WO2020168241A1

WO2020168241A1 - X-reactivation modulators and uses thereof

Info

Publication number: WO2020168241A1
Application number: PCT/US2020/018362
Authority: WO
Inventors: Nathan Wilson STEBBINS; Benjamin Andrew PORTNEY; Eric Bruno VALEUR
Original assignee: Flagship Pioneering Inc.
Priority date: 2019-02-15
Filing date: 2020-02-14
Publication date: 2020-08-20

Abstract

Methods of treating a human subject having an X-linked disorder by administering one or more of X-reactivation modulators are described. For example, an HDAC3 modulator may be administered in combination with one or more of a PI3K modulator, a DNMT1 modulator, or an XIST modulator such that expression of an XIST-inactivated gene is altered. Also described are methods for reactivating genes on the inactive X chromosome.

Description

X- REACTIVATION MODULATORS AND USES THEREOF

BACKGROUND

Long non-coding RNAs (IncRNAs) are known to affect gene expression by

transcriptionally silencing X chromosomes. XIST is a IncRNA that represses transcription of genes on the X chromosome during early development and differentiation.

SUMMARY OF THE INVENTION

The invention discloses methods and compositions relating to modulators of X- reactivation.

In one aspect, provided herein is a method of treating a subject having an X-linked disorder, said method comprising administering an effective amount of a histone deacetylase 3 (HDAC3) modulator, a DNA-methyltransferase 1 (DNMT1) modulator, a phosphoinositide 3- kinase (PI3K) modulator, or a combination thereof such that the expression of an XIST- inactivated gene is increased in the subject having the X-linked disorder,

In some embodiments, the subject is a human, non-human primate, mouse, rat, dog, cat, pig, cow, horse, or another animal.

In one embodiment, the X-linked disorder is selected from a group comprising incontinia pigmentosa, X-linked hypophosphatemia, Hypophosphataemic rickets, Goltz syndrome, Rett syndrome, CDKL5 deficiency disorder, Alport syndrome, Fabry's Disease, Dent’s disease, testicular feminization syndrome, Addison’s disease with cerebral sclerosis, adrenal hypoplasis, siderius X-linked mental retardation syndrome, Agammaglobulinaemia, Bruton type,

Choroidoretinal degeneration, Choroidaemia, Albinism (ocular), Dent's disease, fragile X syndrome, Epileptic encephalopathy, Albinism deafness syndrome, paroxysmal nocturnal hemoglobinuria, Aldrich syndrome, hereditary hypochromic Anaemia, sideroblastic Anemia with ataxia, Spinal muscular atrophy 2, Cataract, congenital, peroneal Charcot Marie Tooth disease, Spastic paraplegia, Colour blindness, Diabetes insipidus (nephrogenic), Dyskeratosis congenital, Ectodermal dysplasia (anhidrotic), Faciogenital dysplasia (Aarskog syndrome), Glucose-6-phosphate dehydrogenase deficiency, Glycogen storage disease type VIII, Gonadal dysgenesis (XY female type), Granulomatous disease (chronic), Haemophilia A, Haemophilia B, Hydrocephalus (aqueduct stenosis), Lesch Nyhan syndrome (hypoxanthine-guanine- phosphoribosyl transferase deficiency), Kallmann syndrome, Keratosis follicularis spinulosa, Lowe (oculocerebrorenal) syndrome, Menkes syndrome, Renpenning Syndrome, Mental retardation, with or without fragile site (numerous specific types), Coffin Lowry syndrome, Microphthalmia with multiple anomalies (Lenz syndrome), Muscular dystrophy (Becker, Duchenne and Emery— Dreifuss types), Myotubular myopathy, Night blindness (congenital stationary), Nome's disease (pseudoglioma), Nystagmus (oculomotor or jerky), Orofaciodigital syndrome (type I), Ornithine transcarbamylase deficiency (type I hyperammonaemia),

Phosphoglycerate kinase deficiency, Phosphoribosylpyrophosphate synthetase deficiency, Retinitis pigmentosa, Retinoschisis, Muscular atrophy/Dihydrotestosterone receptor deficiency, Spinal muscular atrophy, Spondyloepiphyseal dysplasia tarda, Thrombocytopenia (hereditary), Thyroxine-binding globulin (absence) and McLeod syndrome.

In one embodiment, the HDAC3 modulator is an agent that localizes HDAC3 to a subcellular region that is not a nucleus, nuclear lamina, subnuclear structure, or a nuclear periphery.

In one embodiment, the HDAC3 modulator is an HDAC3 active site inhibitor.

In one embodiment, the HDAC3 modulator decreases HDAC3 activity by reducing interaction of HD AC 3 with an HD AC 3 associated protein. In one embodiment, the HD AC 3 associated protein is SMRT or NCOR1.

In one embodiment, the HD AC 3 modulator inhibits HD AC 3 mRNA. In one

embodiment, the HDAC3 modulator is an antisense oligo nucleotide (ASO) that targets HDAC3, an siRNA that targets HDAC3, an shRNA that targets HDAC3, or a micro RNA that targets HDAC3

In one embodiment, the HDAC3 modulator inhibits HDAC3 gene expression. In one embodiment, the expression of the HDAC3 gene is inhibited by a non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)— CRISPR associated (Cas) (CRISPR-Cas) system. In one embodiment, the CRISPR-Cas system inhibits the expression of a gene encoding an HDAC3 associated protein.

In one embodiment, the HDAC3 modulator inhibits translation of HDAC3 mRNA.

In one embodiment, the HDAC3 modulator degrades HDAC3 protein.

In one embodiment, the HDAC3 modulator inhibits a molecule associated with HDAC3.

In one embodiment, the molecule associated with HDAC3 is XIST, NCOR1, SMRT and SHARP.

In one embodiment, the HDAC3 modulator is an allosteric inhibitor of HDAC3.

In one embodiment, the HDAC3 modulator is a non-active site inhibitor of HDAC3.

In one embodiment, the HDAC3 modulator is Abexinostat (PCI- 24781), Apicidin (OS 12040), AR-42, Belinostat (PXD101), BG45, BML-210, BML-281, BMN290, BRD0302, BRD2283, BRD3227, BRD3308, BRD3349, BRD3386, BRD3493, BRD4161, BRD4884, BRD6688, BRD8951, BRD9757, BRD9757, CBHA, Chromopeptide A, Citarinostat (ACY-214), CM-414, compound 25, CRA-026440, Crebinostat, CUDC-101, CUDC-907, Curcumin,

Dacinostat (LAQ824), Depudecin, Domatinostat (4SC-202), Droxinostat, Entinostat (MS0275), EVX001688, FR901228, FRM-0334, Givinostat, HDACi-4b, HDACi-109, HPOB, 12, KD5170, LB-205, M344, Martinostat, Merck60 (BRD6929), Mocetinostat (MGCD0103), OBP-801, Oxamflatin, Panobinostat (LBH589), PCI-34051, PCI-48000, Pracinostat (SB939), Pyroxamide, Quisinostat (JNJ-26481585), Resminostat, RG2833 (RGFP109), RGFP963, RGFP966,

RGFP968, Rocilinostat (ACY-1215), Romidepsin (FK228), Scriptaid, sodium phenylbutyrate, Splitomicin, T247, Tacedinaline (CI994), Trapoxin, Trichostatin A (TSA), Tucidinostat

(chidamide), Valproic acid, vorinostat (SAHA), W2, MC1742, MC2625, A8B4, A14B3, A12B4, A14B4, A7B4, or any combination thereof.

In one embodiment, the HDAC3 modulator contains a zinc binding group selected from hydroxamate, benzamide, carboxylate-based, sulfur-based, or an epoxy-ketone moiety.

In one embodiment, the HDAC3 modulator is an antibody, or an antigen binding fragment thereof.

In one embodiment, the HDAC3 modulator is characterized as having a HDAC3 inhibition activity in a HD AC 3 activity assay or a HD AC 3 inhibition assay.

In one embodiment, the subject is administered the HDAC3 modulator in combination with a DNA-methyltransferase 1 (DNMT1) inhibitor, a phosphoinositide 3-kinase (PI3K) inhibitor, an XIST inhibitor, or any combination thereof. In one embodiment, the DNMT1 inhibitor is 5-Azacytidin (5-aza), 5-aza-2'deoxycytidine (5-aza-2'-dc), RG108, SGI- 1027, or any combination thereof. In one embodiment, the DNMT1 inhibitor is characterized as having a DNMT1 inhibition activity in a DNMT activity assay or a DNMT1 inhibition assay.

In one embodiment, the PI3K modulator is selected from a group consisting of GNE317, LY294002, Wortmannin, demethoxyviridin, BEZ235, BGT226, BKM120, BYL719, XL765, XL147, GDC-0941, SF1126, GSK1059615, PX-866, CAL-101, BAY80-6946, GDC-0032, IPI- 145, VS-5584, ZSTK474, SAR245409, and RP6530. In one embodiment, the PI3K modulator activates a gene encoding the methyl-CpG-binding protein (MECP2) on the X chromosome. In one embodiment, the PI3K modulator is an antibody, or an antigen-binding fragment thereof, that specifically binds to PI3K or Protein Kinase B (PKB). In one embodiment, the PI3K modulator is an inhibitory RNA molecule that specifically binds to PI3K or Protein Kinase B (PKB). In one embodiment, the inhibitory RNA is an ASO, an siRNA, an shRNA, a miRNA, or any combination thereof.

In another aspect, provided is a method of activating an epigenetically silenced gene or a hypomorphic X-linked allele on an inactive X-chromosome in a cell, the method comprising contacting the cell with an HDAC3 modulator, a PI3K modulator, a DNMT1 modulator, or a combination thereof, such that the epigenetically silenced gene or the hypomorphic X-linked allele is activated.

In one embodiment, the method further comprises characterizing a transcription of the epigenetically silenced gene or the hypomorphic X-linked allele. In one embodiment, the activated epigenetically silenced gene or the activated hypomorphic X-linked allele has a transcription level that is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% greater than a transcription level of the epigenetically silenced gene on an inactive X- chromosome.

In another embodiment, the method further comprises characterizing a translation of a protein encoded by the epigenetically silenced gene. In one embodiment, the protein level produced by the activated epigenetically silenced gene or the activated hypomorphic X-linked allele is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 10%, at least 15%, at least 20%, at least 30% , at least 40% , at least 50% or at least 60% greater than the protein level produced by the epigenetically silenced gene on an inactive X-chromosome.

In one embodiment, the cell is from a heterozygous female or a hemizygous male.

In one embodiment, the epigenetically silenced gene is an XIST-dependent silenced X chromosome gene.

In yet a further aspect, provided herein is a method of treating a human subject having an X-linked disorder, said method comprising administering an effective amount of a phosphoinositide 3-kinase (PI3K) modulator to the subject having the X-linked disorder such that expression of an XIST-inactivated gene is increased, wherein the PI3K modulator decreases activity of PI3K, and wherein the X-linked disorder is selected from a group comprising incontinia pigmentosa, X-linked hypophosphatemia, Hypophosphataemic rickets, Goltz syndrome, Rett syndrome, CDKL5 deficiency disorder, Alport syndrome, Fabry's Disease, Dent’s disease, testicular feminization syndrome, Addison’s disease with cerebral sclerosis, adrenal hypoplasis, siderius X-linked mental retardation syndrome, Agammaglobulinaemia, Bruton type, Choroidoretinal degeneration, Choroidaemia, Albinism (ocular), Dent's disease, fragile X syndrome, Epileptic encephalopathy, Albinism deafness syndrome, paroxysmal nocturnal hemoglobinuria, Aldrich syndrome, hereditary hypochromic Anaemia, sideroblastic Anemia with ataxia, Spinal muscular atrophy 2, Cataract, congenital, peroneal Charcot Marie Tooth disease, Spastic paraplegia, Colour blindness, Diabetes insipidus (nephrogenic),

Dyskeratosis congenital, Ectodermal dysplasia (anhidrotic), Faciogenital dysplasia (Aarskog syndrome), Glucose-6-phosphate dehydrogenase deficiency, Glycogen storage disease type VIII, Gonadal dysgenesis (XY female type), Granulomatous disease (chronic), Haemophilia A, Haemophilia B, Hydrocephalus (aqueduct stenosis), Lesch Nyhan syndrome (hypoxanthine- guanine-phosphoribosyl transferase deficiency), Kallmann syndrome, Keratosis follicularis spinulosa, Lowe (oculocerebrorenal) syndrome, Menkes syndrome, Renpenning Syndrome, Mental retardation, with or without fragile site (numerous specific types), Coffin Lowry syndrome, Microphthalmia with multiple anomalies (Lenz syndrome), Muscular dystrophy (Becker, Duchenne and Emery— Dreifuss types), Myotubular myopathy, Night blindness (congenital stationary), Nome's disease (pseudoglioma), Nystagmus (oculomotor or jerky), Orofaciodigital syndrome (type I), Ornithine transcarbamylase deficiency (type I

hyperammonaemia), Phosphoglycerate kinase deficiency, Phosphoribosylpyrophosphate synthetase deficiency, Retinitis pigmentosa, Retinoschisis, Muscular

atrophy/Dihydrotestosterone receptor deficiency, Spinal muscular atrophy, Spondyloepiphyseal dysplasia tarda, Thrombocytopenia (hereditary), Thyroxine-binding globulin (absence) and McLeod syndrome.

In one embodiment, the PI3K modulator activates a gene encoding the methyl-CpG- binding protein (MECP2) on the X chromosome. In one embodiment, the PI3K modulator is an antibody, or an antigen-binding fragment thereof, that specifically binds to PI3K or Protein Kinase B (PKB).

In one embodiment, the PI3K modulator is an inhibitory RNA molecule that specifically binds to PI3K or Protein Kinase B (PKB).

In one embodiment, the inhibitory RNA is an ASO, an siRNA, an shRNA, a miRNA, or any combination thereof.

In one embodiment, the subject is administered a DNA-methyltransferase 1 (DNMT1) inhibitor in combination with the PI3K inhibitor.

In one embodiment, the DNMT1 inhibitor is 5-Azacytidin (5-aza), 5-aza-2'deoxycytidine (5-aza-2'-dc), RG108, SGI-1027, or any combination thereof.

In one embodiment, the disorder is Rett syndrome.

Another aspect of the invention, is a method of activating an epigenetically silenced gene or a hypomorphic X-linked allele on an inactive X-chromosome in a cell, the method comprising contacting the cell with a PI3K inhibitor such that the epigenetically silenced gene or the hypomorphic X-linked allele is activated.

In one embodiment, activation is characterized by transcription of the epigenetically silenced gene or the hypomorphic X-linked allele.

In one embodiment, the activated epigenetically silenced gene or the activated hypomorphic X-linked allele has a transcription level that is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 10%, at least 15% , at least 20% , at least 30% , at least 40% , at least 50%, or at least 60% greater than a transcription level of the epigenetically silenced gene or the hypomorphic X-linked allele on an inactive X-chromosome, and wherein the transcription level is determined, e.g., according to a FISH assay or a qPCR.

In one embodiment, the activation is characterized by translation of a protein encoded by the epigenetically silenced gene or the hypomorphic X-linked allele.

In one embodiment, the protein level produced by the activated epigenetically silenced gene or the activated hypomorphic X-linked allele is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 10%, at least 15% , at least 20% , at least 30% , at least 40%, at least 50% or at least 60% greater than the protein level produced by the epigenetically silenced gene or the hypomorphic X-linked allele on an inactive X-chromosome, and wherein the protein level is determined, e.g., according to a western blot assay. In one embodiment, the cell is from a heterozygous female or a hemizygous male.

In one embodiment, the method further comprises contacting the cell with an HDAC3 modulator.

In a further aspect of the invention, provided is a method of treating a human subject having an X-linked disorder, said method comprising administering an effective amount of a DNMT1 modulator to the human subject having the X-linked disorder such that expression of an XIST-inactivated gene is increased and the X-linked disorder is treated, wherein the DNMT1 modulator decreases activity of DNMT1, and wherein the X-linked disorder is selected from a group comprising incontinia pigmentosa, X-linked hypophosphatemia, Hypophosphataemic rickets, Goltz syndrome, Rett syndrome, CDKL5 deficiency disorder, Alport syndrome, Fabry's Disease, Dent’s disease, testicular feminization syndrome, Addison’s disease with cerebral sclerosis, adrenal hypoplasis, siderius X-linked mental retardation syndrome,

Agammaglobulinaemia, Bruton type, Choroidoretinal degeneration, Choroidaemia, Albinism (ocular), Dent's disease, fragile X syndrome, Epileptic encephalopathy, Albinism deafness syndrome, paroxysmal nocturnal hemoglobinuria, Aldrich syndrome, hereditary hypochromic Anaemia, sideroblastic Anemia with ataxia, Spinal muscular atrophy 2, Cataract, congenital, peroneal Charcot Marie Tooth disease, Spastic paraplegia, Colour blindness, Diabetes insipidus (nephrogenic), Dyskeratosis congenital, Ectodermal dysplasia (anhidrotic), Faciogenital dysplasia (Aarskog syndrome), Glucose-6-phosphate dehydrogenase deficiency, Glycogen storage disease type VIII, Gonadal dysgenesis (XY female type), Granulomatous disease (chronic), Haemophilia A, Haemophilia B, Hydrocephalus (aqueduct stenosis), Lesch Nyhan syndrome (hypoxanthine-guanine-phosphoribosyl transferase deficiency), Kallmann syndrome, Keratosis follicularis spinulosa, Lowe (oculocerebrorenal) syndrome, Menkes syndrome, Renpenning Syndrome, Mental retardation, with or without fragile site (numerous specific types), Coffin Lowry syndrome, Microphthalmia with multiple anomalies (Lenz syndrome), Muscular dystrophy (Becker, Duchenne and Emery— Dreifuss types), Myotubular myopathy, Night blindness (congenital stationary), Nome's disease (pseudoglioma), Nystagmus

(oculomotor or jerky), Orofaciodigital syndrome (type I), Ornithine transcarbamylase deficiency (type I hyperammonaemia), Phosphoglycerate kinase deficiency, Phosphoribosylpyrophosphate synthetase deficiency, Retinitis pigmentosa, Retinoschisis, Muscular

In one embodiment, the DNMT1 modulator is 5-Azacytidin (5-aza), 5-aza- 2'deoxycytidine (5-aza-2'-dc), RG108, SGI- 1027, or any combination thereof.

In one embodiment, the DNMT1 modulator is administered in combination with a PI3K inhibitor and/or an HDAC3 inhibitor.

In one aspect of the invention, provided herein a method of activating an epigenetically silenced gene or a hypomorphic X-linked allele on an inactive X-chromosome in a cell, the method comprising contacting the cell with two or more inhibitors selected from a group consisting of a DNMT1 inhibitor, a PI3K inhibitor, and an HDAC3 inhibitor such that the epigenetically silenced gene or the hypomorphic X-linked allele is activated.

In one embodiment, activation is characterized by an increase in transcription level of the epigenetically silenced gene or the hypomorphic X-linked allele.

In one embodiment, the transcription level of the activated epigenetically silenced gene or the hypomorphic X-linked allele is at least 6%, at least 10%, at least 15%, at least 20%, is at least 30%, at least 40%, at least 50% or at least 60% higher than a transcription level of the epigenetically silenced gene or the hypomorphic X-linked allele on an inactive X-chromosome, wherein the transcription level of the epigenetically silenced gene or the hypomorphic X-linked allele is determined, e.g., according to a qPCR assay or a FISH assay.

In one embodiment, activation is characterized by an increase in the protein level of the epigenetically silenced gene or the hypomorphic X-linked allele.

In one embodiment, the protein level of the activated epigenetically silenced gene or the hypomorphic X-linked allele is at least 6%, is least 10%, at least 15% , at least 20% , at least 30% , at least 40% , at least 50% or at least 60% greater than the protein level of the

epigenetically silenced gene or the hypomorphic X-linked allele on an inactive X-chromosome, wherein the protein level is determined, e.g., according to a western blot assay.

In one embodiment, the cell is from a heterozygous female or a hemizygous male.

In embodiment, the silenced gene on the X chromosome is an XIST-dependent silenced X chromosome gene. Also featured is a method of activating an epigenetically silenced gene or a hypomorphic X-linked allele on an inactive X-chromosome in a human subject, the method comprising administering to the human subject a first dose of the DNMT1 modulator, and

administering to the human subject a second dose of the DNMT1 modulator, an HDAC3 modulator, a PI3K modulator or a combination thereof at a time period between 1 to 168 hours after the administration of the first dose of the DNMT1 modulator, such that the epigenetically silenced gene or a hypomorphic X-linked allele on the inactive X-chromosome is activated.

In some embodiments, administration of the second dose of the DNMT1 modulator, an HDAC3 modulator, a PI3K modulator or a combination thereof is between 1 and 144 hours, 1 and 120 hours, 1 and 96 hours, 1 and 72 hours, 1 and 48 hours or 1 and 24 hours after the administration of the first dose of the DNMT1 modulator.

In one embodiment, the PI3K modulator is GNE317, LY294002, Wortmannin, demethoxyviridin, BEZ235, BGT226, BKM120, BYL719, XL765, XL147, GDC-0941, SF1126, GSK1059615, PX-866, CAL-101, BAY80-6946, GDC-0032, IPI-145, VS-5584, ZSTK474, SAR245409, or RP6530.

(chidamide), Valproic acid, vorinostat (SAHA), W2, MC1742, MC2625, A8B4, A14B3, A12B4, A14B4, A7B4, or any combination thereof. In one embodiment, the HDAC3 modulator contains a zinc binding group selected from hydroxamate, benzamide, carboxylate-based, sulfur-based, or an epoxy-ketone moiety.

In one embodiment, the subject is a heterozygous female or a hemizygous male.

In one embodiment, the epigenetically silenced gene on the X chromosome is an XIST- dependent silenced X chromosome gene.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 illustrates a reverse transcription and real-time PCR assay readout in HDAC3 expressing fibroblasts after treatment with siRNA reagent targeting human HDAC3. % scale on the vertical axis indicates normalized % of HDAC3 RNA remaining.

FIG. 2 illustrates a reverse transcription and real-time PCR assay readout in cells that express SMRT/NCOR2 after treatment with siRNA reagent targeting human SMRT. % scale on the vertical axis indicates normalized % of SMRT RNA remaining.

FIG. 3 illustrates a reverse transcription and real-time PCR assay readout in cells that express SHARP after treatment with siRNA reagent targeting human SHARP. % scale on the vertical axis indicates normalized % of SHARP RNA remaining.

FIG. 4 illustrates a western blot of an acetylated histone marker after HDAC3 was inhibited by treating cells with Vorinostat or suberanilohydroxamic acid (SAHA).

FIG. 5 illustrates a reverse transcription and real-time PCR assay readout in DNMT1 expressing fibroblasts after treatment with siRNA reagent targeting human DNMT1. % scale on the vertical axis indicates normalized % of DNMT1 RNA remaining.

FIG. 6 illustrates a dot blot image after treatment of DNMT1 expressing fibroblasts with a DNMT1 inhibitor, decitabine.

FIG. 7 illustrates a reverse transcription and real-time PCR assay readout in cells that express DNMT1 and SHARP after treatment with siRNA reagents targeting human SHARP and human DNMT1. % scale on the vertical axis indicates normalized % of SHARP or DNMT1 RNAs remaining.

FIGS. 8A-8B illustrate a FISH assay that shows the increase in biallelic expression X chromosome.

FIGS. 9A-9B illustrate a FISH assay that shows increased expression of MECP expression. FIG. 10 illustrates X chromosome gene expression after perturbation of HDAC3 and DNMT1. The vertical axis shows the percentage of nuclei in cells treated with HDAC3 and DNMT1 inhibitors.

FIG. 11 illustrates MECP expression after perturbation of HDAC3 and DNMT1. The vertical axis shows the levels of MECP2 RNA transcripts in cells treated with HDAC3 and DNMT1 inhibitors.

DETAILED DESCRIPTION OF THE INVENTION

A. Definitions

The terms“activate” and“activation,” as used herein, refer to expression of a gene. In contrast, an inactivated gene is one in which transcription is silenced, or is at a minimal basal level not associated with activity. Activation of a gene generally refers to active transcription of mRNA from the gene. In some embodiments, activation refers to maintenance of gene expression where a decrease in expression would otherwise be expected. In other embodiments, activation refers to an increase in gene expression than would otherwise be expected, such as from a gene which was previously inactivated.

The term“allosteric inhibitor,” as used herein, refers to a molecule that decreases, inhibits or prevents a function of a protein by targeting a site on the protein which is not the active site of the protein. In some embodiments, an allosteric inhibitor prevents the protein from changing into its active form or becoming functionally active. In some embodiments, an allosteric inhibitor may, for example, lead to a loss of functional activity, subcellular mis- localization, destabilization and/or reduction in the levels of the protein.

The terms“degrade” and“degradation,” as used herein, each refer to the breakdown of a molecule, e.g., a protein (e.g., proteolysis) or a nucleic acid. In some embodiments, degradation refers to a destabilization or modification (e.g., ubiquitination) of a protein or nucleic acid for destruction by cellular machinery (e.g., proteasome) or by chemical methods (e.g., tryptic digestion).

As used herein, the term“DNMT1” is an abbreviation for DNA (cytosine-5- ) methyltransferase 1. Unless specified otherwise, the term“DNMT1” is intended to be inclusive of DNMT1 nucleic acids (DNA and mRNA) and proteins, and refers to human DNMT1 unless otherwise specified. DNMT1 refers to the gene (DNA) encoding the DNMT1 protein. Where DNMT1 protein or mRNA is specifically intended, protein or mRNA will be used in reference to DNMT1, i.e.,“DNMT1 protein” or“DNMT1 mRNA”.

The term“DNMT1 activity”, as used herein, refers to a biological function that is associated with DNMT1 protein. For example, DNMT1 protein catalyzes the methylation of DNA. DNMT1 activity can be measured by any method measuring DNMT1 levels and/or the levels of DNMT1 substrates (e.g., methylated DNA levels) known those in the art. For example, DNMT1 protein activity can be measured by determining the amount of methylated DNA by performing a dot blot analysis.

The term“effective amount” is an amount of an agent sufficient to produce a desired effect. Generally, an“effective amount” depends upon the context in which it is being applied. The term“therapeutically effective amount,” as used herein, is an amount of an agent sufficient to effect a therapeutic beneficial or desired result in a subject, including, for example, an effect at the cellular level or tissue level, or a clinical result. For example, a therapeutically effective amount for treating an X-linked disorder is an amount of a modulator sufficient to achieve a clinically relevant result as compared to a response obtained without administration of the modulator.

The terms“epigenetically silenced gene” and“epigenetic gene silencing,” as used herein, refer to non-mutational gene inactivation. In one embodiment, epigenetic gene silencing is propagated from precursor cells to clones of daughter cells. Examples of epigenetic gene silencing are DNA methylation and modifications of histone tails.

The term“expression” as used herein refers to either or both transcription and translation. Where only transcription is intended, the phrase“gene expression” may be used. Where only translation of a protein is intended, the phrase“protein expression” may be used.

As used herein,“HDAC3” is an abbreviation for histone deacetylase 3, a Class I histone deacetylase (HD AC I) enzyme. Unless specified otherwise, the term“HDAC3” is intended to be inclusive of HDAC3 nucleic acids (DNA and mRNA) and proteins, and is intended to refer to human HDAC3 unless otherwise specified. HDAC3 refers to the gene (DNA) encoding the HDAC3 protein. Where HDAC3 protein or mRNA is specifically intended, protein or mRNA will be used in reference to HDAC3, i.e.,“HDAC3 protein” or“HDAC3 mRNA”.

The term“HDAC3 activity”, as used herein, refers to a biological function that is associated with HDAC3 protein. HDAC3 protein regulates gene expression by catalyzing the removal of acetyl groups from lysine residues in histones. In one instance, HDAC3 acetylates histone H4 at Lys8. HDAC3 activity can be measured by any method measuring HDAC3 levels and/or the levels of HDAC3 substrates known to those in the art. For example, a western blot analysis using antibodies detecting HDAC3 protein can be used to assay HDAC3 activity, where the level of HDAC3 protein would be correlate to the level of HDAC3 activity. In one instance, measurement of an HDAC3 protein substrate could be tested, where Western blot analysis is performed using antibodies histone H4 at Lys8 (H4K8ac) to detect H4 acetylation. Increase or decrease in levels of H4 acetylation would represent an increase or decrease, respectively, of HDAC3 activity.

The term“hypomorphic X-linked allele” refers to a version of a gene on the X

chromosome that results in a reduction or loss of gene function. Such a reduction or loss can result from, for example, reduced or absent gene or protein expression, or reduced or absent functional performance of the gene product.

As used herein, the term“increasing” refers to modulating that results in greater function, expression, or activity of a metric relative to a reference. In contrast, the term“decreasing”, as used herein, refers to modulating that results in lower amounts of function, expression, or activity of a metric relative to a reference. For example, subsequent to administration of a modulator described herein, the amount of a marker of a metric (e.g., target expression) as described herein may be increased or decreased in a subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more relative to the amount of the marker prior to administration. Generally, the metric is measured subsequent to administration at a time that the administration has had the recited effect, e.g., at least one week, one month, 3 months, or 6 months, after a treatment regimen has begun.

The term“inhibitory RNA molecule,” as used herein, refers to a nucleic acid molecule, naturally occurring or chemically synthesized that decreases the expression of a specific gene. For example, an inhibitory RNA molecule can decrease mRNA expression either as an antisense oligo that is complementary to the inhibitory RNA molecule or by binding to a strong or moderate binding site for an RNA-binding protein (e.g., HNRNPU, PUM1, PTBP1) in the genome. The term“kinase modulator”, as used herein, refers to a molecule that is capable of altering the levels and/or activity of a kinase, thereby changing (e.g., decreasing) the function of the kinase (e.g., decreasing phosphorylation activity of the kinase or decreasing levels of kinase mRNA). An example of a kinase modulator is a“kinase inhibitor” which reduces or blocks the ability of the kinase to phosphorylate. Kinases mediate the transfer of a phosphate moiety from a high energy molecule (such as ATP) to their substrate molecule (e.g., PIP2), typically catalyzing the phosphorylation of substrates. Thus, kinase activity can be measured by any method measuring phosphorylation known in the art.

As used herein,“MECP2” is an abbreviation for Methyl-CpG-binding protein 2

(MeCP2). Unless specified otherwise, the term“MECP2” is intended to be inclusive of MECP2 nucleic acids (DNA and mRNA) and proteins, and is intended to refer to human MECP2 unless otherwise specified. MECP2 refers to the gene (DNA) encoding the MECP2 protein. Where MECP2 protein or mRNA is specifically intended, protein or mRNA will be used in reference to MECP2, i.e.,“MECP2 protein” or“MECP2 mRNA”.

The term“MECP2 activity”, as used herein, refers a biological function that is associated MECP2. MECP2 is a chromatin modifying agent that can act as a transcriptional activator or a transcriptional repressor. Loss of function mutations in MECP2 has been implicated in the disease etiology of certain dominant X-linked diseases (e.g., Rett syndrome (RTT)). MECP2 activity can be measured by any method measuring MECP2 levels known to those in the art. For example, a single-molecule RNA fluorescence in situ hybridization (FISH) assay may be performed on cultured fibroblasts expressing MECP2 mRNA using a probe set and conjugated oligos that are specific for MECP2 mRNA and a control autosomal gene, such as ERRB2. Cells treated with FISH probes are then imaged using fluorescence microscopy to quantify the amount of probe present for each target, representing the expression level of MECP2 mRNA.

As used herein, the term“modulator” or“modulating agent” refers to a molecule that is capable of altering the level and/or activity of a target molecule (e.g., HDAC3), e.g., altering production of a gene product (mRNA or protein). For example, an“HDAC3 modulator” refers to a molecule that is capable of altering the levels and/or activity of HDAC3, thereby changing (e.g., decreasing) the function of HDAC3 (e.g., decreasing activity of HDAC3 protein or decreasing levels of HDAC3 mRNA). An example of an HDAC3 modulator is an“HDAC3 inhibitor”. In another example, a“PI3K modulator” refers to a molecule that is capable of altering the levels and/or activity of PI3K, and thereby changing (e.g., decreasing) the activity of PI3K, e.g., reducing levels of PI3K protein or PI3K mRNA). An example of a PI3K modulator is a“PI3K 3 inhibitor”. The term“DNMT1 modulator” refers to a molecule that is capable of altering the levels and/or function of DNMT1, thereby changing (e.g., decreasing) the activity of DNMT1, e.g., reducing levels of DNMT1 protein or DNMT1 mRNA). A“DNMT1 inhibitor” is an example of a DNMT1 modulator that decreases the activity of DNMT1.

The term“non-active site inhibitor,” refers to a molecule that disrupts or prevents a target from interacting directly or indirectly with a molecule(s) associated with the target. This disruption may lead, for example, to a loss of functional activity, mis-localization, destabilization and/or reduction in the levels of the target.

The term“non-selective inhibitor”, refers to a molecule that associates directly or indirectly with a target at a site other than that utilized by the substrate (or a substrate analogue).

"Pharmaceutically acceptable," as used herein, refers a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively nontoxic, i.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

As used herein,“PI3K” is an abbreviation for phosphoinositide 3-kinase. Unless specified otherwise, the term“PI3K” is intended to be inclusive of PI3K nucleic acids (DNA and mRNA) and proteins, and is intended to refer to human PI3K unless otherwise specified. PI3K refers to the gene (DNA) encoding the PI3K protein. Where PI3K protein or mRNA is specifically intended, protein or mRNA will be used in reference to PI3K, i.e.,“PI3K protein” or “PI3K mRNA”.

The term“PI3K activity”, as used herein, refers to a biological function that is associated with PI3K. PI3K protein regulates gene expression by catalyzing the phosphorylation of the inositol ring of phosphatidylinositol at a hydroxyl group in position 3. PI3K activity can be measured by any method measuring PI3K levels and/or the levels of PI3K substrates (e.g., Phosphatidylinositol 4,5-bisphosphate, referred to as PIP2) known to those in the art. For example, a PI3-kinase activity ELISA assay using PIP2 substrate, and control standards can be used to assay PI3K activity. PI3K activity can be measured by measuring the levels

of phosphatidylinositol 3,4,5 trisphosphate (PIP3) produced in the assay. As used herein, the term“reactivation” refers to increased gene expression over a repressed state of the gene. In one embodiment, reactivation results in complete or partial reversal. In one embodiment, reactivation of a silenced gene allows for expression of the gene. “X-reactivation” refers to increased gene expression over a repressed state of the gene which is located on an X-chromosome. In one embodiment, X-reactivation results in reactivation of a silenced gene on the X-chromosome. In one embodiment, reactivation is a partial or complete reversal of gene expression resulting in a clinical benefit for a subject having an X-linked disorder.

The term“selective inhibitor”, refers to a molecule that competes with a target molecule’s substrate (or a substrate analogue) for the binding site(s) on the target molecule.

As used herein, a“subject” refers to an organism, for example, a mammal (e.g., a human, a non-human mammal, a non-human primate, a primate, a laboratory animal, a mouse, a rat, a hamster, a cat, or a dog). In one embodiment a subject is a human subject. A subject can be male or female. In one embodiment, a subject is a male or female who has a sex chromosome disorder.

The term“treat” and“treatment” refers to the medical management of a subject with the intent to improve, ameliorate, stabilize (i.e., not worsen), prevent or cure a disease, pathological condition, or disorder. This term includes active treatment (treatment directed to improve the disease, pathological condition, or disorder), causal treatment (treatment directed to the cause of the associated disease, pathological condition, or disorder), palliative treatment (treatment designed for the relief of symptoms), preventative treatment (treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder); and supportive treatment (treatment employed to supplement another therapy). Treatment also includes diminishment of the extent of the disease or condition;

preventing spread of the disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable.“Ameliorating” or“palliating” a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment. Treatment does not require the complete amelioration of a symptom or disease and encompasses embodiments in which one reduces symptoms and/or underlying risk factors. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder, as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented. The term“prevent” does not require the 100% elimination of the possibility of an event. Rather, it denotes that the likelihood of the occurrence of the event has been reduced in the presence of the compound or method.

As used herein,“XIST” refers to X inactive specific transcript. XIST is an RNA molecule that is involved in X-inactivation. XIST is the RNA product of the XIST gene. XIST refers to the gene (DNA) encoding XIST (the XIST gene product). Other names for XIST include DXS1089, DXS399E, LINCOOOOl, NCRNAOOOOl, SXI1, swd66, and X inactive specific transcript (non-protein coding). As used herein, XIST refers to human XIST unless otherwise specified.

As used herein, the phrase“XIST-dependent X chromosome gene” refers to a gene located on an X chromosome that undergoes XIST-mediated X chromosome inactivation.

The term“XIST-inactivated gene” refers to a gene on the X-chromosome that is silenced, downregulated and/or inhibited by XIST. Generally, XIST-mediated gene silencing is known to involve transcriptional silencing of one or more genes on the X-chromosome by excluding RNA Polymerase II (Pol-II), and repositioning active genes into transcriptionally silenced nuclear compartments.

The term“X-linked disorder” or“X-linked disease,” as used herein, refers to a condition in a subject caused by a defect(s) and/or a mutation(s) on the subject’s X-chromosome. X-linked disorders occur in both males and females. In males, mutations in an existing X-chromosome may result in an X-linked disorder. In females, a defective gene on the active X chromosome may result in an X-linked disorder.

The present disclosure provides compositions and methods for modulating X-reactivation in order to increase expression of repressed genes on an inactive X chromosome. Examples of such modulators are described below and include HDAC3 modulators, DNMT1 modulators, kinase modulators, and XIST modulators. B. HDAC3 Modulators

Human HDAC3 is a 428 amino acid protein but its histone deacetylase activity is reported to be encompassed within residues 1-379, particularly in an active site comprising residues including but not limited to Hisl34, Hisl35 Aspl70, Hisl72, Asp259, Arg265, Lys266, and Tyr298. A human HDAC3 gene is described in NCBI Gene ID: 8841, NCBI Gene

Reference Sequence: NG_029678.2; a human HDAC3 transcript is described in NCBI RNA Transcript Reference Sequence: NM_003883.4; and a human HDAC3 protein is described in NCBI Protein Reference Sequence: NP_004983.1 and a UniProtKB ID - 01537

An HDAC3 modulator may be used to reactivate genes whose expression is repressed on an X chromosome. An HDAC3 modulator may diminish the deacetylase activity of HDAC3 and/or disrupt or prohibit the binding of HDAC3 with SMRT, thereby inhibiting XIST mediated gene silencing.

In some instances, an HDAC3 modulator is used to inhibit the activity, stability, assembly, proper subcellular localization and/or expression of HDAC3. HDAC3 modulation can be used in a therapeutic method, wherein the HDAC3 modulator is administered to a human subject in need thereof (e.g., a subject having an X-linked disorder), resulting in expression of an X-inactivated gene and thereby treating the subject therein. Thus, activity of HDAC3 can be inhibited by administration of an HDAC3 modulator described herein. In some instances, an HDAC3 modulation completely inhibits HDAC3 activity, such that HDAC3 activity not detectable according to methods known in the art. Alternatively, an HDAC3 modulator can inhibit HD AC 3 activity by at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In other instances, HDAC3 is inhibited by at least about 60%, 70%, or 80% by an HDAC3 modulator described herein.

An HDAC3 modulator may exhibit simultaneous activation of activity, stability, assembly, and/or expression of HDAC3 in cells or tissue other than the target cells or target tissue. In some embodiments of the invention, this nonspecific binding does not significantly affect the inhibitory function of HDAC3 modulator in target cells or target tissue and results in no significant adverse effects in the subject.

Inhibition HDAC3 can result in the decrease, suppression or attenuation of activity of a biological pathway, or a biological activity, such as XIST dependent gene silencing, e.g., by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control subject, or compared to the corresponding activity in a subject before the subject is treated with the modulator. Inhibition of HDAC3 can also result in the activation, de-repression, expression (e.g., expression of mRNA, expression of protein), of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex. Gene activation (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator. Gene activation (e.g., expression of mRNA, expression of protein) of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator.

In some instances, partial inhibition of HDAC3 activity results in the complete activation of one or more genes silenced by XIST silencing complex. For example, inhibition of HDAC3 activity by the HDAC3 modulator to at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% relative to HDAC3 level in the corresponding untreated cell, tissue or subject results in the increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) on the inactive X-chromosome (e.g., silenced by XIST silencing complex) to at least a level in a subject, cell or tissue, expressing the gene normally. Complete gene activation (e.g., expression of mRNA, expression of protein) of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator. In other instances, partial inhibition of the HDAC3 activity results in the substantial activation of one or more genes silenced by XIST silencing complex. For example, inhibition of HDAC3 activity by the HDAC3 modulator to at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% relative to HDAC3 level in the corresponding untreated cell, tissue or subject results in at least 1-fold, at least 2-fold, at least 5-fold, at least 10- fold, at least 50-fold, at least 100- fold, at least 500-fold, at least 1000 fold increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) on the inactive X-chromosome (e.g., silenced by XIST silencing complex) compared to the untreated cell tissue or subject where the HDAC3 modulator was not administered. In some other instances, full inhibition of the HDAC3 activity results in the complete activation of one or more genes silenced by XIST silencing complex. For example, 100% inhibition of HDAC3 activity by the HDAC3 modulator results in the increased expression (e.g., expression of mRNA, expression of protein) of a silenced gene (e.g., MECP2, ATRX, CDLK5) on the inactive X-chromosome (e.g., silenced by XIST silencing complex) to at least a level in a subject, cell or tissue, expressing the gene normally. Substantial gene activation (e.g., expression of mRNA, expression of protein) of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator.

In other instances, inhibition of the HDAC3 activity results in the substantial activation (e.g., expression of mRNA, expression of protein) of one or more genes silenced by XIST silencing complex. For example, inhibition of HDAC3 activity by the HDAC3 modulator in a cell, tissue or subject results in at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100- fold, at least 500-fold, at least 1000 fold increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) compared to the corresponding untreated cell tissue or subject where the HDAC3 modulator was not administered.

Routine methods known in the art can be used to measure the percent inhibition of HDAC3 activity (e.g., HDAC3 deacytylase activity) including, but not limited to, measuring HDAC3 expression by determining the HDAC3 RNA level using qPCR analysis as disclosed in Example 1, measuring HDAC3 protein by western blot analysis or measuring levels of histone H4 acetylation in cell culture by western blot. Similarly, routine methods can be used to measure the percent activation and or increased expression of the silenced gene after treatment with HDAC3 modulator, including, but not limited to, measuring gene expression by determining the mRNA levels using qPCR analysis, measuring the silenced gene product (e.g., protein) by western blot analysis.

In some instances, the methods described herein reversibly modulate HDAC3 activity and/or localization of HDAC3. For example, administration of HDAC3 modulator to a cell, tissue or subject may transiently modulate HDAC3 activity or expression, e.g., a modulation that persists for no more than about 30 mins to about 14 days after administration of the modulator, or no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, or any time there between, after the administration of the modulator.

In some instances, the methods described herein irreversibly modulate HDAC3 activity and/or localization of HDAC3. For example, administration of HDAC3 modulator to a cell, tissue or subject may irreversibly or stably modulate HDAC3 activity or expression, e.g., a modulation that persists for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or longer or any time there between, after administration of the modulator. i. HDAC3 modulators targeting HDAC3 mRNA

In some instances, the methods described herein relate to the modulation of HDAC3 expression that results in the reactivation of the genes silenced by XIST silencing complex. In some instances, the HDAC3 modulator described herein is an inhibitory oligonucleotide.

Inhibitory oligonucleotides described herein may interfere with HDAC3 DNA, mRNA and/or protein.

In some instances, an inhibitory oligonucleotide is an antisense oligonucleotide (ASO). The ASOs described herein is at least partially complementary to a target RNA or DNA molecule. ASOs described herein can be short or long. The ASOs described herein may be from 8 to 200 nucleotides in length, in some instances between 10 and 100, in some instances between 12 and 50. The oligonucleotides of the present invention are, in some instances, single stranded, chemically modified and synthetically produced. In some instances, ASOs described herein may be modified to include high affinity RNA binders (e.g., locked nucleic acids (LNAs)) as well as chemical modifications. In one instance, the ASO comprises one or more residues that are modified to increase nuclease resistance, and/or to increase the affinity of the ASO for the target sequence (e.g., HDAC3 mRNA). In a specific instance, the ASO comprises a nucleotide analogue. In some instances, the ASO may be expressed inside a target cell, such as a neuronal cell, from a nucleic acid sequence, such as delivered by a viral (e.g. lentiviral, AAV, or adenoviral) or non-viral vector. In an important aspect of the present invention, an ASO, in some instances, single- stranded, is administered to a subject having a X-linked disorder such that the X-linked disorder (e.g., Rett syndrome) is treated or cured.

In some instances, an inhibitory oligonucleotide is an inhibitory RNA molecule (RNAi) that can inhibit HDAC3 mRNA expression through the biological process of RNA interference. RNAi comprise RNA or RNA-like structures typically containing 15-50 base pairs (such as about 18-25 base pairs) and having a nucleobase sequence identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene within the cell (e.g., HDAC3 mRNA). RNAi comprise a sequence substantially complementary, or fully complementary, to all or a fragment of a target gene (e.g., HDAC3 mRNA). RNAi may complement sequences at the boundary between introns and exons to prevent the maturation of newly-generated nuclear RNA transcripts of specific genes (e.g., HDAC3 gene) into mRNA for transcription. RNAi complementary to specific genes can hybridize with the mRNA for that gene and prevent its translation. RNAi can be administered to the cell, tissue or the subject as“ready- to-use” RNA synthesized in vitro or as an antisense gene transfected into cells which will yield RNAi upon transcription. Hybridization of RNAi with mRNA results in degradation of the hybridized molecule by RNAse H and/or inhibition of the formation of translation complexes, resulting in an inhibition or decrease in the expression of the gene targeted by RNAi. The length of the RNAi molecule that hybridizes to the target transcript is around 10 nucleotides, is between about 15 or 30 nucleotides, or is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,

30 or more nucleotides. The degree of identity of the antisense sequence to the target transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. RNAi described herein may also comprise overhangs, e.g., 3' and/or 5' overhangs of about 1-5 bases independently on each of the sense strands (strand to which the RNAi hybridizes) and antisense strands (strand complementary to which the RNAi hybridizes). In one embodiment, both the sense strand and the antisense strand contain 3' and 5' overhangs. The sense and antisense strands of an RNAi molecule may or may not contain the same number of nucleotide bases. The antisense and sense strands may form a duplex wherein the 5' end only has a blunt end, the 3' end only has a blunt end, both the 5' and 3' ends are blunt ended, or neither the 5' end nor the 3' end are blunt ended. In another embodiment, one or more of the nucleotides in the overhang contains a thiophosphate, phosphorothioate, deoxynucleotide inverted (3' to 3' linked) nucleotide or is a modified ribonucleotide or deoxynucleotide. RNAi are readily designed and produced by technologies known in the art. In addition, there are computational tools that increase the chance of finding effective and specific sequence motifs (Pei et al. 2006, Reynolds et al. 2004,

Khvorova et al. 2003, Schwarz et al. 2003, Ui-Tei et al. 2004, Heale et al. 2005, Chalk et al.

2004, Amarzguioui et al. 2004). RNAi include, but are not limited to: short interfering RNAs (siRNAs), short hairpin RNAs (shRNA), micro RNAs (miRNAs) and double-strand RNAs (dsRNA).

In one instance, the disclosure includes a siRNA composition to inhibit expression of HDAC3, e.g., a siRNA specific for HDAC3 mRNA that upon binding to HDAC3 mRNA, inhibits HDAC3 expression and results in the reactivation of a gene silenced by XIST silencing complex. HDAC3 specific siRNA sequences include AAAGCGAUGUGGAGAUUUA

(SEQ.ID. NO.l) and GCACCCGCAUCGAGAAUCA (SEQ.ID. NO.2). siRNAs recruit RISC (RNA-Induced Silencing Complex), a multiprotein complex, to cleave and downregulate target genes. In one instance, siRNA comprises a nucleotide sequence that is identical to about 10 to about 40, in some instances about 15 to 30, in some instances about 20 to 25, contiguous nucleotides of the target mRNA (e.g., HDAC3 mRNA). In some embodiments, the siRNA sequence commences with the dinucleotide AA, comprises a GC-content of about 30-70% (about 30-60%, about 40-60%, or about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target mRNA in the cell, tissue or subject in which it is to be introduced. The percent identity can be, for example, determined by a standard BLAST search.

In some instances, an shRNA is used to inhibit expression of HDAC3, e.g., a shRNA CUAGGGCAAGGAGCAACCCAGCUGAUCUAGAGGAUCAGCUGGGUUGCUCCUUGCU UUUU- mature antisense sequence (SEQ.ID. NO.3),

UC AGCUGGGUU GCUCCUU GC ATAGGT ACC ATTGTC AGGC (SEQ.ID. N0.4) specifically binding and inhibiting HDAC3 mRNA which results in the reactivation of a gene silenced by XIST silencing complex.

In yet another instance, miRNA composition is used to inhibit expression of HDAC3, e.g., a miRNA UAACACUUGUUAAAGAUCCUUA (SEQ.ID. NO.5) specifically binding and inhibiting HDAC3 mRNA which results in the reactivation of a gene silenced by XIST silencing complex. miRNAs reduce protein output through translational suppression or polyA removal and mRNA degradation (Wu et al., Proc Natl Acad Sci USA 103:4034-4039, 2006). Known miRNA binding sites are within mRNA 3' UTRs; miRNAs seem to target sites with near-perfect complementarity to nucleotides 2-8 from the miRNA's 5' end (Rajewsky, Nat Genet 38

Suppl:58-13, 2006; Lim et al., Nature 433:769-773, 2005). This region is known as the seed region. In some embodiments, siRNAs can function as miRNAs and vice versa (Zeng et al., Mol Cell 9:1327-1333, 2002; Doench et al., Genes Dev 17:438-442, 2003).

In some instances, an inhibitory nucleic acid described herein is chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the inhibitory nucleic acid. Such moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let, 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues

(Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49- 54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or tri ethyl ammonium 1 ,2- di-O-hexadecyl- rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain

(Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim.Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a carbohydrate (Prakash et al., Nucl. Acids Res, 2014, 8796-8801), or a peptide (Ammala et al., Sci. Adv., 2018, 4, eaat3386). See also US patent nos. 4,828,979; 4,948,882; 5,218,105;

5,525,465; 5,541,313; 5,545,730; 5,552, 538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109, 124; 5, 118,802; 5,138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762, 779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582;

4,958,013; 5,082, 830; 5, 112,963; 5,214, 136; 5,082,830; 5, 112,963; 5,214, 136; 5, 245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391, 723;

5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5, 565,552; 5,567,810; 5,574,142;

5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599, 928; 5,688,941 and

PCT/US2017/031010 each of which is herein incorporated by reference.

In one embodiment, an HDAC3 modulator is an indirect modulator and inhibits HDAC3 by degrading mRNA of HDAC3-associated proteins (e.g., SMRT, NCOR1). In one instance, indirect contact refers to the contact made by the modulator with molecules associated with HDAC3. For example, the modulator may contact molecules including but not limited to one or more of SHARP, SMRT, and NCOR1. In one aspect, an ASO, in some instances, single- stranded, decrease, destabilize or inhibits one or more molecules associated with HDAC3 and required for the formation and /or maintenance of the XIST silencing complex (e.g., SMRT, SHARP). In another aspect, an ASO, in some instances, single-stranded, decrease, destabilize or inhibits one or more molecules associated with HDAC3 but may not be required for the formation and /or maintenance of the XIST silencing complex (e.g., NCOR1). Similarly, in one instance, the disclosure includes a siRNA composition to inhibit expression of SMRT, e.g., a siRNA specific for SMRT mRNA that upon binding to SMRT mRNA, inhibits SMRT expression and results in the reactivation of a gene silenced by XIST silencing complex. In another instance, the disclosure includes a siRNA composition to inhibit expression of NCOR1, e.g., a siRNA specific for NCOR1 mRNA that upon binding to NCOR1 mRNA, inhibits NCOR1 expression. In other instance, the disclosure includes a shRNA composition to inhibit expression of SMRT, e.g., a shRNA specific for SMRT mRNA that upon binding to SMRT mRNA, inhibits SMRT expression and results in the reactivation of a gene silenced by XIST silencing complex. In another instance, the disclosure includes a shRNA composition to inhibit expression of NCOR1, e.g., a shRNA specific for NCOR1 mRNA that upon binding to NCOR1 mRNA, inhibits NCOR1 expression. In a specific instance, the disclosure includes a miRNA

composition to inhibit expression of SMRT, e.g., a miRNA specific for SMRT mRNA that upon binding to SMRT mRNA, inhibits SMRT expression and results in the reactivation of a gene silenced by XIST silencing complex. In one instance, the disclosure includes a miRNA composition to inhibit expression of NCOR1, e.g., a miRNA specific for NCOR1 mRNA that upon binding to NCOR1 mRNA, inhibits NCOR1 expression. ii. HDAC3 modulators targeting HDAC3

In some instances, an HDAC3 modulator disrupts HDAC3 or disrupts one or more genes or molecules associated with HDAC3 (e.g., SMRT, NCOR1). Non-limiting exemplary gene disrupting systems include the clustered regulatory interspaced short palindromic repeat

(CRISPR) system, zinc finger nucleases (ZFNs), and Transcription Activator- Like Effector- based Nucleases (TALEN). CRISPR-based methods are described, e.g., in Gaj et al. Trends Biotechnol. 31.7 (2013):397-405; CRISPR methods of gene editing are described, e.g., in Guan et al., Application of CRISPR-Cas system in gene therapy: Pre-clinical progress in animal model. DNA Repair 2016 Jul. 30; Zheng et al., Precise gene deletion and replacement using the

CRISPR/Cas9 system in human cells. BioTechniques, Vol. 57, No. 3, September 2014, pp. 115- 124.

In one instance, the HDAC3 modulator is a CRISPR- Cas system with a 20 bp guide RNA (gRNA) complementary to the HDAC3 gene and a Cas nuclease (e.g., Cas9). In one example, residues 14-27 of the HDAC3 open reading frame (ORF) are targeted using CRISPR- Cas 9 system to generate indel mutations leading to a frameshift in the HDAC3 ORF

(AHDAC3). Using an X-chromosome silencing assay, cell expression of the ATRX gene can be measured using wild type (WT) HDAC3 and AHDAC3. Cells with WT HDAC3 will not express ATRX from the inactive X chromosome, and cells with AHDAC3 inhibit the XIST silencing complex and express X-reactivated allele of the gene ATRX. In another instance, an HDAC3 modulator is a CRISPR- Cas system with a 20 bp guide RNA (gRNA) complementary to the SMRT gene and a Cas nuclease (e.g., Cas9). CRISPR systems use RNA-guided nucleases termed CRISPR-associated or“Cas” endonucleases (e. g., Cas9 or Cpfl) to cleave foreign DNA. In a typical CRISPR/Cas system, an endonuclease is directed to a target nucleotide sequence (e. g., a HDAC3 gene) by sequence-specific, non-coding“guide RNAs” that target single- or double-stranded DNA sequences. Three classes (I-III) of CRISPR systems have been identified. The class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). One class II CRISPR system includes a type II Cas endonuclease such as Cas9, a CRISPR RNA (“crRNA”), and a trans-activating crRNA (“tracrRNA”). The crRNA contains a“guide RNA”, typically about 20-nucleotide RNA sequence that corresponds to a target DNA sequence. The crRNA also contains a region that binds to the tracrRNA to form a partially double- stranded structure which is cleaved by RNase III, resulting in a crRNA/tracrRNA hybrid. The

crRNA/tracrRNA hybrid then directs the Cas9 endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence must generally be adjacent to a“protospacer adjacent motif’ (“PAM”) that is specific for a given Cas endonuclease; however, PAM sequences appear throughout a given genome. CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; examples of PAM sequences include 5'-NGG

(Streptococcus pyogenes), 5'-NNAGAA (Streptococcus thermophilus CRISPR1), 5'-NGGNG (Streptococcus thermophilus CRISPR3), and 5'-NNNGATT (Neisseria meningitis). Some endonucleases, e. g., Cas9 endonucleases, are associated with G-rich PAM sites, e. g., 5'-NGG, and perform blunt-end cleaving of the target DNA at a location 3 nucleotides upstream from (5' from) the PAM site. Another class II CRISPR system includes the type V endonuclease Cpfl, which is smaller than Cas9; examples include AsCpfl (from Acidaminococcus sp.) and LbCpfl (from Lachnospiraceae sp.). Cpfl -associated CRISPR arrays are processed into mature crRNAs without the requirement of a tracrRNA; in other words, a Cpfl system requires only the Cpfl nuclease and a crRNA to cleave the target DNA sequence. Cpfl endonucleases, are associated with T-rich PAM sites, e. g., 5'-TTN. Cpfl can also recognize a 5'-CTA PAM motif. Cpfl cleaves the target DNA by introducing an offset or staggered double-strand break with a 4- or 5- nucleotide 5' overhang, for example, cleaving a target DNA with a 5-nucleotide offset or staggered cut located 18 nucleotides downstream from (3' from) from the PAM site on the coding strand and 23 nucleotides downstream from the PAM site on the complimentary strand; the 5-nucleotide overhang that results from such offset cleavage allows more precise genome editing by DNA insertion by homologous recombination than by insertion at blunt-end cleaved DNA. See, e. g., Zetsche et al. (2015) Cell, 163:759-771.

A variety of CRISPR associated (Cas) genes or proteins can be used in the context of the methods described herein and the choice of Cas protein will depend upon the particular target gene in a cell, tissue or subject. Non-limiting examples of Cas proteins include class II systems including Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Cpfl, C2C1, or C2C3. In some instance, a Cas protein, e.g., a Cas9 protein, may be from any of a variety of prokaryotic species. In some specific instance, a particular Cas protein, e.g., a particular Cas9 protein, is selected to recognize a particular protospacer-adjacent motif (PAM) sequence. In some instances, the targeting moiety includes a sequence targeting polypeptide, such as an enzyme, e.g., Cas9. In certain instances, a Cas protein, e.g., a Cas9 protein, may be obtained from a bacteria or archaea or synthesized using known methods. In certain specific instances, a Cas protein may be from a gram positive bacteria or a gram negative bacteria. In these instances, a Cas protein may be from a Streptococcus, (e.g., a S. pyogenes, a S. thermophilus) a Crptococcus, a Corynebacterium, a Haemophilus, a Eubacterium, a Pasteurella, a Prevotella, a Veillonella, or a Marinobacter. In some embodiments nucleic acids encoding two or more different Cas proteins, or two or more Cas proteins, may be introduced into a cell, zygote, embryo, or animal, e.g., to allow for recognition and modification of sites comprising the same, similar or different PAM motifs.

In some instances, the Cas protein is modified to deactivate the nuclease, e.g., nuclease- deficient Cas9, and to induce epigenetic modifications to the target gene, e.g., epigenetically silence HDAC3, epigenetically silence SMRT. Epigenetic modifying agents useful in the methods described herein include agents that affect, e.g., DNA methylation, histone acetylation, and RNA-associated silencing. In some instances, the methods described herein involve sequence-specific targeting of an epigenetic enzyme (e.g., HDAC3, DNMT1). HDAC3 may be altered to increase or decrease epigenetic modification (e.g., increasing methylation of HDAC3 and silencing its expression by impeding the binding of transcriptional proteins). In one instance, an HDAC3 modulator is a CRISPR- dCas system with a 16-17 bp guide RNA (gRNA) complementary to the HDAC3 gene and an inactivated dCas nuclease (e.g., dCas9). In another instance, an HDAC3 modulator is a CRISPR- dCas system with a 16-17 bp guide RNA (gRNA) complementary to the SMRT gene and an inactivated dCas nuclease (e.g., dCas9). In these specific instances described herein, the Cas nuclease is enzymatically inactive, e.g., a dCas9, and does not cut the target DNA but interferes with transcription by steric hindrance. In some instances, an inactivated dCas9 described herein is conjugated to an epigenetic modifying agent (e.g., DNA methylase) to form a chimeric protein. For example, fusions of a catalytically inactive endonuclease e.g., a dead Cas9 (dCas9) tethered with all or a portion of (e.g., biologically active portion of) an (one or more) effector domain create chimeric proteins that can be guided to specific DNA sites by one or more RNA sequences (e.g., gRNA) to modulate activity and/or expression of one or more target nucleic acids sequences (e.g., to methylate or demethylate a HDAC3 sequence). In some instances, fusion of a dCas9 with all or a portion of one or more effector domains of an epigenetic modifying agent (such as a DNA methylase or enzyme with a role in DNA demethylation) creates a chimeric protein that is useful in the methods described herein. Accordingly, in some instance, a nucleic acid encoding a dCas9- methylase fusion is administered to a subject in need thereof in combination with a site-specific gRNA or antisense DNA oligonucleotide that targets the HDAC3, SMRT or NCOR 1 gene, thereby decreasing expression of the target genes. In some instance, all or a portion of one or more methylase, or enzyme with a role in DNA demethylation, effector domains are fused with the inactive nuclease, e.g., dCas9. In other aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more methylase, or enzyme with a role in DNA demethylation, effector domains (all or a biologically active portion) are fused with dCas9. The chimeric proteins described herein may also comprise a linker, e.g., an amino acid linker. In some aspects, a linker comprises 2 or more amino acids, e.g., one or more GS sequences. In some aspects, fusion of Cas9 (e.g., dCas9) with two or more effector domains (e.g., of a DNA methylase or enzyme with a role in DNA demethylation) comprises one or more interspersed linkers (e.g., GS linkers) between the domains. In some aspects, dCas9 is fused with 2-5 effector domains with interspersed linkers.

CRISPR technology for editing the genes of eukaryotes is disclosed in US Patent Application Publications 2016/0138008 A 1 and US2015/0344912A1, and in U.S. Pat. Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418,

8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. Cpfl endonuclease and

corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016/0208243 Al. iii. HD AC modulators targeting HDAC3 protein

In some instances, the methods described herein relate to the modulation of HDAC3 activity that results in the reactivation of the genes silenced by XIST silencing complex. In these instances, reactivation of genes on the X-chromosome silenced by the XIST silencing complex, includes administering a HDAC3 modulator. In a specific, reactivation of genes on the X- chromosome that has the propensity to be silenced by the XIST silencing complex, includes administering a HDAC3 modulator. In other instances, the methods described herein relate to the modulation of HDAC3 activity that results in the reactivation of the genes silenced by XIST silencing complex and/or the hypomorphic X-linked allele (e.g., MECP2) is activated. In some instances, the HDAC3 modulator described herein is an inhibitor of HDAC3 translation, thereby inhibiting or reducing HDAC3 activity. In some instances, the HDAC3 modulator described herein is an inhibitor of HDAC3 activity, thereby inhibiting the deacetylase activity of HDAC3, and thereby preventing HDAC3 from acting to deacetylate chromatin and silence transcription.

In other instances, the HDAC3 modulator described herein is an inhibitor of HDAC3 and/or SMRT translation, thereby inhibiting or reducing the HDAC3 activity and/or SMRT activity. In one instance, the modulator described herein disrupts or prohibits the binding of HDAC3 with SMRT or abolishes the deacetylase activity of HDAC3, and thereby prevent HDAC3 from acting to deacetylate chromatin and silence transcription. In another instance, the modulator described herein disrupts or prohibits the binding of HDAC3 with NCOR1. In yet another instance, the modulator described herein disrupts or prohibits the binding of SMRT with SHARP. In some instances, a modulator is selected from a group consisting of inhibitory nucleotides, antibodies, nanobodies (e.g., camelid nanobody), protein drugs, aptamers, peptides (e.g., cyclic peptides), or small molecule inhibitors that disrupt the interaction of HDAC3 with SMRT or NCOR1, or alters (e.g., decreases, abolishes) the deacetylase activity of HDAC3. In some instances, the HDAC3 modulator is a Class I HD AC inhibitor or a HD AC 3 -specific inhibitor. Methods for designing nanobodies are described in Steeland et al., 2016, Drug Discov. Today,

doi:10.1016/j.dmdis.2016.04.003 and Oliveira et al., 2013, J. Control. Release, 172:607-617, the entire contents of both of which are herein incorporated by reference. Methods for designing nucleic acid aptamers are described in Hermann and Patel, 2000, Science, 287:820-825, and Patel and Suri, 2000, Rev. Molec. Biotechnol., 74:39-60, the entire contents of both of which are herein incorporated by reference.

The present disclosure includes modulators that directly contact HDAC3, disrupting HDAC3 activity. In certain embodiments, however, modulators indirectly impact HDAC3 activity. The present disclosure also includes HDAC3 modulators that result in the reduction or loss of interaction of HDAC3 associated proteins (e.g., SMRT, NCOR1). In one instance, indirect contact refers to the contact made by the modulator with molecules associated (interacting directly or indirectly) with HDAC3. For example, the modulator may contact molecules including but not limited to one or more of SHARP, SMRT and NCOR1. The binding site of SMRT on HDAC3 includes aa residues 9-49, referred to as N- terminal region of HDAC3. Residues 9-49 in the N-terminal region domain of HDAC3 may be important for its interaction with SMRT, and/or formation and maintenance of the XIST silencing complex. In one instance, the modulator described herein is an active site inhibitor, e.g., binding in the active site of HDAC3 constituted of residues including but not limited to Hisl34, Hisl35 Aspl70, Hisl72, Asp259, Arg265, Lys266, and Tyr298, and resulting in the loss of HDAC3 deacytylase activity and/or the activity of destabilization of the XIST silencing complex. In another instance, the modulator described herein is an allosteric inhibitor, e.g., binding in a site other than the active site of HDAC3 and resulting in the loss of HDAC3 functional activity of destabilization of the XIST silencing complex. In yet another instance, the modulator described herein is a non-active site inhibitor, e.g., binding in a site other than the active site of HDAC3 and resulting in the disruption of HDAC3 interaction with SMRT or NCOR1. In some instance, the non-active site inhibitor described herein may additionally bind to SMRT protein including but not limited to the binding sites for SHARP or the binding site for HDAC3. In a specific instance, the non-active site inhibitor described herein binds to the deactylase activating domain (DAD) of SMRTat aa residues 395-489 which disrupts the binding or interaction of SMRT with HDAC3. In another specific instance, the non-active site inhibitor described herein binds to amino acids 2518-2525 of SMRT which may disrupt either the interaction of -SMRT with SHARP or may destabilize the SHARP/SMRT/HDAC3 interaction.

In some instances, the present disclosure provides methods of treating a human subject having an X-linked disorder, said method comprising administering an effective amount of a HDAC3 modulator to the subject having the X-linked disorder such that the HDAC3 modulator localizes HDAC3 to a subcellular region that is not a nucleus or a nuclear periphery. HDAC3 is primarly localized to the nucleus of the cell. Recruitment of HDAC3 to the XIST silencing compartment through its interactions with SMRT, SHARP, and other protein and nucleic acid components, further increases the local concentration of HDAC3 at the nuclear periphery (includes the region close to the inner nuclear membrane and the nuclear lamina) and on the inactive X chromosome. Localization of HDAC3 to the nucleus and/or nuclear periphery may be necessary and sufficient for the formation and maintenance of the XIST silencing complex. The effect of the HDAC3 modulator in partially or completely excluding HDAC3 from the nucleus or the nuclear periphery results in the prevention of the formation of, and/or

destabilization of, and/or HD AC enzymatic activity of the XIST silencing complex. Localization of HDAC3 to a cellular compartment can be determined using standard fluorescence, where an HDAC3 modulator mis-localizes HDAC3 to a region that is not a nucleus, not a nuclear lamina, and not a nuclear periphery.

In some instances, the methods include administering a HDAC3 modulator that fully inhibits localization of HDAC3 to the nucleus. In some other instances, the methods include administering a HDAC3 modulator that partially inhibits localization of HDAC3 to the nucleus. For example, the localization of HDAC3 to the nucleus is inhibited by at least about 1%, 2%,

3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of the HDAC3 modulator as described herein. In other instances, the localization of HDAC3 to the nucleus s inhibited by at least about 60%, 70%, or 80% by administration of the HDAC3 modulator described herein. HDAC3 modulator may simultaneous inhibit one or more of the activity, stability, localization, and/or expression of HDAC3 in cells or tissue. The inhibition of the localization of HDAC3 to the nucleus can result in destabilization of the XIST silencing complex, which may result in the repression of XIST dependent gene silencing, e.g., by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control subject, or compared to the corresponding activity in a subject before the subject is treated with the HDAC3 modulator. In some instances, the inhibition of localization of HDAC3 to the nucleus can also result in the activation, de-repression, expression, of one or more genes on the X-chromosome that was silenced and/or has an increased propensity to be silenced by XIST silencing complex, e.g., gene activation by at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator. In some instances, partial inhibition of the localization of HDAC3 to the nucleus results in the complete activation of one or more genes silenced by XIST silencing complex. For example, inhibition of the localization of HDAC3 to the nucleus by the HDAC3 modulator to utmost about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of HDAC3 level in the corresponding untreated cell, tissue or subject to the nucleus results in the increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) to at least a level in a subject, cell or tissue, expressing the gene normally. In other instances, partial inhibition of the localization of HDAC3 to the nucleus results in the substantial activation of one or more genes silenced by XIST silencing complex. For example, inhibition of the localization of HDAC3 to the nucleus by the HDAC3 modulator to about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of HDAC3 level in the corresponding untreated cell, tissue or subject to the nucleus results in at least 1-fold, at least 2-fold, at least 5-fold, at least 10- fold, at least 50-fold, at least 100- fold, at least 500-fold, at least 1000 fold increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) compared to the untreated cell tissue or subject where the HDAC3 modulator was not administered. Inhibiting localization of HDAC3 increased gene activation (e.g., expression of mRNA, expression of protein) of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the HDAC3 modulator.

In some other instances, full inhibition of the localization of HDAC3 to the nucleus results in the complete activation of one or more genes silenced by XIST silencing complex. For example, 100% inhibition of the localization of HDAC3 to the nucleus (e.g., HDAC3 excluded from the nucleus) by the HDAC3 modulator results in the increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) to at least a level in a subject, cell or tissue, expressing the gene normally. In other instances, full inhibition of the localization of HDAC3 to the nucleus results in the substantial activation of one or more genes silenced by XIST silencing complex.

For example, 100% inhibition of the localization of HDAC3 to the nucleus in a cell, tissue or subject results in at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100- fold, at least 500-fold, at least 1000 fold increased expression of a silenced gene (e.g., MECP2, ATRX, CDFK5) compared to the corresponding untreated cell tissue or subject where the HDAC3 modulator was not administered. Several small molecule HDAC3 modulators are available. Non-limiting examples of small molecule inhibitors of HDAC3 include Abexinostat (PCI- 24781), Apicidin (OSI2040), AR-42, Belinostat (PXD101), BG45, BML-210, BML-281, BMN290, BRD0302, BRD2283, BRD3227, BRD3308, BRD3349, BRD3386, BRD3493, BRD4161, BRD4884, BRD6688, BRD8951, BRD9757, BRD9757, CBHA, Chromopeptide A, Citarinostat (ACY-214), CM-414, compound 25, CRA-026440, Crebinostat, CUDC-101, CUDC-907, Curcumin, Dacinostat (LAQ824), Depudecin, Domatinostat (4SC-202), Droxinostat, Entinostat (MS0275),

EVX001688, FR901228, FRM-0334, Givinostat, HDACi-4b, HDACi-109, HPOB, 12, KD5170, LB-205, M344, Martinostat, Merck60 (BRD6929), Mocetinostat (MGCD0103), OBP-801, Oxamflatin, Panobinostat (LBH589), PCI-34051, PCI-48000, Pracinostat (SB939), Pyroxamide, Quisinostat (JNJ-26481585), Resminostat, RG2833 (RGFP109), RGFP963, RGFP966,

(chidamide), Valproic acid, vorinostat (SAHA), W2, MC1742, MC2625, A8B4, A14B3, A12B4, A14B4, A7B4, or any combination thereof. In some instances, the HDAC3 inhibitor comprises a hydroxamate zinc binding group. Non-limiting examples of HDAC3 inhibitors comprising a hydroxamate zinc binding group include A7B4, A8B4, A12B4, A14B3, A14B4, Abexinostat (PCI-24781), AR-42, Belinostat (PXD101), BML-281, BRD9757, CBHA, Citarinostat (ACY- 214), CM-414, CRA-026440, Crebinostat, CUDC-101, CUDC-907, Dacinostat (LAQ824), Droxinostat, Givinostat, HPOB, 12, M344, Martinostat, MC1742, MC2625, Oxamflatin, Panobinostat (LBH589), PCI-34051, PCI-48000, Pracinostat (SB939), Pyroxamide, Quisinostat (JNJ-26481585), Reminostat, Rocilinostat (ACY-1215), Scriptaid, Trichostatin A (TSA), vorinostat (SAHA). In other instances, the HDAC3 inhibitor comprises a benzamide zinc binding group. Non-limiting examples of HDAC3 inhibitors comprising a benzamide zinc binding group include BG45, BML-210, BMN290, BRD0302, BRD2283, BRD3227, BRD3308, BRD3349, BRD3386, BRD4161, BRD4884, BRD6688, BRD8951, compound 25, Domatinostat (4SC-202), Entinostat (MS0275), HDACi-4b, HDACi-109, Merck60 (BRD6929), Mocetinostat

(MGCD0103), RG2833 (RGFP 109), RGFP963, RGFP966, RGFP968, T247, Tacedinaline (CI994), Tucidinostat (chidamide). In yet another instance, the HDAC3 inhibitor comprises a carboxylate -based zinc binding group. Non-limiting examples of HDAC3 inhibitors comprising a carboxylate-based zinc binding group include sodium phenylbutyrate, Splitomicin, Valproic acid. In othe instance, the HDAC3 inhibitor comprises a sulfur-based zinc binding group. Non limiting examples of HDAC3 inhibitors comprising a sulfur-based zinc binding group include to KD5170, chromopeptide A, FR901228, LB-205, OBP-801, Romidepsin, W2. In some instances, the HDAC3 inhibitor comprises a covalently reactive warhead, such as an epoxy-keton moiety. Non-limiting examples of HDAC3 inhibitors comprising a covalently reactive warhead include Depudecin, Trapoxin.

Small molecule HDAC3 modulators can be a synthetic or naturally occurring chemical compound, for instance a peptide or oligonucleotide that may optionally be derivatized, natural product or any other low molecular weight (often less than about 5 kDalton) organic,

bioinorganic or inorganic compound, of either natural or synthetic origin. Such small molecules may be a therapeutically deliverable substance or may be further derivatized to facilitate delivery.

C. Kinase Modulators

Kinases mediate the transfer of a phosphate moiety from a high energy molecule (such as ATP) to their substrate molecule (e.g., PIP2), typically catalyzing the phosphorylation of substrates and acting as a transcriptional regulator (transcriptional activator or repressor) of genes in various biological pathways (e.g., PI3K/AKT signaling pathway, JNK signaling pathway). Phosphorylation of molecules can enhance or inhibit their activity and modulate their ability to interact with other molecules. Mutations in kinases or inhibition of kinases can lead to a loss-of-function or gain-of-function of certain gene and can result in various disease in humans.

In certain embodiments, the present disclosure provides methods of treating a human subject having an X-linked disorder, said method comprising administering an effective amount of a kinase modulator other than PI3K to the subject having the X-linked disorder such that expression of an Xist-inactivated gene is increased.

Kinase modulators described herein include modulators of one or more kinases including, but not limited to, PI3K, Activin Receptor Type 1 kinase (ACVR1, also known as ALK2), Aurora Kinase A (AURKA), 3-phosphoinositide dependent protein kinase- 1 (PDPK1) and serine/threonine kinases 1/2 (SGK1/2). A kinase modulator may be used to reactivate genes whose expression is repressed on an X chromosome. A kinase modulator may diminish the kinase activity, thereby inhibiting XIST mediated gene silencing.

The present disclosure provides methods of treating a human subject having an X-linked disorder, said method comprising administering an effective amount of a kinase modulator to the subject having the X-linked disorder such that expression of an XIST-inactivated gene is increased.

The kinase modulator may diminish the activity of kinase and/or disrupt or prohibit kinase signaling pathway, thereby inhibiting XIST mediated gene silencing. The kinase modulator may be selective to kinase (e.g., binds only a specific kinase to have an effect on kinase activity, stability or expression) or non-selective (e.g., binds one or more targets or other kinases or binds other targets to have an effect on kinase activity, stability or expression).

Activin Receptor Type 1 (ACVR1) is a receptor serine-threonine kinase (also known as ALK2) that mediates signaling by bone morphogenic proteins (BMPs). ACVR1 catalyzes the phosphorylation of substrates (e.g., BMP-1) and acts as a transcriptional regulator

(transcriptional activator or repressor). In some instances, gain-of-function mutations in ACVR1 result in the autosomal dominant disease fibrodysplasia ossificans progressiva (FOP) and have been found in the childhood malignancy diffuse intrinsic pontine glioma (DIPG).

Non-limiting examples of ACVR1 modulators for use in the methods described herein include K02288 and LDN193189. K02288 is a potent and selective inhibitor of ACVR1/ALK2, ALK1. LDN193189 inhibits the transcriptional activity of BMP type I receptors ACVR1/ALK2 and ALK3. Further non-limiting examples of ACVR1 inhibitors include LDN19318, DMH-1, ML-347, BML-275, dorsomorphin, and LDN-212854, or any combinations thereof.

Non-limiting examples of AURKA modulators for use in the methods described herein include VX-680, MLN8237, TAS-119, MLN8054, PF-03814735, SNS-314, BI 811283, AMG 900, AZD1152, AS703569, R763, PHA-739358, CD532, and MK-0457, or any combinations thereof.

Non-limiting examples of PDPK1 modulators for use in the methods described herein include OSU-03012, BAG-956, BX-795, GSK-2334470, BX-912, and PHT-427, or any combinations thereof. The serum and glucocorticoid kinase (SGK) family of serine/threonine kinases includes three distinct but highly homologous isoforms (SGK1, SGK2, and SGK3) that share a similar domain structure. All three are activated by PDPK1 and have been implicated in a wide variety of cellular processes. Non-limiting examples of SGK1/2 modulators for use in the methods described herein include GSK-650394 and EMD638683, or combinations thereof.

Human phosphoinositide 3-kinase ( PI3K ) is described in NCBI Gene ID: 5294, NCBI Gene Reference Sequence: NG_050579.1, NCBI RNA Transcript Reference Sequence:

NM_001282426.2. PI3K protein is described in NCBI Protein Reference Sequence:

NP_001269355.1 and a UniProtKB ID - P48736.

A PI3K modulator may be used to reactivate genes whose expression is repressed on an X chromosome. A PI3K modulator may diminish the kinase activity of PI3K, thereby inhibiting XIST mediated gene silencing.

The present disclosure provides methods of treating a human subject having an X-linked disorder, said method comprising administering an effective amount of a PI3K modulator to the subject having the X-linked disorder such that expression of an XIST-inactivated gene is increased.

The PI3K modulator may diminish the activity of PI3K and/or disrupt or prohibit PBK/Akt (Protein Kinase B, also known as PKB) signaling pathway, thereby inhibiting XIST mediated gene silencing. The PI3K modulator may be selective to PI3K (e.g., binds only PI3K to have an effect on PI3K activity, stability or expression) or non-selective (e.g., binds one or more targets other than PI3K, for example, other kinases, or binds other targets including PI3K to have an effect on PI3K activity, stability or expression).

In some instances, the methods include administering a PI3K modulator that fully inhibits the activity, stability, and/or expression of PI3K and/or PKB. For example, the activity of PI3K is inhibited by 100% by administration of the PI3K modulator described herein. In some instances, the methods include administering a PI3K modulator that partially inhibits the activity, stability and/or expression of PI3K and/or PKB. For example, the activity of PI3K is inhibited by at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of the PI3K modulator as described herein. In other instances, PI3K is inhibited by at least about 60%>, 70%>, or 80%> by administration of the PI3K modulator described herein. PI3K modulator may exhibit simultaneous activation of activity, stability, assembly, and/or expression of PI3K in cells or tissue other than the target cells or target tissue. In some embodiments of the invention, this nonspecific binding does not significantly affect the inhibitory function of PI3K modulator in target cells or target tissue and results in no significant adverse effects in the subject.

The inhibition of the target gene or the gene product thereof (e.g., PI3K or other kinase) can result in the decrease, suppression or attenuation of the activity of a biological pathway (e.g., PBK/Akt signaling pathway) or a biological activity, such as XIST dependent gene silencing, e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control subject, or compared to the corresponding activity in a subject before the subject is treated with the modulator. The inhibition of the target gene or the gene product thereof (e.g., PI3K or other kinase) can also result in the activation, de-repression, expression (e.g., expression of mRNA, expression of protein), of one or more genes on the X- chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex. The gene activation (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%,

5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator. In some instances, partial inhibition of the kinase (e.g., PI3K) activity results in the complete activation of one or more genes silenced by XIST silencing complex. For example, inhibition of kinase (e.g., PI3K) activity by the PI3K modulator to at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% relative to the kinase (e.g., PI3K) level in the corresponding untreated cell, tissue or subject results in the increased expression of a silenced gene (e.g., MECP2) to at least a level in a subject, cell or tissue, expressing the gene normally. In other instances, partial inhibition of the kinase (e.g., PI3K) activity results in the substantial activation of one or more genes silenced by XIST silencing complex. For example, inhibition of kinase (e.g., PI3K) activity by the kinase (e.g., PI3K) modulator to at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% relative to the kinase (e.g., PI3K) level in the corresponding untreated cell, tissue or subject results in at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100- fold, at least 500-fold, at least 1000 fold increased expression of a silenced gene (e.g., MECP2) compared to the untreated cell tissue or subject where the kinase (e.g., PI3K) modulator was not administered. In some other instances, full inhibition of the kinase (e.g., PI3K) activity results in the complete activation of one or more genes silenced by XIST silencing complex. For example, 100% inhibition of kinase (e.g., PI3K) activity by the kinase (e.g., PI3K) modulator results in the increased expression of a silenced gene (e.g., MECP2) to at least a level in a subject, cell or tissue, expressing the gene normally. In other instances, full inhibition of the kinase (e.g., PI3K) activity results in the substantial activation of one or more genes silenced by XIST silencing complex. For example, 100% inhibition of kinase (e.g., PI3K) activity by the kinase (e.g., PI3K) modulator in a cell, tissue or subject results in at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100- fold, at least 500-fold, at least 1000 fold increased expression of a silenced gene (e.g., MECP2) compared to the corresponding untreated cell tissue or subject where the kinase (e.g., PI3K) modulator was not administered. Gene activation (e.g., expression of mRNA, expression of protein) of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the kinase modulator.

Routine methods known in the art can be used to measure the percent inhibition of kinase (e.g., PI3K) activity (e.g., phosphorylating the 3 position hydroxyl group of the inositol ring of phosphatidylinositol) including, but not limited to, measuring kinase (e.g., PI3K) expression by determining the kinase (e.g., PI3K) RNA level using qPCR analysis as disclosed in Example 20, measuring kinase (e.g., PI3K) protein by western blot analysis as described in Example 20 or measuring kinase (e.g., PI3K) activity as described in Example 22. Similarly, routine methods can be used to measure the percent activation and or increased expression of the silenced gene after treatment with kinase (e.g., PI3K) modulator, including, but not limited to, measuring gene expression by determining the mRNA levels using qPCR analysis, measuring the silenced gene product (e.g., protein) by western blot analysis.

In some instances, the methods described herein reversibly modulate kinase (e.g., PI3K) activity and/or localization of kinase (e.g., PI3K). For example, administration of kinase (e.g., PI3K) modulator to a cell, tissue or subject may transiently modulate kinase (e.g., PI3K) activity or expression, e.g., a modulation that persists for no more than about 30 mins to about 7 days after administration of the modulator, or no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs,

7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration of the modulator.

In some instances, the methods described herein irreversibly modulate kinase (e.g., PI3K) activity and/or localization of kinase (e.g., PI3K). For example, administration of kinase (e.g., PI3K) modulator to a cell, tissue or subject may irreversibly or stably modulate kinase (e.g., PI3K) activity or expression, e.g., a modulation that persists for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days,

29 days, 30 days, or longer or any time there between, after administration of the modulator.

In some instances, the methods described herein relate to the modulation of kinase (e.g., PI3K) protein expression that results in the reactivation of the genes silenced by XIST silencing complex. In these instances, reactivation of genes on the X-chromosome silenced by the XIST silencing complex, includes administering a kinase (e.g., PI3K) modulator. In a specific instance, reactivation of genes on the X-chromosome that has the propensity to be silenced by the XIST silencing complex, includes administering a kinase (e.g., PI3K) modulator. In other instances, the methods described herein relate to the modulation of the kinase (e.g., PI3K) protein expression that results in the reactivation of the genes silenced by XIST silencing complex and/or the hypomorphic X-linked allele (e.g., MECP2 gene on a X allele) is activated. In some instances, the kinase (e.g., PI3K) modulator described herein is an inhibitor of the kinase (e.g., PI3K) translation, thereby inhibiting or reducing the expression of the kinase (e.g., PI3K) protein. In some other instance, the kinase (e.g., PI3K) modulator described herein is an inhibitor of translation of a downstream substrate of the kinase (e.g., PI3K (e.g., PKB)). In some instances, the kinase (e.g., PI3K) modulator described herein is an inhibitor of the kinase (e.g., PI3K) activity, thereby inhibiting the phosphorylation activity of the kinase (e.g., PI3K), and thereby preventing the kinase (e.g., PI3K) from silencing transcription of genes in the X-chromosome. In other instances, the kinase (e.g., PI3K) modulator described herein is an inhibitor of the kinase (e.g., PI3K and/or PKB) translation, thereby inhibiting or reducing the expression of the kinase protein (e.g., PI3K protein and/or PKB protein). In one instance, the kinase (e.g., PI3K) modulator described activates the expression of methyl-CpG binding protein 2 (MECP2) gene. Loss of function mutations in the MECP2 gene has been implicated in the disease etiology of certain dominant X-linked diseases (e.g., Rett syndrome (RTT)) where a majority of the patients are females heterozygous for MECP2 deficiency. In some instances, a modulator is selected from a group consisting of antibodies, nanobodies (e.g., camelid nanobody), protein drugs, aptamers, peptides (e.g., cyclic peptides), or small molecule inhibitors that disrupt the interaction of the kinase (e.g., PI3K) with its substrates.

Several small molecule PI3K modulators are available. Non-limiting examples of small molecule inhibitors of PI3K include GNE317, LY294002, Wortmannin, demethoxyviridin, BEZ235, BGT226, BKM120, BYL719, XL765, XL147, GDC-0941, SF1126, GSK1059615, PX-866, CAL-101, BAY80-6946, GDC-0032, IPI-145, VS-5584, ZSTK474, SAR245409, and RP6530, or any combination thereof.

The kinase (e.g., PI3K) modulators used in the methods described can also be an inhibitory oligonucleotide that interferes with kinase DNA, and/or mRNA expression. In some instances, inhibitory oligonucleotide is an ASO that specifically binds to kinase mRNA. In other instances, the ASO binds specifically to substrates of the kinase (e.g., PKB). The ASO described herein is at least partially complementary to a target RNA or DNA molecule. The ASO described herein may be from 8 to 200 nucleotides in length, in some instances between 10 and 100, in some instances between 12 and 50.

The present disclosure includes kinase modulators that directly or indirectly (e.g., contact PI3K substrate PKB) contact the kinase to degrade kinase (e.g., PI3K and/or PKB) mRNA. In one instance, the kinase modulator is a siRNA composition to inhibit expression of the kinase, e.g., a siRNA specific for kinase mRNA that upon binding to kinase mRNA, inhibits kinase expression and results in the reactivation of the silenced MECP2 gene. In another instance, the disclosure includes a siRNA composition to inhibit expression of PKB. In some instance, the kinase modulator is a shRNA composition to inhibit expression of the kinase, e.g., a shRNA specific for PI3K mRNA that upon binding to PI3K mRNA, inhibits kinase expression and results in the reactivation of the silenced MECP2 gene. In another instance, the disclosure includes a shRNA composition to inhibit expression of PKB. In a specific instance, the disclosure includes a miRNA composition to inhibit expression of kinase, e.g., a miRNA specific for PI3K mRNA that upon binding to PI3K mRNA, inhibits kinase expression and results in the reactivation of the silenced MECP2 gene. In another instance, the disclosure includes a shRNA composition to inhibit expression of PKB.

The methods described herein for treating a human subject having an X-linked disorder can also comprise administration of inhibitors of other kinases including Activin Receptor Type 1 kinase (ACVR1, also known as ALK2), Aurora Kinase A (AURKA), 3-phosphoinositide dependent protein kinase- 1 (PDPK1) and serine/threonine kinases 1/2 (SGK1/2).

Non-limiting examples of ACVR1 inhibitors for use in the methods described herein include K02288 and LDN193189. K02288 is a potent and selective inhibitor of ACVR1/ALK2, ALK1. LDN193189 inhibits the transcriptional activity of BMP type I receptors ACVR1/ALK2 and ALK3. Further non-limiting examples of ACVR1 inhibitors include LDN19318, DMH-1, ML-347, BML-275, dorsomorphin, and LDN-212854, or any combinations thereof.

Non-limiting examples of AURKA inhibitors for use in the methods described herein include VX-680, MLN8237, TAS-119, MLN8054, PF-03814735, SNS-314, BI 811283, AMG 900, AZD1152, AS703569, R763, PHA-739358, CD532, and MK-0457, or any combinations thereof.

Non-limiting examples of PDPK1 inhibitors for use in the methods described herein include OSU-03012, BAG-956, BX-795, GSK-2334470, BX-912, and PHT-427, or any combinations thereof.

Non-limiting examples of SGK1/2 inhibitors for use in the methods described herein include GSK-650394 and EMD638683, or combinations thereof.

Aside from PI3K, other kinase modulators can be used to reactivate genes whose expression is repressed on an X chromosome. A kinase modulator may diminish the kinase activity of the target kinase, thereby inhibiting XIST mediated gene silencing.

D. Modulators ofDNA Methylation

A DNA methylation modulator may be used to reactivate genes whose expression is repressed on an X chromosome. A DNA methylation modulator may diminish the methylation of a target gene, thereby inhibiting XIST mediated gene silencing.

In certain embodiments, the present disclosure provides methods of treating a human subject having an X-linked disorder, said method comprising administering an effective amount of a DNA methylation modulator to the subject having the X-linked disorder such that expression of an XIST-inactivated gene is increased.

In one embodiment, a DNA methylation modulator is a DNA (cytosine-5)- methyltransferase 1 (DNMT1) modulator, a chromatin modifying agent. DNMT1, typically functions as a transcriptional repressor, and was found to be involved in XIST mediated gene silencing and/or transcriptional activation of XIST. In some instances, the DNMT1 modulator used in the methods described herein modulates DNMT1 gene expression ( DNMT1 is described in NCBI Gene ID: 1786, NCBI Gene Reference Sequence: NG_028016.3, and DNMT1 mRNA is described in NCBI RNA Transcript Reference Sequence: NM_001130823.3. In some instances, the DNMT1 modulator used in the methods described herein modulates DNMT1 protein (see NCBI Protein Reference Sequence: NP_001124295.1 and a UniProtKB ID - P26358). Inhibition of DNMT1 enzymatic activity results in DNA demethylation which has been correlated with decrease in XIST levels. Inhibition of XIST expression leads to repression of XIST mediated gene silencing, X-reactivation.

i. DNMT1 modulators

In some instances, the methods include administering a DNMT1 modulator that fully inhibits the activity, stability, and/or expression of DNMT1. For example, the activity of DNMT1 is inhibited by 100% by administration of the DNMT1 modulator described herein. In some instances, the methods include administering a DNMT1 modulator that partially inhibits the activity, stability and/or expression of DNMT1. For example, the activity of DNMT1 is inhibited by at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of the DNMT1 modulator as described herein. In other instances, DNMT1 is inhibited by at least about 60%>, 70%>, or 80%> by administration of the DNMT1 modulator described herein. DNMT1 modulator may exhibit simultaneous inactivation of activity, stability, and/or expression of DNMT1 in cells or tissue other than the target cells or target tissue.

Inhibition of DNMT1 can result in the decrease, suppression or attenuation of biological activity, such as XIST dependent gene silencing, e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control subject, or compared to the corresponding activity in a subject before the subject is treated with the modulator. The inhibition of the target gene or the gene product thereof (e.g., DNMT1) can also result in the activation, de-repression, expression (e.g., expression of mRNA, expression of protein), of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex. The gene activation (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator. In some instances, partial inhibition of the DNMT1 activity results in the complete activation of one or more genes silenced by XIST silencing complex. For example, inhibition of DNMT1 activity by the DNMT1 modulator to at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% relative to DNMT1 level in the corresponding untreated cell, tissue or subject results in the increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) to at least a level in a subject, cell or tissue, expressing the gene normally. In other instances, partial inhibition of the DNMT1 activity results in the substantial activation of one or more genes silenced by XIST silencing complex. For example, inhibition of DNMT1 activity by the DNMT1 modulator to at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% relative to DNMT1 level in the corresponding untreated cell, tissue or subject results in at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100- fold, at least 500-fold, at least 1000 fold increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) compared to the untreated cell tissue or subject where the DNMT1 modulator was not administered.

In some other instances, full inhibition of the DNMT1 activity results in the complete activation of one or more genes silenced by XIST silencing complex. For example, 100% inhibition of DNMT1 activity by the DNMT1 modulator results in the increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) to at least a level in a subject, cell or tissue, expressing the gene normally. In other instances, full inhibition of the DNMT1 activity results in the substantial activation of one or more genes silenced by XIST silencing complex. For example, 100% inhibition of DNMT1 activity by the DNMT1 modulator in a cell, tissue or subject results in at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100- fold, at least 500-fold, at least 1000 fold increased expression of a silenced gene (e.g., MECP2, ATRX, CDLK5) compared to the corresponding untreated cell tissue or subject where the DNMT1 modulator was not administered.

Routine methods known to a person of skill in the art can be used to measure the percent inhibition of DNMT1 activity (e.g., DNA methyltransferase activity) including, but not limited to, measuring DNMT1 expression by determining the DNMT1 RNA level using qPCR analysis as disclosed in Example 11, measuring DNMT1 protein by western blot analysis as described in Example 12. Similarly, routine methods can be used to measure the percent activation and or increased expression of the silenced gene after treatment with DNMT1 modulator, including, but not limited to, measuring gene expression by determining the mRNA levels using qPCR analysis, measuring the silenced gene product (e.g., protein) by western blot analysis. ii. Temporal modulation of DNMT1

In some instances, the methods described herein reversibly modulate DNMT1 activity. For example, administration of DNMT1 modulator to a cell, tissue or subject may transiently modulate DNMT1 activity or expression, e.g., a modulation that persists for no more than about 30 mins to about 7 days after administration of the modulator, or no more than about 1 hr, 2 hrs,

3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs,

17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration of the modulator.

In some instances, the methods described include temporally modulating DNMT1 activity. In one instance, the method comprises the steps of administering to the subject a first dose of the DNMT1 modulator, and determining clearance of the DNMT1 modulator from the subject. The DNMT1 modulator is cleared in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration. The method further comprises administering to the same subject a second dose of the DNMT1 modulator immediately after the clearance of the first dose of DNMT1 modulator. In some instances, the DNMT1 modulator administered to the the subject as a second dose is identical (e.g., same small molecule or inhibitory nucleotide inhibitor of DNMT1) to the DNMT1 modulator administered to the same subject as a second dose. In other instances, the DNMT1 modulator administered to the the subject as a second dose is different (e.g., first dose is a same small molecule inhibitor of DNMT1 and the second dose is an inhibitory nucleotide inhibitor of DNMT1 and vice versa) compared to the DNMT1 modulator administered to the same subject as a first dose. In some instances, the dosage of the first and second dose, are identical. In another instance, the second dose is higher than the first dose. In yet another instance, the second dose is lower than the first dose.

In some specific instances, the method described above further comprises administering to the same subject a second dose of the DNMT1 modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of DNMT1 inhibitor. In some specific instances, the DNMT1 modulator administered to the the subject as a first dose has faster clearance than the DNMT1 modulator administered to the same subject as a second dose. In other instances, the DNMT1 modulator administered to the the subject as a second dose has faster clearance than the DNMT1 modulator administered to the same subject as a first dose. In yet another instance, the DNMT1 modulators administered as a first and second dose

respectively have the same rate of clearance from the subject.

In some specific instances, the method described above further comprises administering to the same subject a second dose of the DNMT1 modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration of the first dose of DNMT1 inhibitor. In some specific instances, the DNMT1 modulator administered to the the subject as a first dose has faster clearance than the DNMT1 modulator administered to the same subject as a second dose. In other instances, the DNMT1 modulator administered to the the subject as a second dose has faster clearance than the DNMT1 modulator administered to the same subject as a first dose. In yet another instance, the DNMT1 modulators administered as a first and second dose

respectively have the same rate of clearance from the subject.

In some instances, the method described above comprises co-administering to the subject two different DNMT1 modulators. In some instances, the DNMT1 modulators have different clearance rate from the subject. In another instance, the DNMT1 modulators administered have the same rate of clearance from the subject. In another instance, the method comprises the steps of administering to the subject a first dose of the DNMT1 modulator, and determining clearance of the DNMT1 modulator from the subject. The DNMT1 modulator is cleared from the subject in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the

administration. The method further comprises administering to the same subject a second dose of the HDAC3 modulator described herein immediately after the clearance of the first dose of DNMT1 modulator. In some specific instances, the method described above further comprises administering to the same subject a second dose of the HDAC3 modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of DNMT1 modulator. In some specific instances, the DNMT1 modulator administered to the the subject as a first dose has faster clearance than the HDAC3 modulator administered to the same subject as a second dose. In other instances, the HDAC3 modulator administered to the the subject as a second dose has faster clearance than the DNMT1 modulator administered to the same subject as a first dose. In yet another instance, the DNMT1 modulator and the HDAC3 modulator have the same rate of clearance from the subject. In some instances, the dosage of the first and second dose, are identical. In another instance, the second dose is higher than the first dose. In yet another instance, the second dose is lower than the first dose.

In another instance, the method comprises the steps of administering to the subject a first dose of the HDAC3 modulator, and determining clearance of the HDAC3 modulator from the subject. The HDAC3 modulator is cleared from the subject in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration. The method further comprises administering to the same subject a second dose of the DNMT1 modulator described herein immediately after the clearance of the first dose of HDAC3 modulator. In some specific instances, the method described above further comprises administering to the same subject a second dose of the DNMT1 modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of HDAC3 modulator. In some instances, the dosage of the first and second dose, are identical. In another instance, the second dose is higher than the first dose. In yet another instance, the second dose is lower than the first dose.

In some instances, the method described above comprises co-administering to the subject a DNMT1 modulator and a HDAC3 modulator. In some instances, the DNMT1 modulator has a faster clearance rate compared to the clearance rate of the HDAC3 modulator in the same subject. In some instances, the HDAC3 modulator has a faster clearance rate compared to the clearance rate of the DNMT1 modulator in the same subject. In another instance, the DNMT1 modulator and HDAC3 modulator have the same rate of clearance from the subject.

In yet another instance, the method comprises the steps of administering to the subject a first dose of the DNMT1 modulator, and determining clearance of the DNMT1 modulator from the subject. The DNMT1 modulator is cleared from the subject previously administered with a first dose of DNMT1 inhibitor in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration of the DNMT1 modulator. The method further comprises administering to the same subject a second dose of the PI3K modulator described herein immediately after the clearance of the first dose of DNMT1 modulator.

In some specific instances, the method described above further comprises administering to the same subject a second dose of the PI3K modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs,

19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of DNMT1 modulator. In some specific instances, the DNMT1 modulator administered to the the subject as a first dose has faster clearance than the PI3K modulator administered to the same subject as a second dose. In other instances, the PI3K modulator administered to the the subject as a second dose has faster clearance than the DNMT1 modulator administered to the same subject as a first dose. In yet another instance, the DNMT1 modulator and the PI3K modulator have the same rate of clearance from the subject. In some instances, the dosage of the first and second dose, are identical. In another instance, the second dose is higher than the first dose. In yet another instance, the second dose is lower than the first dose.

In another instance, the method comprises the steps of administering to the subject a first dose of the PI3K modulator, and determining clearance of the PI3K modulator from the subject. The PI3K modulator is cleared from the subject in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs,

19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration. The method further comprises administering to the same subject a second dose of the DNMT1 modulator described herein immediately after the clearance of the first dose of PI3K modulator. In some specific instances, the method described above further comprises administering to the same subject a second dose of the DNMT1 modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs,

11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of PI3K modulator. In some instances, the dosage of the first and second dose, are identical. In another instance, the second dose is higher than the first dose. In yet another instance, the second dose is lower than the first dose.

In some instances, the method described above comprises co-administering to the subject a DNMT1 modulator and a PI3K modulator. In some instances, the DNMT1 modulator has a faster clearance rate compared to the clearance rate of the PI3K modulator in the same subject. In some instances, the PI3K modulator has a faster clearance rate compared to the clearance rate of the DNMT1 modulator in the same subject. In another instance, the DNMT1 modulator and PI3K modulator have the same rate of clearance from the subject.

In another instance, the method comprises the steps of administering to the subject a first dose of the DNMT1 modulator, and determining clearance of the DNMT1 modulator from the subject. The DNMT1 modulator is cleared from the in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration. The method further comprises administering to the same subject a second dose comprising a combination of the HDAC3 and PI3K modulator described herein immediately after the clearance of the first dose of DNMT1 modulator. In some specific instances, the method described above further comprises administering to the same subject a second dose of the HDAC3 and PI3K modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of DNMT1 modulator. In some instances, the dosage of the first and second dose, are identical. In another instance, the second dose is higher than the first dose. In yet another instance, the second dose is lower than the first dose.

In another instance, the method comprises the steps of administering to the subject a first dose of a combination of HD AC 3 and PI3K modulators, and determining clearance of the combination of HDAC3 and PI3K modulators from the subject. The combination of the HDAC3 and PI3K modulators is cleared from the subject in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration. The method further comprises administering to the same subject a second dose of the DNMT1 modulator described herein immediately after the clearance of the first dose of the combination of HDAC3 and PI3K modulators. In some specific instances, the method described above further comprises administering to the same subject a second dose of the DNMT1 modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of the combination of HDAC3 and PI3K modulators. In some instances, the dosage of the first and second dose, are identical. In another instance, the second dose is higher than the first dose. In yet another instance, the second dose is lower than the first dose.

In some instances, the method described above comprises co-administering to the subject a DNMT1 modulator and a combination of HDAC3 and PI3K modulators. In some instances, the DNMT1 modulator has a faster clearance rate compared to the clearance rate of the combination of HDAC3 and PI3K modulators in the same subject. In some other instances, the DNMT1 modulator has a faster clearance rate than the clearance rate of the either one of the HDAC3 or the PI3K modulators in the same subject. In some instances, the combination of HDAC3 and PI3K modulators has a faster clearance rate compared to the clearance rate of the DNMT1 modulator in the same subject. In some other instances, either one of the HDAC3 or the PI3K modulators have a faster clearance rate compared to the clearance rate of the DNMT1 modulator in the same subject. In yet another instance, the DNMT1 modulator and the combination of HDAC3 and PI3K modulators, have the same rate of clearance from the subject. In some instances, the methods described herein irreversibly modulate DNMT1 activity. For example, administration of DNMT1 modulator to a cell, tissue or subject may irreversibly or stably modulate DNMT1 activity or expression, e.g., a modulation that persists for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or longer or any time there between, after administration of the modulator. iii. DNMT1 modulators

In some instances, the methods described herein relate to the modulation of DNA methylation that results in the reactivation of the genes silenced by XIST silencing complex. In these instances, reactivation of genes on the X-chromosome silenced by the XIST silencing complex, includes administering a DNA methylation modulator. In a specific instance, the DNA methylation modulator is a DNMT1 modulator. In some instances, the methods described herein relate to the modulation of DNMT1 expression that results in the reactivation of the genes silenced by XIST silencing complex and/or the hypomorphic X-linked allele is activated. In some instances, the DNMT1 modulator described herein is an inhibitor of DNMT1 translation, thereby inhibiting or reducing the expression of DNMT1 protein. In some other instance, the DNMT1 modulator described herein is an inhibitor of translation of a downstream substrate of DNMT1 (e.g., XIST). In some instances, the DNMT1 modulator described herein is an inhibitor of DNMT1 activity, thereby inhibiting the methyl transferase activity of DNMT1, and thereby preventing DNMT1 from activating transcription of XIST. In some instances, a modulator is selected from a group consisting of antibodies, nanobodies (e.g., camelid nanobody), protein drugs, aptamers, peptides (e.g., cyclic peptides), or small molecule inhibitors that disrupt the interaction of DNMT1 with its substrates. Several small molecule DNMT1 modulators are available. Non-limiting examples of small molecule modulators of DNMT1 include 5-azacytidine (azacytidine, Azacitidine, 4-amino- l-beta-D-ribofuranosyl-s-triazin-2(lH)-one, Vidaza), decitabine (5-aza-2'-deoxycytidine,

Dacogen), Zebularine (pyrimidin-2-one beta-ribofuranoside), procainamide, procaine, hydralazine, NSC 14778, Olsalazine, Nanaomycin, SID 49645275, A2isoxazoline,

epigallocatechin-3-gallate (EGCG), MG98, SGI- 110 (2'- deoxy-5-azacytidylyl-(3'- 5')-2'- deoxyguanosine), RG108 (N-phthalyl-L- tryptophan), SGI-1027, SW155246, SW15524601, SW155246-2, and DZNep (SGI- 1036, 3- deazaneplanocin A), or any combination thereof. See also Medina-Franco et al., Int. J. Mol. Sci. 2014, 15(2), 3253-3261; Yoo et al., Computations Molecular Bioscience, 1(1):7- 16 (2011).

The DNMT1 modulators used in the methods described can also be an inhibitory oligonucleotide that interferes with DNMT1 DNA, and/or mRNA expression. In some instances, inhibitory oligonucleotide is an ASO that specifically binds to DNMT1 mRNA. In other instances, the ASO binds specifically to substrates of DNMT1 (e.g., XIST). The ASO described herein is at least partially complementary to a target RNA or DNA molecule. The ASO described herein may be from 8 to 200 nucleotides in length, in some instances between 10 and 100, in some instances between 12 and 50.

The present disclosure includes DNMT1 modulators that directly or indirectly (e.g., contact DNMT1 substrate XIST) contact DNMT1 to degrade DNMT1 and/or XIST RNA. In one instance, the DNMT1 modulator is a siRNA composition to inhibit expression of DNMT1, e.g., a siRNA specific for DNMT1 mRNA that upon binding to DNMT1 mRNA, inhibits DNMT1 expression and results in the transcriptional silencing of XIST. In some instance, the DNMT1 modulator is a shRNA composition to inhibit expression of DNMT1, e.g., a shRNA specific for DNMT1 mRNA that upon binding to DNMT1 mRNA, inhibits DNMT1 expression and results in the in the transcriptional silencing of XIST. In a specific instance, the disclosure includes a miRNA composition to inhibit expression of DNMT1, e.g., a miRNA specific for DNMT1 mRNA that upon binding to DNMT1 mRNA, inhibits DNMT1 expression and results in the in the transcriptional silencing of XIST.

In other instances, the methods described herein include temporally modulating DNMT1 activity. In one specific instance, the method comprises the steps of administering to the subject a first dose of the DNMT1 modulator, and determining clearance of the DNMT1 modulator from the subject. The DNMT1 inhibitor is cleared from the subject previously administered with a first dose of DNMT1 inhibitor in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration of the DNMT1 modulator. The method further comprises administering to the same subject a second dose of the DNMT1 modulator described herein immediately after the clearance of the first dose of DNMT1 modulator. In some specific instances, the method described above further comprises administering to the same subject a second dose of the DNMT1 modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of DNMT1 modulator.

In some other instances, the methods described herein irreversibly modulate DNMT1 activity. For example, administration of DNMT1 modulator to a cell, tissue or subject may irreversibly or stably modulate DNMT1 activity or expression, e.g., a modulation that persists for at least about 1 hr to about 30 days, or at least about 2 hrs, 6 hrs, 12 hrs, 18 hrs, 24 hrs, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or longer or any time there between, after administration of the modulator.

E. Modulators ofXist

In some instances, the methods described herein relate to the modulation of XIST that results in the reactivation of the genes silenced by XIST silencing complex. In some instances, a modulator is selected from a group consisting of inhibitory nucleotides, antibodies, nanobodies (e.g., camelid nanobody), protein drugs, aptamers, or peptide (e.g., cyclic peptides) inhibitors that disrupt the interaction of XIST with a protein binding partner or chromatin.

In some instances, the XIST modulator described herein is an inhibitory oligonucleotide. Inhibitory oligonucleotides described herein may interfere with XIST.

In some instances, an inhibitory oligonucleotide is an antisense oligonucleotide (ASO). The ASOs described herein is at least partially complementary to a target RNA or DNA molecule. ASOs described herein can be short or long. The ASOs described herein may be from 8 to 200 nucleotides in length, in some instances between 10 and 100, in some instances between 12 and 50. The oligonucleotides of the present invention are, in some instances, single stranded, chemically modified and synthetically produced. In some instances, ASOs described herein may be modified to include high affinity RNA binders (e.g., locked nucleic acids (LNAs)) as well as chemical modifications. In one instance, the ASO comprises one or more residues that are modified to increase nuclease resistance, and/or to increase the affinity of the ASO for the target sequence (e.g., XIST). In a specific instance, the ASO comprises a nucleotide analogue. In some instances, the ASO may be expressed inside a target cell, such as a neuronal cell, from a nucleic acid sequence, such as delivered by a viral (e.g. lentiviral, AAV, or adenoviral) or non-viral vector. In an important aspect of the present invention, an ASO, in some instances, single- stranded, is administered to a subject having a X-linked disorder such that the X-linked disorder (e.g., Rett syndrome) is treated or cured.

In some instances, an inhibitory oligonucleotide is an inhibitory RNA molecule (RNAi) that can inhibit XIST through the biological process of RNA interference. RNAi comprise RNA or RNA-like structures typically containing 15-50 base pairs (such as about 18-25 base pairs) and having a nucleobase sequence identical (complementary) or nearly identical (substantially complementary) to an XIST sequence within the cell. RNAi comprise a sequence substantially complementary, or fully complementary, to all or a fragment of a target gene (e.g., XIST). RNAi may complement sequences at the boundary between introns and exons to prevent the maturation of newly-generated nuclear RNA transcripts of specific genes (e.g., XIST gene). RNAi complementary to specific genes can hybridize with XIST and prevent its functionality. RNAi can be administered to the cell, tissue or the subject as“ready-to-use” RNA synthesized in vitro or as an antisense gene transfected into cells which will yield RNAi upon transcription. Hybridization of RNAi with RNA results in degradation of the hybridized molecule by RNAse H and/or inhibition of the formation of translation complexes, resulting in an inhibition or decrease in the expression of the gene targeted by RNAi. The length of the RNAi molecule that hybridizes to the target transcript is around 10 nucleotides, is between about 15 or 30 nucleotides, or is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the antisense sequence to the target transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. RNAi described herein may also comprise overhangs, e.g., 3' and/or 5' overhangs of about 1-5 bases independently on each of the sense strands (strand to which the RNAi hybridizes) and antisense strands (strand complementary to which the RNAi hybridizes). In one embodiment, both the sense strand and the antisense strand contain 3' and 5' overhangs. The sense and antisense strands of an RNAi molecule may or may not contain the same number of nucleotide bases. The antisense and sense strands may form a duplex wherein the 5' end only has a blunt end, the 3' end only has a blunt end, both the 5' and 3' ends are blunt ended, or neither the 5' end nor the 3' end are blunt ended. In another embodiment, one or more of the nucleotides in the overhang contains a thiophosphate, phosphorothioate, deoxynucleotide inverted (3 ' to 3 ' linked) nucleotide or is a modified ribonucleotide or deoxynucleotide. RNAi are readily designed and produced by technologies known in the art. As described elsewhere herein, there are computational tools that increase the chance of finding effective and specific sequence motifs.

In one instance, the disclosure includes a siRNA composition to inhibit XIST, e.g., a siRNA specific for XIST that upon binding to XIST, inhibits XIST function and results in the reactivation of a gene silenced by XIST silencing complex. In one instance, siRNA comprises a nucleotide sequence that is identical to about 10 to about 40, in some instances about 15 to 30, in some instances about 20 to 25, contiguous nucleotides of the target (e.g., XIST). In some embodiments, the siRNA sequence commences with the dinucleotide AA, comprises a GC- content of about 30-70% (about 30-60%, about 40-60%, or about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the cell, tissue or subject in which it is to be introduced. The percent identity can be, for example, determined by a standard BLAST search.

In some instances, an inhibitory nucleic acid described herein is chemically linked to one or more moieties or conjugates as described elsewhere herein. In some instances, an XIST modulator disrupts XIST or disrupts one or more genes or molecules associated with XIST. Non-limiting exemplary gene disrupting systems include a CRISPR system, a modified Cas, ZFNs, and TALENs as described elsewhere herein.

In one instance, the XIST modulator is a CRISPR- Cas system with a 20 bp guide RNA (gRNA) complementary to the XIST gene and a Cas nuclease (e.g., Cas9). In one example, residues 14-27 of the XIST open reading frame (ORF) are targeted using CRISPR-Cas 9 system to generate indel mutations leading to a frameshift in the XIST ORF (AXIST).

In some instances, fusion of a dCas9 with all or a portion of one or more effector domains of an epigenetic modifying agent (such as a DNA methylase or enzyme with a role in DNA demethylation) creates a chimeric protein that is useful in the methods described herein.

Accordingly, in some instance, a nucleic acid encoding a dCas9-methylase fusion is administered to a subject in need thereof in combination with a site-specific gRNA or antisense DNA oligonucleotide that targets the XIST gene, thereby decreasing expression of the target genes. In some instance, all or a portion of one or more methylase, or enzyme with a role in DNA demethylation, effector domains are fused with the inactive nuclease, e.g., dCas9. In other aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more methylase, or enzyme with a role in DNA demethylation, effector domains (all or a biologically active portion) are fused with dCas9. The chimeric proteins described herein may also comprise a linker, e.g., an amino acid linker. In some aspects, a linker comprises 2 or more amino acids, e.g., one or more GS sequences. In some aspects, fusion of Cas9 (e.g., dCas9) with two or more effector domains (e.g., of a DNA methylase or enzyme with a role in DNA demethylation) comprises one or more interspersed linkers (e.g., GS linkers) between the domains. In some aspects, dCas9 is fused with 2-5 effector domains with interspersed linkers.

Non-limiting examples of the small molecule modulators of XIST IncRNA and/or molecules associated with XIST IncRNA include UNC1999, E7438 (Tazemetostat) GSK-126, GSK-343, 3-deazaneplanocin A, isoliquiritigenin, 3-aminobenzamide, PFI3, JQ1

MS37452, PRT4165, ZM447439, hesperadin, VX-680/MK-0457 (Tozasertib), AT9283, AZD1152, AKI- 001, PHA-680632, JNJ-7706621, CCT129202, MLN8237 (Alisertib), ENMD-2076, VX- 689/MK-5108, PHA-739358, CYC 116, SNS-314, R763 /AS703569, PF-03814375,

GSK1070916, AMG-900, MG132, mevinolin, bestatin, DPQ, plumbagin, berberine, astemizole, and those provided in, for example, U.S. Publication Nos. 2009/0012031, 2009/0203010, 2010/0222420, 2011/0251216, 2011/0286990, 2012/0014962, 2012/0071418, 2013/0040906, US20140378470, US20140275081, US20140357688, 2013/0195843, PCT/US2011/035336,and PCT /US 2016/026218.

The present disclosure provides agents targeting XIST IncRNA that directly or indirectly contact XIST IncRNA to degrade it. In one instance, the agent targeting XIST IncRNA is a siRNA composition to inhibit expression of XIST IncRNA, e.g., a siRNA specific for XIST IncRNA that upon binding to XIST IncRNA, inhibits XIST IncRNA expression. In some instance, the agent targeting XIST IncRNA is a shRNA composition to inhibit expression of XIST IncRNA, e.g., a shRNA specific for XIST IncRNA that upon binding to XIST IncRNA, inhibits XIST IncRNA expression. In a specific instance, the agent targeting XIST IncRNA is a miRNA composition to inhibit expression of XIST IncRNA, e.g., a miRNA specific for XIST IncRNA that upon binding to XIST IncRNA, inhibits XIST IncRNA expression. In another instance, the agent targeting XIST IncRNA is a small molecule inhibitor of XIST IncRNA. In yet another instance, the agent targeting XIST IncRNA is a small molecule inhibitor of molecules associated with XIST IncRNA.

F. Combination Methods for Modulating XIST

The present disclosure provides methods of treating a human subject having an X-linked disorder, said method comprising administering to the subject having the X-linked disorder, an effective amount of a HDAC3 modulator in combination with one or more of a PI3K modulator, a DNMT1 modulator and an XIST modulator such that expression of an XIST-inactivated gene is increased. In a specific instance of the method described above, the expression of an XIST- inactivated gene is increased to a level substantially higher than the level of increase in the subject that can be achieved by the administration of any one of the modulators described above as monotherapy. The administration of a combination therapy, as described above, can be advantageous as the combination of inhibition of histone deacetylation, with one or more of the DNA demethylation of XIST, transcriptional silencing of XIST and inhibition of transcriptional silencing of genes in the X-chromosome, may increases the frequency of X- reactivation and/or lead to higher levels of X-reactivation. XIST dependent gene silencing is maintained by multiple pathways and the genes silenced by XIST can be reactivated by targeting two or more components required for XIST mediated gene silencing. In some instances, the use of HDAC3 modulator in combination with one or more of a PI3K modulator, a DNMT1 modulator and an XIST modulator may lead to a synergistic effect with higher levels and/or frequency of re activation of genes silenced by XIST. i. Combination with inhibitors of DNA methylation

In some instances, reactivation of XIST-dependent silenced genes includes the inhibition of HDAC3 activity in combination with inhibition of DNA methylation. For example,

Fibroblasts are administered with a siRNA reagent targeting human HDAC3 in combination with the DNA DNMT1 inhibitor Decitabine, can show higher levels of reactivation of silenced X- chromosome gene MECP2 (i.e. having high levels of MECP2 mRNA) than with administration of either of the HDAC3 siRNA or Decitabine alone to fibroblast, as described in Example 25.

The combined inhibition of HDAC3 and DNMT1 can result in the decrease, suppression or attenuation of XIST dependent gene silencing, e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to the corresponding activity in a subject after the subject is treated with either a HDAC3 or DNMT1 modulator alone. The combined inhibition of HDAC3 and DNMT1 can also result in the activation, de-repression, expression (e.g., expression of mRNA, expression of protein), of one or more genes on the X- chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex. The gene activation (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%,

5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% higher than the corresponding activity in a subject after the subject is treated with either a HDAC3 or DNMT1 modulator alone in the same type of cell, tissue or subject.

In other instances, reactivation of XIST-dependent silenced genes includes the inhibition of HDAC3 activity in combination with inhibition of PI3K activity. The combined inhibition of HDAC3 and PI3K can result in the decrease, suppression or attenuation of XIST dependent gene silencing, e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to the corresponding activity in a subject after the subject is treated with either a HDAC3 or PI3K modulator alone. The combined inhibition of HDAC3 and PI3K can also result in the activation, de-repression, expression (e.g., expression of mRNA, expression of protein), of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex. The gene activation (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% higher than the corresponding activity in a subject after the subject is treated with either a HDAC3 or PI3K modulator alone in the same type of cell, tissue or subject.

In another instance, reactivation of genes silenced by XIST-mediated gene silencing includes the inhibition of HDAC3 activity in combination with inhibition of XIST activity. The combined inhibition of HDAC3 and XIST can result in the decrease, suppression or attenuation of XIST dependent gene silencing, e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to the corresponding activity in a subject after the subject is treated with either a HDAC3 or XIST modulator alone. The combined inhibition of HDAC3 and XIST can also result in the activation, de-repression, expression (e.g., expression of mRNA, expression of protein), of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex. The gene activation (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% higher than the corresponding activity in a subject after the subject is treated with either a HDAC3 or XIST modulator alone in the same type of cell, tissue or subject.

In yet another instance, reactivation of XIST-dependent silenced genes includes the inhibition of HDAC3 activity in combination with inhibition of DNA methylation, inhibition of PI3K activity and/or inhibition of XIST activity. The combined inhibition of HD AC 3, DNMT1, PI3K and XIST can result in the decrease, suppression or attenuation of XIST dependent gene silencing, e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to the corresponding activity in a subject after the subject is treated with either one of the HD AC 3, DNMT1, PI3K and XIST modulators. The combined inhibition of HDAC3, DNMT1, PI3K and XIST can also result in the activation, de-repression, expression (e.g., expression of mRNA, expression of protein), of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex. The gene activation (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% higher than the corresponding activity in a subject after the subject is treated with either one of the HDAC3, DNMT1, PI3K and XIST modulators in the same type of cell, tissue or subject.

In some instances, the methods described herein include temporally modulating DNMT1 activity in combination with the activity of one or more of HD AC 3, PI3K and XIST. In one instance, the method comprises the steps of administering to the subject a first dose of the DNMT1 modulator, and determining clearance of the DNMT1 modulator from the subject. The DNMT1 inhibitor is cleared from the subject previously administered with a first dose of DNMT1 inhibitor in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration of the DNMT1 modulator. The method further comprises administering to the same subject a second dose of the HDAC3 modulator described herein immediately after the clearance of the first dose of DNMT1 modulator. In some specific instances, the method described above further comprises administering to the same subject a second dose of the HDAC3 modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of DNMT1 modulator.

In another instance, the method comprises the steps of administering to the subject a first dose of the DNMT1 modulator, and determining clearance of the DNMT1 modulator from the subject. The DNMT1 inhibitor is cleared from the subject previously administered with a first dose of DNMT1 inhibitor in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration of the DNMT1 modulator. The method further comprises administering to the same subject a second dose of the PI3K modulator described herein immediately after the clearance of the first dose of DNMT1 modulator. In some specific instances, the method described above further comprises administering to the same subject a second dose of the PI3K modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs,

22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of DNMT1 modulator.

In yet another instance, the method comprises the steps of administering to the subject a first dose of the DNMT1 modulator, and determining clearance of the DNMT1 modulator from the subject. The DNMT1 inhibitor is cleared from the subject previously administered with a first dose of DNMT1 inhibitor in no more than about 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the administration of the DNMT1 modulator. The method further comprises administering to the same subject a second dose comprising a combination of the HDAC3 and PI3K modulator described herein immediately after the clearance of the first dose of DNMT1 modulator. In some specific instances, the method described above further comprises administering to the same subject a second dose of the HDAC3 and PI3K modulator after at least 1 hr, 2 hrs, 3 hrs, 4 hrs, 5 hrs, 6 hrs, 7 hrs, 8 hrs, 9 hrs, 10 hrs, 11 hrs, 12 hrs, 13 hrs, 14 hrs, 15 hrs, 16 hrs, 17 hrs, 18 hrs, 19 hrs, 20 hrs, 21 hrs, 22 hrs, 24 hrs, 36 hrs, 48 hrs, 60 hrs, 72 hrs, 4 days, 5 days, 6 days, 7 days, or any time there between, after the clearance of the first dose of DNMT1 modulator. ii. Combination with agents targeting XIST IncRNA

In some instances, reactivation of XIST-dependent silenced gene includes the inhibition of one or more of HDAC3 activity, DNMTI activity and PI3K activity in combination with agents targeting XIST IncRNA. Agents targeting IncRNA include inhibitory nucleotides, antibodies, nanobodies (e.g., camelid nanobody), protein drugs, aptamers, peptides (e.g., cyclic peptides), or small molecule inhibitors that disrupt the interaction of IncRNA with components of XIST silencing complex (e.g., SHARP) or inhibit the transcription of XIST IncRNA. In some instances, the methods described herein relate to the combined modulation of HDAC3 protein expression and transcription of IncRNA, that results in the reactivation of the genes silenced by XIST silencing complex. In other instances, the methods described herein relate to the combined modulation of HDAC3 mRNA expression and transcription of IncRNA, that results in the reactivation of the genes silenced by XIST silencing complex. In these instances, reactivation of genes on the X-chromosome silenced by the XIST silencing complex, includes administering a HDAC3 modulator and an agent targeting XIST IncRNA. In some instances, the agent targeting IncRNA described herein is an inhibitor specific to IncRNA, thereby inhibiting or the expression of the IncRNA. In some instances, the agent targeting IncRNA described herein is an inhibitor that disrupts or prohibits the binding of IncRNA with other components of the XIST silencing complex, such as SHARP.

The present disclosure provides methods of treating a human subject having an X-linked disorder, said method comprising administering an effective amount of one or more of HDAC3 modulator, DNMTI modulator and PI3K modulator in combination with agents targeting XIST IncRNA to the subject having the X-linked disorder such that X-linked disorder is treated or cured. The agents targeting XIST IncRNA, used in the methods administering a combination of modulators, can be an inhibitory oligonucleotide that interferes with XIST IncRNA expression.

In some instances, inhibitory oligonucleotide is an ASO that specifically binds to XIST IncRNA. In other instances, the ASO binds specifically to other components of the XIST silencing complex, such as SHARP. The ASO described herein is at least partially complementary to a target RNA or DNA molecule. The ASO described herein may be from 8 to 200 nucleotides in length, in some instances between 10 and 100, in some instances between 12 and 50.

Non-limiting examples of the small molecule modulators of XIST IncRNA and/or molecules associated with XIST IncRNA include UNC1999, E7438 (Tazemetostat) GSK-126, GSK-343, 3-deazaneplanocin A, isoliquiritigenin, 3-aminobenzamide, PFI3 JQ1 {÷), MS37452, PRT4165, ZM447439, hesperadin, VX-680/MK-0457 (Tozasertib), AT9283, AZD1152, AKI- 001, PHA-680632, JNJ-7706621, CCT129202, MLN8237 (Alisertib), ENMD-2076, VX- 689/MK-5108, PHA-739358, CYC 116, SNS-314, R763 /AS703569, PF-03814375,

The present disclosure encompasses various combinations of modulating agents. For example, a small molecule HDAC3 modulator can be administered to a subject having a X- linked disorder with an siRNA/shRNA/miRNA/ASO specific for XIST IncRNA, or vice versa. Similarly, other combinations of the various forms of the modulators and agents described herein, such as, the inhibitory nucleotides, antibodies, nanobodies (e.g., camelid nanobody), protein drugs, aptamers, peptides (e.g., cyclic peptides), and small molecule inhibitors, are also envisioned. iii. Agents targeting molecules associated with XIST IncRNA

The present disclosure provides methods of treating a human subject having an X-linked disorder, said method comprising administering to the subject having the X-linked disorder, an effective amount of an agent targeting XIST IncRNA and/or molecules associated with XIST IncRNA (e.g., SHARP, SAF-A). In some instances, the methods described herein include administering an inhibitor of an XIST-interacting factor (e.g, inhibitor of SHARP, inhibitor of SAF-A).

In some instance of methods described herein, the inhibitor of an XIST-interacting factor is a small molecule inhibitor or an inhibitory nucleic acid that targets a gene encoding the XIST- interacting factor. In a specific instance, the XIST-interacting factor is SHARP and the inhibitor is inhibitory nucleic acid that targets the SHARP gene. Non-limiting examples of the inhibitory nucleic acid described herein include ASOs, siRNAs, shRNAs, and microRNAs that target XIST-interacting protein (e.g., SHARP, NCOR1). In one instance, the agent targeting SHARP is a siRNA composition that upon binding to SHARP mRNA, inhibits SHARP mRNA expression. In another instance, the agent targeting SHARP is a shRNA composition that upon binding to SHARP mRNA, inhibits SHARP mRNA expression. In one other instance, the agent targeting SHARP is a miRNA composition that upon binding to SHARP mRNA, inhibits SHARP mRNA expression. In some instances, inhibitory oligonucleotide is an ASO that specifically binds to SHARP. The ASO described herein is at least partially complementary to SHARP RNA or DNA molecule. The ASO described herein may be from 8 to 200 nucleotides in length, in some instances between 10 and 100, in some instances between 12 and 50. In another instance, the agent the agent targeting SHARP is a small molecule inhibitor of SHARP.

Non-limiting examples of the small molecule modulators of SHARP and/or molecules associated with SHARP include MG132.

G. Modulating XIST Mediated Gene Silencing

XIST RNA has been implicated in the X-chromosome silencing by recruiting XIST silencing complex comprising a multitude of biomolecules. XIST mediated gene silencing is initiated early in the development and maintained throughout the lifetime of a cell in a female heterozygous subject. While the XIST mediated gene silencing silences functional genes in X- chromosome to maintain homeostasis, reactivation of the silenced genes can be beneficial to treat X-linked diseases with a defective allele (e.g., Rett syndrome).

Provided herein are methods treating a human subject having an X-linked disorder by modulation of one or more target molecules that directly or indirectly affect the activity, stability, assembly, proper subcellular localization and/or expression of the individual components of the XIST silencing complex, e.g., by altering the level, activity, and/or degradation of XIST RNA.

In some instances, the methods described herein provide for treating a human subject having an X-linked disorder by modulation of one or more target molecules that directly or indirectly affect the activity, stability, assembly, proper subcellular localization and/or expression of the component required for the formation of a functional XIST silencing complex, e.g., by altering the level, activity, or metabolism of HDAC3 such that the alteration results treatment of X-linked disorder associated with the silencing of genes on the X-chromosome. Modulation of target molecules may be measured by conventional assays known to a person of skill in the art, including, but not limited to, measuring target RNA levels by, e.g., quantitative real-time RT- PCR (qRT- PCR), RNA FISH, measuring target protein levels by, e.g., immunoblot. According to some aspects of the present invention, molecules that modulate components of the XIST silencing complex interactions or molecules that modulate components required for the formation of the XIST silencing complex, are useful for their ability to either prevent or reverse the silencing of X chromosome genes or any XIST-mediated gene silencing. i. Tissue types targeted

The invention also features methods of activating an epigenetically silenced gene or a hypomorphic X-linked allele on an inactive X-chromosome in a cell (e.g., fibroblast, neuronal cell line) or a particular tissue (e.g., brain tissue skeletal tissue, muscle tissue, liver tissue, kidney tissue, skin tissue). Table 1 lists tissues affected in a particular X-linked disease. Different genes have been implicated in the X-linked disorders affecting the brain tissue. Different genes have been implicated in the X-linked disorders, such as those affecting the brain tissue. Table 2 lists genes that have shown to be implicated in X-linked disorders. Exemplary X-linked disorders (genes implicated are shown in parentheses) affecting brain tissue include, Rett Syndrome (MeCP2 gene), Cornelia De Lange Syndrome (HDAC8 gene), CDKL5 Syndrome

(CDLK5gene), Happle Syndrome (EBP gene), Fragile X Syndrome (FMR1 gene,

Adrenoleukodystrophy (ABCD1 gene), Glioblastoma (ATRX gene) and Spinal Muscular Atrophy (SMA gene). For example, ED-Muscular Dystrophy (EMD gene) is an X-linked disorder (the gene implicated is shown in parentheses) affecting skeletal tissue. Duchenne Muscular Dystrophy (DMD gene) and Danon Disease (LAMP-2 gene) are exemplary X-linked disorders (genes implicated are shown in parentheses) affecting muscle. For example, Urea Cycle Disorder (OTC gene) is an X-linked disorder (the gene implicated is shown in

parentheses) affecting liver tissue. Hypophosphatemia Rickets (PHEX gene) and Alport

Syndrome (COL4A5 gene) are exemplary X-linked disorders (genes implicated are shown in parentheses) affecting kidney. Incontinentia Pigmenti (NEMO gene) and X-linked

Protoporphyria (ALAS2 gene) are exemplary X-linked disorders (genes implicated are shown in parentheses) affecting skin.

Reactivation of the associated gene in a particular tissue or cell type, both in vitro or in vivo , can result in a therapeutic benefit. Table 1: Tissue and X-linked Diseases

Table 2: Diseases and Linked Genes on the X Chromosome

By contacting the cell or tissue types described herein, the modulating agent or a combination of agents described herein may alter the activity, stability, assembly, proper subcellular localization and/or expression of the target molecule and result in the reactivation of genes implicated in the X-linked disorder listed in Table 1 or 2. ii. Levels of X-reactivation

The methods described herein are based in part on the examples which illustrate how different modulators and/or inhibitors, for example, the HDAC3 modulator, a DNA- methyltransferase 1 (DNMT1) modulator, a kinase (e.g., PI3K) modulator, an XIST modulator, alone or in any combination thereof, modulate or inhibit the formation of a functional XIST silencing complex that is required for the silencing or reduced expression and/or functionality of certain genes silenced on the X-chromosome. The disclosure is based, in part, on the principle that inhibition of a molecule (e.g., HDAC3) necessary for the formation of a functional XIST silencing complex by a modulator (e.g., HDAC3 modulator) results in the destabilization or the degradation of the XIST silencing complex. Disruption of a functional XIST silencing complex results in the re-activation of genes that were silenced by the XIST silencing complex, which can lead to beneficial effects in the treatment and/or management of X-linked disorders associated with the silencing or reduced expression and/or functionality of certain genes on the X- chromosome. On this basis the present disclosure describes a variety of different methods for the use of agents that alter the activity, stability, assembly, proper subcellular localization, expression of the individual components of the XIST silencing complex or combinations thereof, such that the alteration results in reactivation of in the re-activation of genes that were silenced by the XIST silencing complex and/or treatment of X-linked disorders associated with the genes silenced by the XIST silencing complex.

The methods described herein can be used, for example, to modulate XIST silencing complex in single cells, e.g., isolated cells in culture, or in tissues, organs, or a subject. In some instances, the methods are used to modulate XIST silencing complex in a cell or subject that has an X-linked disease. In some instances, the subject is a heterozygous female or a hemizygous male. Modulation of XIST silencing complex can be achieved in various cell types, including proliferating fibroblasts and post-mitotic neurons. The methods described herein can also be used, for example, to reactivate silenced genes in single cells, e.g., isolated cells in culture, or in tissues, organs, or whole animals. In some instances, the methods are used to reactivate silenced genes in a cell or subject that has an X-linked disease. In some instances, the subject is a heterozygous female or a hemizygous male. Reactivation of silenced genes on the X- chromosome can be achieved in various cell types, including proliferating fibroblasts and post mitotic neurons. In some instances, protein expression from silenced genes on the X- chromosome can be achieved in various cell types, including proliferating fibroblasts and post mitotic neurons.

Routine methods known to a person of skill in the art can be used to measure the percent reactivation of silenced gene (e.g., MECP2 gene) including, but not limited to, measuring gene expression by single-molecule RNA fluorescence in situ hybridization (FISH) as disclosed in Examples 28 and 29. Other methods conventional methods to measure gene expression, such as ChIP-Seq, RT-PCR can also be used to measure and/or determine reactivation of genes silenced by the XIST silencing complex on the X-chromosome. Similarly, conventional assays to measure protein levels known to a person of skill in the art, including, but not limited to, immunoblot, western blot and ELISA assays can be used. Other functional assays, e.g., binding assay using surface plasmon resonance can also be used to determine reactivation of genes described herein.

The methods provided herein are reactivating and/or producing expression product from one or more silenced genes in the diseased allele. Accordingly, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering an effective amount of a modulator to the subject having the X-linked disorder such that expression of one or more of the XIST-inactivated gene is increased. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator.

In one instance, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering an effective amount of at least one modulator described herein to the subject having the X-linked disorder such that expression of one or more of the XIST-inactivated gene is increased. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%,

20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulator.

In one instance, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering an effective amount of a combination of modulators to the subject having the X-linked disorder such that expression of one or more of the XIST-inactivated gene is increased. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%,

20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the combination of modulators. In one instance, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering an effective amount of one or more modulators alone or in combination to the subject having the X-linked disorder such that expression of one or more of the XIST-inactivated gene is increased. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%,

10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the modulators.

In one instance, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering an effective amount of a HDAC3 modulator to the subject having the X-linked disorder such that expression of one or more of the XIST- inactivated gene is increased. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to an untreated control cell, tissue or subject, or compared to the corresponding activity in the same type of cell, tissue or subject before treatment with the HDAC3 modulator.

In another instance, the disclosure provides a method of treating a subject having an X- linked disorder, said method comprising administering an effective amount of a HDAC3 modulator in combination with inhibition of DNA methylation, inhibition of PI3K activity and/or inhibition of XIST activity. The modulation of HD AC 3 in combination with modulation of one or more of DNMT1, PI3K and XIST result in the activation, de-repression, expression (e.g., expression of mRNA, expression of protein), of one or more genes on the X-chromosome (e.g., epigenetically silenced gene or a hypomorphic X-linked allele) that was silenced and/or has an increased propensity to be silenced by XIST silencing complex. The gene activation (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%,

20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% higher than the corresponding activity in a subject after the subject is treated with either one of the HDAC3, DNMT1, PI3K and XIST modulators in the same type of cell, tissue or subject.

In one instance, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering a first dose of the DNMT1 modulator to the subject having the X-linked disorder, determining clearance of the DNMT1 modulator and administering to the same subject a second dose of the same or different DNMT1 modulator after the clearance of the first dose of DNMT1 modulator. The method described above can result in the increased expression of one or more genes silenced by XIST-mediated gene silencing. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to the corresponding activity in the same type of cell, tissue or subject administered with a single dose of DNMT1 modulator.

In another instance, the disclosure provides a method of treating a subject having an X- linked disorder, said method comprising administering a first dose of the DNMT1 modulator to the subject having the X-linked disorder, determining clearance of the DNMT1 modulator and administering to the same subject a second dose of one or more modulators described herein after the clearance of the first dose of DNMT1 modulator. The method described above can result in the increased expression of one or more genes silenced by XIST-mediated gene silencing. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to the corresponding activity in the same type of cell, tissue or subject administered with a single dose of either a DNMT1 modulator or the second modulators.

In another instance, the disclosure provides a method of treating a subject having an X- linked disorder, said method comprising administering a first dose of the DNMT1 modulator to the subject having the X-linked disorder, determining clearance of the DNMT1 modulator and administering to the same subject a second dose of HDAC3 modulator after the clearance of the first dose of DNMT1 modulator. The method described above can result in the increased expression of one or more genes silenced by XIST-mediated gene silencing. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to the corresponding activity in the same type of cell, tissue or subject administered with a single dose of either a DNMT1 modulator or a HDAC3 modulator.

In yet another instance, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering a first dose of the DNMT1 modulator to the subject having the X-linked disorder, determining clearance of the DNMT1 modulator and administering to the same subject a second dose of kinase (e.g., PI3K) modulator after the clearance of the first dose of DNMT1 modulator. The method described above can result in the increased expression of one or more genes silenced by XIST-mediated gene silencing. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to the corresponding activity in the same type of cell, tissue or subject administered with a single dose of either a DNMT1 modulator or a kinase (e.g., PI3K) modulator.

In another instance, the disclosure provides a method of treating a subject having an X- linked disorder, said method comprising administering a first dose of the DNMT1 modulator to the subject having the X-linked disorder, determining clearance of the DNMT1 modulator and administering to the same subject a second dose of XIST modulator after the clearance of the first dose of DNMT1 modulator. The method described above can result in the increased expression of one or more genes silenced by XIST-mediated gene silencing. The increased expression of the silenced gene (e.g., expression of mRNA, expression of protein) can be at least 1%, 2%, 3%, 4%, 5%, 6%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% more compared to the corresponding activity in the same type of cell, tissue or subject administered with a single dose of either a DNMT1 modulator or a XIST modulator. iii. Therapeutic uses

The methods provided herein are useful for the treatment of certain diseases, such as an X-linked disorder wherein the administration of one or more modulators to a subject having the X-linked disorder reactivates the silenced genes in the diseased allele. The modulators can include inhibitory nucleotides, antibodies, nanobodies (e.g., camelid nanobody), protein drugs, aptamers, peptides (e.g., cyclic peptides), small molecule inhibitors, and combinations thereof.

The modulators can be administered to a subject having the X-linked disorder as a monotherapy (a single agent) or in a combination therapy where the subject is administered with two or more of the same (e.g., two different HDAC3 modulators) or different modulators (e.g., a HDAC3 modulator in combination with a DNMTI modulator), either simultaneously or sequentially or temporally. Accordingly, in one instance, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering an effective amount of a HDAC3 modulator as a monotherapy to the subject having the X-linked disorder. In another instance, the disclosure provides a method of treating a subject having an X-linked disorder, said method comprising administering an effective amount of a HDAC3 modulator in combination with one or more of the DNMT1 modulator, kinase (e.g., PI3K) modulator and XIST modulator. The methods provided herein also encompass treatment of X-linked disorders by the

administration of different types of modulators. The types of modulators that can be administered include inhibitory nucleotides, antibodies, nanobodies (e.g., camelid nanobody), protein drugs, aptamers, peptides (e.g., cyclic peptides), small molecule inhibitors, and combinations thereof. For example, an siRNA specific to HDAC3 can be administered to the subject in combination with a small molecule DNMT1 modulator.

In one embodiment, the present disclosure provides methods for treating X-linked diseases. In one instance, the X-linked disease is a X-linked dominant disease that affects female subjects. In one instance, the X-linked disease is a X-linked dominant disease that affects XXY male subjects. In another instance, the X-linked disease is a X-linked recessive disease affecting female subjects. In another instance, the X-linked disease is a X-linked disease that can be treated by the administration of an effective amount of a HDAC3 modulator as a monotherapy to the subject having the X-linked disorder. In yet another instance, the X-linked disease is a X- linked disease that can be treated by the administration of an effective amount of a HDAC3 modulator in combination with one or more of the DNMT1 modulator, kinase (e.g., PI3K) modulator and XIST modulator to the subject having the X-linked disorder. In a specific instance, the X-linked disease is a X-linked disease that can be treated by the co-administration of an effective amount of a HD AC 3 modulator and a modulator selected from the group consisting of DNMT1 modulator, kinase (e.g., PI3K) modulator and XIST modulator, to the subject having the X-linked disorder. In another specific instance, the X-linked disease is a X- linked disease that can be treated by the sequential administration of an effective amount of a HDAC3 modulator and a modulator selected from the group consisting of DNMT1 modulator, kinase (e.g., PI3K) modulator and XIST modulator, to the subject having the X-linked disorder. In the instance with the sequential administration, HDAC3 modulator can be administered as a first or second dose. In another instance, the X-linked disease is a X-linked disease that can be treated by the administration of an effective amount of a DNMT1 modulator as a first dose followed by the administration of the same or a different DNMTI modulator as a second dose after the clearance of the first dose from the subject. In yet another instance, the X-linked disease is a X-linked disease that can be treated by the administration of an effective amount of a DNMTI modulator as a first dose followed by the administration of a HDAC3 modulator as a second dose after the clearance of the first dose from the subject.

Non limiting examples of X-linked disorders treated by the methods described herein include incontinia pigmentosa, X-linked hypophosphatemia, Hypophosphataemic rickets, Goltz syndrome, Rett syndrome, CDKL5 deficiency disorder, Alport syndrome, Fabry's Disease, Dent’s disease, testicular feminization syndrome, Addison’s disease with cerebral sclerosis, adrenal hypoplasis, siderius X-linked mental retardation syndrome, Agammaglobulinaemia, Bruton type, Choroidoretinal degeneration, Choroidaemia, Albinism (ocular), Dent's disease, fragile X syndrome, Epileptic encephalopathy, Albinism deafness syndrome, paroxysmal nocturnal hemoglobinuria, Aldrich syndrome, hereditary hypochromic Anaemia, sideroblastic Anemia with ataxia, Spinal muscular atrophy 2, Cataract, congenital, peroneal Charcot Marie Tooth disease, Spastic paraplegia, Colour blindness, Diabetes insipidus (nephrogenic),

Therapeutic agents (e.g. modulators administered as single agents) or therapeutic compositions (e.g. modulators administered as a combination therapy) may include a modulator or combinations of modulators described herein, in a pharmaceutically acceptable form that prevents and/or reduces the symptoms of a particular disease (e.g., an X-linked disorder, Retts syndrome). For example, a therapeutic composition may be a pharmaceutical composition that prevents and/or reduces the symptoms of Rett syndrome. It is contemplated that the therapeutic composition of the present invention will be provided in any suitable form. The therapeutic composition may contain diluents, adjuvants and excipients, among other ingredients as described herein. The form of the therapeutic composition will depend on a number of factors, including the mode of administration, the capacity of the patient to incorporate the intended dosage form, etc. One of ordinary skill in the art would be able to determine empirically an appropriate therapeutically effective amount.

Pharmaceutical compositions described herein may include a pharmaceutical carrier and/or a polymeric carrier, e.g., a liposome, and delivered by known methods to a subject in need thereof Such methods include transfection (e.g., lipid-mediated, cationic polymers, calcium phosphate); electroporation or other methods of membrane disruption (e.g., nucleofection) and viral delivery (e.g., lentivirus, retrovirus, adenovirus, AAV). Methods of delivery are also described, e.g., in Gori et ah, Delivery and Specificity of CRISPR/Cas9 Genome Editing Technologies for Human Gene Therapy. Human Gene Therapy. July 2015, 26(7): 443-451. doi:10.1089/hum.2015.074; and Zuris et al. Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2014 Oct. 30;

33(l):73-80.

The pharmaceutical compositions described herein may be formulated for delivery to a cell, tissue and/or to a subject via any route of administration. Modes of administration may include injection, infusion, inhalation, intranasal, intraocular, topical delivery, intercannular delivery, or ingestion. Injection includes, without limitation, intravenous, intramuscular, intra arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. In some embodiments, administration includes aerosol inhalation, e.g., with nebulization. In some embodiments, administration is systemic (e.g., oral, rectal, nasal, sublingual, buccal, or parenteral), enteral (e.g., system-wide effect, but delivered through the gastrointestinal tract), or local (e.g., local application on the skin, intravitreal injection). In one embodiment, the composition is administered systemically. In another embodiment, the administration is non- parenteral and the therapeutic is a parenteral therapeutic.

The compositions may be administered once to the subject or, multiple administrations may be performed over a period of time or, alternatively, temporally with the second

administration performed after the clearance of the first dose. In some instances, administrations may be given as needed, e.g., for as long as symptoms associated with the disease, or disorder persist. In some embodiments, repeated administrations may be indicated for the remainder of the subject's life. Treatment periods may vary and could be, e.g., one day, two days, three days, one week, two weeks, one month, two months, three months, six months, a year, or longer.

EXAMPLES

The below Examples further describe and demonstrate the uses of methods of the present disclosure. The Examples are not intended to limit the disclosure in any way. Unless described in the past tense, descriptions of experiments are not intended to convey that the experiments have actually been performed.

The present Examples describe, among other things, experiments in cells such as cultured cells (e.g., fibroblasts). However, one of ordinary skill in the art reading the present specification will understand that the present specification also teaches application of the disclosed methods, in a therapeutic context, for example, in mammalian tissue (e.g., brain tissue) and/or in a subject (e.g., a subject with an X-linked disorder), as described further herein.

Example 1: HDAC3 modulation

This Example demonstrates the modulation of HDAC3 expression by a HDAC3 specific inhibitory oligonucleotide.

siRNA is a class of double- stranded inhibitory RNA molecule, 20-25 base pairs in length, that can inhibit target mRNA expression through the biological process of RNA interference. Transfection of siRNA into a cell interferes with the expression of the target gene within the cell with complementary nucleotide sequences. Inhibition of target gene expression occurs by degrading target mRNA after transcription, thereby preventing translation.

Fibroblasts that express HDAC3 are grown to approximately 70% confluence and transfected with 25 nM of a commercial siRNA reagent targeting human HDAC3 (Dharmacon). For non-targeting control conditions, cells are transfected with 25 nM a commercial non targeting pool siRNA reagent (Dharmacon). Cells are transfected using a transfection reagent optimized for siRNA transfection (Dharmacon) according to manufacturer's instructions. Cells are allowed to recover and harvested for HDAC3 expression after 48-96 hours.

Example 2: Measuring HDAC3 expression

This Example describes methods to measure HDAC3 mRNA expression and levels of HDAC3 protein.

Experimental design- measuring HDAC3 mRNA levels

HDAC3 expression was measured by determining HDAC3 RNA level by Real time quantitative PCR (RT-qPCR) analysis. Total RNA was isolated from cells, such as those transfected in Example 1. Reverse transcription and real-time PCR assays were performed using a TaqMan kit (ThermoFisher Scientific) with 200 nM forward primer, 200 nM reverse primer, and total RNA. Relative levels of HDAC3 RNA were normalized to GAPDH as a stably expressed control. HDAC3 and GAPDH probes were as follows HDAC3: Hs00187320_ml; GAPDH:Hs02786624_gl.. Ct values for each target gene in each sample are computed by the instrument software based on the amplification curves, and used to determine relative expression values for HDAC3 and GAPDH in each sample.

The results shown in FIG. 1 demonstrate that siRNA reagent targeting human HDAC3 inhibits the HDAC3 mRNA levels.

Example 3: Decreasing HDAC3 activity

This Example demonstrates modulation of HDAC3 activity by a small molecule inhibitor.

Vorinostat or suberanilohydroxamic acid (SAHA) (Sigma) has been shown to bind to and inhibit the active site of histone deacetylases, act as a chelator for zinc ions present in the active site of histone deacetylases. To prepare for treatment, vorinostat or suberanilohydroxamic acid (SAHA) (Sigma) was dissolved in DMSO (Sigma) at a concentration of 50 mM, which was diluted into PBS at a concentration of 2 mM prior to use. The diluent, DMSO, was added alone to culture media as a control. Fibroblasts were grown in 24 well plates with either 2 mM SAHA or control for 7 days with fresh media added every 3-4 days.

Example 4: Decreasing HDAC3 activity by perturbing SMRT

This Example demonstrates modulation of HDAC3 activity by perturbation of the interaction between HD AC 3 and SMRT.

HDAC3 activity can be modulated by perturbation of a binding partner, such as SMRT. HDAC3 activity depends on a physical interaction with the conserved deacetylation domain (DAD) of SMRT or NCOR1, and without these interactions, HDAC3 can be rendered inactive. Thus, by attenuating the interaction between HDAC3 and SMRT, HDAC3 activity is expected to be altered.

To determine the effect of inhibition of SMRT-HDAC3 interaction on HDAC3 activity, siRNA pools targeting SMRT were transfected into cells expressing HDAC3, such as by the methods described in Example 1. Reverse transcription and real-time PCR assays were performed using a TaqMan kit (ThermoFisher Scientific). Relative levels of SMRT/NCOR2 RNA were normalized to GAPDH as a stably expressed control. SMRT and GAPDH probes were as follows SMRT:Hs00196955_ml; GAPDH:Hs02786624_gl. Ct values for each gene in each sample were computed by the instrument software based on the amplification curves and used to determine relative expression values for SMRT and GAPDH in each sample.

As shown in FIG. 2, SMRT mRNA levels were reduced in samples treated with siRNA pools targeting SMRT relative to the controls treated with scrambled siRNA.

Example 5: Decreasing HDAC3 activity by perturbing SHARP

This Example demonstrates modulation of HDAC3 activity by perturbation of SHARP.

HDAC3 activity is modulated by perturbation of a component of XIST silencing complex, such as SHARP. HD AC is recruited to RNA targets by SHARP. By attenuating the complex, HDAC3 activity on SHART target RNA is expected to be affected. To determine the effect of perturbation of SHARP on HDAC3 activity, siRNA pools targeting SHARP were transfected into cells expressing HDAC3, such as by the methods described in Example 1. Reverse transcription and real-time PCR assays were performed using a TaqMan kit (ThermoFisher Scientific). Relative levels of SHARP RNA were normalized to GAPDH as a stably expressed control. SHARP and GAPDH probes were as follows

S HARP/S PEN : Hs00209232_m 1 ; GAPDH:Hs02786624_gl. Ct values for each gene in each sample were computed by the instrument software based on the amplification curves, and used to determine relative expression values for DNMT1 and GAPDH in each sample. As shown in FIG. 3, SHARP mRNA levels were reduced in samples treated with siRNA pools targeting SHARP relative to the controls treated with scrambled siRNA.

Example 6: Measuring HDAC3 activity in cell culture

This Example demonstrates methods to measure HDAC3 activity in cultured cells.

To determine modulation of HDAC3 activity in cells, western blot analysis was performed such as by the methods described in Example 2. Antibodies detecting HDAC3, and histone H4 at Lys8 (H4K8ac) (Cell Signaling) were used to probe the blot. HDAC3 acetylates histone H4 at Lys8 and inhibiting HDAC3 activity is expected to reduce detection of H4 acetylation.

HDAC3 protein or an an acetylated histone marker protein (H4K8ac) was measured by western blot analysis. Cells, such as those transfected in Example 1, were lysed and whole cell proteins are isolated with RIPA buffer (ThermoFisher Scientific). Lysates were run on SDS- PAGE after protein normalization. Samples were transferred onto PVDF membranes.

Membranes were probed with the appropriate primary antibodies: anti-HD AC3 (Cell Signaling), anti-H4K8ac (Cell Signaling), and H3 (Cell signaling) as a loading control, followed by HRP- conjugated secondary antibodies against the primary antibodies. Proteins recognized by the antibodies are detected using the Chemiluminescent Detection Kit (Pierce).

The western blot of an acetylated histone marker after HDAC3 was inhibited shown in FIG. 4 demonstrates the inhibition of HDAC3 activity.

Example 7: Combinations of HDAC3 modulators This Example demonstrates modulation of HDAC3 expression and/or activity with multiple effectors.

To determine if the combination of two or more HD AC 3 modulators affect HD AC 3 expression and/or activity, fibroblasts are treated with effectors to modulate HDAC3 expression and activity. The fibroblasts are seeded in 24 well plates and treated with siRNA, such as by the methods described in Example 1. After 24 hours, cells are treated with an HDAC3 inhibitor, such as by the methods described in Examples 3 or 4. Negative controls include non-template siRNA control and DMSO.

The inhibition of HDAC3 expression is measured as described in Example 2. The inhibition of HDAC3 activity is measured by western blot as described in Example 2.

Example 8: Measuring X chromosome gene expression

This Example describes measuring X chromosome gene expression after perturbation of HDAC3.

The status of increased gene expression of one or more X chromosome genes is assessed by fluorescence in situ hybridization. MECP2 is a gene located on the long arm of the X chromosome, in band 28. By decreasing protein activity (e.g., HDAC3) that suppresses X chromosome gene expression, it is expected that X chromosome gene expression will be increased over control when HDAC3 activity is decreased.

Single-molecule RNA fluorescence in situ hybridization (FISH) is performed on any one of the cells described in Examples 1, 3, 4, and 7 using a target RNA detection kit (Affymetrix) and a compatible ultra- sensitive FISH module (Affymetrix) according to manufacturer’s protocol to determine X chromosome gene expression.

In this assay, cells, such as those described in Examples 1, 3, 4, and 7, are fixed on coverslips. Fixed cells are first permeabilized with an aqueous solution of detergent at room temperature, and then incubated with a desired mixture of a probe set (Affymetrix) in an aqueous solution of formamide, detergent and blocker at 40 °C for 3 h, followed by an incubation with a first solution of DNA in an aqueous solution with formamide and detergent at 40 °C for 30 min, a second solution of DNA in an aqueous solution with formamide and detergent at 40 °C for 30 min, and alkaline phosphatase-conjugated oligos in an aqueous buffered solution at 40 °C for 30 min. For DAPI staining, cell-fixed coverslips are incubated in 30 nM DAPI in PBS at room temperature for 15-20 min. The probe set and conjugated oligos for FISH are specific for MECP2 and a control autosomal gene, such as ERRB2. Cells treated with FISH probes are then imaged using fluorescence microscopy to quantify the amount of probe present for each target, representing the expression level of each target at the time of fixation.

MECP2 protein is measured by western blot analysis. Cells, such as those described in Examples herein, are lysed and whole cell proteins are isolated with RIPA buffer (ThermoFisher Scientific). Lysates are run on SDS-PAGE after protein normalization. Samples are transferred onto PVDF membranes. Membranes are probed with the appropriate primary antibodies: anti- MECP2 (Cell Signaling), and H3 (Cell signaling) as a loading control, followed by HRP- conjugated secondary antibodies against the primary antibodies. Proteins recognized by the antibodies are detected using the Chemiluminescent Detection Kit (Pierce).

It is expected that increases in MECP2 RNA expression result in increases in MECP2 protein levels.

Example 9: DNMT1 modulation

This Example demonstrates the effect of DNMT1 modulation on X chromosome activation.

Fibroblasts that express DNMT1 were grown to approximately 70% confluence and transfected with 25 nM of a commercial siRNA reagent targeting human DNMT1 (Dharmacon). For non-targeting control conditions, cells were transfected with 25 nM a commercial non targeting pool siRNA reagent (Dharmacon). Cells were transfected using a transfection reagent optimized for siRNA transfection (Dharmacon) according to manufacturer's instructions. Cells were allowed to recover and harvested for DNMT1 expression after 48-96 hours.

Example 10: Measuring DNMT1 expression

This Example describes methods to measure DNMT1 mRNA expression and levels of DNMT1 protein.

Measuring DNMT1 mRNA levels

Reverse transcription and real-time PCR assays were performed using a TaqMan kit (ThermoFisher Scientific). Relative levels of DNMT1 RNA were normalized to GAPDH as a stably expressed control. DNMT1 and GAPDH probe sequences were as follows DNMT1: Hs00945875_ml; GAPDH:Hs02786624_gl. Ct values for each gene in each sample were computed by the instrument software based on the amplification curves, and used to determine relative expression values for DNMT1 and GAPDH in each sample.

FIG. 5 shows that DNMT1 mRNA levels were reduced in samples treated with siRNAs targeting DNMT1 relative to the controls treated with scrambled siRNA.

Measuring DNMT1 protein levels

DNMT1 protein is measured by western blot analysis. Cells, such as those transfected in Example la, are lysed and whole cell proteins are isolated with RIPA buffer (ThermoFisher Scientific). Lysates are run on SDS-PAGE after protein normalization. Samples are transferred onto PVDF membranes. Membranes are probed with the appropriate primary antibodies: anti- DNMT1 (Cell Signaling), and H3 (Cell signaling) as a loading control, followed by HRP- conjugated secondary antibodies against the primary antibodies. Proteins recognized by the antibodies are detected using the Chemiluminescent Detection Kit (Pierce).

Example 11: Decreasing DNMT1 activity

This Example demonstrates modulation of DNMT1 activity by a small molecule inhibitor.

DNMT1 inhibitors such as decitabine can be substituted for cytosine. Azacytosine- guanine dinucleotides are recognized as substrate by the DNA methyltransferases, which catalyze the methylation reaction by a nucleophilic attack. This results in a covalent bond between the carbon-5 atom of the cytosine ring and the enzyme. The bond is normally resolved by beta-elimination through the carbon-5 atom, but this latter reaction does not occur with azacytosine because its carbon-5 is substituted by nitrogen, leaving the enzyme covalently bound to DNA and blocking its DNA methyltransferase function.

To prepare for treatment, 2'-Deoxy-5-azacytidine or 4-Amino-l -(2-dcoxy-P-D- ribofuranosyl)-l,3,5-triazin-2(lH)-one or Decitabine (Sigma) was dissolved in DMSO (Sigma) at a concentration of 50 mM, which was diluted into PBS at a concentration of 0.5 mM prior to use. The diluent, DMSO, was added alone to culture media as a control. Fibroblasts were grown in 24 well plates with either 25mM Decitibine or control for 7 days and replaced with fresh media and decitibine every day. Example 12: Measuring DNMT1 activity

This Example demonstrates methods to measure HDAC3 activity in cultured cells.

DNMT1 is an enzyme responsible for methylation of DNA. DNMT1 activity can measured by amount of methylated DNA via a dot blot analysis.

Cells were treated for 7 days as described in Example 11 and harvested. DNA was isolated from cultured cells using a DNA isolation kit (Qiagen) and quantified using

fluorescence-based dsRNA quantification kit (Life Technologies). One microgram of DNA was denatured using 0.4 mol/L NaOH. Samples were then heated to 100°C for 10 minutes to ensure complete denaturation. Samples were then neutralized by adding an equal volume of 2 mol/L ammonium acetate, pH 7.0, to the target DNA solution. Samples were loaded onto Hybond-ECL nitrocellulose membrane. The membrane was removed and allowed to air dry for 30 minutes at room temperature. The membrane was then blocked for 2 hours in 5% milk in dot blot buffer (20 mmol/L Tris, .05% Tween-20), washed 1 x in dot blot buffer, and incubated in 5-methylcytosine primary antibody (Abeam) for 2 hours at room temperature in dot blot buffer and 5% milk. The membrane was then washed 5 x for 5 minutes and incubated in horseradish peroxidase- conjugated secondary antibody (anti-rabbit, 1:5000) for 1 hour at room temperature in dot blot buffer and 5% milk, followed by 5 washes in dot blot buffer for 5 minutes. The membrane was incubated in ECL reagent and images are captured with an analysis software (Alpha Innotech).

FIG. 6 shows the Dot blot image after treatment with DNMT1 inhibitor treatment. The results demonstrate the modulation of DNMT1 activity by Decitabine.

Example 13: Combinations of DNMT1 modulators

This Example demonstrates modulation of DNMT1 expression and/or activity with multiple effectors.

To determine if the combination of two or more DNMT1 modulators affect DNMT1 expression and/or activity, fibroblasts are treated with effectors to modulate DNMT1 expression and activity. The fibroblasts are seeded in 24 well plates and treated with siRNA, such as by the methods described in Example 9. After 24 hours, cells are treated with an DNMT1 inhibitor, such as by the methods described in Examples 11. Negative controls include non-template siRNA control and DMSO. The inhibition of DNMT1 expression is measured as described in Example 11. The inhibition of DNMT1 activity is measured by dot blot as described in Example 12.

Example 14: Measuring X chromosome gene expression

This Example demonstrates measuring X chromosome gene expression after perturbation of DNMT1.

The status of increased gene expression of one or more X chromosome genes was assessed by fluorescence in situ hybridization. MECP2 is a gene located on the long arm of the X chromosome, in band 28. By decreasing protein activity (e.g., DNMT1) that suppresses X chromosome gene expression, it was expected that X chromosome gene expression will be increased over control when DNMT1 activity is decreased.

Single-molecule RNA fluorescence in situ hybridization (FISH) was performed on any one of the cells described in Examples 9, 11, 12, and 13 using a target RNA detection kit (Affymetrix) and a compatible ultra-sensitive FISH module (Affymetrix) according to manufacturer’s protocol to determine X chromosome gene expression.

In this assay, cells, such as those described in Examples 9, 11, or 13 were fixed on coverslips. Fixed cells were first permeabilized with an aqueous solution of detergent at room temperature, and then incubated with a desired mixture of a probe set (Affymetrix) in an aqueous solution of formamide, detergent and blocker at 40°C for 3 h, followed by an incubation with a first solution of DNA in an aqueous solution with formamide and detergent at 40°C for 30 min, a second solution of DNA in an aqueous solution with formamide and detergent at 40°C for 30 min, and alkaline phosphatase-conjugated oligos in an aqueous buffered solution at 40°C for 30 min. For DAPI staining, cell-fixed coverslips were incubated in 30 nM DAPI in PBS at room temperature for 15-20 min. The probe set and conjugated oligos for FISH were specific for MECP2 and a control autosomal gene, such as ERRB2. Cells treated with FISH probes were then imaged using fluorescence microscopy to quantify the amount of probe present for each target, representing the expression level of each target at the time of fixation.

MECP2 protein is measured by western blot analysis. Cells, such as those described in Examples herein, are lysed and whole cell proteins are isolated with RIPA buffer (ThermoFisher Scientific). Fysates are run on SDS-PAGE after protein normalization. Samples are transferred onto PVDF membranes. Membranes are probed with the appropriate primary antibodies: anti- MECP2 (Cell Signaling), and H3 (Cell signaling) as a loading control, followed by HRP- conjugated secondary antibodies against the primary antibodies. Proteins recognized by the antibodies are detected using the Chemiluminescent Detection Kit (Pierce).

Example 15: XIST inhibition by modulation of XIST transcript number

This Example demonstrates modulation of XIST transcript number expression by a XIST specific inhibitory oligonucleotide.

XIST is a long non-coding RNA responsible for X inactivation, an early developmental process in mammalian females that transcriptionally silences one of the pairs of X chromosomes, providing dosage equivalence between males and females. Reduction in XIST transcript number can prevent or reduce silencing of the X chromosome.

Fibroblasts that express XIST are grown to approximately 70% confluence and transfected with 25 nM of a commercial siRNA reagent targeting human XIST (Dharmacon). For non-targeting control conditions, cells are transfected with 25 nM a commercial non-targeting pool siRNA reagent (Dharmacon). Cells are transfected using a transfection reagent optimized for siRNA transfection (Dharmacon) according to manufacturer's instructions. Cells are allowed to recover and harvested for XIST expression after 48-96 hours.

Example 16: Measuring XIST transcript levels

This Example describes methods to measure XIST transcript levels.

Single-molecule RNA fluorescence in situ hybridization (FISH) is performed on cells described in Examples 15 using a target RNA detection kit (Affymetrix) and an ultra-sensitive FISH module (Affymetrix) according to manufacturer’s protocol to XIST transcript levels.

Cells, such as those described in Examples 9 or 15, are fixed on coverslips. Briefly, cells are first permeabilized with an aqueous solution of detergent at room temperature, and then incubated with a desired mixture of a probe set (Affymetrix) in an aqueous solution of formamide, detergent and blocker at 40°C for 3 h, followed by an incubation with a first solution of DNA in an aqueous solution with formamide and detergent at 40°C for 30 min, a second solution of DNA in an aqueous solution with formamide and detergent at 40°C for 30 min, and alkaline phosphatase-conjugated oligos in an aqueous buffered solution at 40°C for 30 min. For DAPI staining, cell-fixed coverslips are incubated in 30 nM DAPI in PBS at room temperature for 15-20 min. The probe set and conjugated oligos for FISH are specific for XIST and control.

Example 17: Combinations of XIST modulators

This Example demonstrates modulation of XIST transcript number and/or expression with multiple effectors.

To determine if the combination of two or more XIST modulators affect XIST transcript number and/or expression, fibroblasts are treated with effectors to modulate XIST expression and activity. The fibroblasts are seeded in 24 well plates and treated with siRNA, such as by the methods described in Example 15. After 24 hours, cells are treated with a XIST expression perturber, such as by the methods described in Examples 16. Negative controls include non template siRNA control and DMSO. The inhibition of DNMT1 expression is measured as described in Example 16.

Example 18: Measuring X chromosome gene expression

This Example demonstrates measuring X chromosome gene expression after perturbation of XIST.

The status of increased gene expression of one or more X chromosome genes is assessed by fluorescence in situ hybridization. MECP2 is a gene located on the long arm of the X chromosome, in band 28. By decreasing XIST copy number or expression, it is expected that X chromosome gene expression will be increased over control when XIST levels are decreased.

Single-molecule RNA fluorescence in situ hybridization (FISH) is performed on any one of the cells described in Examples 15-17 using a target RNA detection kit (Affymetrix) and a compatible ultra-sensitive FISH module (Affymetrix) according to manufacturer’s protocol to determine X chromosome gene expression.

In this assay, cells, such as those described in Examples 15-17 are fixed on coverslips. Fixed cells are first permeabilized with an aqueous solution of detergent at room temperature, and then incubated with a desired mixture of a probe set (Affymetrix) in an aqueous solution of formamide, detergent and blocker at 40°C for 3 h, followed by an incubation with a first solution of DNA in an aqueous solution with formamide and detergent at 40°C for 30 min, a second solution of DNA in an aqueous solution with formamide and detergent at 40°C for 30 min, and alkaline phosphatase-conjugated oligos in an aqueous buffered solution at 40°C for 30 min. For DAPI staining, cell-fixed coverslips are incubated in 30 nM DAPI in PBS at room temperature for 15-20 min. The probe set and conjugated oligos for FISH are specific for MECP2 and a control autosomal gene, such as ERRB2. Cells treated with FISH probes are then imaged using fluorescence microscopy to quantify the amount of probe present for each target, representing the expression level of each target at the time of fixation.

Example 19: Decreasing PI3K expression

This Example demonstrates modulation of PI3K expression. This Example demonstrates modulation of PI3K expression by a XPI3K specific inhibitory oligonucleotide.

Pharmacological inhibition of the PI3K pathway has been suggested to reactivate the X chromosome. PIK3CA encodes the key enzymatic subunit pi 10a of phosphatidylinositol 3- kinase (PI3K) and knockdown PIK3CA has been shown to impair activation of the PI3K pathway (Zhou et al World J Gastroenterol 17(32): 3700-3708, 2011).

Fibroblasts that express PIK3CA are grown to approximately 70% confluence and transfected with 25 nM of a commercial siRNA reagent targeting human PIK3CA (Dharmacon). For non-targeting control conditions, cells are transfected with 25 nM a commercial non targeting pool siRNA reagent (Dharmacon). Cells are transfected using a transfection reagent optimized for siRNA transfection (Dharmacon) according to manufacturer's instructions. Cells are allowed to recover and harvested for PIK3CA expression after 48-96 hours. Example 20: Measuring PI3K expression

This Example describes methods to measure PI3K expression and protein levels.

Measuring PI3K mRNA levels

PI3K expression is measured on the RNA level by qPCR analysis. Total RNA is isolated from cells, such as those transfected in Example 19, using a phenol-based RNA isolation reagent (Invitrogen).

Reverse transcription and real-time PCR assays are performed using a quantitative SYBR Green RT-PCR master mix kit (ThermoFisher Scientific) with 200 nM forward primer, 200 nM reverse primer, and total RNA. Relative levels of PI3KCA RNA are normalized to b-actin as a stably expressed control. PI3KCA and b-actin primer sequences (Chen et al, JBC 286: 32775- 3278, 2011) are as follows PI3KCA and b-actin primer sequences (Chen et al, JBC 286: 32775- 3278, 2011) are as follows PI3KCA: PIK3CA forward: 5’- TGGATGCTCTACAGGGCTTT-3’ (SEQ.ID.NO.6); Reverse: 5’ -GTCTGGGTTCTCCCAATTC A-3 (SEQ.ID.NO.7)’; b-Actin primers forward 5'-ACGGCCAGGTCATCACTATTG-3' (SEQ.ID.NO.8); reverse 5'- CAAGAAGGAAGGCTGGAAAAG-3 ' (SEQ.ID.NO.9). During qPCR amplification, SYBR green fluorescence intensity for each target gene is recorded by the qPCR instrument

(ThermoFisher Scientific) as a measurement of the amount of double-stranded DNA produced during each PCR cycle. Ct values for each gene in each sample are computed by the instrument software based on the amplification curves, and used to determine relative expression values for PI3KCA and b-actin in each sample.

Measuring PI3K protein levels

PI3KCA protein is measured by western blot analysis. Cells, such as those transfected in Example la, are lysed and whole cell proteins are isolated with RIPA buffer (ThermoFisher Scientific). Lysates are run on SDS-PAGE after protein normalization. Samples are transferred onto PVDF membranes. Membranes are probed with the appropriate primary antibodies: anti- PI3KCA (Cell Signaling), and H3 (Cell signaling) as a loading control, followed by HRP- conjugated secondary antibodies against the primary antibodies. Proteins recognized by the antibodies are detected using the Chemiluminescent Detection Kit (Pierce). Example 21: Decreasing PI3K activity

This Example demonstrates modulation of PI3K activity by a small molecule inhibitor. LY294002 inhibits PI3K activity via competitive inhibition of an ATP binding site on the p85a subunit of PI3K. To prepare for treatment, LY-294,002 hydrochloride, LY294002 (Sigma) is dissolved in DMSO (Sigma). The diluent, DMSO, is added alone to culture media as a control. Fibroblasts are grown in 24 well plates with either 20mM LY294002 or control for 7 days and replaced with fresh media and LY294002 every day.

Example 22: Measure PI3K activity

This Example describes methods to measure methods to measure PI3K activity.

Pharmacological inhibition of the PI3K pathway has been suggested to reactivate the X chromosome.

PI3K activity assays are performed using the PI3-kinase activity ELISA: Pico (Echelon Biosciences Incorporated). Briefly, cells, such as those described in 20 and 21, are washed once with ice-cold PBS then lysed using sonication in ice-cold PI3K assay lysis buffer (50 mM Tris- HC1, pH 7.4, 40 mM NaCl, 1 mM EDTA, 0.5 % Triton X-100, 1.5 mM Na3V04, 50 mM NaF,

10 mM sodium pyrophosphate, and 10 mM sodium glycerol phosphate, supplemented with proteinase inhibitors). PI3-K reactions are run following manufacturer’s instructions, with the Class I PI3-K physiological substrate PI(4,5)P2 (PIP2). The enzyme reactions, PIP3 standards, and controls are then mixed and incubated with PIP3 binding protein that is highly specific and sensitive to PIP3. This mixture is then transferred to a PIP3-coated microplate for competitive binding. Afterwards, a peroxidase-linked secondary detector and colorimetric detection is used to detect the amount of PIP3 produced by PI3-K through comparing the enzyme reactions with a PIP3 standard curve.

Example 23: Combinations of PI3K modulators

This Example demonstrates modulation of PI3K expression and/or activity with multiple effectors.

To determine if the combination of two or more PI3K modulators affect PI3K expression and/or activity, fibroblasts are treated with effectors to modulate PI3K expression and activity. The fibroblasts are seeded in 24 well plates and treated with siRNA, such as by the methods described in Example 19. After 24 hours, cells are treated with an PI3K inhibitor, such as by the methods described in Examples 21. Negative controls include non-template siRNA control and DMSO.

The inhibition of PI3K expression is measured as described in Example 20. The inhibition of PI3K activity is measured by PI3K activity assay as described in Example 22.

Example 24: Measuring X chromosome gene expression

This Example demonstrates measuring X chromosome gene expression after perturbation of PI3K.

The status of increased gene expression of one or more X chromosome genes is assessed by fluorescence in situ hybridization. MECP2 is a gene located on the long arm of the X chromosome, in band 28. By decreasing protein activity (e.g., PI3KCA) that suppresses X chromosome gene expression, it is expected that X chromosome gene expression will be increased over control when PI3KCA activity is decreased.

Single-molecule RNA fluorescence in situ hybridization (FISH) is performed on any one of the cells described in Examples 19-23 using a target RNA detection kit (Affymetrix) and a compatible ultra-sensitive FISH module (Affymetrix) according to manufacturer’s protocol to determine X chromosome gene expression.

In this assay, cells, such as those described in Examples 19-23 are fixed on coverslips. Fixed cells are first permeabilized with an aqueous solution of detergent at room temperature, and then incubated with a desired mixture of a probe set (Affymetrix) in an aqueous solution of formamide, detergent and blocker at 40°C for 3 h, followed by an incubation with a first solution of DNA in an aqueous solution with formamide and detergent at 40°C for 30 min, a second solution of DNA in an aqueous solution with formamide and detergent at 40°C for 30 min, and alkaline phosphatase-conjugated oligos in an aqueous buffered solution at 40°C for 30 min. For DAPI staining, cell-fixed coverslips are incubated in 30 nM DAPI in PBS at room temperature for 15-20 min. The probe set and conjugated oligos for FISH are specific for MECP2 and a control autosomal gene, such as ERRB2. Cells treated with FISH probes are then imaged using fluorescence microscopy to quantify the amount of probe present for each target, representing the expression level of each target at the time of fixation. MECP2 protein is measured by western blot analysis. Cells, such as those described in Examples herein, are lysed and whole cell proteins are isolated with RIPA buffer (ThermoFisher Scientific). Lysates are run on SDS-PAGE after protein normalization. Samples are transferred onto PVDF membranes. Membranes are probed with the appropriate primary antibodies: anti- MECP2 (Cell Signaling), and H3 (Cell signaling) as a loading control, followed by HRP- conjugated secondary antibodies against the primary antibodies. Proteins recognized by the antibodies are detected using the Chemiluminescent Detection Kit (Pierce).

Example 25: Modulation of two or more targets in combination.

Multiple targets from the preceding Examples were modulated simultaneously or at different times in the same cells to affect X chromosome gene expression. This Example demonstrates the resulting increased X chromosome gene expression by simultaneously modulating HDAC3 and DNMT1 expression or activity.

Fibroblasts expressing DNMT1 and HDAC3 were seeded in 24 well plates at approximately 70% confluence in medium containing a combinationDNMTl inhibitor (Sigma) at a concentration of 0.5 mM, and either 2 mM of HD AC inhibitor SAHA (Sigma) or 3.3 uM of HDAC3 inihibitor RGFP966 (Cayman Chemical). 7 dayspost-transfection, cells were harvested for assessment of X chromosome gene expression. As controls, cells plated in parallel are grown in medium containing DMSO only (no decitabine or eitherHDAC inhibitor).

Example 26: Temporal modulation of DNMT1 and HDAC3 activities.

This Example demonstrates the resulting increased X chromosome gene expression by modulating HDAC3 and DNMT1 expression at different points of time.

Fibroblasts expressing DNMT1 and HDAC3 are seeded in 24 well plates and first treated with a DNMT1 inhibitor, 2'-Deoxy-5-azacytidine or 4-Amino-l-(2-deoxy-P-D-ribofuranosyl)- l,3,5-triazin-2(lH)-one (Decitabine) (Sigma) added to the medium at a concentration of 25 pM for two days. After two days of decitabine treatment, fresh medium without decitabine is exchanged and the cells are transfected with 25 nM of a commercial siRNA reagent targeting human HDAC3 (Dharmacon) using a transfection reagent optimized for siRNA transfection (Dharmacon) according to manufacturer's instructions. Cells are allowed to recover and harvested for assessment of DNMT1 activity, HDAC3 activity, and X chromosome gene expression after 48-96 hours. As controls, cells plated in parallel are are grown in medium containing DMSO only (no decitabine) and transfected with either siRNAs targeting HDAC3 or non-targeting scrambled siRNAs.

Example 27: Measuring specific modulation of target RNA and/or protein levels, and/or activity.

This Example describes methods to measure modulation of two different targets to achieve increased X chromosome gene expression. Specifically, this Example demonstrates the modulation of DNMT1 and SHARP modulation by siRNA (verified by qPCR.

DNMT1 and SHARP expression was measured by the RNA level using qPCR analysis.

FIG. 7 illustrates that the DNMT1 mRNA levels and the SHARP mRNA levels were both reduced in samples treated with siRNAs targeting DNMT1 and SHARP, respectively, relative to the control treated with scrambled siRNA.

Measuring protein levels

HDAC3 protein is measured by western blot analysis. Cells, such as those treated in Example 25 or 26, are lysed and whole cell proteins are isolated with RIPA buffer

(ThermoFisher Scientific). Lysates are run on SDS-PAGE after protein normalization. Samples are transferred onto PVDF membranes. Membranes are probed with the appropriate primary antibodies: anti-HD AC3 (Cell Signaling), and H3 (Cell Signaling) as a loading control, followed by HRP-conjugated secondary antibodies against the primary antibodes. Proteins recognized by the antibodies are detected using the Chemiluminescent Detection Kit (Pierce).

DNMT1 activity is measured by dot blot analysis. Cells are treated for 7 days as described in Example 11 and harvested. DNA was isolated from cultured cells using a DNA isolation kit (Qiagen) and quantified using fluorescence-based dsRNA quantification kit (Life Technologies). One microgram of DNA was denatured using 0.4 mol/L NaOH. Samples were then heated to 100°C for 10 minutes to ensure complete denaturation. Samples are then neutralized by adding an equal volume of 2 mol/L ammonium acetate, pH 7.0, to the target DNA solution. Samples are loaded onto a prewet (6 x SSC) nitrocellulose membrane loaded into a 48- well (slot format) microfiltration unit (Bio-Rad). With the vacuum off, denatured DNA is loaded and pulled through by gravity filtration, followed by gentle vacuum. The membrane is removed and allowed to air dry for 30 minutes at room temperature. Once dry, the membrane is placed between 2 pieces of filter paper and baked under vacuum at 80°C for 2 hours. The dry membrane is then blocked for 2 hours in 5% milk in dot blot buffer (20 mmol/L Tris, .05% Tween-20), washed 1 x in dot blot buffer, and incubated in 5-methylcytosine primary antibody (Abeam) for 2 hours at room temperature in dot blot buffer and 5% milk. The membrane is then washed 5 x for 5 minutes and incubated in horseradish peroxidase-conjugated secondary antibody (anti rabbit, 1:5000) for 1 hour at room temperature in dot blot buffer and 5% milk, followed by 5 washes in dot blot buffer for 5 minutes. The membrane is incubated in ECL reagent and images are captured with an analysis software (Alpha Innotech).

Example 28: Measuring X chromosome gene expression

This Example demonstrates measuring X chromosome gene expression after perturbation of HDAC3 and DNMT1 RNA, protein levels, or enzymatic activity.

The status of increased gene expression of one or more X chromosome genes was assessed by fluorescence in situ hybridization (FISH). Assessing with FISH probes targeting intronic regions of the MECP2 gene identifies alleles undergoing active transcription. Two FISH spots using intronic probes indicates two actively expressing X chromosome alleles and therefore X-reactivation. By assessing with exonic FISH probes, total MECP2 gene expression was measured, and the X chromosome reactivation showed increase over control. MECP2 is a gene located on the long arm of the X chromosome, in band 28. By decreasing HDAC3 and DNMT1 RNA or protein levels, or modulating their enzymatic activities, in combination, it is expected that there will be an increased number of cells X chromosome genes biallelicly, and that X chromosome gene expression will be increased over control.

Single-molecule RNA fluorescence in situ hybridization was performed on any one of the cells described in Examples 25-26 using a target RNA detection kit (Thermo Fisher) and an ultra- sensitive FISH module (Thermo Fisher) according to manufacturer’s protocol to determine X chromosome gene expression.

Cells, such as those described in Examples 25-26, were fixed on coverslips. Fixed cells were first permeabilized with an aqueous solution of detergent at room temperature, and then incubated with a desired mixture of a probe set (Thermo Fisher) in an aqueous solution of formamide, detergent and blocker at 40 °C for 3 h, followed by an incubation with a first solution of DNA in an aqueous solution with formamide and detergent at 40 °C for 30 min, a second solution of DNA in an aqueous solution with formamide and detergent at 40 °C for 30 min, and alkaline phosphatase-conjugated oligos in an aqueous buffered solution at 40 °C for 30 min. For DAPI staining, cell-fixed coverslips were incubated in 30 nM DAPI in PBS at room temperature for 15-20 min. The probe set and conjugated oligos for FISH, targeting either intronic or exonic MECP2 sequences, were specific for MECP2 and a control autosomal gene such as ERRB2. Cells treated with FISH probes are then imaged using fluorescence microscopy to quantify the amount of probe present for each target, representing the expression level of each target at the time of fixation.

FIGS. 8A-8B show the increase in biallelic expression X chromosome as measured in a FISH assay described above. Perturbation of HDAC3 and DNMT1 increased the number of cells X chromosome genes biallelicly, and the X chromosome gene expression was increased in FIG. 8B over the control in FIG. 8A. FIG.10 shows the percentage of nuclei in cells treated with HDAC3 and DNMT1 inhibitors.

FIGS. 9A-9B show the increased expression of MECP as measured in a FISH assay described above. FIG.11 shows the increase in the expression of the MECP2 RNA transcripts in cells treated with HDAC3 and DNMT1 inhibitors.

Example 29: Increased gene expression on X chromosome in vivo

This Example demonstrates modulation of one or more targets and measurement of X chromosome gene expression in disease relevant tissues in vivo.

Chemical inhibitors described in Example 25 are re-suspended in vehicle (0.9% NaCl, 0.5% methylcellulose, 4.5% DMSO), or vehicle alone are injected into the opposite hemispheres of the brain of an anesthetized mouse every 2 days for 21 days. The drug regimen is based on the results from the rate of reactivation achieved in fibroblasts determined in Example 28. To maintain spatiotemporal control, all injections are done approximately at the predefined stereotactic coordinates with the position of bregma set as the reference of the X and Y coordinates (stereotactic zero). At the termination of the experiment, mice are sacrificed, and fixed by transcardial perfusion with 4% paraformaldehyde. Mouse brains are then isolated, embedded in optimum cutting temperature (OCT) and frozen at -80°C. Sections are mounted and analyzed by FISH as described in Example 8.

Example 30: Generation of Rett Syndrome neurons

This Example demonstrates generation of Rett syndrome neurons and modulation of targets in diseased cells in vitro. The targets are modulated in Rett Syndrome neurons to affect X chromosome activation.

Rett syndrome (RTT) is a rare neurodevelopmental disease characterized by a

constellation of features including epilepsy, autistic-like behaviors, and delayed development. Most RTT patients are females who carry a heterozygous loss-of- function mutation in an X- linked gene, MECP2. Because MECP2 is X-linked, its allele- specific expression pat- tern is determined by X chromosome inactivation (XCI), a mammalian dosage compensation mechanism in which one X chromosome is randomly epigenetically silenced and is referred to as the“inactive” X chromosome (Xi). As a result of XCI, ~50% of cells in RTT females carry a wild-type but silenced copy of MECP2 on the Xi chromosome, which, if reactivated by methods described in Examples 1-5, can compensate for MECP2 deficiency.

RTT neurons specific neurons are derived from clonal induced pluripotent stem cell (iPSC) line, T158M-iPSC, which is derived from GM17880, an RTT fibroblast cell line that harbors a hetero- zygous T158M missense mutation in MECP2. The T158M- iPSC clone carries mutant MECP2 on the Xa chromosome and wild-type MECP2 on the Xi chromosome. As a positive isogenic control, non-RTT iPSC clones are used, which are also derived from GM17880 but carry wild-type MECP2 on the Xa.

Neuronal differentiation is initiated to produce neuronal precursor cells, which are then differentiated into neurons. iPSC derived neural progenitor and differentiated neuronal cells were generated using the Human ES/iPS Cell Neurogenesis kit (Sigma). Undifferentiated iPS cell colonies were seeded on to MEFs for 48 hours with 20% KOSR medium supplemented with FGF-2, 8 ng/mL (Sigma). After 48 hours, growth medium was replaced by neural induction medium 1 (Sigma) for five days with medium changed every other day. On day six, cells were dissociated with non-enzymatic buffer (Sigma) and plated on 0.5 mg/mL Matrigel® plates with neural induction medium 2 (Sigma) for an additional five days with medium changed every other day. Neural progenitor cells were plated on poly- L-ornithine/laminin, 10 pg/mL each (Sigma) at 10 to 20 thousand cells/cm2 with neuronal differentiation medium (Sigma) that was

supplemented with 0.5 mM dibutyryl cAMP and 0.2 mM ascorbic acid phosphate. About 80% of the medium was refreshed every two to three days for a total of 9-14 days.

Example 31: Assay of Rett Syndrome neurons

This Example demonstrates methods to measure neuronal function in disease specific cells. Rett syndrome patients have defective neuronal organization and dendritic complexity, including reduced glutamatergic synapse number, soma size, and number of dendritic spines.

RTT neurons are treated with either DMSO or the X chromosome modulators for 3 weeks as described in Example 30. MECP2 RNA is monitored following methods described in Example 5.

Following treatment, neurons are fixed on coverslips and subjected to antigen retrieval (0.1 M citric acid, 0.1 M Tris-base, pH=6; 5 min in 100°C) 3 before staining. Neurons are stained with neuronal markers anti-MAP2 (1:1000, Aves Labs, MAP) and an a n t i - b - 111 - 1 u h u 1 i n (TUBB3; 1:250, Biolegend, 657405) in order to determine soma size and dendritic spine counts. Neuronal morphological features are imaged and quantified using NeuroTrack software in an incubator mounted microscopy system (Incucyte).

Example 32: Modulation of HDAC3 and PI3K in combination

This example demonstrates modulation of HDAC3 and PI3K activity in combination to affect X chromosome reactivation.

Vorinostat or suberanilohydroxamic acid (SAHA) (Sigma) has been shown to bind to and inhibit the active site of histone deacetylases, act as a chelator for zinc ions also found in the active site of histone deacetylases while LY294002 inhibits PI3K activity via competitive inhibition of an ATP binding site on the p85a subunit of PI3K. To prepare for treatment, vorinostat or suberanilohydroxamic acid (SAHA) (Sigma) and LY-294,002 hydrochloride, LY294002 (Sigma) are dissolved in DMSO (Sigma) The diluent, DMSO, is added alone to culture media as a control. Fibroblasts are grown in 24 well plates with either 2 mM SAHA, 20mM LY294002, a combination of SAHA (2 mM) and LY294002(20p M), or control for 7 days with fresh media added daily.

Inhibition of HDAC3 and PI3K activity will be measured following methods described in Examples herein. Reactivation of the X chromosome will be measured following methods described in the previous Examples.

Example 33: Modulation of HDAC3 and XIST

This Example demonstrates modulation of HDAC3 and XIST activity in combination to affect X chromosome reactivation.

Fibroblasts expressing XIST and HDAC3 are seeded in 24 well plates at approximately 70% confluence in medium containing a HDAC3 inhibitor suberanilohydroxamic acid (SAHA) (Sigma) at a concentration of 2mM. Cells are then transfected with 25 nM of a commercial siRNA reagent targeting human XIST (Dharmacon) using a transfection reagent optimized for siRNA transfection (Dharmacon) according to manufacturer's instructions. Cells are allowed to recover for one day, then fresh medium containing 2mM SAHA is exchanged. 48-96h post transfection, cells are harvested for assessment of HDAC3 activity, XIST RNA levels, and X chromosome gene expression. As controls, cells plated in parallel are grown in medium containing DMSO only (no SAHA) and transfected with either siRNAs targeting XIST or non targeting scrambled siRNAs.

Inhibition of HDAC3 and XIST will be measured following methods described in other Examples herein. Reactivation of the X chromosome will be measured following methods described in a previous Example.

Example 34: Modulation of HDAC3 in combination with inhibition of DNA methylation, PI3K activity, and XIST

This example demonstrates modulation of HDAC3 in combination with modulation of DNMT1, PI3K, and XIST.

Fibroblasts expressing HDAC3, DNMT1, PI3K, and XIST are seeded in 24 well plates at approximately 70% confluence in medium containing a HDAC3 inhibitor suberanilohydroxamic acid (SAHA) (Sigma) at a concentration of 2mM, DNMT1 inhibitor, 2'-Deoxy-5-azacytidine or 4-Amino-l-(2-deoxy-P-D-ribofuranosyl)-l,3,5-triazin-2(lH)-one (Decitabine) (Sigma) at a concentration of 25 mM, and PI3K inhibitor LY294002 at a concentration of 20mM. Cells are then transfected with 25 nM of a commercial siRNA reagent targeting human XIST

(Dharmacon) using a transfection reagent optimized for siRNA transfection (Dharmacon) according to manufacturer's instructions. Cells are allowed to recover for one day, then fresh medium containing 2mM SAHA is exchanged. 48-96h post-transfection, cells are harvested for assessment of HDAC3, DNMT1, and PI3K activity, as well as XIST RNA levels, and X chromosome gene expression. As controls, cells plated in parallel are grown in medium containing DMSO only, individual compounds, and transfected with either siRNAs targeting XIST or non-targeting scrambled siRNAs.

Inhibition of HDAC3, XIST, DNMT1, and PI3K will be measured following methods described in previous Examples. Reactivation of the X chromosome will be measured following methods described in other Examples herein.

Example 35: Measuring X reactivation in a subject

This example demonstrates measurement of X reactivation in human subjects.

Human skin tissue is biopsied using 4mm round Visipunch instrument. Tissue is then embedded in optimum cutting temperature (OCT) and frozen at -80°C. Sections are mounted and analyzed by FISH as described in other Examples herein with probes specific for target gene.

Blood samples are collected from patients. Peripheral blood mononuclear cells (PBMCs) with X chromosome silenced are purified using standard Ficoll-Paque gradient centrifugation according to the instructions of the manufacturer (Amersham Pharmacia, Uppsala, Sweden). Briefly, 4 ml of Ficoll-Paque gradient is pipetted into two 15-ml centrifuge tubes. The heparinized blood is diluted 1:1 in phosphate-buffered saline (PBS) and carefully layered over the Ficoll-Paque gradient (9 to 10 ml/tube). The tubes are centrifuged for 20 min at 1,020 x g. The cell interface layer is harvested carefully, and the cells are washed twice in PBS (for 10 min at 640 x g followed by 10 min at 470 x g) and resuspended in RPMI 1640 medium with

Glutamax supplemented with penicillin (50 U/ml)- streptomycin (50 pg/ml) and 10 mM HEPES (complete RPMI medium) before counting. Upon isolation, PBMCs are fixed and analyzed by FISH as described in other Examples herein. Example 36: Allele-specific methods to detect activation of the inactive X chromosome.

This Example demonstrates methods to measure activation of the inactive X

chromosome.

Because females inherit one of each of their X chromosomes from genetically distinct parents, naturally occurring sequence variations, called single nucleotide polymorphisms (SNPs), can be used to distinguish gene products from a single X chromosome based on sequence differences. The typical X chromosome in human populations harbors nearly 35,000 naturally occurring single-nucleotide polymorphisms (SNPs), or an average of one SNP in every 3.77 kilobases of DNA, and so many X chromosome gene products have at least one SNP where the sequence of the gene product expressed from the maternal X chromosome differs from the sequence of the gene product expressed from the paternal X chromosome. Moreover,

heterozygous sequence differences or mutations in protein coding genes, or engineered protein tags (such as GFP) introduced at protein-coding genes, allow the detection of distinct protein product variants from each X chromosome.

It is possible to determine from which X chromosome a given gene product is expressed in a population of female cells. In differentiated cells, all genetic variants from the Xa (active X chromosome) haplotype are expressed, while variants from the Xi (inactive X chromosome) haplotype are not. Thus, in a population of female cells where X is randomly inactivated, each cell expresses one haplotype or the other at a ratio of approximately 1:1 across the population. However, in a population of female cells derived from a single differentiated clone, every cell inactivates the same X chromosome haplotype as the original founder cell, and the entire population expresses the same gene product variant from the Xa, and none of the gene product variants from the Xi. In such a clonal cell population, X chromosome reactivation leads to increased expression of gene products from the Xi, and thus assays for genetic variants that exist only on Xi can be used to measure the level of X chromosome reactivation.

In this Example, sequence variations in RNA expressed from two different X

chromosome alleles are detected and measured using commercial SNP detection probes in qPCR.

RNA from Xi activated or control human IMR90 fibroblast cells is obtained and reverse transcribed into cDNA directly by using a cell processing kit (Thermo Fisher Scientific). Taqman qPCR probes (Thermo Fisher Scientific) designed to detect Allele 1 and Allele 2 each with distinct fluorescent labels, VIC and FAM respectively, are mixed with cDNA in the reaction mix and cycled in a qPCR machine (Thermo Fisher Scientific).

The detected ratio of VIC vs. FAM fluorescence during qPCR amplification measures the relative amounts of cDNA from Allele 1 and Allele 2 present in the original sample. In this way, the expression of both alleles is measured simultaneously in the same sample, and Xi expression is measured as an increase in expression of the inactive allele relative to the active allele.

Example 37: Allele-specific RNA measurement by RNA sequencing.

In this Example, sequence variants in RNAs expressed from two different X chromosome alleles are quantitatively detected using next-generation sequencing.

RNA from Xi activated or control human IMR90 fibroblast cells is purified using RNA purification kit (Qiagen), and mRNA is enriched using oligo-dT purification beads (New

England Biolabs). Purified mRNA is reverse transcribed into cDNA and converted into an Illumina-compatible RNA sequencing library using a mRNA library prep kit (Illumina), with each sample separately indexed prior to pooling. Libraries are sequenced to a depth of 20 million reads each using a sequencer, demultiplexed and aligned to a reference human genome (hg38), allowing SNP identification.

The expression of both haplotypes of all X-chromosome genes are measured

simultaneously in the same sample, and Xi expression level is measured as an increase in expression of the inactive haplotype relative to the active haplotype, across the entire X chromosome.

Example 38: Allele-specific protein measurement by immuno-staining and flow cytometry.

In this Example, female cells heterozygous for a specific protein are fixed and stained with a fluorescently conjugated antibody that detects one allele of the protein, and stained cells are analyzed using flow cytometry.

On average, approximately 50% of cells express wild-type MECP2 from the Xa, and thus these cells stain positively with allele specific antibody. The remaining cells may express a different allele of MECP2 from the Xa, not the wild-type copy of MECP2 located on Xi, because they lack positive staining with the allele specific antibody. Upon induction of Xi activation, cells with wild-type MECP2 are expected to express wild-type MECP2, which is detectable by the fluorescent antibody using flow cytometry.

Xi activated or untreated female fibroblasts heterozygous for a frame-shift mutation in MECP2 are resuspended in PBS, fixed with 4% paraformaldehyde for 15 minutes at room temperature, and washed with PBS. Cells are then permeabilized using methanol added to 90%, and immunostained using rabbit-anti-MECP2 D4F3 PE-conjugated antibody (Cell Signaling Technologies) according to manufacturer’s instructions. Stained cells are analyzed using a flow cytometer to measure PE fluorescence of each cell within the population, and analysis software is used to determine the proportion of cells expressing wild-type MECP2 in Xi activated and untreated cell populations.

An increase in the number of cells expressing detectable wild-type MECP2 in Xi activated samples is expected upon inactive X chromosome activation.

Example 39: Allele-specific protein measurement by engineered fluorescent reporters.

In this Example, differential X allele expression is measured using fluorescent markers.

A marker protein is translationally fused to an X-linked gene on the Xi, and a second marker protein is constitutively expressed from an autosomal gene as a reference for total cell number. In a clonal population of female cells, the second marker is always expressed, whereas the first marker is not expressed. Upon X reactivation, the first marker may be detected in live cells.

Clonally derived female IMR90 fibroblast cells are genetically engineered to

translationally link a destabilized GFP gene (Evrogen) to endogenous MECP2 gene using a 2A peptide (as described in, for example, Liu ct. ah, Nature, Scientific Reportsvolume 7, Article number: 2193 (2017)) on the Xi allele. The cells have been further engineered to express RFP from a lentiviral insertion into an autosomal gene. Xi activated and untreated cells are grown in flat-bottom 96-well plates. GFP and RFP fluorescence for each well are measured using a fluorescent plate reader. The ratio of GFP to RFP measurements is calculated, where GFP level is proportional to expression from Xi, and RFP level is proportional to the cell number in each well. An increase in GFP/RFP ratio in Xi activated cells vs. untreated control is expected when Xi is activated. Example 40: Allele-specific protein measurement by enzymatic assay.

In this Example, clonal female cells heterozygous for protein expression are subjected to an enzymatic activity assay for mutant enzyme expressed from Xa.

In the clonal cell population, mutant HPRT1 is expressed from Xa, whereas the gene for non-mutant and enzymatically functional HPRT1 is on the Xi, and is not expressed. Upon Xi activation, wild-type HPRT1 enzyme is expressed, and its activity may be detected in cell lysate using a sensitive commercial HPRT assay kit.

In this assay, clonally derived female fibroblasts heterozygous for a mutation in HPRT1 (Coriell Institute, PubMed ID: 4842775) express the defective mutant allele of HPRT 1 from Xa, while the non-mutant allele of HPRT1 is located on the Xi and is not expressed. Cells are seeded in multiwell plates and are Xi activated or untreated (control), washed in PBS, and lysed in a mild lysis buffer containing 1% Triton X-100.

Lysate samples are then assayed for HPRT1 activity using the HPRT assay kit

(NOVOCIB), which measures the rate of HPRT production of IMP, which is oxidized by recombinant IMPDH enzyme along with simultaneous reduction of NAD+ to NADH, measurable by absorbance at 340nm. Along with sample lysates, serial dilutions of recombinant HPRT enzyme are used to generate a standard curve, ranging from 20 ng/mL to 1.5 ug/mL, so that the amount of non-mutant HPRT1 in each sample can be accurately determined.

The amount of functional HPRT1 in each sample is expected to increase as expression from the Xi is activated, and so increased HPRT1 activity over control untreated samples indicates inactive X chromosome expression.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, the descriptions and examples should not be construed as limiting the scope of the invention. The disclosures of all patent and scientific literature cited herein are expressly incorporated in their entirety by reference.

Claims

CLAIMS What is claimed is:

1. A method of treating a subject having an X-linked disorder, said method comprising:

administering an effective amount of a histone deacetylase 3 (HDAC3) modulator, a DNA-methyltransferase 1 (DNMT1) modulator, a phosphoinositide 3- kinase (PI3K) modulator, or a combination thereof;

wherein expression of an XIST-inactivated gene is increased in the subject having the X-linked disorder.

2. The method of claim 1, wherein the X-linked disorder is selected from a group consisting of incontinia pigmentosa, X-linked hypophosphatemia, Hypophosphataemic rickets,

Goltz syndrome, Rett syndrome, CDKL5 deficiency disorder, Alport syndrome, Fabry's Disease, Dent’s disease, testicular feminization syndrome, Addison’s disease with cerebral sclerosis, adrenal hypoplasis, siderius X-linked mental retardation syndrome, Agammaglobulinaemia, Bruton type, Choroidoretinal degeneration, Choroidaemia, Albinism (ocular), Dent's disease, fragile X syndrome, Epileptic encephalopathy, Albinism deafness syndrome, paroxysmal nocturnal hemoglobinuria, Aldrich syndrome, hereditary hypochromic Anaemia, sideroblastic Anemia with ataxia, Spinal muscular atrophy 2, Cataract, congenital, peroneal Charcot Marie Tooth disease, Spastic paraplegia, Colour blindness, Diabetes insipidus (nephrogenic), Dyskeratosis congenital, Ectodermal dysplasia (anhidrotic), Faciogenital dysplasia (Aarskog syndrome), Glucose- 6-phosphate dehydrogenase deficiency, Glycogen storage disease type VIII, Gonadal dysgenesis (XY female type), Granulomatous disease (chronic), Haemophilia A, Haemophilia B, Hydrocephalus (aqueduct stenosis), Lesch Nyhan syndrome

(hypoxanthine-guanine-phosphoribosyl transferase deficiency), Kallmann syndrome, Keratosis follicularis spinulosa, Lowe (oculocerebrorenal) syndrome, Menkes syndrome, Renpenning Syndrome, Mental retardation, with or without fragile site (numerous specific types), Coffin Lowry syndrome, Microphthalmia with multiple anomalies (Lenz syndrome), Muscular dystrophy (Becker, Duchenne and Emery-Dreifuss types), Myotubular myopathy, Night blindness (congenital stationary), Nome's disease (pseudoglioma), Nystagmus (oculomotor or jerky), Orofaciodigital syndrome (type I), Ornithine transcarbamylase deficiency (type I hyperammonaemia), Phosphoglycerate kinase deficiency, Phosphoribosylpyrophosphate synthetase deficiency, Retinitis pigmentosa, Retinoschisis, Muscular atrophy/Dihydrotestosterone receptor deficiency, Spinal muscular atrophy, Spondyloepiphyseal dysplasia tarda, Thrombocytopenia (hereditary), Thyroxine-binding globulin (absence) and McLeod syndrome.

3. The method of claim 1, wherein the HDAC3 modulator is an agent that localizes HDAC3 to a subcellular region that is not a nucleus, nuclear lamina, subnuclear structure, or a nuclear periphery.

4. The method of claim 1, wherein the HDAC3 modulator is an HDAC3 active site

inhibitor.

5. The method of claim 1, wherein the HDAC3 modulator decreases HDAC3 activity by reducing interaction of HDAC3 with an HDAC3 associated protein.

6. The method of claim 5, wherein the HDAC3 associated protein is SMRT or NCOR1.

7. The method of claim 1, wherein the HD AC 3 modulator inhibits HD AC 3 mRNA.

8. The method of claim 1, wherein the HDAC3 modulator is an antisense oligonucleotide

(ASO), an siRNA, an shRNA, or a microRNA.

9. The method of claim 1, wherein the HDAC3 modulator inhibits HDAC3 gene expression.

10. The method of claim 9, wherein the expression of the HDAC3 gene is inhibited by a non- naturally occurring Clustered Regularly Interspaced Short Palindromic Repeats

(CRISPR) associated (Cas) (CRISPR-Cas) system.

11. The method of claim 10, wherein the CRISPR-Cas system inhibits the expression of a gene encoding an HD AC 3 associated protein.

12. The method of claim 1, wherein the HDAC3 modulator inhibits translation of HDAC3 mRNA.

13. The method of claim 1, wherein the HDAC3 modulator degrades HDAC3 protein.

14. The method of claim 1, wherein the HD AC 3 modulator inhibits a molecule associated with HD AC 3.

15. The method of claim 14, wherein the molecule associated with HDAC3 is NCOR1, SMRT or SHARP.

16. The method of claim 1, wherein the HDAC3 modulator is an allosteric inhibitor of

HDAC3.

17. The method of claim 1, wherein the HDAC3 modulator is a non-active site inhibitor of HDAC3.

18. The method of claim 1, wherein the HDAC3 modulator is Abexinostat (PCI-24781), Apicidin (OSI2040), AR-42, Belinostat (PXD101), BG45, BML-210, BML-281, BMN290, BRD0302, BRD2283, BRD3227, BRD3308,BRD3349, BRD3386, BRD3493, BRD4161, BRD4884, BRD6688, BRD8951, BRD9757, BRD9757, CBHA,

Chromopeptide A, Citarinostat (ACY-214), CM-414, compound 25, CRA-026440, Crebinostat, CUDC-101, CUDC-907, Curcumin, Dacinostat (LAQ824), Depudecin, Domatinostat (4SC-202), Droxinostat, Entinostat (MS0275), EVX001688, FR901228, FRM-0334, Givinostat, HDACi-4b, HDACi-109, HPOB, 12, KD5170, LB-205, M344, Martinostat, Merck60 (BRD6929), Mocetinostat (MGCD0103), OBP-801, Oxamflatin, Panobinostat (LBH589), PCI-34051, PCI-48000, Pracinostat (SB939), Pyroxamide, Quisinostat (JNJ-26481585), Resminostat, RG2833 (RGFP109), RGFP963, RGFP966, RGFP968, Rocilinostat (ACY-1215), Romidepsin (FK228), Scriptaid, sodium phenylbutyrate, Splitomicin, T247, Tacedinaline (CI994), Trapoxin, Trichostatin A (TSA), Tucidinostat (chidamide), Valproic acid, vorinostat (SAHA), W2, MC1742, MC2625, A8B4, A14B3, A12B4, A14B4, A7B4, or any combination thereof.

19. The method of claims 1, wherein the HDAC3 modulator contains a zinc binding group selected from hydroxamate, benzamide, carboxylate-based, sulfur-based, or an epoxy ketone moiety.

20. The method of claim 1, wherein the HDAC3 modulator is an antibody or an antigen

binding fragment thereof.

21. The method of any one of claims 1-20, wherein the HDAC3 modulator is characterized as having HDAC3 inhibition activity in a HDAC3 activity assay or a HDAC3 inhibition assay.

22. The method of claim 1, wherein the DNMT1 modulator is 5-Azacytidin (5-aza), 5-aza- 2'deoxycytidine (5-aza-2'-dc), RG108, SGI- 1027, or any combination thereof.

23. The method of claim 1, wherein the DNMT1 modulator is characterized as having

DNMT1 inhibition activity in a DNMT activity assay or a DNMT1 inhibition assay.

24. The method of claim 1, wherein the PI3K modulator is selected from a group consisting of GNE317, LY294002, Wortmannin, demethoxyviridin, BEZ235, BGT226, BKM120, BYL719, XL765, XL147, GDC-0941, SF1126, GSK1059615, PX-866, CAL-101, BAY80-6946, GDC-0032, IPI-145, VS-5584, ZSTK474, SAR245409, and RP6530.

25. The method of claim 1, wherein the PI3K modulator is an antibody, or an antigen -binding fragment thereof, that specifically binds to PI3K or Protein Kinase B (PKB).

26. The method of claim 1, wherein the PI3K modulator is an inhibitory RNA that binds to PI3K or Protein Kinase B (PKB).

27. The method of claim 26, wherein the inhibitory RNA is an ASO, an siRNA, an shRNA, a miRNA, or any combination thereof.

28. A method of activating an epigenetically silenced gene or a hypomorphic X-linked allele on an inactive X-chromosome in a cell, the method comprising contacting the cell with an HD AC 3 modulator, a PI3K modulator, a DNMT1 modulator, or a combination thereof, such that the epigenetically silenced gene or the hypomorphic X-linked allele is activated.

29. The method of claim 28, further comprising characterizing a transcription of the

epigenetically silenced gene or the hypomorphic X-linked allele.

30. The method of claim 29, wherein the activated epigenetically silenced gene or the

activated hypomorphic X-linked allele has a transcription level that is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 10%, at least 15%, at least 20%, at least 30% , at least 40% , at least 50%, or at least 60% greater than a transcription level of the epigenetically silenced gene or the hypomorphic X-linked allele on an inactive X-chromosome.

31. The method of claim 28, further comprising characterizing a translation of a protein

encoded by the epigenetically silenced gene or the hypomorphic X-linked allele.

32. The method of claim 31, wherein the protein level produced by the activated

epigenetically silenced gene or the activated hypomorphic X-linked allele is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 10%, at least 15% at least 20%, at least 30%, at least 40%, at least 50% or at least 60% greater than the protein level produced by the epigenetically silenced gene or the hypomorphic X-linked allele on an inactive X-chromosome.

33. The method of any one of claims 28-32, wherein the cell is from a heterozygous female or a hemizygous male.

34. The method of claim 33, wherein the epigenetic ally silenced gene is an XIST-dependent silenced X chromosome gene.

35. A method of activating an epigenetically silenced gene or a hypomorphic X-linked allele on an inactive X-chromosome in a human subject, the method comprising:

administering to the human subject a first dose of the DNMT1 modulator; and administering to the human subject a second dose of the DNMT1 modulator, an HDAC3 modulator, a PI3K modulator or a combination thereof at a time period between 1 to 72 hours after the administration of the first dose of the DNMT1 modulator, such that the epigenetically silenced gene or a hypomorphic X-linked allele on the inactive X- chromosome is activated.

36. The method of claim 35, wherein the DNMT1 modulator is 5-Azacytidin (5-aza), 5-aza- 2'deoxycytidine (5-aza-2'-dc), RG108, SGI- 1027, or any combination thereof.

37. The method of claim 35, wherein the PI3K modulator is GNE317, LY294002,

Wortmannin, demethoxyviridin, BEZ235, BGT226, BKM120, BYL719, XL765, XL147, GDC-0941, SF1126, GSK1059615, PX-866, CAL-101, BAY80-6946, GDC-0032, IPI- 145, VS-5584, ZSTK474, SAR245409, or RP6530.

38. The method of claim 35, wherein the HDAC3 modulator is Abexinostat (PCI-24781), Apicidin (OSI2040), AR-42, Belinostat (PXD101), BG45, BML-210, BML-281, BMN290, BRD0302, BRD2283, BRD3227, BRD3308, BRD3349, BRD3386, BRD3493, BRD4161, BRD4884, BRD6688, BRD8951, BRD9757, BRD9757, CBHA,

39. The method of claim 35, wherein the HDAC3 modulator contains a zinc binding group selected from hydroxamate, benzamide, carboxylate-based, sulfur-based, or an epoxy ketone moiety.

40. The method of any one of claims 35-39, wherein the subject is a heterozygous female or a hemizygous male.

41. The method of claim 35, wherein the epigenetic ally silenced gene on the X chromosome is an XIST-dependent silenced X chromosome gene.