secondary agent. In particular embodiments such use is in a method of treating a patient suffering from cancer including, but not limited to, breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal -like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL). In certain embodiments, a secondary agent is selected from: a chemotherapeutic agent including, but not limited to, capecitabine (Xeloda), carboplatin, cisplatin, cyclophosphamide, docetaxel (Taxotere), doxorubicin, epirubicin (Ellence), eribulin (Halaven), fluorouracil (5-FU, Eftidex), gemcitabine (Gemzar), ixabepilone (Ixempra), methotrexate (Rheumatrex, Trexall), paclitaxel (Taxol), or vinorelbine (Navelbine); a combination regiment including, but not limited to, AC (doxorubicin and cyclophosphamide), EC (epirubicin, cyclophosphamide), AC or EC (epirubicin and cyclophosphamide) followed by T (doxorubicin and cyclophosphamide, followed by paclitaxel or docetaxel), CAF (cyclophosphamide, doxorubicin, and 5-FU), CEF (cyclophosphamide, epirubicin, and 5-FU), CMF (cyclophosphamide, methotrexate, and 5-FU), TAC (docetaxel, doxorubicin, and cyclophosphamide), TC (docetaxel and cyclophosphamide), AC-TH (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab), AC-THP (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab, pertuzumab), TCHP (docetaxel, carboplatin, trastuzumab, pertuzumab), TCH (docetaxel, carboplatin, trastuzumab), or TH (paclitaxel, trastuzumab); hormone therapy including, but not limited to, selective estrogen receptor modulators, tamoxifen, toremifene (Fareston), fiilvestrant (Faslodex), goserelm (Zoladex), or leuprolide (Eligard, Lupron); aromatase inhibitors (AIs) including, but not limited to, anastrozole (Arimidex), exemestane (Aromasin), or letrozole (Femara); HER2-targeted therapy including, but not limited to, trastuzumab (Herceptin), lapatinib (TYKERB), pertuzumab (Peijeta), or neratinib (Nerlynx).

Certain embodiments are drawn to a combination of a compound targeted to MALATl as described herein and a secondary agent, such as a secondary agent selected from: a chemotherapeutic agent including, but not limited to, capecitabine (Xeloda), carboplatin, cisplatin, cyclophosphamide, docetaxel (Taxotere), doxorubicin, epirubicin (Ellence), eribulin (Halaven), fluorouracil (5-FU, Efudex), gemcitabine (Gemzar), ixabepilone (Ixempra), methotrexate (Rheumatrex, Trexall), paclitaxel (Taxol), or vinorelbine (Navelbine); a combination regiment including, but not limited to, AC (doxorubicin and cyclophosphamide), EC (epirubicin, cyclophosphamide), AC or EC (epirubicin and cyclophosphamide) followed by T (doxorubicin and cyclophosphamide, followed by paclitaxel or docetaxel), CAF (cyclophosphamide, doxorubicin, and 5-FU), CEF (cyclophosphamide, epirubicin, and 5-FU), CMF (cyclophosphamide, methotrexate, and 5-FU), TAC (docetaxel, doxorubicin, and cyclophosphamide), TC (docetaxel and cyclophosphamide), AC-TH (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab), AC-THP (doxorubicin, cyclophosphamide, paclitaxel, trastuzumab, pertuzumab), TCHP (docetaxel, carboplatin, trastuzumab, pertuzumab), TCH (docetaxel, carboplatin, trastuzumab), or TH (paclitaxel, trastuzumab); hormone therapy including, but not limited to, selective estrogen receptor modulators, tamoxifen, toremifene (Fareston), fulvestrant (Faslodex), goserelin (Zoladex), or leuprolide (Eligard, Lupron); aromatase inhibitors (AIs) including, but not limited to, anastrozole (Arimidex), exemestane (Aromasin), or letrozole (Femara); HER2 -targeted therapy including, but not limited to, trastuzumab (Herceptin), lapatinib (TYKERB), pertuzumab (Perjeta), or neratinib (Nerlynx).

In certain embodiments the compound targeted to MALAT1 as described herein and the secondary agent are used in combination treatment by administering the two agents simultaneously, separately or sequentially. In certain embodiments the two agents are formulated as a fixed dose combination product. In other embodiments the two agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially).

In certain embodiments, a compound targeted to MALAT1 as described herein is used in combination with an immunomodulator agent such as an anti-PD-Ul antibody (or an antigen-binding fragment thereof), an anti-PD-1 antibody (or an antigen-binding fragment thereof), an anti-CTLA-4 antibody (or an antigen-binding fragment thereof) or an 0X40 agonist ((e ., an 0X40 ligand fusion protein, or an 0X40 agonist antibody or antigen-binding fragment thereof).

In certain embodiments, a compound targeted to MAUAT1 as described herein is used in combination with an immune checkpoint inhibitor such as an anti-PD-L 1 antibody (or an antigen-binding fragment thereof), an anti-PD-1 antibody (or an antigen-binding fragment thereof), or an anti-CTLA-4 antibody (or an antigenbinding fragment thereof).

Anti-PD-Ll antibodies are known in the art. Exemplary anti-PD-Ll antibodies include: MEDI4736 (durvalumab), MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105 and MPDL3280A (atezohzumab).

Anti-PD-1 antibodies are known in the art. Exemplary anti-PD-1 antibodies include: nivolumab, pembrolizumab, pidilizumab, and AMP-514

Anti-CTLA-4 antibodies are known in the art. Exemplary anti-CTLA-4 antibodies include: tremelimumab and ipilimumab, also termed MDX-010 (or BMS-734016).

0X40 agonists and antibodies are known in the art. Exemplary 0X40 agonists and/or antibodies include: MEDI6383, 9B12 and MEDI0562.

In one embodiment, the combination includes the antisense oligonucleotide Ionis 1158161 or a salt thereof, and at least one immunomodulator selected from the group consisting of: MEDI4736, MPDL3280A, BMS936559, 2.7A4, AMP-714, MDX-1105, nivolumab, pembrolizumab, pidilizumab, MPDL3280A, tremelimumab, ipilimumab, MEDI0562 and MEDI0562.

Certain Anti-PD-Ll Antibodies

Antibodies that specifically bind and inhibit PD-L1 are included in the present disclosure.

Durvalumab (MEDI4736) is an exemplary anti-PD-Ll antibody that is selective for a PD-L1 polypeptide and blocks the binding of PD-L1 to the PD-1 and CD80 receptors. Durvalumab can relieve PD- L1 -mediated suppression of human T-cell activation in vitro and inhibits tumor growth in a xenograft model via a T-cell dependent mechanism.

Information regarding durvalumab (or fragments thereof) for use in the methods provided herein can be found in U S. PatentNo. 8,779,108, the disclosure of which is incorporated herein by reference in its entirety. The fragment crystallizable (Fc) domain of durvalumab contains a triple mutation in the constant domain of the IgGl heavy chain that reduces binding to the complement component Clq and the Fey receptors responsible for mediating antibody-dependent cell-mediated cytotoxicity (ADCC).

Durvalumab and antigen-binding fragments thereof for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In certain embodiments, MEDI4736 or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 2 14H90PT antibody as disclosed in U.S. Patent Nos. 8,779, 108 and 9493565, which is herein incorporated by reference in its entirety.

There are numerous anti-PD-Ll antibodies in the published literature that could feature in the present disclosure, including compounds in development and/or in clinical trials such as: durvalumab (MEDI4736), MPDL3280A, BMS936559, 2.7A4, AMP-714 and MDX-1105. Patent specifications disclosing anti-PD-Ll antibodies that may be useful in the present disclosure include: U.S. Pat. Nos. 7,943,743; 8,383,796; 9, 102,725; 9,273,135 (BMS/Medarex), US2006/0153841 (Dana Farber), US2011/0271358 (Dana Farber), U.S. Pat. Nos. 8,552,154 and 9,102,727 (Dana Farber), U.S. Pat. No. 8,217,149 (Genentech), including issued U.S. PatentNo. 8,217,149, US2012/0039906 (INSERM), US2016/0031990 (Amplimmune), U.S. Patent No. 8,779,108 (Medlmmune - for durvalumab/MEDI4726 and 2.7A4), US2014/0044738 (Amplimmune - for AMP-714) and US2010/0285039 (John’s Hopkins University). Each of these disclosures is herein incorporated by reference in its entirety.

Certain Anti-CTLA-4 Antibodies

Antibodies that specifically bind CTLA-4 and inhibit CTLA-4 activity are useful for enhancing an anti tumor immune response. Information regarding tremelimumab (or antigen-binding fragments thereof) for use in the methods provided herein can be found in US 6,682,736 (where it is referred to as 11.2.1), the disclosure of which is incorporated herein by reference in its entirety. Tremelimumab (also known as CP-675,206, CP- 675, CP-675206, and ticilimumab) is a human IgG2 monoclonal antibody that is highly selective for CTLA-4 and blocks binding of CTLA-4 to CD80 (B7.1) and CD86 (B7.2). It has been shown to result in immune activation in vitro and some patients treated with tremelimumab have shown tumor regression.

Tremelimumab for use in the methods provided herein comprises a heavy chain and a light chain or a heavy chain variable region and a light chain variable region. In a specific aspect, tremelimumab or an antigen binding fragment thereof for use in the methods provided herein compnses a light chain variable region comprising the amino acid sequences shown herein above and a heavy chain variable region comprising the amino acid sequence shown herein above. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the Kabat-defmed CDR1, CDR2, and CDR3 sequences shown herein above, and wherein the light chain variable region comprises the Kabat-defmed CDR1, CDR2, and CDR3 sequences shown herein above. Those of ordinary skill in the art would easily be able to identify Chothia-defmed, Abm-defmed or other CDR definitions known to those of ordinary skill in the art. In a specific aspect, tremelimumab or an antigen-binding fragment thereof for use in the methods provided herein comprises the variable heavy chain and variable light chain CDR sequences of the 11.2.1 antibody as disclosed in U.S. Pat. No. 6,682,736, which is herein incorporated by reference in its entirety.

Other anti-CTLA-4 antibodies are described, for example, in US 20070243184. In one embodiment, the anti-CTLA-4 antibody is Ipilimumab, also termed MDX-010; BMS-734016.

Certain 0X40 Agonists

0X40 agonists interact w ith the 0X40 receptor on CD4+ T-cells during, or shortly after, priming by an antigen resulting in an increased response of the CD4+ T-cells to the antigen. An 0X40 agonist interacting with the 0X40 receptor on antigen specific CD4+ T-cells can increase T cell proliferation as compared to the response to antigen alone. The elevated response to the antigen can be maintained for a period of time substantially longer than in the absence of an 0X40 agonist. Thus, stimulation via an 0X40 agonist enhances the antigen specific immune response by boosting T-cell recognition of antigens, e.g., tumor cells. 0X40 agonists are described, for example, in U.S. Patent Nos. 6,312,700, 7,504,101, 7,622,444, and 7,959,925, which are incorporated herein by reference in their entireties. Methods of using such agonists in cancer treatment are described, for example, in US2015/0098942 and in US2015/0157710, each of which are incorporated herein by reference in its entirety.

0X40 agonists include, but are not limited to 0X40 binding molecules, e.g., binding polypeptides, e g., 0X40 ligand (“OX40L”) or an OX40-binding fragment, variant, or derivative thereof, such as soluble extracellular ligand domains and OX40L fusion proteins, and anti-OX40 antibodies (for example, monoclonal antibodies such as humanized monoclonal antibodies), or an antigen-binding fragment, variant or derivative thereof. Examples of anti-OX40 monoclonal antibodies are described, for example, in U.S. Patent Nos. 5,821,332 and 6,156,878, the disclosures of which are incorporated herein by reference in their entireties. In certain embodiments, the anti-OX40 monoclonal antibody is 9B 12, or an antigen-binding fragment, variant, or derivative thereof, as described in Weinberg, A D., et al J Immunother 29, 575-585 (2006), which is incorporated herein by reference in its entirety. In another embodiment, an 0X40 antibody is MEDI0562 as described in US 2016/0137740.

In certain embodiments, the antibody which specifically binds to 0X40, or an antigen-binding fragment thereof binds to the same 0X40 epitope as mAb 9B 12. An example of a humanized 0X40 antibody is described by Morris et al., Mol Immunol. May 2007; 44(12): 3112-3121. 9B12 is a murine IgGl, anti-OX40 mAb directed against the extracellular domain of human 0X40 (CD134) (Weinberg, A.D., et al. J Immunother 29, 575-585 (2006)). It was selected from a panel of anti-OX40 monoclonal antibodies because of its ability to elicit an agonist response for 0X40 signaling, stability, and for its high level of production by the hybridoma. For use in clinical applications, 9B12 mAb is equilibrated with phosphate buffered saline, pH 7.0, and its concentration is adjusted to 5.0 mg/ml by diafiltration.

"0X40 ligand" ("OX40L") (also variously termed tumor necrosis factor ligand superfamily member 4, gp34, TAX transcriptionally-activated glycoprotein- 1, and CD252) is found largely on antigen presenting cells (APCs), and can be induced on activated B cells, dendritic cells (DCs), Langerhans cells, plamacytoid DCs, and macrophages (Croft, M., (2010) Ann Rev Immunol 28:57-78). Other cells, including activated T cells, NK cells, mast cells, endothelial cells, and smooth muscle cells can express OX40L in response to inflammatory cytokines (Id.). OX40L specifically binds to the 0X40 receptor. The human protein is described in U.S. Patent 6,156,878. The mouse OX40F is described in U.S. Patent 5,457,035. OX40L is expressed on the surface of cells and includes an intracellular, a transmembrane and an extracellular receptor-binding domain. A functionally active soluble form of OX40T can be produced by deleting the intracellular and transmembrane domains as described, e.g., in U.S. Pat. Nos. 5,457,035; 6,312,700; 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098, 184; and 7,125,670, the disclosures of which are incorporated herein for all purposes. A fimctionally active form of OX40L is a form that retains the capacity to bind specifically to 0X40, that is, that possesses an 0X40 "receptor binding domain." An example is amino acids 51 to 183 of human OX40L. Methods of determining the ability of an OX40L molecule or derivative to bind specifically to 0X40 are discussed below. Methods of making and using OX40L and its derivatives (such as derivatives that include an 0X40 binding domain) are described in U.S. Pat. Nos. 6,156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670, which also describe proteins comprising the soluble form of OX40L linked to other peptides, such as human immunoglobulin ("Ig") Fc regions, that can be produced to facilitate purification of 0X40 ligand from cultured cells, or to enhance the stability of the molecule after in vivo administration to a mammal (see also, U.S. Pat. Nos. 5,457,035 and 7,959,925, both of which are incorporated by reference herein in their entireties).

Also included within the definition of OX40L are 0X40 ligand variants which vary in amino acid sequence from naturally occurring 0X40 ligand molecules but which retain the ability to specifically bind to an 0X40 receptor. Such variants are described in U.S. Pat. Nos. 5,457,035; 6, 156,878; 6,242,566; 6,528,055; 6,528,623; 7,098,184; and 7,125,670. In a related embodiment, a mutant of OX40L which has lost the ability to specifically bind to 0X40, for example amino acids 51 to 183, in which the phenylalanine at position 180 of the receptor-binding domain of human OX40L has been replaced with alanine (F180A) is used.

0X40 agonists include a fusion protein in which one or more domains of OX40L is covalently linked to one or more additional protein domains. Exemplary OX40L fusion proteins that can be used as 0X40 agonists are described in U S. Pat. No. 6,312,700, the disclosure of which is incorporated herein by reference in its entirety. In one embodiment, an 0X40 agonist includes an OX40L fusion polypeptide that self-assembles into a multimeric (e.g., trimeric or hexameric) OX40L fusion protein. Such fusion proteins are described, e g., in U.S. Patent No. 7,959,925, which is incorporated by reference herein in its entirety. The multimeric OX40L fusion protein exhibits increased efficacy in enhancing antigen specific immune response in a subject, particularly a human subject, due to its ability to spontaneously assemble into highly stable trimers and hexamers.

In another embodiment, an 0X40 agonist capable of assembling into a multimeric form includes a fusion polypeptide comprising in an N-termmal to C-terminal direction: an immunoglobulin domain, wherein the immunoglobulin domain includes an Fc domain, a trimerization domain, wherein the trimerization domain includes a coiled coil trimerization domain, and a receptor binding domain, wherein the receptor binding domain is an 0X40 receptor binding domain, e.g., an OX40L or an OX40-binding fragment, variant, or derivative thereof, where the fusion polypeptide can self-assemble into a trimeric fusion protein. In one aspect, an 0X40 agonist capable of assembling into a multimeric form is capable of binding to the 0X40 receptor and stimulating at least one 0X40 mediated activity. In certain aspects, the 0X40 agonist includes an extracellular domain of 0X40 ligand.

The trimerization domain of an 0X40 agonist capable of assembling into a multimeric form serves to promote self-assembly of individual OX40L fusion polypeptide molecules into a trimeric protein. Thus, an OX40L fusion polypeptide with a trimerization domain self-assembles into a tnmenc OX40L fusion protein. In one aspect, the trimerization domain is an isoleucine zipper domain or other coiled coli polypeptide structure. Exemplary coiled coil trimerization domains include: TRAF2 (GENBANK® Accession No. Q 12933, amino acids 299-348; Thrombospondin 1 (Accession No. P07996, amino acids 291-314; Matrilin-4 (Accession No. 095460, ammo acids 594-618; CMP (matrilm-1) (Accession No. NP 002370, ammo acids 463-496; HSF1 (Accession No. AAX42211, amino acids 165-191; and Cubilin (Accession No. NP— 001072 , amino acids 104-138. In certain specific aspects, the trimerization domain includes a TRAF2 trimerization domain, a Matrilin-4 trimerization domain, or a combination thereof.

OX40L FP is a human 0X40 ligand IgG4P fusion protein that specifically binds to, and triggers signaling by, the human 0X40 receptor, a member of the TNFR superfamily. OX40L FP is also disclosed in US2016/0024176, incorporated herein by reference in its entirety. OX40L FP is composed of three distinct domains: (1) human 0X40 ligand extracellular receptor binding domains (RBDs) that form homotrimers and bind the 0X40 receptor; (2) isoleucine zipper trimerization domains derived from TNFR-associated factor 2 that stabilize the homotrimenc structure of the 0X40 ligand RBDs; and (3) human IgG4 fragment crystallizable gamma (Fey) domains that facilitate Fey receptor clustering of the fusion protein when bound to 0X40 receptors, and contain a serine to proline substitution at position 228 (according to EU numbering) in the hinge regions (IgG4P) to promote stability of two sets of 0X40 ligand RBD homotrimers. The IgG4P Fc domain is fused directly to an isoleucine zipper trimenzation domain derived from amino acid residues 310-349 of human tumor necrosis factor 2 (TRAF2). Fused to the c-terminus of the TRAF2 domain are amino acid residues 51- 183 of the extracellular receptor binding domain (RBD) of human OX40L (gene name TNFSF4). The TRAF2 domain stabilizes the homotrimeric structure of OX40L RBDs to enable 0X40 binding and activation, while the IgG4P Fc domain confers serum stability, dimerization of OX40L trimers, and facilitates Fey receptor clustering of the hexameric fusion protein. One OX40L FP variant possesses a phenylalanine (F) to alanine (A) mutation at the ammo acid corresponding to position 180 in OX40L. Another OX40L FP variant has the IgG4P Fc domain replaced with a human IgGl Fc domain. In particular embodiments, the 0X40 agonist for use in the present disclosure is one of the OX40L FP variants.

In particular embodiments, the 0X40 agonist for use in the present disclosure has been modified to increase its serum half-life. For example, the serum half-life of an 0X40 agonist can be increased by conjugation to a heterologous molecule such as serum albumin, an antibody Fc region, or PEG. In certain embodiments, 0X40 agonists can be conjugated to other therapeutic agents or toxins to form immunoconjugates and/or fusion proteins. In certain embodiments, the 0X40 agonist can be formulated so as to facilitate administration and promote stability of the active agent.

Antibody Derivatives

Antibodies for use in the present disclosure (e.g., anti-CTLA-4, anti-PD-Ll, anti-PD-1, anti-OX40) may include variants of these sequences that retain the ability to specifically bind their targets. Such variants may be derived from the sequence of these antibodies by a skilled artisan using techniques well known in the art. For example, amino acid substitutions, deletions, or additions, can be made in the FRs and/or in the CDRs. While changes in the FRs are usually designed to improve stability and immunogenicity of the antibody, changes in the CDRs are typically designed to increase affinity of the antibody for its target. Variants of FRs also include naturally occurnng immunoglobulin allotypes. Such affinity-increasing changes may be determined empirically by routine techniques that involve altering the CDR and testing the affinity antibody for its target. For example, conservative ammo acid substitutions can be made within any one of the disclosed CDRs. Various alterations can be made according to the methods described in Antibody Engineering, 2nd ed., Oxford University Press, ed. Borrebaeck, 1995. These include but are not limited to nucleotide sequences that are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a“silent” change. For example, the nonpolar amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine, and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

Derivatives and analogs of antibodies of the present disclosure can be produced by various techniques well known in the art, including recombinant and synthetic methods (Mamatis (1990) Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., and Bodansky et al. (1995) The Practice of Peptide Synthesis, 2nd ed., Spring Verlag, Berlin, Germany). Analogous shuffling or combinatorial techniques are also disclosed by Stemmer (Nature (1994) 370: 389-391), who describes the technique in relation to a b-lactamase gene but observes that the approach may be used for the generation of antibodies.

One may generate novel VH or VL regions carrying one or more sequences derived from the sequences disclosed herein using random mutagenesis of one or more selected VH and/or VL genes. One such technique, error-prone PCR, is described by Gram et al. (Proc. Nat. Acad. Sci. U.S.A. (1992) 89: 3576-3580).

Another method that may be used is to direct mutagenesis to CDRs of VH or VL genes. Such techniques are disclosed by Barbas et al. (Proc. Nat. Acad. Sci. U.S.A. (1994) 91: 3809-3813) and Schier et al. (J. Mol. Biol. (1996) 263: 551-567).

Similarly, one or more, or all three CDRs may be grafted into a repertoire of VH or VL domains, which are then screened for an antigen-binding fragment specific for CTLA-4 or PD-L1.

A portion of an immunoglobulin variable domain will comprise at least one of the CDRs substantially as set out herein and, optionally, intervening framework regions from the scFv fragments as set out herein. The portion may include at least about 50% of either or both of FR1 and FR4, the 50% being the C-terminal 50% of FR1 and the N-terminal 50% of FR4. Additional residues at the N-terminal or C-terminal end of the substantial part of the variable domain may be those not normally associated with naturally occurring variable domain regions. For example, construction of antibodies by recombinant DNA techniques may result in the introduction of N- or C-terminal residues encoded by linkers introduced to facilitate cloning or other manipulation steps. Other manipulation steps include the introduction of linkers to join variable domains to further protein sequences including immunoglobulin heavy chain constant regions, other variable domains (for example, in the production of diabodies), or proteinaceous labels as discussed in further detail below.

A skilled artisan will recognize that antibodies for use in the present disclosure may comprise antigenbinding fragments containing only a single CDR from either VL or VH domain. Either one of the single chain specific binding domains can be used to screen for complementary domains capable of forming a two-domain specific antigen-binding fragment capable of, for example, binding to CTLA-4 and PD-L1.

Antibodies for use in the present disclosure described herein can be linked to another functional molecule, e.g., another peptide or protein (albumin, another antibody, etc.). For example, the antibodies can be linked by chemical cross-linking or by recombinant methods. The antibodies may also be linked to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; or 4, 179,337. The antibodies can be chemically modified by covalent conjugation to a polymer, for example, to increase their circulating half-life. Exemplary polymers and methods to attach them are also shown in U S. Pat. Nos. 4,766,106; 4,179,337; 4,495,285, and 4,609,546.

The antibodies may also be altered to have a glycosylation pattern that differs from the native pattern. For example, one or more carbohydrate moieties can be deleted and/or one or more glycosylation sites added to the original antibody. Addition of glycosylation sites to the presently disclosed antibodies may be accomplished by altering the amino acid sequence to contain glycosylation site consensus sequences known in the art. Another means of increasing the number of carbohydrate moieties on the antibodies is by chemical or enzymatic coupling of glycosides to the amino acid residues of the antibody. Such methods are described in WO 87/05330, and in Aplin et al. (1981) CRC Crit. Rev. Biochem., 22: 259-306. Removal of any carbohydrate moieties from the antibodies may be accomplished chemically or enzymatically, for example, as described by Hakimuddin et al. (1987) Arch. Biochem. Biophys., 259: 52; and Edge et al. (1981) Anal. Biochem., 118: 131 and by Thotakuraet al. (1987) Meth. Enzymol., 138: 350. The antibodies may also be tagged with a detectable, or functional, label. Detectable labels include radiolabels such as 1311 or 99Tc, which may also be attached to antibodies using conventional chemistry. Detectable labels also include enzyme labels such as horseradish peroxidase or alkaline phosphatase Detectable labels further include chemical moieties such as biotin, which may be detected via binding to a specific cognate detectable moiety, e.g., labeled avidin.

Antibodies, in which CDR sequences differ only insubstantially from those set forth herein are encompassed within the scope of this present disclosure. Typically, an amino acid is substituted by a related amino acid having similar charge, hydrophobic, or stereochemical characteristics Such substitutions would be within the ordinary skills of an artisan. Unlike in CDRs, more substantial changes can be made in FRs without adversely affecting the binding properties of an antibody. Changes to FRs include, but are not limited to, humanizing a non-human derived or engineering certain framework residues that are important for antigen contact or for stabilizing the binding site, e g ., changing the class or subclass of the constant region, changing specific amino acid residues which might alter the effector function such as Fc receptor binding, e.g., as described in U.S. Pat. Nos. 5,624,821 and 5,648,260 and Lund et al. (1991) J. Immun. 147: 2657-2662 and Morgan et al. (1995) Immunology 86: 319-324, or changing the species from which the constant region is derived.

One of skill in the art will appreciate that the modifications described above are not all-exhaustive, and that many other modifications would be obvious to a skilled artisan in light of the teachings of the present disclosure.

Certain Compounds

In certain embodiments, compounds described herein can be antisense compounds. In certain embodiments, the antisense compound comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, a compound or antisense compound is single-stranded. Such a single- stranded compound or antisense compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.

In certain embodiments, compounds are double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary' to a target nucleic acid and a second modified oligonucleotide having a region complementary' to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, compound comprises a conjugate group. In certain embodiments, one of the modified oligonucleotides is conjugated. In certain embodiments, both the modified oligonucleotides are conjugated. In certain embodiments, the first modified oligonucleotide is conjugated. In certain embodiments, the second modified oligonucleotide is conjugated. In certain embodiments, the first modified oligonucleotide consists of 12-30 linked nucleosides and the second modified oligonucleotide consists of 12-30 linked nucleosides. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 36-2646 or 2664-2813. In certain embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 2-10.

In certain embodiments, antisense compounds are double-stranded. Such double -stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double stranded antisense compounds typically composes or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such double -stranded antisense compound may be modified or unmodified. Either or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group. The oligomeric compounds of double -stranded antisense compounds may include non-complementary overhanging nucleosides.

Examples of single-stranded and double-stranded compounds include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics. In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 10 to 30 linked subunits. In certain embodiments, a compound described herein composes an oligonucleotide consisting of 12 to 30 linked subunits. In certain embodiments, a eompound described herein comprises an oligonucleotide consisting of 12 to 22 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 14 to 30 linked subunits. In certain embodiments, compound described herein comprises an oligonucleotide consisting of 14 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 15 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 15 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 17 to 20 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 30 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 21 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 18 to 20 linked subunits. In certain embodiments, a compound described herein composes an oligonucleotide consisting of 20 to 30 linked subunits. In other words, such oligonucleotides consist of 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 14 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 16 linked subunits. In certain embodiments, a compound described herein composes an oligonucleotide consisting of 17 linked subunits. In certain embodiments, compound described herein comprises an oligonucleotide consisting of 18 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 19 linked subunits. In certain embodiments, a compound described herein comprises an oligonucleotide consisting of 20 linked subunits. In other embodiments, a compound described herein comprises an oligonucleotide consisting of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to

24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,

47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits, or a range defined by any two of the above values. In some embodiments the linked subunits are nucleotides, nucleosides, ornucleobases.

In certain embodiments, the compound may further comprise additional features or elements, such as a conjugate group, that are attached to the oligonucleotide. In certain embodiments, such compounds are antisense compounds. In certain embodiments, such compounds are oligomeric compounds. In embodiments where a conjugate group comprises a nucleoside (i.e. a nucleoside that links the conjugate group to the oligonucleotide), the nucleoside of the conjugate group is not counted in the length of the oligonucleotide.

In certain embodiments, compounds may be shortened or truncated. For example, a single subunit may be deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation). A shortened or truncated compound targeted to an MALAT1 nucleic acid may have two subunits deleted from the 5’ end, or alternatively may have two subunits deleted from the 3’ end, of the compound. Alternatively, the deleted nucleosides may be dispersed throughout the compound.

When a single additional subunit is present m a lengthened compound, the additional subunit may be located at the 5’ or 3’ end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound having two subunits added to the 5’ end (5’ addition), or alternatively to the 3’ end (3’ addition), of the compound. Alternatively, the added subunits may be dispersed throughout the compound.

It is possible to increase or decrease the length of a compound, such as an oligonucleotide, and/or introduce mismatch bases without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305- 7309; Gautschi et al. J. Natl. Cancer Inst. March 2001, 93:463-471; Maher and Dolnick Nuc. Acid. Res. 1998, 16:3341-3358). However, seemingly small changes in oligonucleotide sequence, chemistry and motif can make large differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli et al. J. Am. Chem. Soc. 2011, 133, 16642).

In certain embodiments, compounds described herein are interfering RNA compounds (RNAi), which include double -stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double- stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post- transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term“RNAi” is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.

In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to MALAT1 described herein. In certain embodiments, the compound can be double- stranded. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16. 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 2-10 or 36-2813 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813 and a second strand In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on MALAT1 to which any of SEQ ID NOs: 2-10 or 36-2813 is targeted, and (ii) a second strand. In certain embodiments, the compound comprises a first strand comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 2-10 and a second strand. In certain embodiments, the compound comprises a first strand comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10 and a second strand. In certain embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to the site on MALAT1 to which any of SEQ ID NOs: 2-10 is targeted, and (ii) a second strand. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe). In certain embodiments, the compound comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification. In certain embodiments, the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U S. Pat. No. 6,673,661. In other embodiments, the compound contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000.

In certain embodiments, the first strand of the compound is an siRNA guide strand and the second strand of the compound is an siRNA passenger strand. In certain embodiments, the second strand of the compound is complementary to the first strand In certain embodiments, each strand of the compound consisting of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the first or second strand of the compound can comprise a conjugate group.

In certain embodiments, a compound descnbed herein can comprise any of the oligonucleotide sequences targeted to MALAT1 described herein. In certain embodiments, the compound is single stranded. In certain embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 2- 10 or 36-2813. In certain embodiments, the compound comprises a nucleobase sequence complementary' to the site on MALAT1 to which any of SEQ ID NOs: 2-10 or 36-2813 is targeted. In certain embodiments, the compound comprises at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobase portion of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises the nucleobase sequence of any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises ribonucleotides in which uracil (U) is in place of thymine (T) in any one of SEQ ID NOs: 2-10. In certain embodiments, the compound comprises a nucleobase sequence complementary to the site on MALAT1 to which any of SEQ ID NOs: 2- 10 is targeted. In certain embodiments, the compound comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe). In certain embodiments, the compound comprises at least one 2’-F sugar modification and at least one 2 -OMe sugar modification. In certain embodiments, the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the compound. In certain embodiments, the compound comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the compound contains a capped strand, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In certain embodiments, the compound can comprise a conjugate group.

In certain embodiments, compounds descnbed herein comprise modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or b such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the modified oligonucleotides provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the ' H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: ²H or ³H in place of ¾ ¹³C or ¹⁴C in place of ¹²C, ^1SN in place of ¹⁴N, ¹⁷0 or ¹⁸0 in place of ¹⁶0, and ³³S, ³⁴S, ³⁵S, or ³⁶S in place of ²S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes, such as an imaging assay.

Certain Mechanisms

In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently“DNA- like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change m an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal. Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.

Nucleotide sequences that encode MALAT1 include, without limitation, the following: RefSEQ No. XR 001309.1 (SEQ ID NO: 1), which is incorporated by reference in its entirety.

Hybridization

In some embodiments, hybridization occurs between a compound disclosed herein and a MALAT1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with a MALAT1 nucleic acid.

Complementarity

An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. An oligonucleotide is fully complementar or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches. In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein are antisense compounds. In certain embodiments, compounds comprise oligomeric compounds. Non-complementary nucleobases between a compound and a MALAT1 nucleic acid may be tolerated provided that the compound remains able to specifically hybndize to a target nucleic acid. Moreover, a compound may hybridize over one or more segments of a MALAT1 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the compounds provided herein, or a specified portion thereof, are, are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a MALAT1 nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the compounds provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a MALAT1 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of a compound with a target nucleic acid can be determined using routine methods.

For example, a compound in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a compound which consisting of 18 nucleobases having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl Math., 1981, 2, 482 489).

In certain embodiments, compounds described herein, or specified portions thereof, are fully complementary (i.e 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a compound may be fully complementary to a MALAT1 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein,“fully complementary” means each nucleobase of a compound is complementary to the corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase compound can be“fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary' to the target sequence.

In certain embodiments, compounds described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity' against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3’-end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3’-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.

The location of a non-complementary nucleobase may be at the 5’ end or 3’ end of the compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the compound. When two or more non-complementary' nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a MALAT1 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a MALAT1 nucleic acid, or specified portion thereof.

In certain embodiments, compounds described herein also include those which are complementary to a portion of a target nucleic acid. As used herein,“portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A“portion” can also refer to a defined number of contiguous nucleobases of a compound. In certain embodiments, the— compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the compounds are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof. In certain embodiments, compounds described herein are antisense compounds or oligomeric compounds. In certain embodiments, compounds described herein are modified oligonucleotides. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, compounds described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the compounds or SEQ ID NOs, or a portion thereof, disclosed herein. In certain embodiments, compounds desenbed herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof, in which the compounds comprise an oligonucleotide having one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.

In certain embodiments, compounds described herein comprise or consist of antisense compounds. In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, compounds described herein comprise or consist of oligonucleotides. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Certain Modified Compounds

In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage).

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.

1. Modified Sugar Moieties

In certain embodiments, sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2’, 4’, and/or 5’ positions. In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-0O¾ (“OMe” or“O-methyl”), and I'-O/CFFbOCFF (^"MOF^") . In certain embodiments, 2’ -substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cio alkoxy, O-Ci-Cio substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(R_m)-alkyl, O-alkenyl, S-alkenyl, N(R_m)-alkenyl, O-alkynyl, S-alkynyl, N(R_m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaiyl, aralkyl, O-alkaryl, O-aralkyl, 0(CH2)2SCH3,0(CH2)20N(Rm)(Rn) or OCH2C(=0)-N(R_m)(Rn), where each R_m and R_n is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2’-substituent groups described in Cook et al., U.S. 6,531,584; Cook et al, U.S. 5,859,221; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4’- substituent groups suitable for linearly non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5’- substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5’-methyl (R or S), 5'-vinyl, and 5’-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et ah, US2010/190837 and Rajeev et ah, US2013/0203836.

In certain embodiments, a 2’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2’-substituent group selected from: F, NEE, ¾ OCF3_, OCEE, 0(CH₂)₃NH₂, CH2CHCH2, OCH₂CH=CH₂, OCH2CH2OCH3, 0(CH₂)₂SCH3, 0(CH₂)₂0N(R_m)(R„), 0(CH2)₂0(CH₂)2N(CH3)2, and N-substituted acetamide (OCH₂C(=0)-N(R_m)(Rn)), where each R_m and R_n is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2’-substituent group selected from: F, OCF3. OCH3, OCH2CH2OCH3, 0(CH₂)₂SCH₃, 0(CH₂)₂0N(CH₃)₂, 0(CH₂)₂0(CH₂)₂N(CH₃)₂, and 0CH₂C(=0)-N(H)CH₃ (“NMA”).

In certain embodiments, a 2’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2’-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2’-substituted or 2-modified sugarmoieties are referred to as 2’-substituted nucleosides or 2-modified nucleosides.

Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second nng resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH₂-2', 4'-(CH₂)₂-2', 4'-(CH₂)₃-2', 4^,-CH₂-0-2^l (“LNA”), 4'-CH₂-S-2', 4'-(CH₂)₂-0-2' (“ENA”), 4'-CH(CH₃)-0-2' (referred to as“constrained ethyl” or“cEt” when in the S configuration), 4’-CH₂- O-CH2-2’, 4’-CH₂-N(R)-2’, 4'-CH(CH₂0CH₃)-0-2' (“constrained MOE” or“cMOE”) and analogs thereof (see, e.g., Seth et ah, U.S. 7,399,845, Bhat et ah, U.S. 7,569,686, Swayze et ah, U.S. 7,741,457, and Swayze et ah, U.S. 8,022,193), 4'-C(CH₃)(CH₃)-0-2' and analogs thereof (see, e.g., Seth et ah, U.S. 8,278,283), 4'-CH₂- N(0O¾)-2' and analogs thereof (see, e.g., Prakash et ah, U.S. 8,278,425), 4'-CH₂-0-N(CH₃)-2' (see, e.g., Allerson et ah, U.S. 7,696,345 and Allerson et ah, U.S. 8,124,745), 4^,-CH₂-C(H)(CH₃)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH₂-C(=CH₂)-2' and analogs thereof (see e.g.,, Seth et ah, U.S. 8,278,426), 4’-C(R_aR_b)-N(R)-0-2’, 4’-C(R_aR,)-0-N(R)-2’, 4'-CH₂-0-N(R)-2', and 4'-CH₂-N(R)-0-2', wherein each R, R_a, and R_b is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et ah, U.S. 7,427,672). In certain embodiments, such 4’ to T bndges independently comprise from 1 to 4 linked groups independently selected from: -[C(R_a)(R_¾)]_n-, -[C(R_a)(R_b)]_n-0-, -C(R_a)=C(R_t,)-, -C(R_a)=N-, -C(=NR_a)-, -C(=0)- , -C(=S)-, -0-, -Si(R_a)₂-, -S(=0)_x-, and -N(R,)-;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each ¾ and R_¾ is, independently, H, a protecting group, hydroxyl, C₁-C₁₂ alkyl, substituted C₁-C₁₂ alkyl, C₂-C₁₂ alkenyl, substituted C₂-Ci₂ alkenyl, C₂-C₁₂ alkynyl, substituted C₂-Ci₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl. heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ₁J₂, SJi, N3, COOJi, acyl (C(=0)- H), substituted acyl, CN, sulfonyl (S(=0)₂-Ji), or sulfoxyl (S(=0)-Ji); and each Ji and J₂ is, independently, H, C₁-C₁₂ alkyl, substituted C₁-C₁₂ alkyl, C₂-Ci₂ alkenyl, substituted C₂-C₁₂ alkenyl, C₂-Ci₂ alkynyl, substituted C₂-C₁₂ alkynyl, C₅-C₂₀ aryl, substituted C₅-C₂₀ aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C₁-C₁₂ aminoalkyl, substituted C₁-C₁₂ aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier el al, Nucleic Acids Research , 1997, 25(22), 4429-4443, Albaek et al, J Org. Chem , 2006, 77 , 7731-7740, Singh et al., Chem. Commun ., 1998, 7, 455-456; Koshkin et al., Tetrahedron , 1998, 57, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8 , 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Elayadi et al, Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al, Chem. Biol , 2001, 8, 1-7; Orum et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al.,U.S. 7,053,207, Imanishi et al., U.S. 6,268,490, Imanishi et al. U.S. 6,770,748, Imanishi et al, U.S. RE44,779; Wengel et al, U.S. 6,794,499, Wengel et al, U.S. 6,670,461; Wengel et al, U.S. 7,034,133, Wengel et al, U.S. 8,080,644; Wengel et al, U.S. 8,034,909; Wengel et al, U.S. 8,153,365; Wengel et al, U.S. 7,572,582; and Ramasamy et al, U.S. 6,525,191, Torsten et al, WO 2004/106356, Wengel et al, WO 1999/014226; Seth et al,WO 2007/134181; Seth et al, U.S. 7,547,684; Seth et al, U.S. 7,666,854; Seth et al, U.S. 8,088,746; Seth et al, U.S. 7,750, 131; Seth et al, U.S. 8,030,467; Seth et al, U.S. 8,268,980; Seth et al, U.S. 8,546,556; Seth et al, U.S. 8,530,640; Migawa et al, U.S. 9,012,421; Seth et al, U.S. 8,501,805; Allerson et al, US2008/0039618; and Migawa et al, US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the a-L configuration or the b-D configuration.

LNA (b-D-configuration) a-L-LNA (a-L-con figuration)

bridge = 4'-CH₂-0-2' bridge = 4'-CH₂-0-2'

a-L-methyleneoxy (4’-CH₂-0-2’) or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al , Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the b-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5’-substituted and 4’-2’ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g , with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.

In certain embodiments, sugar surrogates compnse rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate compnses a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Leumann, CJ . Bioorg. &Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g., Swayze et al., U.S. 8,088,904; Swayze et al, U S. 8,440,803; and Swayze et al., U.S.

9,005,906, F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety;

T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T₄ is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-termmal group; qi, q2, q3, q₄, qs, qr. and q7 are each, independently, H, Ci-Ce alkyl, substituted Ci-Ce alkyl, C2-C6 alkenyl, substituted CVG, alkenyl, C2-C alkynyl, or substituted C2-C6 alkynyl; and each of R_L and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJIJ₂, SJi, N₃, OC(=X)Ji, OC(=X)N J J₂. \T,C(=X)NJ_|J₂. and CN, wherein X is 0, S or NJi, and each Ji, J₂, and J_{3 i}s, independently, H or CrCr, alkyl.

In certain embodiments, modified THP nucleosides are provided wherein qi, q₂, q3, q₄, qs, qi and q7 are each H. In certain embodiments, at least one of qi, q2, q₃, q₄, qs, qe and q₇ is other than H. In certain embodiments, at least one of qi, q2, q₃, q₄. qs, q₆ and q_? is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R₂ is H, and in certain embodiments, Ri is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et ah, U.S. 5,698,685; Summerton et ah, U.S. 5,166,315; Summerton et ah, U.S. 5, 185,444; and Summerton et ah, U.S. 5,034,506). As used here, the term“morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as“modifed morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013/130378.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

2. Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.

In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

In certain embodiments, modified nucleobases are selected from: 5 -substituted pyrimidines, 6- azapy rim i^odines alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine,

5 -hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine,

6-N-methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (OC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymme, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N- benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N- benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size- expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et ah, U.S. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et ah, Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B , Eds , CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403, Manoharan et ah, US2003/0175906; Dinh et ah, U.S. 4,845,205; Spielvogel et ah, U.S. 5,130,302; Rogers et ah, U.S. 5,134,066; Bischofberger et ah, U.S. 5, 175,273; Urdea et ah, U.S. 5,367,066; Benner et ah, U.S. 5,432,272; Matteucci et ah, U.S. 5,434,257; Gmemer et ah, U.S. 5,457,187; Cook et ah, U.S. 5,459,255; Froehler et ah, U.S. 5,484,908; Matteucci et ah, U.S. 5,502, 177; Hawkins et ah, U.S. 5,525,711; Haralambidis et ah, U.S. 5,552,540; Cook et ah, U.S. 5,587,469; Froehler et ah, U.S. 5,594,121; Switzer et ah, U.S. 5,596,091; Cook et ah, U.S. 5,614,617; Froehler et ah, U.S. 5,645,985; Cook et ah, U.S. 5,681,941; Cook et ah, U.S. 5,811,534; Cook et ah, U.S. 5,750,692; Cook et ah, U.S. 5,948,903; Cook et ah, U.S. 5,587,470; Cook et ah, U.S. 5,457,191; Matteucci et ah, U.S. 5,763,588; Froehler et ah, U.S. 5,830,653; Cook et ah, U.S. 5,808,027; Cook et ah, U.S. 6, 166,199; and Matteucci et ah, U.S. 6,005,096.

In certain embodiments, compounds targeted to a MALAT1 nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosme.

3. Modified Internucleoside Linkages

The naturally occuring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkageln certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over compounds having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (,Vp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (/Zp) configuration. In certain embodiments, modified oligonucleotides comprising l/Zp) and/or (L^'r) phosphorothioates comprise one or more of the following formulas, respectively, wherein“B” indicates a nucleobase:

Unless otherwise indicated chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

In certain embodiments, compounds targeted to an MALAT1 nucleic acid comprise one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of an antisense compound is a phosphorothioate intemucleoside linkage.

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphoms atom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous- containing and non-phosphorous-containing linkages are well known.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage. The two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphoms atom. Representative phosphorus-containing intemucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=0”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P=S”). and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing intemucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(CH3)-0-CH2-), thiodiester, thionocarbamate (-0-C( 0)(NH)-S ): siloxane (-0-SiH2-0-); and N,N'-dimethylhydrazine (-CH2- N(CH3)-N(CH3)-). Modified intemucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral intemucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.

Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-0-5'), amide-3 (3'-CH2-C(=0)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=0)-5'), formacetal (3'-0-CH2-0-5'), methoxypropyl, and thioformacetal (3'-S-CH2-0-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

In certain embodiments, oligonucleotides comprise modified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified intemucleoside linkage motif. In certain embodiments, intemucleoside linkages are arranged in a gapped motif In such embodiments, the intemucleoside linkages in each of two wing regions are different from the intemucleoside linkages in the gap region. In certain embodiments the intemucleoside linkages in the wings are phosphodiester and the intemucleoside linkages the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped intemucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.

In certain embodiments, oligonucleotides comprise a region having an alternating intemucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified intemucleoside linkages. In certain such embodiments, the oligonucleotide composes a region that is uniformly linked by phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each intemucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one intemucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate intemucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate intemucleoside linkages. In certain such embodiments, at least one such block is located at the 3’ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3’ end of the oligonucleotide.

In certain embodiments, oligonucleotides comprise one or more methylphosponate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.

In certain embodiments, it is desirable to arrange the number of phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate intemucleoside linkages and the number and position of phosphodiester intemucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate intemucleoside linkages may be decreased and the number of phosphodiester intemucleoside linkages may be increased while still maintaining nuclease resistance In certain embodiments it is desirable to decrease the number of phosphorothioate intemucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester intemucleoside linkages while retaining nuclease resistance.

Certain Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages. In certain embodiments, modified oligonucleotides compose one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). a. Certain Sugar Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or“wings” and a central or internal region or“gap.” The three regions of a gapmer motif (the 5’-wing, the gap, and the 3’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3’-most nucleoside of the 5’-wing and the 5’-most nucleoside of the 3’-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5 '-wing differs from the sugar motif of the 3 '-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2’-deoxy nucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2’-deoxy nucleosides and the nucleosides on the wing sides of each wmg/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2’-deoxy nucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2’- modification.

In certain embodiments, a modified oligonucleotide can comprise a sugar motif described in Swayze et al., US2010/0197762; Freier et al, US2014/0107330; Freier et al, US2015/0184153; and Seth et al, US2015/0267195, each of which is incorporated by reference in its entirety herein.

Certain embodiments provided herein are directed to modified oligomeric compounds useful for inhibiting target nucleic acid expression, which can be useful for treating, preventing, ameliorating, or slowing progression of a disease associated with such a target nucleic acid. In certain embodiments, the modified oligomeric compounds comprise antisense oligonucleotides that are gapmers having certain sugar motifs. In certain embodiments, the gapmer sugar motifs provided herein can be combined with any nucleobase sequence and any intemucleoside linkage motif to form potent antisense oligonucleotides.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: ekk-d9-kkee, wherein ^£d’ represents a 2’-deoxyribose sugar, ^£k’ represents a cEt nucleoside, and V represents a 2’-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject’s cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: k-d9-kekeke, wherein ^£d’ represents a 2’-deoxyribose sugar, ^£k’ represents a cEt nucleoside, and ^£e’ represents a 2’-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject’s cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d8-kekek, wherein ^£d’ represents a 2’-deoxyribose sugar, ^£k’ represents a cEt nucleoside, and ^£e’ represents a 2’-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject’s cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kkk-d9-keke, wherein ^£d’ represents a 2’-deoxynbose sugar, ^£k’ represents a cEt nucleoside, and ^£e’ represents a 2’-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject’s cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-kdkdk, wherein ^£d’ represents a 2’-deoxyribose sugar, ^£k’ represents a cEt nucleoside, and ^£e’ represents a 2’-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject’s cancer. In certain embodiments, a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, wherein‘d’ represents a 2’-deoxyribose sugar,‘k’ represents a cEt nucleoside, and‘e’ represents a 2’-MOE nucleoside. In certain embodiments, a method comprises contacting a cell or administering to a subject a compound compnsing a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-eeekk, wherein‘d’ represents a 2 -deoxyribosc sugar,‘k’ represents a cEt nucleoside, and‘e’ represents a 2’-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject’s cancer.

In certain embodiments, a method comprises contacting a cell or administering to a subject a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having the motif: kk-d9-ekeke, wherein‘d’ represents a 2’-deoxynbose sugar,‘k’ represents a cEt nucleoside, and‘e’ represents a 2’-MOE nucleoside. In certain embodiments, the cell is a cancer cell. In certain embodiments, the subject has cancer. In certain embodiments, administering the compound to the subject treats the subject’s cancer.

b. Certain Nucleobase Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2- thiopyrimidine and a 5-propynepyrimidine.

c. Certain Internucleoside Linkage Motifs

In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments essentially each intemucleoside linking group is a phosphate intemucleoside linkage (P=0). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate intemucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the intemucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal intemucleoside linkages are modified.

4. Certain Modified Oligonucleotides

In certain embodiments, compounds described herein compnse modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, intemucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif. Likewise, such gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent with respect to one or more parameter, such parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, intemucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of nucleobase sequence. Certain Conjugated Compounds

In certain embodiments, the compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’ -end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a compound has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, oligonucleotides are complementary to a sense transcript.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearanceln certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.

Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e ., hexyl-S-tntylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3 , 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e ., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., I I·. BS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993 , 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et ah, Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et ah, Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic, a palmityl moiety (Mishra et ah, Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycliolesterol moiety (Crooke et ah, J. Pharmacol. Exp. Ther., 1996, i, 923-937), a tocopherol group (Nishina et ah, Molecular Therapy Nucleic Acids, 2015, 4, e220; doi: 10.1038/mtna.2014.72 and Nishina et ah, Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (5)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fmgolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain compounds, a conjugate group is a single chemical bond (i.e. conjugate moiety is attached to an oligonucleotide via a conjugate linker through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups . One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted Ci- Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5- methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker- nucleosides are typically linked to one another and to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker- nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, a compound may comprise (1) amodified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker- nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is more than 30. Alternatively an compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate may comprise one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to one another and/or to the remainder of the compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxy nucleoside that is attached to either the 3' or 5 '-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

Compositions and Methods for Formulating Pharmaceutical Compositions

Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compounds compnse or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of cnteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

A compound described herein targeted to MALAT1 nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as stenle water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to MALAT1 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense compounds or oligomeric compounds. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.

In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.

EXAMPLES

Non-limiting disclosure and incorporation by reference

Although the sequence listing accompanying this filing identifies each sequence as either“RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as RNA or“DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2 -OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2 -OH for the natural 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence“ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence“AUCGAUCG” and those having some DNA bases and some RNA bases such as“AUCGATCG” and compounds having other modified nucleobases, such as“AT^mCGAUCG,” wherein ^mC indicates a cytosine base comprising a methyl group at the 5 -position.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same . Each of the references recited the present application is incorporated herein by reference m its entirety. Example 1: Design of gapmers with PS inteniucleoside linkages complementary to human MALAT1 RNA

Modified oligonucleotides complementary to human a MALAT1 nucleic acid were designed. The modified oligonucleotides in the table below are 3-10-3 cET gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of either ten 2’ -deoxynucleosides, or of a combination of one 2'-0-methyl nucleoside and nine 2’ - deoxynucleosides. The central gap segment is flanked by wing segments on the 5’ direction and the 3’ direction comprising three nucleosides each. Each nucleoside in the 5’ wing segment and each nucleoside in the 3’ wing segment has a cEt sugar modification. The intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. Each cytosine residue is a 5-methylcytosine. The sequence and chemical notation column specifies the sequence, including 5- methylcytosines, sugar chemistry, and the intemucleoside linkage chemistry; wherein subscript‘d’ represents a 2'-b-ϋ- deoxyribosyl sugar moiety, subscript‘k’ represents a cET sugar moiety, subscript‘s’ represents to a phosphorothioate intemucleoside linkage, superscript‘m’ before the cytosine residue represents a 5-methylcytosine, and subscript ^£y’ represents a 2'-0-methyl ribose sugar.“Start site” indicates the 5’-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.“Stop site” indicates the 3’-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.

Each modified oligonucleotide listed in the table below is complementary to human MALAT1 nucleic acid sequence SEQ ID NO: 1 (GENBANK Accession No: XR_001309.1).

Table 1

cET gapmers with PS intemucleoside linkages complementary to human MALAT1

Example 2: Antisense inhibition of human MALAT1 in A-431 cells by modified oligonucleotides

The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in a single table shown below. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with 5 nM of modified oligonucleotide After a treatment period of approximately 48 hours, RNA was isolated from the cells and MALAT1 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS2736 (forward sequence AAAGCAAGGTCTCCCCACAAG, designated herein as SEQ ID NO.: 2814; reverse sequence TGAAGGGTCTGTGCTAGATCAAAA, designated herein as SEQ ID NO.: 2815; probe sequence TGCCACATCGCCACCCCGT, designated herein as SEQ ID NO.: 2816) was used to measure RNA levels. MALAT1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of MALAT1 RNA relative to untreated control cells (%UTC).

Table 2

Inhibition of MALATl RNA by 3-10-3 cEt gapmers targeting SEQ ID NO.: 1

Example 3: Dose-dependent inhibition of human MALATl in A-431 cells by cEt gapmers

Modified oligonucleotides described in the studies above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, MALATl RNA levels were measured as previously described using the Human MALATl primer-probe set RTS2736. MALATl RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent control of the amount of MALATl RNA relative to untreated control cells (%UTC). IC50s were calculated using a linear regression on a log/linear plot of the data in excel. Table 3

Dose-dependent inhibition of human MALAT1 mRNA expression by modified oligonucleotides in A-431

Example 4: Dose-dependent inhibition of human MALAT1 in MDA-MB-436 cells by cEt gapmers

Modified oligonucleotides described in the studies above were tested at various doses in MDA-MB-436 cells.

Cultured MDA-MB-436 cells at a density of 5,000-12,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, MALAT1 RNA levels were measured as previously described using the Human MALAT1 primer-probe set RTS2736. MALAT1 RNA levels were normalized to b-actin, measured using human primer-probe set HTS5002 (forward sequence CGGACTATGACTTAGTTGCGTTACA, designated herein as SEQ ID NO.: 2817; reverse sequence GCCATGCCAATCTCATCTTGT, designated herein as SEQ ID NO. : 2818; probe sequence

CCTTTCTTGACAAAACCTAACTTGCGCAGA, designated herein as SEQ ID NO.: 2819). Results are presented in the tables below as percent control of the amount of MALAT1 RNA relative to untreated control cells (%UTC). Each table below represents a separate experiment. IC50s for table 4 were calculated using the“log(inhibitor) vs. response - variable slope (4 parameters)” formula using Prism6 software. IC50s for tables 5 and 6 were calculated using the“log(inhibitor) vs. response - variable slope (3 parameters)” formula using Prism7 software.

Table 4

Dose-dependent inhibition of human MALAT1 RNA expression by modified oligonucleotides in MDA-MB-436 cells

Table 5

Table 6

Dose-dependent inhibition of human MALATl RNA expression by modified oligonucleotides in MDA-MB-436 cells

Example 5: Tolerability of modified oligonucleotides targeting human MALATl in CD-I mice

CD-I mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of male CD-I mice at 4-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-I mice was injected with PBS. Mice were euthanized 25 days post start of treatment (24 hours post final administration).

Plasma chemistry markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), and albumin (ALB) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the tables below.

Table 7

Plasma chemistiy markers in CD-I mice

Body and organ weights

Body weights of CD-I mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below.

Table 8

Body and organ weights

Example 6: Tolerability of modified oligonucleotides targeting human MALAT1 in CD-I mice

Treatment

Groups of male CD-I mice at 4-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-I mice was injected with PBS. Mice were euthanized 24 days post start of treatment (24 hours post final administration).

Plasma chemistry markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), hlood urea nitrogen (BUN) and total bilirubin (TBIL), were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the tables below.

Table 9

Plasma chemistiy markers in CD-I mice

Body and organ weights

Table 10

Body and organ weights

Example 7: Tolerability of modified oligonucleotides targeting human MALAT1 in CD-I mice

Treatment

Groups of male CD-I mice at 4-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-I mice was injected with PBS. Mice were euthanized 26 days post start of treatment (24 hours post final administration).

Plasma chemistry markers

To evaluate the effect of modified oligonucleotides on liver function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and total bilirubin (TBIL), were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the tables below.

Table 11

Plasma chemistry markers in CD-I mice

Body and organ weights

Table 12

Body and organ weights

Example 8: Tolerability of modified oligonucleotides targeting human MALAT1 in CD-I mice

Treatment

Groups of male CD-I mice at 4-6 weeks of age (obtained from Charles River) were injected subcutaneously twice a week for four weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of male CD-I mice was injected with PBS. Mice were euthanized 25 days post start of treatment (24 hours following the final administration).

Plasma chemistry markers

Table 13

Plasma chemistry markers in CD-I mice

Body and organ weights

Table 14

Body and organ weights

Example 9: Tolerability of modified oligonucleotides targeting human MALAT1 in CD-I mice

Treatment

Plasma chemistry markers

Table 15

Plasma chemistry markers in CD-I mice

Body and organ weights Body weights of CD-I mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Kidney, spleen, and liver weights were measured at the end of the study and are presented in the table below.

Table 16

Body and organ weights

Example 10: Effect of modified oligonucleotides targeting human MALAT1 in cynomolgus monkeys

Cynomolgus monkeys were treated with certain Ionis modified oligonucleotides selected from studies described in the Examples above. Modified oligonucleotide tolerability was evaluated.

STUDY 1

Treatment

Prior to the study, the monkeys were kept in quarantine during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed 2-4 kg. Seven groups of 4 randomly assigned male cynomolgus monkeys each were injected subcutaneously with Ionis oligonucleotide or saline in a clockwise rotation between four different sites on the back. Following loading doses on days 1, 3, 5 and 7, the monkeys were dosed once per week for 6 weeks (on days 14, 21, 28, 35, and 41) with 35 mg/kg of Ionis oligonucleotide. A control group of 4 cynomolgus monkeys was injected with 0.9% saline in a similar manner and served as the control group.

During the study period, the monkeys were observed at least once daily for signs of illness or distress. Any animal experiencing illness or distress was promptly reported to the veterinarian and Study Director. Any animal in poor health or in a possible monbund condition was identified for further monitoring and possible euthanasia. Scheduled euthanasia of the animals was conducted on day 43 approximately 48 hours after the last dose by exsanguination while under deep anesthesia The protocols described in the Example were approved by the Institutional Animal Care and Use Committee (IACUC).

Body and organ weight measurements

To evaluate the effect of modified oligonucleotides on the overall health of the animals, body and organ weights were measured. Terminal body weight was measured prior to necropsy. Organ weights were measured as well.

Table 17

Body and organ weights (g)

Kidney and Liver function

To evaluate the effect of modified oligonucleotides on hepatic and kidney function, blood samples were collected from all the study groups on day 43. The monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain serum. Levels of various liver function markers were measured using a Toshiba 120FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of blood urea nitrogen (BUN), creatinine (CREA), total protein (TP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured.

Table 18

Liver function markers in cynomolgus monkey plasma

Pro-inflammatory proteins analysis

To evaluate any inflammatory effect of modified oligonucleotides in cynomolgus monkeys, blood samples were taken for analysis. The monkeys were fasted overnight prior to blood collection. On day 41 (pre-dose and 24hours post dose), approximately 0.8 niL of blood was collected from each animal and put into tubes without anticoagulant for serum separation The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min at room temperature to obtain serum. Complement C3 were measured using a Toshiba 120 FR NEO chemistry analyzer (Toshiba Co., Japan). Another marker of inflammation, C-Reactive Protein (CRP) was tested together with the clinical chemistry parameters tested for liver function above. Table 19

Pro-inflammatory protein analysis in cynomolgus monkeys

Hematology

To evaluate any effect of modified oligonucleotides in cynomolgus monkeys on hematologic parameters, blood samples of approximately 0.5 mL of blood was collected from each of the available study animals on day 43. The samples were collected in tubes containing K₂-EDTA. Samples were analyzed for redblood cell (RBC) count, Hemoglobin (HGB), Hematocrit (HCT), platelet count (PLT), total white blood cell count (WBC), neutrophil counts (NEU), lymphocyte counts (LYM), and monocyte counts (MON) using an ADVIA2120i hematology analyzer (Siemens, USA).

Table 20

Hematological marker analysis in cynomolgus monkeys

Urine Analysis

Food was removed overnight the day before fresh urine collection, but water was supplied. Fresh urine samples for urinalysis and urine chemistry were collected from all animals using a clean cage pan on wet ice (first in the morning) on day 43. Urinalysis/Urine Chemistry parameters creatinine (UCRE), microprotein (UTP), urine microalbumin (UALB), and protein/creatinine (P/C) ratio were measured using a Toshiba 120FR automated chemistry analyzer (Toshiba Co., Japan).

Table 21

Urine analysis in cynomolgus monkeys

STUDY 2

Treatment

Prior to the study, the monkeys were kept in quarantine during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed 2-4 kg. Four groups of 4 randomly assigned male cynomolgus monkeys each were injected subcutaneously with Ionis oligonucleotide or saline in a clockwise rotation between four different sites on the back. Following loading doses on days 1, 3, 5 and 7, the monkeys were dosed once per week for 6 weeks (on days 14, 21, 28, 35, and 41) with 35 mg/kg of Ionis oligonucleotide. A control group of 4 cynomolgus monkeys was injected with 0.9% saline in a similar manner and served as the control group.

Body and organ weight measurements

To evaluate the effect of modified oligonucleotides on the overall health of the animals, body and organ weights were measured. Terminal body weight was measured prior to necropsy. Organ weights were measured as well. Table 22

Body and organ weights (g)

Kidney and Liver function

To evaluate the effect of modified oligonucleotides on hepatic and kidney function, blood samples were collected from all the study groups on day 43. The monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without anticoagulant for semm separation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain semm. Levels of various liver function markers were measured using a Toshiba 120FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of blood urea nitrogen (BUN), creatinine (CREA), total protein (TP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured.

Table 23

Liver function markers in cynomolgus monkey plasma

Pro-inflammatory proteins analysis

To evaluate any inflammatory effect of modified oligonucleotides in cynomolgus monkeys, blood samples were taken for analysis. The monkeys were fasted overnight prior to blood collection. On day 41 (pre-dose and 24hours postdose), approximately 0.8 niL of blood was collected from each animal and put into tubes without anticoagulant for serum separation The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min at room temperature to obtain serum. Complement C3 were measured using a Toshiba 120 FR NEO chemistry analyzer (Toshiba Co., Japan). Another marker of inflammation, C-Reachve Protein (CRP) was tested together with the clinical chemistry parameters tested for liver function above. Table 24

Pro-inflammatory protein analysis in cynomolgus monkeys

Hematology

To evaluate any effect of modified oligonucleotides in cynomolgus monkeys on hematologic parameters, blood samples of approximately 0.5 mL of blood was collected from each of the available study animals on day 43. The samples were collected in tubes containing K -EDTA. Samples were analyzed for redblood cell (RBC) count, Hemoglobin (HGB), Hematocrit (HCT), platelet count (PLT), total white blood cell count (WBC), neutrophil counts (NEU), lymphocyte counts (LYM), and monocyte counts (MON) using an ADVIA2120i hematology analyzer (Siemens, USA).

Table 25

Hematological marker analysis in cynomolgus monkeys

Urine Analysis

Table 26

Urine analysis in cynomolgus monkeys

Example 11: Dose-dependent inhibition of human MALAT1 in A431 cells by comparator compounds

Certain modified oligonucleotides described in the art were tested at various doses in A431 cells and used as comparator compounds in other Examples below. The following modified oligonucleotides described in the art were compared: 395240, 395243, 395244, 395248, 395251, 395252, 395253, 395254, 395255, 395256, 395257, 395259, 395267, 395269, 395272, 395275, 395280, 395283, 395287, 395290, 556089, 559497, and 626112. The chemical notation column in the table below specifies the sequence and chemistry information, including 5-methylcytosines, sugar chemistry, and the intemucleoside linkage chemistry; wherein subscript‘d’ represents a 2’^-D-deoxyribosyl sugar moiety, subscript‘k’ represents a cET sugar moiety, subscript‘e’ represents a 2’-MOE sugar moiety, subscript,‘s’ represents to a phosphorothioate intemucleoside linkage, superscript‘m’ before the cytosine residue represents a 5- methylcytosine, and subscript‘o’ represents a phosphodiester intemucleoside linkage.“Start site” indicates the 5’-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.“Stop site” indicates the 3’-most nucleoside to which the gapmer is complementary in the human nucleic acid sequence. Each modified oligonucleotide listed in the table below is complementary to human MALAT1 nucleic acid sequence SEQ ID NO: 1 (GENBANK AccessionNo: XR 001309.1).

Table 27

Certain Comparator Compounds

Compounds 1058667 and 1058668 have been described in the art. The chemical notation column in the table below specifies the sequence and chemistry information of certain comparator compounds, including 5-methylcytosines, sugar chemistry, and the intemucleoside linkage chemistry; wherein subscript‘d’ represents a 2^'-[i-D-dco.\ynbosyl sugar moiety, subscript T represents an LNA sugar moiety, subscript‘s’ represents to a phosphorotluoate intemucleoside linkage, and superscript‘m’ before the cytosine residue represents a 5-methylcytosine. Compounds 1058667 and 1058668 are complementary to mouse MALAT1 nucleic acid sequence and mismatched with human MALAT1 nucleic acid sequence.“Start site” indicates the 5’-most nucleoside to which the gapmer is complementary in the mouse nucleic acid sequence.“Stop site” indicates the 3’-most nucleoside to which the gapmer is complementary in the mouse nucleic acid sequence. Each modified oligonucleotide listed in the table below is complementary to mouse MALAT1 nucleic acid sequence SEQ ID NO: 2823 (complement of GENBANK Accession No: NC 000085.6 truncated from nucleotides 5793001 to 5806000)

Table 28

Certain Comparator Compounds

The modified oligonucleotides below were tested in a series of experiments using the same culture conditions.

The results for each experiment are presented in separate tables shown below. Cultured A431 cells at a density of 10,000 cells per well were transfected using free uptake with modified oligonucleotides diluted to different concentrations as specified in the tables below. After a treatment period of approximately 48 hours, RNA levels were measured as previously described using the Human primer-probe set RTS2738 (described herein above). MALAT1 RNA levels were normalized to total RNA, as measured by RIBOGREEN®. Results are presented as percent change of MALAT1 RNA, relative to PBS control.

The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in excel and is also presented in the tables below. Table 29

Dose-dependent percent reduction of human MALAT1 RNA in A431 cells by modified oligonucleotides

Table 30

Example 12: Antisense inhibition of human MALAT1 in A431 cells by 3-10-3 cEt gapmers

Modified oligonucleotides complementaiy to a MALAT1 nucleic acid were synthesized and tested for their effect on MALATl RNA levels in vitro in comparison with comparator compounds 395240, 395253, 395254, 395256, 556089, and 559497 described above. The modified oligonucleotides were tested in a series of experiments using the same culture conditions The results for each separate experiment are presented in separate tables below.

Except for the comparator compounds 395240, 395253, 395254, and 395256, which are 5-10-5 MOE gapmers (i.e., they have a central gap segment of ten 2’-deoxynucleosides flanked on each side by wing segments, each comprising five 2’-0-methoxyethyl modified nucleosides), the modified oligonucleotides are all 3-10-3 cEt gapmers (i.e., they have a central gap segment of ten 2’-deoxynucleosides flanked on each side by wing segments, each comprising three cEt modified nucleosides). The intemucleoside linkages throughout each modified oligonucleotide are phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.

“Start site” indicates the 5’ -most nucleoside of the target sequence to which the modified oligonucleotide is complementary.“Stop site” indicates the 3’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are 100% complementary to either the human MALATl RNA transcript, designated herein as SEQ ID NO: 1 (GENBANK Accession No. XR 001309.1) or the human MALAT1 RNA transcript designated here in as SEQ ID NO: 2824 (GENBANK Accession No. EF177381.1). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.

Cultured A431 cells at a density of 10,000 cells per well were transfected using free uptake with 5 nM of modified oligonucleotide. After a treatment period of 48 hours, RNA was isolated from the cells and MALAT1 RNA levels were measured by quantitative real-time RTPCR. Human MALAT1 primer probe set RTS2736 (described herein above) was used to measure RNA levels. MALATl RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent change of MALATl RNA, relative to PBS control (%UTC). The symbol ^"G indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set, and so the associated data is not reliable. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides. In some cases, %UTC values are not available. This is indicated as N.D. (Not Defined) and additional assays will be performed to accurately assess the potency and efficacy of such modified oligonucleotides.

Modified oligonucleotides marked with a triple asterisk (=¾=) have been previously described in Example 1. The %UTC data for modified oligonucleotides marked with a triple asterisk (***) in the tables below is identical to the data described in Example 2 as the data is from the same experiments.

Table 31

Inhibition of MALAT1 RNA by 3-10-3 cEt gapmers

Table 32

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Example 13: Antisense inhibition of human MALAT1 in A431 cells by 3-10-3 cEt gapmers

Modified oligonucleotides complementaiy to a MALAT1 nucleic acid were synthesized and tested for their effect on MALAT1 RNA levels in vitro in comparison with comparator compounds 395254 and 559497 described above. The modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each separate experiment are presented in separate tables below.

Except for the comparator compound 395254, which is a 5-10-5 MOE gapmer (i.e., it has a central gap segment of ten 2’-deoxynucleosides flanked on each side by wing segments, each comprising five 2’-0-methox ethyl modified nucleosides), the modified oligonucleotides are all 3-10-3 cEt gapmers (i.e., they have a central gap segment of ten 2’- deoxynucleosides flanked on each side by wing segments, each comprising three cEt modified nucleosides). The intemucleoside linkages throughout each modified oligonucleotide are phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines. “Start site” indicates the 5’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary.“Stop site” indicates the 3’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are 100% complementary to either the human MALATl RNA transcript, designated herein as SEQ ID NO: 1 (GENBANK Accession No. XR OO 1309.1) or the human MALATl RNA transcript designated here in as SEQ ID NO: 2824 (GENBANK Accession No. EF177381.1). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.

Table 33

Inhibition of MALATl RNA by 3-10-3 cEt gapmers

Table 34

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 35

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 36

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 37

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 38

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 39

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 40

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 41

Inhibition of MALAT1 RNA by 3-10-3 cEt gapmers

Table 42

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 43

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 44

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 45

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 46

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 47

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 48

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 49

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 50

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 51

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 52

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 53

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 54

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 55

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 56

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 57

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 58

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 59

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 60

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 61

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 62

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 63

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Table 64

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Example 14: Design of gapmers with 2’-0 methyl modifications complementary to human MALAT1 RNA

Modified oligonucleotides complementary to human a MALAT1 nucleic acid were designed. The modified oligonucleotides in the table below are 3-10-3 cET gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of a combination of one 2'-0-methyl nucleoside and nine 2’-deoxynucleosides. The central gap segment is flanked by wing segments on the 5’ direchon and the 3’ direchon comprising three nucleosides each. Each nucleoside in the 5’ wing segment and each nucleoside in the 3’ wing segment has a cEt sugar modification. The intemucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. The sequence and chemical notation column specifies the sequence, including 5-methylcytosines, sugar chemistry, and the intemucleoside linkage chemistry; wherein subscript‘d’ represents a 2 -(i-D-dcox\ ribosyl sugar moiely, subscript‘k’ represents a cET sugar moiety, subscript‘s’ represents to a phosphorothioate intemucleoside linkage, superscript‘m’ before the cytosine residue represents a 5-methylcytosine, and subscript‘y’ represents a 2’-OMe sugar moiety.“Start site” indicates the 5’- most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.“Stop site” indicates the 3’- most nucleoside to which the gapmer is complementary in the human nucleic acid sequence.

Table 65

cET gapmers with 2’-OMe sugars complementary to human MALAT1

Example 15: Antisense inhibition of human MALAT1 in HepG2 cells by 3-10-3 cEt gapmers

Modified oligonucleotides complementaiy to a MALAT1 nucleic acid were synthesized and tested for their effect on MALATl RNA levels in vitro in comparison with comparator compounds 395240 and 556089 described above. The modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each separate experiment are presented in separate tables below

Except for comparator compound 395240, which is a 5-10-5 MOE gapmer (i.e., it has a central gap segment of ten 2’-deoxynucleosides flanked on each side by wing segments, each comprising five 2’-0-methoxyethyl modified nucleosides), the modified oligonucleotides are all 3-10-3 cEt gapmers (i.e., they have a central gap segment of ten 2’- deoxynucleosides flanked on each side by wing segments, each comprising three cEt modified nucleosides). The intemucleoside linkages throughout each modified oligonucleotide are phosphorothioate (P=S) linkages. All cytosine nucleobases throughout each modified oligonucleotide are 5-methylcytosines.

“Start site” indicates the 5’ -most nucleoside of the target sequence to which the modified oligonucleotide is complementary.“Stop site” indicates the 3’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the tables below, the modified oligonucleotides are 100% complementary to either the human MAL ATl RNA transcript, designated herein as SEQ ID NO: 1 (GENBANK Accession No. XR_001309.1) or the human MALATl RNA transcript designated here in as SEQ ID NO: 2824 (GENBANK Accession No. EF177381 1). ‘N/A’ indicates that the modified oligonucleotide is not complementary to that particular target sequence with 100% complementarity.

Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 300 nM of modified oligonucleotide. After an overnight incubation, RNA was isolated from the cells and MALATl RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS2738 (forward sequence GAATTGCGTCATTTAAAGCCTAGTT, designated herein as SEQ ID NO: 2820; reverse sequence

TCATCCTACCACTCCCAATTAATCT, designated herein as SEQ ID NO: 2821; probe sequence

ACGCATTTACTAAACGCAGACGAAAATGGA, designated herein as SEQ ID NO: 2822) was used to measure RNA levels. MALATl RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent change of MALATl RNA, relative to PBS control. The symbol ^"G indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer probe set and so the associated data is not reliable. In such instances, additional assays using alternative primer probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides. Table 66

Inhibition of MALAT1 RNA by 3-10-3 cEt gapmers

Table 67

Inhibition of MALAT1 RNAby 3-10-3 cEtgapmers

Example 16: Dose-dependent inhibition of human MALAT1 in A431 cells by 3-10-3 cEt gapmers

Certain modified oligonucleotides described in the studies above exhibiting significant in vitro inhibition of MALAT1 RNA were selected and tested at various doses in A431 cells in comparison with comparator compounds 395240, 395243, 395244, 395248, 395253, 395254, 395255, 395256, 395280, 556089, and 559497 described above.

The modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A431 cells at a density of 10,000 cells per well were transfected using free uptake with modified oligonucleotides diluted to different concentrations as specified in the tables below. After a treatment period of approximately 48 hours, RNA levels were measured as previously described using the Human primer-probe set RTS2736. MALATl RNA levels were normalized to total RNA, as measured by RIBOGREEN®. Results are presented as percent change of MALATl RNA, relative to PBS control.

The half maximal inhibitory concentration (IC₅₀) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in excel and is also presented in the tables below. The %UTC values for modified oligonucleotides marked with a triple asterisk in the tables below has been previously presented in Example 3 (Table 3) herein above. The %UTC and IC₅₀ data for modified oligonucleotides marked with a triple asterisk (***) in the tables below is identical to the data presented in Example 3 as the data is from the same experiments.

Table 68

Dose-dependent percent reduction of human MALATl RNA in A431 cells by modified oligonucleotides

Table 69

Example 17: Dose-dependent inhibition of human MALAT1 in A431 cells by 3-10-3 cEt gapmers

Certain modified oligonucleotides described in the studies above exhibiting significant in vitro inhibition of MAL AT 1 RNA were selected and tested at various doses in A431 cells .

The modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results for each experiment are presented in separate tables shown below. Cultured A431 cells at a density of 10,000 cells per well were transfected using free uptake with modified oligonucleotides diluted to different concentrations as specified in the tables below. After a treatment period of approximately 48 hours, RNA levels were measured as previously described using the Human primer-probe set RTS2736. MALAT1 RNA levels were normalized to total RNA, as measured by RIBOGREEN®. Results are presented as percent change of MALAT1 RNA, relative to PBS control.

The half maximal inhibitory concentration (ICso) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in excel and is also presented in the tables below. The %UTC values for modified oligonucleotides marked with a triple asterisk in the tables below has been previously presented in Example 3 (Table 3) herein above. The %UTC and IC50 data for modified oligonucleotides marked with a triple asterisk (*%) in the tables below is identical to the data presented in Example 3 as the data is from the same experiments. Table 70

Table 71

Table 72

Table 73

Table 74

Table 75

Table 76

Table 77

Table 78

Table 79

Table 80

Table 81

Table 82

Table 83

Table 84

Table 85

Example 18: Dose-dependent inhibition of human MALAT1 in MDA-MB-436 cells by cEt gapmers

Modified oligonucleotides described in the studies above were tested at various doses in MDA-MB-436 cells. Cultured MDA-MB-436 cells at a density of 5,000-12,000 cells per well were treated using free uptake with modified oligonucleotides diluted to concentrations described in the tables below. After approximately 48 hours, MALAT1 RNA levels were measured as previously described using the Human MALAT1 primer-probe set RTS2736. MALAT1 RNA levels were normalized to b-actin, measured using human primer-probe set HTS5002 (described herein above). Results are presented in the tables below as percent control of the amount of MALAT1 RNA relative to untreated control cells (%UTC). IC50s were calculated using the“log(inhibitor) vs. response - variable slope (4 parameters)” formula using Prism6 software. The %UTC values for modified oligonucleotides marked with a triple asterisk in the tables below has been previously presented in Example 4 (Table 4) herein above. The %UTC data for modified oligonucleotides marked with a triple asterisk (***) in the tables below is identical to the data presented in Table 4 as the data is from the same experiments. Table 86

Example 19: Tolerability of modified oligonucleotides targeting human MALAT1 in CD-I mice

BALB/c mice are a multipurpose mouse model frequently utilized for safety and efficacy testing. The mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers. Study 1

Groups of four 6-to-8-week-old male B ALB/c mice were injected subcutaneously tw ice a week for 4 weeks (for a total of 8 treatments) with 50 mg/kg of modified oligonucleotides. One group of four male CD-I mice was injected with PBS. Mice were euthanized 24 hours following the final administration.

To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), total bilirubin (TBIL), and blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below. Assays include four animals in a group, except where an asterisk (*) indicates that 3 animals or less was used for a specific assay. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

Table 87

Plasma chemistry markers in male BALB/c mice

Body weight was measured on day 25, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

Table 88

Body and organ weights (in grams)

Study 2

Groups of four 4-to-6-week-old male CD-I mice were injected subcutaneously twice a week for 4 weeks (for a total of 8 treatments) with 50 mg/kg/dose of modified oligonucleotides. One group of four male CD-I mice was injected with PBS. Mice were euthanized 24 hours following the final administration. The values for modified oligonucleotides marked with a tnple asterisk in the tables below have been previously presented in Tables 7 and 8 herein above. The data for modified oligonucleotides marked with a triple asterisk (***) in the tables below is identical to the data presented in Table 7 and Table 8 as the data is from the same experiments.

To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), total bilirubin (TBIL), and albumin (ALB) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below. Assays include four animals in a group, except where an asterisk (*) indicates that 3 animals or less was used for a specific assay. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

Table 89

Plasma chemistry markers in CD-I Male mice

Body weights of CD-I mice were measured at the end of the study, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 90

Body and organ weights (in grams)

Study 3

Groups of four 4-to-6-week-old male CD-I mice were injected subcutaneously twice a week for 4 weeks (for a total of 8 treatments) with 50 mg/kg/dose of modified oligonucleotides. One group of four male CD-I mice was injected with PBS. Mice were euthanized 24 hours following the final administration.

To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below. Assays include four animals in a group, except where an asterisk (*) indicates that 3 animals or less was used for a specific assay. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

The values for modified oligonucleotides marked with a triple asterisk in the tables below have been previously presented in Tables 13 and 14 herein above. The data for modified oligonucleotides marked with a triple asterisk (*%) in the tables below is identical to the data presented in Table 13 and Table 14 as the data is from the same experiments Table 91

Plasma chemistry markers in CD-I Male mice

Body weights of CD-I male mice were measured at days 1 and 25, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 92

Body and organ weights (in grams)

Study 4

Groups of four 4-to-6-week-old male CD-I mice were injected subcutaneously twice a week for 4 weeks (for a total of 8 treatments) with 50 mg/kg/dose of modified oligonucleotides. One group of four male CD-I mice was injected with PBS. Mice were euthanized 72 hours following the final administration. The values for modified oligonucleotides marked with a triple asterisk in the tables below have been previously presented in Tables 15 and 16 herein above. The data for modified oligonucleotides marked with a triple asterisk (*%) in the tables below is identical to the data presented in Table 15 and Table 16 as the data is from the same experiments.

Table 93

Plasma chemistry markers in CD-I Male mice

Body weights of CD-I male mice were measured at days 1 and 25, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 94

Body and organ weights (in grams)

Study 5

Groups of four 4-to-6-week-old male CD-I mice were injected subcutaneously twice a week for 4 weeks (for a total of 8 treatments) with 50 mg/kg/dose of modified oligonucleotides. One group of four male CD-I mice was injected with PBS. Mice were euthanized 24 hours following the final administration. The values for modified oligonucleotides marked with a triple asterisk in the tables below have been previously presented in Tables 9 and 10 herein above. The data for modified oligonucleotides marked with a triple asterisk (***) in the tables below is identical to the data presented in Table 9 and Table 10 as the data is from the same experiments.

To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below. Assays include four animals in a group, except where an asterisk (*) indicates that 3 animals or less was used for a specific assay. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies. Table 95

Plasma chemistry markers in CD-I Male mice

Body weights of CD-I male mice were measured at days 1 and 25, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

Table 96

Body and organ weights (in grams)

Example 20: Tolerability of modified oligonucleotides targeting human MALAT1 in Sprague-Dawley rats

Sprague-Dawley rats are a multipurpose model used for safet and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

Study 1

Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). The rats were euthanized; and organs, urine and plasma were harvested for further analysis 2 days after the last dose.

Plasma chemistry markers

To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY ). The results are presented in the table below. Assays include four animals in a group, except where an asterisk (*) indicates that 3 animals or less was used for a specific assay. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

Table 97

Plasma chemistry markers in Sprague-Dawle rats

Blood obtained from rat groups at the end of the study, day 43, were sent to IDEXX BioAnalytics for measurement of blood cell counts. Counts taken include red blood cell (RBC) count, Hemoglobin (HGB), Hematocrit (HCT), platelet count (PLT), total white blood cell count (WBC), neutrophil counts (NEU), lymphocyte counts (LYM), and monocyte counts (MON). The results are presented in the tables below. Ionis oligonucleotides that caused changes in the blood cell count outside the expected range for modified oligonucleotides were excluded in further studies.

Table 98

Blood Cell Count in Sprague-Dawley Rats

To evaluate the effect of Ionis oligonucleotides on kidney function, urinary levels of micro total protein (MTP) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The ratios of MTP to creatinine (MTP/C ratio) are presented in the table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies.

Table 99

MTP to creatinine ratio in Sprague-Dawley rats

Body weights of rats were measured at on day 41, and the average body weight for each group is presented in the table below. Liver, spleen and kidney weights were measured at the end of the study, and are presented in the table below. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

Table 100

Body and organ weights (g)

Study 2

Groups of 4 Sprague-Dawley rats each were weekly injected subcutaneously with 50 mg/kg of Ionis oligonucleotide for 6 weeks (total 7 doses). The rats were euthanized; and organs, urine and plasma were harvested for further analysis 1 day after the last dose.

Plasma chemistry markers

To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below. Modified oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for modified oligonucleotides were excluded in further studies.

Table 101

Plasma chemistry markers in Sprague-Dawle rats

Blood obtained from rat groups at the end of the study, day 43, were sent to IDEXX BioAnalytics for measurement of blood cell counts. Counts taken red blood cell (RBC) count, Hemoglobin (HGB), Hematocrit (HCT), platelet count (PLT), total white blood cell count (WBC), neutrophil counts (NEU), lymphocyte counts (LYM), and monocyte counts (MON).. The results are presented in the tables below. Ionis oligonucleotides that caused changes in the blood cell count outside the expected range for modified oligonucleotides were excluded in further studies.

Table 102

Blood Cell Count in Sprague-Dawley Rats

Table 103

MTP to creatinine ratio in Sprague-Dawley rats

Body weights of rats were measured at days 1 and 38 and the average body weight for each group is presented in the table below. Liver, spleen and kidney weights were measured at the end of the study, and are presented in the table below. Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.

Table 104

Body and organ weights (g)

Claims

WHAT IS CLAIMED:

1. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813.

2 A compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813.

3. A compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813.

4 A compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813.

5 A compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2-10 or 36-2813.

6 A compound comprising amodified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813.

7 A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of any one of SEQ ID NOs: 2-10 or 36-2813.

8 A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and complementary within nucleotides 1535-1550, 2034-2049, 2341-2356, 4821-4836, 4840-4855, 4931-4946, 5049-5064, 5494-5509, or 5495-5510 of SEQ ID NO: 1.

9 The compound of any one of claims 1-8, wherein at least one mtemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage, at least one sugar of the modified oligonucleotide is a modified sugar, or at least one nucleobase of the modified oligonucleotide is a modified nucleobase.

10. The compound of claim 9, wherein the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.

11. The compound of claim 9 or 10, wherein the modified sugar is a bicyclic sugar.

12. The compound of claim 11, wherein the bicyclic sugar is selected from the group consisting of: 4'-(CH₂)-0-2' (LNA); 4'-(CH₂)₂-0-2' (ENA); and 4'-CH(CH₃)-0-2' (cEt).

13. The compound of claim 9 or 10, wherein the modified sugar is 2’-0-methoxyethyl.

14. The compound of any one of claims 9-13, wherein the modified nucleobase is a 5- methylcytosine.

15. The compound of any one of claims 1-14, wherein the modified oligonucleotide has:

a gap segment consisting of linked 2’-deoxynucleosides;

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

16. A compound comprising amodified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-10 or 36-2813, wherein the modified oligonucleotide has:

a gap segment consisting of linked 2^,-deoxynucleosides;

a 5’ wing segment consisting of linked nucleosides; and

a 3’ wing segment consisting of linked nucleosides;

17. A compound comprising a modified oligonucleotide consisting of 16-80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2-7, 36- 2646, or 2664-2813, wherein the modified oligonucleotide has:

a gap segment consisting of ten linked 2’-deoxynucleosides;

a 5’ wing segment consisting of three linked nucleosides; and

a 3’ wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5 wing segment and the 3’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is 5-methylcytosine.

18. The compound of any one of claims 1-17, wherein the oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementar to SEQ ID NO: 1.

19. The compound of any one of claims 1-18, wherein the compound is single-stranded.

20. The compound of any one of claims 1-18, wherein the compound is double-stranded.

21. The compound of any one of claims 1-20, wherein the compound comprises ribonucleotides.

22. The compound of any one of claims 1-20, wherein the compound comprises deoxyribonucleotides.

23. The compound of any one of claims 1 -22, wherein the modified oligonucleotide consists of 16 to 30 linked nucleosides.

24. The compound of any preceding claim, wherein the compound consists of the modified oligonucleotide.

25. A compound consisting of a pharmaceutically acceptable salt of any of the compounds of claims 1-24.

26. The compound of claim 25, wherein the pharmaceutically acceptable salt is a sodium salt.

27. The compound of claim 26, wherein the pharmaceutically acceptable salt is a potassium salt.

28. A modified oligonucleotide according to the following chemical structure:

29. The modified oligonucleotide of claim 28, wherein the modified oligonucleotide is the sodium salt or the potassium salt.

30. A modified oligonucleotide according to the following chemical structure:

31. A composition comprising the compound of any one of claims 1-27 or the modified oligonucleotide of any one of claims 28-30, and a pharmaceutically acceptable diluent or carrier.

32. A composition comprising the compound of any one of claims 1-27 or the modified oligonucleotide of any one of claims 28-30, and water.

33. A composition compnsing the compound of any one of claims 1-27 or the modified oligonucleotide of any one of claims 28-30 for use in therapy.

34. A method of treating or ameliorating cancer in an individual comprising administering to the individual a compound targeted to MALAT1, thereby treating or ameliorating the cancer

35. The method of claim 34, wherein the compound is an antisense compound targeted to MALAT1.

36. The method of claim 34 or 35, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-. PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

37. The method of any of claims 34-36, wherein administering the compound inhibits or reduces cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis.

38. The method of any of claims 34-37, wherein administering the compound increases or induces cancer cell differentiation, cancer cell adhesion, or tumor differentiation.

39. The method of any of claims 34-38, wherein administering the compound induces a cancer cell or tumor to have a cystic, ductular, or acinar phenotype or morphology.

40. The method of any of claims 34-39, wherein admimstenng the compound induces a cancer cell or tumor to have a more differentiated phenotype or structure.

41. The method of claim 40, wherein the more differentiated phenotype or structure comprises presence of secretory lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of E-cadherin or casein.

42. A method of inhibiting expression of MALAT1 in a cancer cell comprising contacting the cancer cell with a compound targeted to MALAT1, thereby inhibiting expression of MALAT1 in the cancer cell.

43. The method of claim 42, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

44. A method of reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in an individual having cancer comprising administering a compound targeted to MALAT1 to the individual, thereby reducing or inhibiting cancer cell proliferation, cancer cell migration, cancer cell branching morphogenesis, tumor progression, tumor growth, or metastasis in the individual.

45. A method of increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in an individual having cancer comprising administering a compound targeted to MALAT1 to the individual, thereby increasing or inducing cancer cell differentiation, cancer cell adhesion, or tumor differentiation in the individual.

46. A method of inducing a cancer cell or tumor to have a cystic, ductular, or acinar phenotype or morphology in an individual having cancer comprising administering a compound targeted to MALAT1 to the individual, thereby inducing the cancer cell or tumor to have a cystic, ductular, or acinar phenotype or morphology.

47. A method of inducing a cancer cell or tumor to have a more differentiated phenotype or structure comprising administering a compound targeted to MALAT1 to the individual, thereby inducing the cancer cell or tumor to have a more differentiated phenotype or structure.

48. The method of claim 47, wherein the more differentiated phenotype or structure comprises presence of secretory lipid droplets, increased desmosomal structures, polarized ductal structures, or increased levels of E-cadherin or casein.

49. The method of any of claims 44-48, wherein the individual has breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal -like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER- , PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+. and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid. rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

50. The method of any one of claims 34-49, wherein the compound is an antisense compound targeted to MALAT1.

51. The method of any one of claims 34-49, wherein the compound is the compound of any one of claims 1-27, the modified oligonucleotide of any one of claims 28-30, or the composition of claim 31 or 32.

52. The method of any of claims 34-51, wherein the compound is administered parenterally.

53. Use of a compound targeted to MALAT1 for treating, preventing, or ameliorating a cancer associated with MALATl .

54. The use of claim 53, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma: breast lobular carcinoma: luminal A breast cancer; lummal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-): ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

55. The use of claim 53 or 54, wherein the compound is an antisense compound targeted to MALAT1.

56. The use of any one of claims 53-55, wherein the compound is the compound of any one of claims 1-27, the modified oligonucleotide of any one of claims 28-30, or the composition of claim 31 or 32.

57. Use of a compound targeted to MALAT1 in the manufacture of a medicament for treating or ameliorating a cancer associated with MALAT1.

58. The use of claim 57, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (E1NSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

59. The use of claim 57 or 58, wherein the compound is an antisense compound targeted to

MALAT1.

60. The use of any one of claims 57-59. wherein the compound is the compound of any one of claims 1-27, the modified oligonucleotide of any one of claims 28-30, or the composition of claim 31 or 32.

61. Use of a compound targeted to MALAT1 in the preparation of a medicament for treating or ameliorating a cancer associated with MALAT1.

62. The use of claim 61, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometrial cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skm cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

63. The use of claim 61 or 62, wherein the compound is an antisense compound targeted to MALAT1.

64. The use of any one of claims 61-63, wherein the compound is the compound of any one of claims 1-27, the modified oligonucleotide of any one of claims 28-30, or the composition of claim 31 or 32.

65. A method comprising administering a compound targeted to MALAT1 to an individual.

66. The method of claim 65, wherein the compound is an antisense compound.

67. The method of claim 66, wherein the antisense compound comprises an antisense oligonucleotide complementary to MALATl .

68. The method of any of claims 65-67, wherein the individual has cancer.

69. The method of claim 68, wherein the cancer is breast cancer; inflammatory breast cancer; breast ductal carcinoma; breast lobular carcinoma; luminal A breast cancer; luminal B breast cancer; basal-like breast cancer; HER2 positive (HER2+) breast cancer; HER2 negative (HER2-) breast cancer; Estrogen Receptor negative (ER-) breast cancer; Estrogen Receptor positive (ER+) breast cancer; Progesterone Receptor negative (PR-) breast cancer; Progesterone Receptor positive (PR+) breast cancer; ER positive (ER+) and PR positive (PR+) breast cancer; ER positive (ER+) and PR negative (PR-) breast cancer; ER negative (ER-) and PR positive (PR+) breast cancer; ER positive (ER+) and HER2 negative (HER2-) breast cancer; ER-, PR-, and HER2- triple negative breast cancer (ER-, PR-, HER2-; TNBC); hormone receptor negative breast cancer (ER- and PR-); ER+, PR+, and HER2+ triple positive breast cancer (ER+, PR+, HER2+; TPBC); hepatocellular carcinoma (HCC); head and neck squamous cell carcinoma (HNSCC); oral tongue squamous cell carcinoma (OTSCC); sarcomas (e.g. epitheloid, rhabdoid and synovial); esophageal cancer; gastric cancer; ovarian cancer; pancreatic cancer; lung cancer; non-small cell lung carcinoma (NSCLC); small-cell lung carcinoma (SCLC); squamous cell carcinoma (SCC); head and neck cancer; head and neck squamous cell carcinoma (HNSCC); gastrointestinal cancer; large intestinal cancer; small intestinal cancer; stomach cancer; colon cancer; colorectal cancer; bladder cancer; liver cancer; biliary tract cancer; urothelial cancer; endometnal cancer; cervical cancer; prostate cancer; mesothelioma; chordoma; renal cancer; renal cell carcinoma (RCC); brain cancer; neuroblastoma; glioblastoma; skin cancer; melanoma; basal cell carcinoma; merkel cell carcinoma; blood cancer; hematopoetic cancer; myeloma; multiple myeloma (MM); B cell malignancies; lymphoma; B cell lymphoma; Hodgkin lymphoma; T cell lymphoma; leukemia; or acute lymphocytic leukemia (ALL).

70. The method of any of claims 65-69, wherein the compound is the compound of any one of claims 1-27, the modified oligonucleotide of any one of claims 28-30, or the composition of claim 31 or 32.

71. The method of any of claims 65-70, wherein the compound is administered parenterally.