WO2020173817A1 - Protéines de liaison à la calcite - Google Patents

Protéines de liaison à la calcite Download PDF

Info

Publication number
WO2020173817A1
WO2020173817A1 PCT/EP2020/054578 EP2020054578W WO2020173817A1 WO 2020173817 A1 WO2020173817 A1 WO 2020173817A1 EP 2020054578 W EP2020054578 W EP 2020054578W WO 2020173817 A1 WO2020173817 A1 WO 2020173817A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
calcite
sequence
seq
enzyme activity
Prior art date
Application number
PCT/EP2020/054578
Other languages
English (en)
Inventor
Jeppe Christian MOURITSEN
José ARNAU
Rikke NOERREGAARD-SARUP
Original Assignee
Novozymes A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes A/S filed Critical Novozymes A/S
Publication of WO2020173817A1 publication Critical patent/WO2020173817A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C12N9/20—Triglyceride splitting, e.g. by means of lipase
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/14—Extraction; Separation; Purification
    • C07K1/16—Extraction; Separation; Purification by chromatography
    • C07K1/22—Affinity chromatography or related techniques based upon selective absorption processes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/465—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from birds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/01—Carboxylic ester hydrolases (3.1.1)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand

Definitions

  • the present invention relates to methods of preparing proteins having the ability to bind calcite. Further, the invention relates to methods of stabilizing, purifying, recovering and/or formulating proteins comprising a calcite binding sequence by binding to calcite.
  • Industrial protein production is typically done by fermenting a recombinant host cell comprising a genetic construct encoding the desired protein. Such processes are well known for the production of many different proteins for example industrial enzymes and pharmaceuticals.
  • a process typically involves a number a separation and purification techniques depending on the particular protein and the purity required for the intended purpose.
  • the invention provides a polypeptide comprising a sequence encoding a desired polypeptide and a sequence having calcite binding properties, wherein the calcite binding sequence has the sequence of: YHHGEEED (SEQ ID NO: 3);
  • the desired polypeptide has biological activity.
  • the invention related to a method for recovering a polypeptide of the invention from an aqueous solution comprising the polypeptide of the invention comprising the steps of: a) Providing an aqueous solution of a polypeptide according to the invention;
  • the aqueous solution in step a) is a fermentation broth.
  • the invention relates to polynucleotides, expression constructs and vectors comprising said polynucleotide and host cells comprising these as well as methods for preparing the poly peptides of the invention using such host cells.
  • the invention relates to composition comprising the polypeptide of the invention, in particular comprising the polypeptide of the invention bound to calcite.
  • Figure 1 shows a SDS-PAGE gel; to the left is shown the molecular weight marker; lane 1 (Mark12) shows the molecular weight marker, Lane 2 shows culture supernatant from an Asper gillus oryzae expressing the DORA2 construct without added calcite; and lane 3 shows same culture fluid but with addition of calcite. For further details see example 2 and 3.
  • Figure 2 shows test tubes with culture fluid and calcite illuminated with green light, where the DsRed protein flouresses orange.
  • Control For further information see example 3.
  • Figure 3 shows an SDS-PAGE gel disclosing the results of example 5.
  • First and last lane is the molecular weight marker, for definition of the bands see figure 1.
  • Lane 2 is purified T 1 construct;
  • lane 3 is purified T 1 construct with addition of calcite.
  • Lane 4 is wash solution after wash of the calcite with bound T 1 construct.
  • Lane 5 is T1 construct released from calcite with EDTA treatment.
  • SEQ ID NO: 1 the amino acid sequence of Sea 1
  • SEQ ID NO: 2 the amino acid sequence of Sea 2
  • SEQ ID NO: 3 Binding sequence BS1.
  • SEQ ID NO: 4 Binding sequence BS2
  • SEQ ID NO: 5 amino acid ZEN-DsRed-BS2 (DORA 2) construct.
  • SEQ ID NO: 6 Primer oKRN-11.
  • SEQ ID NO: 7 Primer oKRN-12.
  • SEQ ID NO: 8 Primer oKRN-17.
  • SEQ ID NO: 10 Primer oKRN-15
  • SEQ ID NO: 12 Amino acid sequence of ZEN-DsRed (DORA6) construct.
  • SEQ ID NO: 13 Primer oKRN-26
  • SEQ ID NO: 14 Primer oKRN-25
  • SEQ ID NO: 15 Primer oKRN-27
  • SEQ ID NO: 16 Amino acid sequence of T1 construct: Lipase-BS1
  • SEQ ID NO: 17 Amino acid sequence of T2 construct: Lipase-BS2
  • SEQ ID NO: 18 Amino acid sequence of T3 construct: Lipase-BS1-BS2
  • SEQ ID NO: 19 Amino acid sequence of T4 construct: Lipase
  • Calcite is a carbonate mineral and the most stable polymorph of Calcium carbonate (CaCOs). Calcite is a common constituent of sedimentary rocks and limestone.
  • Coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA.
  • the coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
  • control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention.
  • Each control sequence may be native (/.e., from the same gene) or foreign (/.e., from a different gene) to the polynucleotide encoding the polypeptide or native or foreign to each other.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide se quence, promoter, signal peptide sequence, and transcription terminator.
  • the con trol sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
  • Calcite binding property mean that the protein in question has the ability to bind to calcite.
  • Calcite binding can according to the invention be determined by providing an aqueous solution of the protein in question, adding calcite to the solution and determining whether the protein has bound to calcite or not.
  • a convenient method is to separate the solid calcite from the solution by centrifugation or filtration and determining the amount of protein in the solution or on the calcite.
  • a polypeptide is according to the invention considered to have calcite binding properties if at least 20% of the protein is bound to calcite using such an assay, preferably at least 50%; preferably at least 60%, preferably at least 70%; preferably at least 80% or preferably at least 90%.
  • expression includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-trans- lational modification, and secretion.
  • Expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
  • Fermentation broth The term fermentation broth is intended to mean the broth resulting from fermenting a microorganism in a substrate, preferably a liquid substrate.
  • a fermentation broth is the primary outcome of a fermentation of a microorganism e.g. a fermentation process for producing the polypeptide of the invention.
  • the fermentation broth may be subjected to oper ations to stabilize the produced fermentation product, such as a heat treatment or addition of a chemical stabilizing agent, and/or a simple solid/liquid separation process for removing the cells and insoluble remains from the substrate.
  • host cell means any cell type that is susceptible to transformation, trans fection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
  • host cell encompasses any progeny of a par ent cell that is not identical to the parent cell due to mutations that occur during replication.
  • nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
  • operbly linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
  • Sequence identity The relatedness between two amino acid sequences or between two nucle otide sequences is described by the parameter“sequence identity”.
  • the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276- 277), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.
  • the output of Needle labeled“longest identity” (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
  • the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.
  • the output of Needle labeled“longest identity” is used as the percent identity and is calculated as follows:
  • the present invention relates to proteins and peptides having the ability to bind to calcite. Further the invention relates to methods for producing and recovering such polypeptides and to compo sitions comprising the polypeptides of the invention.
  • Polypeptides of the invention relate to polypeptides comprising a sequence encoding a desired poly peptide and a sequence having calcite binding properties, wherein the calcite binding polypeptide has the sequence of:
  • Binding sequence 1 (BS1): YHHGEEEED (SEQ ID NO:3);
  • Binding sequence 2 (BS2): LDDDDYPKG (SEQ ID NO: 4); or
  • the sequence having calcite binding properties may be located in the N-terminal of the polypep tide, in the C-terminal of the polypeptide or located internally in the polypeptide sequence, where the N-terminal or C-terminal localization is preferred.
  • the polypeptide of the invention may be a simple fusion i.e. a fusion that do not contain additional amino acids belonging to either the desired polypeptide or the binding motive or the fusion may comprise a linker sequence separating the desired polypeptide and the binding motive.
  • the linker sequence may comprise one or more amino acids and has the main purpose of separating the two elements.
  • the exact amino acid sequence of the linker sequence is not critical for the inven tion but it is preferred to select a sequence comprising amino acids with hydrophilic amino acids in order to secure that the linker sequence become hydrated and exposed to the surface of the polypeptide. In principle there are no limits to the size of the linker sequence, however, it is rec ommended that the linker sequence contains less than 50 amino acids, e.g. up to 30 amino acids, e.g. up to 20 amino acids.
  • the linker sequence comprises a cleavage site for a site specific protease.
  • a cleavage site allow the use of the binding motive e.g. during purification of the protein of the invention; and release of the desired polypeptide from the binding motive when desired. This is particularly useful if the desired polypeptide is a therapeutic polypeptide where you can benefit from the calcite binding properties during recovery and purification of the polypeptide of the in vention and thereafter release the desired therapeutic polypeptide from the binding motive to obtain the therapeutic polypeptide without additional functional sequences.
  • the desired polypeptide may according to the invention be any polypeptide.
  • the de sired polypeptide is a polypeptide that do not have calcite binding properties or at least only low calcite binding in comparison with the desired polypeptide fused to either BS1 or BS2.
  • suitable desired polypeptides according to the invention include therapeutic polypeptides, such as hormones, growth factors and antibodies; and enzymes such a hydrolases, transferases and oxidases.
  • the desired polypeptide is an enzyme selected among aminopeptidase, amylase, amyloglucosidase, mannanase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase, protease, ribonucle
  • the polypeptide of the invention comprises a desired polypeptide that has the activity of the desired polypeptide when the desired polypeptide is attached with the binding motive, whereas in other embodiments the polypeptide of the invention has no or significantly less activity than the desired polypeptide alone without the binding motive. In the latter embodiments, the desired polypeptide will be active when the binding motive is removed from the desired polypeptide.
  • the polypeptide of the invention has at least 25% of the activity of the desired polypeptide, e.g. least 40% of the activity, e.g. at least 50% of the activity, e.g. at least 50% of the activity, e.g. at least 70% of the activity, e.g. at least 80% of the activity or at least 90% of the activity.
  • the polypeptide of the invention has the benefit of being able to bind to calcite with a high specificity.
  • polypeptide of the invention has increased stability compared to the desired polypeptide alone, in particular when the polypeptide of the invention is bound to calcite.
  • the stability of such polypeptides may be expressed as the half-life under defined conditions.
  • the half-life of the polypeptide of the invention is preferably increased at least 10% in comparison with the desired polypeptide alone, preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even at least 100% in comparison with the desired polypeptide alone.
  • polypeptides of the invention may be prepared as a genetic fusion comprising a desired polypeptide and a binding motive where a genetic construct encoding the desired polypeptide and the binding motive in same reading frame is provided with regulatory elements capable of driving expression of the construct in the selected host cell; or it may be prepared by chemical conjuga tion where the desired polypeptide is attached to the binding motive using chemical attachments or conjugation after the polypeptides have been synthetized.
  • Methods for preparing genetic fusions and expression thereof are known in the art and the inven tion is not limited to any particular method, but the skilled person will appreciate that such methods as known in the art may be used according to the invention. Further description of methods of performing genetic fusions and expression thereof is suitable host cells can be found in Ward et al. 1990 Improved production of chymosin in Aspergillus by expression as a glucoamylase-chy- mosin fusion, Nat Biotech 8: 435-440; Arnau et al. 2006 Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins, Prot Expr Purif 48: 1-13 , incor porated herein by reference.
  • the present invention also relates to polynucleotides encoding a polypeptide of the present in vention, as described herein.
  • the techniques used to isolate or clone a polynucleotide include isolation from genomic DNA or cDNA, or a combination thereof.
  • the cloning of the polynucleotides from genomic DNA can be effected, e.g., by using the well-known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York.
  • Other nucleic acid amplification procedures such as ligase chain reaction (LCR), liga tion activated transcription (LAT) and polynucleotide-based amplification (NASBA) may be used.
  • LCR ligase chain reaction
  • LAT liga tion activated transcription
  • NASBA polynucleotide-based amplification
  • Modification of a polynucleotide encoding a polypeptide of the present invention may be neces sary for synthesizing polypeptides substantially similar to the polypeptide.
  • the term“substantially similar” to the polypeptide refers to non-naturally occurring forms of the polypeptide.
  • the present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control se quences.
  • the polynucleotide may be manipulated in a variety of ways to provide for expression of the pol ypeptide. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector.
  • the techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention.
  • the promoter contains transcriptional control sequences that mediate the expression of the polypeptide.
  • the promoter may be any polynucleotide that shows transcriptional activity in the host cell including variant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a bacterial host cell are the promoters obtained from the Bacillus amyloliquefaciens alpha-amylase gene ( amyQ ), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP ), Bacillus stearothermophilus maltogenic amylase gene ( amyM ), Bacillus subtilis levansucrase gene ( sacB ), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis crylllA gene (Agaisse and Lereclus, 1994, Molecular Microbiology 13: 97-107), E.
  • E. coli trc promoter (Egon et ai, 1988, Gene 69: 301-315), Strep- tomyces coelicolor agarase gene ( dagA ), and prokaryotic beta-lactamase gene (Villa-Kamaroff et ai, 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), as well as the tac promoter (DeBoer et ai, 1983, Proc. Natl. Acad. Sci. USA 80: 21-25).
  • promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase ( glaA ), Aspergillus oryzae TAKA amylase, , Aspergillus oryzae or Aspergillus niger translation elongation factor 1 (tef1), Aspergillus oryzae alkaline protease, Aspergillus oryzae those phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amylogluco- sidase (WO 00/56),
  • useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1 , ADH2/GAP), Sac charomyces cerevisiae those phosphate isomerase (TPI), Saccharomyces cerevisiae metallothi- onein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase.
  • ENO-1 Saccharomyces cerevisiae enolase
  • GAL1 Saccharomyces cerevisiae galactokinase
  • ADH1 Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
  • TPI Sacchar
  • the control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription.
  • the terminator is operably linked to the 3’-terminus of the polynucleo tide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.
  • Preferred terminators for bacterial host cells are obtained from the genes for Bacillus clausii alka line protease ( aprH ), Bacillus licheniformis alpha-amylase ( amyL ), and Escherichia coli ribosomal RNA ( rrnB ).
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamyl- ase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium ox- ysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobi- ohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanas
  • Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cere- visiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cere- visiae glyceraldehyde-3-phosphate dehydrogenase.
  • Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
  • control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
  • mRNA stabilizer regions are obtained from a Bacillus thuringiensis crylllA gene (WO 94/25612) and a Bacillus subtilis SP82 gene (Hue et ai, 1995, Journal of Bacteriology 177: 3465-3471).
  • the control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell.
  • the leader is operably linked to the 5’-terminus of the polynucleo tide encoding the polypeptide. Any leader that is functional in the host cell may be used.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, amyB (neutral amylase), those phosphate isomerase (tpiA) and Aspergil lus nidulans tpiA.
  • Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cere visiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde- 3-phosphate dehydrogenase (ADH2/GAP).
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3’-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
  • the control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell’s secretory path way.
  • the 5’-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide.
  • the 5’-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence.
  • a foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence.
  • a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide.
  • any signal peptide coding sequence that directs the expressed poly peptide into the secretory pathway of a host cell may be used.
  • Effective signal peptide coding sequences for bacterial host cells are the signal peptide coding sequences obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus lichen- iformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus alpha-amyl ase, Bacillus stearothermophilus neutral proteases ( nprT , nprS, nprM ), and Bacillus subtilis prsA. Further signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
  • Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus ni- ger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola in- solens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic protein ase.
  • Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cere- visiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et a!., 1992, supra.
  • the control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease ( nprT ), Myceliophthora ther- mophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.
  • the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
  • regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell.
  • regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • Regulatory sequences in prokaryotic systems include the lac , tac, and trp operator systems.
  • yeast the ADH2 system or GAL1 system may be used.
  • the Aspergillus niger glucoamylase promoter In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used.
  • Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.
  • the present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals.
  • the vari ous nucleotide and control sequences may be joined together to produce a recombinant expres sion vector that may include one or more convenient restriction sites to allow for insertion or sub stitution of the polynucleotide encoding the polypeptide at such sites.
  • the polynucle otide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be con veniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vector may be a linear or closed circular plasmid.
  • the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachro- mosomal entity, the replication of which is independent of chromosomal replication, e.g., a plas mid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vector preferably contains one or more selectable markers that permit easy selection of trans formed, transfected, transduced, or the like cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxo- trophs, and the like.
  • bacterial selectable markers are Bacillus licheniformis or Bacillus subtilis dal genes, or markers that confer antibiotic resistance such as ampicillin, chloramphenicol, kanamycin, neo mycin, spectinomycin, or tetracycline resistance.
  • Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1 , and URA3.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylami- noimidazole-succinocarboxamide synthase), adeB (phosphoribosyl-aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltrans- ferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5’-phos- phate decarboxylase), sC (sulfate adenyltransferase), lysF, metF, metG, met H and trpC (an- thranilate synthase), as well as equivalents thereof.
  • adeA phosphoribosylami- noimid
  • Aspergillus cell Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and a Streptomyces hygro- scopicus bar gene.
  • Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.
  • the selectable marker may be a dual selectable marker system as described in WO 2010/039889.
  • the dual selectable marker is an hph-tk dual selectable marker system.
  • the vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
  • the vector may rely on the polynucleotide’s sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination.
  • the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s).
  • the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination.
  • the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • the origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell.
  • the term“origin of replication” or“plasmid replicator” means a polynucleotide that enables a plasmid or vector to replicate in vivo.
  • bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and pUB1 10, pE194, pTA1060, and rAMb1 permitting replication in Bacillus.
  • origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1 , ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.
  • AMA1 and ANSI examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI (Gems et ai, 1991 , Gene 98: 61-67; Cullen et ai., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
  • More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide.
  • An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells con taining amplified copies of the selectable marker gene, and thereby additional copies of the poly nucleotide, can be selected for by cultivating the cells in the presence of the appropriate se lectable agent.
  • the host cell may be a prokaryot or an eukaryot.
  • the prokaryotic host cell may be any Gram-positive or Gram-negative bacterium.
  • Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lacto bacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces.
  • Gram-negative bacteria include, but are not limited to, Campylobacter, E. coli, Flavobacterium, Fusobacterium, Helicobacter, llyobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma.
  • the bacterial host cell may be any Bacillus cell including, but not limited to, Bacillus alkalophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, B. amyloliquefaciens subsp. plantarum, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Ba cillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus methylotrophicus, Bacillus pu- milus, Bacillus safensis, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells.
  • Bacillus alkalophilus Bacillus altitudinis
  • Bacillus amyloliquefaciens Bacillus amyloliquefaciens
  • B. amyloliquefaciens subsp. plantarum Bacillus
  • the bacterial host cell may also be any Streptococcus cell including, but not limited to, Strepto coccus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus equi subsp. Zooepidemicus cells.
  • the bacterial host cell may also be any Streptomyces cell including, but not limited to, Strepto myces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.
  • the introduction of DNA into a Bacillus cell may be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115), competent cell transformation (see, e.g., Young and Spizizen, 1961 , J. Bacteriol. 81 : 823-829, or Dubnau and Davidoff-Abelson, 1971 , J. Mol. Biol. 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotech niques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, J. Bacteriol. 169: 5271- 5278).
  • protoplast transformation see, e.g., Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115
  • competent cell transformation see, e.g., Young and Spizizen, 1961 , J. Bacteriol. 81
  • the introduction of DNA into an E. coli cell may be effected by protoplast transformation (see, e.g., Hanahan, 1983, J. Mol. Biol. 166: 557-580) or electroporation (see, e.g., Dower et a!., 1988, Nucleic Acids Res. 16: 6127-6145).
  • the introduction of DNA into a Streptomyces cell may be effected by protoplast transformation, electroporation (see, e.g., Gong et al., 2004, Folia Mi crobiol. (Praha) 49: 399-405), conjugation (see, e.g., Mazodier et al., 1989, J. Bacteriol.
  • DNA into a Pseudomonas cell may be effected by electroporation (see, e.g., Choi et al., 2006, J. Microbiol. Methods 64: 391-397) or conjugation (see, e.g., Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71 : 51-57).
  • the introduction of DNA into a Streptococcus cell may be effected by natural competence (see, e.g., Perry and Kuramitsu, 1981 , Infect. Immun. 32: 1295-1297), protoplast transformation (see, e.g., Catt and Jollick, 1991 , Microbios 68: 189- 207), electroporation (see, e.g., Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804), or conjugation (see, e.g., Clewell, 1981 , Microbiol. Rev. 45: 409-436).
  • any method known in the art for introducing DNA into a host cell can be used.
  • the host cell may also be a eukaryote, such as a mammalian, insect, plant, or fungal cell.
  • the host cell may be a fungal cell.“Fungi” as used herein includes the phyla Ascomycota, Basid- iomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby’s Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
  • the fungal host cell may be a yeast cell.“Yeast” as used herein includes ascosporogenous yeast ( Endomycetales ), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti ( Bias - tomycetes ). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Pass- more, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
  • the yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as a Kluyveromyces lactis, Saccharomyces carls- bergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kiuyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lip- olytica cell.
  • the fungal host cell may be a filamentous fungal cell.“Filamentous fungi” include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra).
  • the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
  • the filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkan- dera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Ther- moascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
  • the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foeti- dus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Asper gillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium luck- nowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queensland- icum, Chrysosporium tropicum,
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.
  • Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et ai., 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et ai, 1988, Bio/Tech- noiogy Q ⁇ . 1419-1422.
  • Suitable methods for transforming Fusarium species are described by Ma- lardier et ai, 1989, Gene 78: 147-156, and WO 96/00787.
  • Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et ai., 1983, J. Bacterioi. 153: 163; and Hinnen et ai, 1978, Proc. Natl. Acad. Sci. USA 75: 1920.
  • the polypeptide of the invention After preparation of the polypeptide of the invention it is typically recovered from the mixture wherein it has been produced, e.g. if the polypeptide was prepared in a fermentation process the polypeptide is usually recovered from the fermentation broth using a number of separation steps such as filtration, centrifugation, precipitation, solubilization; until the desired purity has been achieved.
  • the polypeptide of the invention may when bound to calcite be released from the calcite using one of the methods 1) lowering the pH of a solution comprising the polypeptide of the invention bound to calcite to a pH value that favors the release of CO2 from dissolved CaCCh; 2) addition of strong chelators, such as EDTA; that have the ability to bind Ca 2+ and thereby dissolve the calcite; and 3) release the polypeptide of the invention by titrating with the binding sequence as synthetic peptide.
  • polypeptide of the invention has been prepared in a chemical attachment or conjugation the polypeptide is recovered from the reaction mixture using usual separation procedures.
  • polypeptide of the invention to bind calcite provides a particularly useful property for the recovery process.
  • the invention provides a method for recovery of the polypeptide of the invention from a fermentation broth, comprising optionally removing the solids, such as cells, cell debris and re maining solids of the substrate; from the fermentation broth, mixing the fermentation broth with sufficient calcite to bind all the polypeptide of the invention, followed by a solid-liquid separation process where the calcite with the polypeptide of the invention attached is separated from the rest of the fermentation broth.
  • the invention also provides a method for recovery of the polypeptide of the invention from a chemical reaction mixture, comprising mixing the reaction mixture with sufficient calcite to bind all the polypeptide of the invention, followed by a solid-liquid separation process where the calcite with the polypeptide of the invention attached is separated from the rest of the reaction mixture.
  • the methods of the invention provides a fast and highly efficient separation of the polypeptide of the invention from the fermentation broth or the reaction mixture where it has been produced.
  • the method of the invention is similar to the affinity-based separation methods as known in the art, in particular in the analytical or small scale production, using affinity pairs such as his-tag, Biotin-streptavidin, antibody-antigen-based purification, but the present invention has the benefit of using calcite as the material that the protein binds to, which is very cheap and nontoxic compared with other binding materials, used in the prior art for releasing tagged poly peptides of the prior art, meaning that the method of the invention is readily useable in large scale industrial recovery processes, e.g.
  • the purification process is amenable to non-column based separation (i.e., using batch or expanded bed adsorption).
  • compositions comprising the polypeptide of the invention
  • the present invention also relates to compositions comprising a polypeptide of the present inven tion.
  • the composition of the invention comprises the polypeptide of the invention attached to calcite.
  • the compositions may comprise a polypeptide of the present invention as the major enzymatic component, e.g., a mono-component composition.
  • the compositions may comprise multiple enzymatic activities, such as one or more (e.g.
  • enzymes selected from the group consisting of hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an alpha- galactosidase, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-gluco- sidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, ester ase, glucoamylase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic en zyme, peroxidase,
  • compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition.
  • PCR amplifications was performed in a volume of 100 pL containing 2.5 units Taq polymerase, 100 ng of pS02, 250 nM of each dNTP, and 10 pmol of each of the two primers de-scribed above in a reaction buffer of 50 mM KCI, 10 mM Tris-HCI pH 8.0, 1.5 mM MgCI2.
  • Amplification was carried out in a Perkin-Elmer Cetus DNA Termal 480, and consisted of one cycle of 3 minutes at 94°C, followed by 25 cycles of 1 minute at 94°C, 30 seconds at 55°C, and 1 minute at 72°C.
  • Aspergillus oryzae COLS1300 ( amyA , amyB, amyC, alpA, nprA, kusA, niaD, niiA, amdS+) was created from A. oryzae PFJ0220 (EP2147107B1) by deleting the promoter and 5' part of both the nitrite reductase (niiA) gene and nitrate reductase (niaD) gene, thereby inactivating their expression (Nielsen M. L. et al. 2006, Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans, Fungal Genetics and Biology vol. 43: 54-64).
  • Aspergillus oryzae COLS1300 transformation was done as described by Christensen et al.; Bio technology 1988 6 1419-1422.
  • A. oryzae mycelia were grown in a rich nutrient broth. The mycelia were separated from the broth by filtration.
  • the enzyme preparation Glucanex ® (Novo- zymes, Bagsvasrd DK) was added to the mycelia in osmotically stabilizing buffer such as 1.2 M MgS0 4 buffered to pH 5.0 with sodium phosphate. The suspension was incubated for 60 minutes at 37degrees C with agitation. The protoplast was filtered through mira-cloth to remove mycelial debris.
  • the protoplast was harvested and washed twice with STC (1.2 M sorbitol, 10 mM CaCh, 10 mM Tris-HCI pH 7.5). The protoplasts were finally re-suspended in 200-1000 pl_ STC.
  • Transformation was done essentially as described in WO 2017/191210 examples 9-11 , with DNA inserts encoding the polypeptide of interest. Selection is based on the ability to grow on Sucrose Medium with nitrate. After 5-7 days of growth at 37 degrees C, stable transformants appeared as vigorously growing and sporulating colonies. Transformants were purified once through conidio- spores.
  • SDS gel used was CriterionTM XT precast gels, 10% Bis-Tris, from BIO-RAD and was run and stained with Coomassie blue as recommend by the manufactory.
  • ZEN-DsRed::sca.1 (DORA2) (SEQ ID NO: 5)
  • DORA2 SEQ ID NO: 5
  • ZEN-DsRed is used as the screening marker for its ability to be secreted from the A. Oryzae cell, as well as its fluorescent properties.
  • Flankl was created by PCR using primers: oKRN-1 1 (5’-ccagaccagcagaggagataatactct, SEQ ID NO: 6) and oKRN-12 (5’- ggtgcggccgcccccagttg, SEQ ID NO: 7) on template plasmid AT1770. Resulting in a fragment of 3625 bp.
  • Flank2 was created by PCR using primers: oKRN-17 (5’- GGCTACTCCGCTCTCGATGAC- GATGACTACCCCAAGGGCtgaacctggcggtagacaatcaat, SEQ ID NO: 8) and oKRN-14 (5’- caaggatacctacagttattcgaaacct, SEQ I D NO: 9) on template plasmid pAT1771. Resulting in frag ment of 3596 bp.
  • Insert was created by PCR using primers: oKRN-15 (5’- attatatacacaactgggggcggccgcac- cATGCGGACTAGGTCG, SEQ ID NO: 10) and oKRN-18 (5’-GTAGTCATCGTCATCGAGAGCG- GAGTAGCCccactggctcccgct, SEQ I D NO: 1 1) on template plasmid pAT1 11 1. Resulting in frag ment of 1542 bp.
  • ZEN- DsRed The purpose of producing a construct containing ZEN-DsRed without a calcite binding sequence is to have a control when comparing protein properties of tagged vs. non- tagged proteins.
  • ZEN- DsRed is used as the screening marker for its ability to be secreted from the A. oryzae cell, as well as its fluorescent properties.
  • Flankl was created by PCR using primers: oKRN-1 1 (5’-ccagaccagcagaggagataatactct, SEQ ID NO: 6) and oKRN-26 (5’- CGACCTAGTCCGCATggtgcggccgcccc, SEQ ID NO: 13) on template plasmid AT1770. Resulting in a fragment of 3640 bp.
  • Flank2 was created by PCR using primers: oKRN-25 (5’- cacagcgggagccagacctggcggtaga- caatcaatc, SEQ ID NO: 14) and oKRN-14 (5’- caaggatacctacagttattcgaaacct, SEQ ID NO: 9) on template plasmid pAT1771. Resulting in fragment of 3569 bp
  • Insert was created by PCR using primers: oKRN-15 (5’- attatatacacaactgggggcggccgcac- cATGCGGACTAGGTCG, SEQ ID NO: 10) and oKRN-27 (5’- tgtctaccgccaggtctggctcccgct, SEQ I D NO: 15) on template plasmid pAT 1 11 1. Resulting in fragment of 1509 bp.
  • Lipase-BS1 contained the sequence:
  • the underlined sequence is a linker sequence sepa rating the lipase sequence from the calcite binding sequence BS1 (SEQ ID NO: 3) in bold.
  • T2 Lipase-BS2 contained the sequence:
  • the underlined sequence is a linker sequence sepa rating the lipase sequence from the calcite binding sequence BS2 (SEQ ID NO: 4) in bold.
  • the underlined sequence is linker sequences separat ing the lipase sequence from the calcite binding sequence BS1 (SEQ ID NO: 3) and BS2 (SEQ ID NO: 4) in bold.
  • T4 Lipase contained the sequence:
  • Supernatants comprising T1-T4 was prepared and the expected mass of the proteins confirmed by LC-MS, confirming the identity and integrity of the constructs.
  • the supernatants comprising T1-T4 were mixed powdered calcite and it was shown that T1-T3 had the calcite binding properties. Further it was demonstrated that the proteins could be released from calcite by treating with EDTA.
  • Purified T1 as prepared in example 4 was contacted with calcite and mixed. The mixture was centrifuged and the supernatant removed. The calcite was washed once with a buffer solution at pH 6.0.
  • T 1 was released from the calcite by treating the calcite with the bound protein with excess of 0.5 M EDTA pH 8.0, 0.2 M NaCI.
  • Example 5 The fractions of Example 5 was analysed for lipase activity using a standard lipase assay. It was shown that the purified T 1 had lipase activity, and further it was confirmed that the EDTA fraction also had lipase activity, which confirms that T1 was capable of binding to calcite, and subsequent be released from calcite by EDTA treatment and still maintained lipase activity.

Abstract

L'invention concerne des protéines ayant des propriétés de liaison à la calcite préparées par fusion d'une protéine à une séquence de liaison à la calcite. L'invention concerne en outre un procédé de récupération de telles protéines à partir de bouillons de fermentation et des compositions comprenant de telles protéines.
PCT/EP2020/054578 2019-02-28 2020-02-21 Protéines de liaison à la calcite WO2020173817A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP19159854.9 2019-02-28
EP19159854 2019-02-28

Publications (1)

Publication Number Publication Date
WO2020173817A1 true WO2020173817A1 (fr) 2020-09-03

Family

ID=65635479

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2020/054578 WO2020173817A1 (fr) 2019-02-28 2020-02-21 Protéines de liaison à la calcite

Country Status (1)

Country Link
WO (1) WO2020173817A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023225459A2 (fr) 2022-05-14 2023-11-23 Novozymes A/S Compositions et procédés de prévention, de traitement, de suppression et/ou d'élimination d'infestations et d'infections phytopathogènes

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (fr) 1986-03-17 1987-09-23 Novo Nordisk A/S Procédé de production de produits protéiniques dans aspergillus oryzae et promoteur à utiliser dans aspergillus
WO1994025612A2 (fr) 1993-05-05 1994-11-10 Institut Pasteur Sequences de nucleotides pour le controle de l'expression de sequences d'adn dans un hote cellulaire
WO1995033836A1 (fr) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides efficaces dans le traitement de maladies cardiovasculaires
WO1996000787A1 (fr) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Systeme d'expression de fusarium non pathogene, non toxicogene, non toxique, et promoteurs et terminateurs utilises dans ce systeme
WO1999043835A2 (fr) 1998-02-26 1999-09-02 Novo Nordisk Biotech, Inc. Procede de production d'un polypeptide dans une cellule de bacille
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
WO2000024883A1 (fr) 1998-10-26 2000-05-04 Novozymes A/S Etablissement et criblage d'une banque d'adn d'interet dans des cellules fongiques filamenteuses
WO2000056900A2 (fr) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoteurs exprimant les genes d'une cellule fongique
US20090029902A1 (en) * 2007-07-26 2009-01-29 Cunningham Scott D Peptides for binding calcium carbonates and methods of use
WO2010039889A2 (fr) 2008-09-30 2010-04-08 Novozymes, Inc. Procédés pour utiliser des gènes de sélection positive et négative dans une cellule de champignon filamenteux
EP2147107B1 (fr) 2007-05-09 2011-07-20 Novozymes A/S Procédé de clonage d'expression, approprié pour sélectionner des clones de bibliothèque produisant un polypeptide d'intérêt
WO2013091801A1 (fr) * 2011-12-20 2013-06-27 Schaefer Kalk Gmbh & Co. Kg Adsorption de biomolécules sur le carbonate de calcium
WO2017191210A1 (fr) 2016-05-04 2017-11-09 Novozymes A/S Édition de génome par crispr-cas9 dans des cellules hôtes fongiques filamenteuses

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (fr) 1986-03-17 1987-09-23 Novo Nordisk A/S Procédé de production de produits protéiniques dans aspergillus oryzae et promoteur à utiliser dans aspergillus
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
WO1994025612A2 (fr) 1993-05-05 1994-11-10 Institut Pasteur Sequences de nucleotides pour le controle de l'expression de sequences d'adn dans un hote cellulaire
WO1995033836A1 (fr) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides efficaces dans le traitement de maladies cardiovasculaires
WO1996000787A1 (fr) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Systeme d'expression de fusarium non pathogene, non toxicogene, non toxique, et promoteurs et terminateurs utilises dans ce systeme
WO1999043835A2 (fr) 1998-02-26 1999-09-02 Novo Nordisk Biotech, Inc. Procede de production d'un polypeptide dans une cellule de bacille
WO2000024883A1 (fr) 1998-10-26 2000-05-04 Novozymes A/S Etablissement et criblage d'une banque d'adn d'interet dans des cellules fongiques filamenteuses
WO2000056900A2 (fr) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoteurs exprimant les genes d'une cellule fongique
EP2147107B1 (fr) 2007-05-09 2011-07-20 Novozymes A/S Procédé de clonage d'expression, approprié pour sélectionner des clones de bibliothèque produisant un polypeptide d'intérêt
US20090029902A1 (en) * 2007-07-26 2009-01-29 Cunningham Scott D Peptides for binding calcium carbonates and methods of use
WO2010039889A2 (fr) 2008-09-30 2010-04-08 Novozymes, Inc. Procédés pour utiliser des gènes de sélection positive et négative dans une cellule de champignon filamenteux
WO2013091801A1 (fr) * 2011-12-20 2013-06-27 Schaefer Kalk Gmbh & Co. Kg Adsorption de biomolécules sur le carbonate de calcium
WO2017191210A1 (fr) 2016-05-04 2017-11-09 Novozymes A/S Édition de génome par crispr-cas9 dans des cellules hôtes fongiques filamenteuses

Non-Patent Citations (51)

* Cited by examiner, † Cited by third party
Title
"Biology and Activities of Yeast", 1980, SOC. APP. BACTERIOL. SYMPOSIUM SERIES
"DNA Cloning: A Practical Approach", 1985, article "I and II"
"Nucleic Acid Hybridization", 1985
AGAISSELERECLUS, MOLECULAR MICROBIOLOGY, vol. 13, 1994, pages 97 - 107
ARNAU ET AL.: "Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins", PROT EXPR PURIF, vol. 48, 2006, pages 1 - 13
B. PERBAL, A PRACTICAL GUIDE TO MOLECULAR CLONING, 1984
BEATRICE DEMARCHI ET AL: "Protein sequences bound to mineral surfaces persist into deep time", ELIFE, vol. 5, 27 September 2016 (2016-09-27), pages e17092, XP055687766, DOI: 10.7554/eLife.17092 *
BUCKLEY ET AL., APPL. ENVIRON. MICROBIOL., vol. 65, 1999, pages 3800 - 3804
BURKE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 98, 2001, pages 6289 - 6294
CATTJOLLICK, MICROBIOS, vol. 68, 1991, pages 189 - 207
CHANGCOHEN, MOL. GEN. GENET., vol. 168, 1979, pages 111 - 115
CHOI ET AL., J. MICROBIOL. METHODS, vol. 64, 2006, pages 391 - 397
CHRISTENSEN ET AL., BIOLTECH-NOLOGY, vol. 6, 1988, pages 1419 - 1422
CHRISTENSEN ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 1419 - 1422
CLEWELL, MICROBIOL. REV., vol. 45, 1981, pages 409 - 436
CULLEN ET AL., NUCLEIC ACIDS RES., vol. 15, 1987, pages 9163 - 9175
DATABASE UniProt [online] 28 February 2018 (2018-02-28), "SubName: Full=transcription factor BIM2-like isoform X4 {ECO:0000313|RefSeq:XP_016547008.1};", XP055687992, retrieved from EBI accession no. UNIPROT:A0A2G2YCV4 Database accession no. A0A2G2YCV4 *
DEBOER, PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 21 - 25
DOWER ET AL., NUCLEIC ACIDS RES., vol. 16, 1988, pages 6127 - 6145
DUBNAUDAVIDOFF-ABELSON, J. MOL. BIOL., vol. 56, 1971, pages 209 - 221
EGON ET AL., GENE, vol. 69, 1988, pages 301 - 315
EVA WEBER ET AL: "GFP Facilitates Native Purification of Recombinant Perlucin Derivatives and Delays the Precipitation of Calcium Carbonate", PLOS ONE, vol. 7, no. 10, 1 January 2012 (2012-01-01), pages e46653 - e46653, XP055056303, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0046653 *
GEMS ET AL., GENE, vol. 98, 1991, pages 61 - 67
GILBERT ET AL.: "Useful proteins from recombinant bacteria", SCIENTIFIC AMERICAN, vol. 242, 1980, pages 74 - 94
GONG ET AL., FOLIA MICROBIOL. (PRAHA, vol. 49, 2004, pages 399 - 405
GUOSHERMAN, MOL. CELLULAR BIOL., vol. 15, 1995, pages 5983 - 5990
HANAHAN, J. MOL. BIOL., vol. 166, 1983, pages 557 - 580
HAWKSWORTH ET AL.: "Ainsworth and Bisby's Dictionary of The Fungi", 1995, CAB INTERNATIONAL, UNIVERSITY PRESS
HUE, JOURNAL OF BACTERIOLOGY, vol. 177, 1995, pages 3465 - 3471
INNIS ET AL.: "PCR: A Guide to Methods and Application", 1990, ACADEMIC PRESS
ITO ET AL., J. BACTERIOL., vol. 153, 1983, pages 163 - 187
KOEHLERTHORNE, J. BACTERIOL., vol. 169, 1987, pages 5271 - 5278
MA-LARDIER ET AL., GENE, vol. 78, 1989, pages 147 - 156
MANN K ET AL: "Ostrich (Struthio camelus) eggshell matrix contains two different C-type lectin-like proteins. Isolation, amino acid sequence, and posttranslational modifications", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - PROTEINS & PROTEOMICS, ELSEVIER, NETHERLANDS, vol. 1696, no. 1, 14 January 2004 (2004-01-14), pages 41 - 50, XP004483644, ISSN: 1570-9639, DOI: 10.1016/J.BBAPAP.2003.09.006 *
MAZODIER, J. BACTERIOL., vol. 171, 1989, pages 3583 - 3585
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
NIELSEN M. L.: "Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans", FUNGAL GENETICS AND BIOLOGY, vol. 43, 2006, pages 54 - 64, XP024918908, DOI: 10.1016/j.fgb.2005.09.005
OREN SHUR ET AL: "A designed, phase changing RTX-based peptide for efficient bioseparations", BIOTECHNIQUES, vol. 54, no. 4, 1 April 2013 (2013-04-01), US, pages 197 - 206, XP055688027, ISSN: 0736-6205, DOI: 10.2144/000114010 *
PERRYKURAMITSU, INFECT. IMMUN., vol. 32, 1981, pages 1295 - 1297
PINEDOSMETS, APPL. ENVIRON. MICROBIOL., vol. 71, 2005, pages 51 - 57
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
ROMANOS ET AL., YEAST, vol. 8, 1992, pages 423 - 488
SAMBROOK ET AL.: "Molecular cloning: A laboratory manual", 1989, COLD SPRING HARBOR LAB.
SHIGEKAWADOWER, BIOTECHNIQUES, vol. 6, 1988, pages 742 - 751
SHIRLY BORUKHIN ET AL: "Screening the Incorporation of Amino Acids into an Inorganic Crystalline Host: the Case of Calcite", ADVANCED FUNCTIONAL MATERIALS, vol. 22, no. 20, 23 October 2012 (2012-10-23), DE, pages 4216 - 4224, XP055330954, ISSN: 1616-301X, DOI: 10.1002/adfm.201201079 *
SIMONENPALVA, MICROBIOLOGICAL REVIEWS, vol. 57, 1993, pages 109 - 137
VILLA-KAMAROFF, PROC. NATL. ACAD. SCI. USA, vol. 75, 1978, pages 1920 - 3731
WANG ET AL: "Recombinant perlucin nucleates the growth of calcium carbonate crystals: Molecular cloning and characterization of perlucin from disk abalone, Haliotis discus discus", COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY PART B: BIOCHEMISTRY AND MOLECULAR BIOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 149, no. 2, 18 October 2007 (2007-10-18), pages 354 - 361, XP022402730, ISSN: 1096-4959 *
WARD ET AL.: "Improved production of chymosin in Aspergillus by expression as a glucoamylase-chymosin fusion", NAT BIOTECH, vol. 8, 1990, pages 435 - 440, XP002013112, DOI: 10.1038/nbt0590-435
YELTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 1470 - 1474
YOUNGSPIZIZEN, J. BACTERIOL., vol. 81, 1961, pages 823 - 829

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023225459A2 (fr) 2022-05-14 2023-11-23 Novozymes A/S Compositions et procédés de prévention, de traitement, de suppression et/ou d'élimination d'infestations et d'infections phytopathogènes

Similar Documents

Publication Publication Date Title
US20190185847A1 (en) Improving a Microorganism by CRISPR-Inhibition
US20240101988A1 (en) Temperature-sensitive cas9 protein
US11174487B2 (en) Stable genomic integration of multiple polynucleotide copies
US20170114091A1 (en) Resolubilization of protein crystals at low ph
US20220275354A1 (en) TEMPERATURE-SENSITIVE RNA- Guided Endonuclease
AU2016282355B2 (en) Method for producing a coffee extract
WO2020173817A1 (fr) Protéines de liaison à la calcite
AU2019382494A1 (en) Polypeptides having lipase activity and use thereof for wheat separation
US20190078097A1 (en) Polynucleotide Constructs For In Vitro and In Vivo Expression
US20220298517A1 (en) Counter-selection by inhibition of conditionally essential genes
EP3728583B1 (fr) Contre-sélection par inhibition de gènes essentiels de manière conditionnelle
US9334493B2 (en) Selection of well-expressed synthetic genes
US20220010305A1 (en) Genome Editing by Guided Endonuclease and Single-stranded Oligonucleotide
US20220025422A1 (en) Improved Filamentous Fungal Host Cells
EP3898985A1 (fr) Expression de protéine en tandem
US20210284991A1 (en) Yeast Cell Extract Assisted Construction of DNA Molecules
WO2022090555A1 (fr) Peptides-leaders et polynucléotides codant pour ceux-ci
WO2024056643A1 (fr) Peptides signal fongiques

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20705087

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20705087

Country of ref document: EP

Kind code of ref document: A1