WO2020166943A1 - Method for editing microalgae by using gene gun method - Google Patents

Abstract

The present invention relates to a method for editing the genes of microalgae by using a gene gun method on an RNA-guided engineered nuclease (RGNE) RNP complex. A gene editing method according to the present invention can apply, to Tetraselmis sp. microalgaean, an RGNE RNP method for accurately and selectively editing a desired gene without foreign DNA introduction, thereby enabling a Tetraselmis variant having improved lipid productivity to be provided.

Description

Correction method of microalgae using gene gun method

The present invention relates to a method for correcting microalgae using a gene gun method, microalgae with improved lipid production capacity accordingly, and a method for producing bioenergy using the microalgae.

Microalgae are single-celled organisms that photosynthesize using carbon dioxide and water as raw materials, and have a very short cycle of cell division and growth than higher plants (about 5-8 hours), such as health supplements, anti-aging ingredients, DHA, cosmetics raw materials, etc. It is a biological resource with high economic potential to be used as a useful high value-added industrial material. Among them, Chlamydomonas reinhardtii has been studied the most as a model species in microalgae research, and the genome project has been completed, making it easy for gene research and manipulation. A variety of studies are in progress for use in industrial fields as well as academic research.

On the other hand, CRISPR gene scissors (RNA-guided engineered nuclease (RGEN)) has developed rapidly over the past two years since it was first developed in 2013, and has developed a variety of pathogens, including human cells as well as plant cells such as livestock, insects, rice, and wheat. It is widely used for species. This method borrows the CRISPR immune system formed by bacteria to prevent the invasion of foreign DNA with genetic scissors. In other words, if a nucleotide sequence fragment (Crisper part) that searches for the nucleotide sequence of a specific gene is made and paired with the cleavage enzyme Cas9, the paired CRISPR system adheres to the target DNA nucleotide sequence. Cuts a specific part of the gene. CRISPR gene scissors were found to be the easiest and most inexpensive scissors developed to date, as well as high accuracy and efficiency. However, in introducing CRISPR gene scissors into cells, DNA scissors such as zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and CRISPR gene scissors (RGEN) are used. In the case of transformation by introducing through a plasmid, it is highly likely to be classified as GMO (Genetically Modified Organism) because foreign DNA was inserted in the process of making the transformant, so it is limited to be used in food, medical, cosmetic and other industries. have. Therefore, there is a need to develop a method for editing genes that does not cause GMO problems.

Recently, when CRISPR gene scissors are introduced into cells, a method of delivering a guide RNA without foreign DNA insertion (DNA-free) and a protein complex (ribonucleoprotein, RNP) has been developed. This however can be a way conversion revolutionary transformation, this method has limitations that can be applied to only some algae on the current cell walls through a chemical process by weakening Chlamydomonas rain hard tiahyi (Chlamydomonas reinhardtii) or diatoms in peoh Although the transformation method using CRISPR gene scissors was developed only in Phaeodactylum tricornutum , there is a problem that the RGEN-RNP technology cannot be used in the same way for various useful microalgae other than the two types of microalgae. . In particular, a DNA-free gene editing method using CRISPR gene scissors, which is found in Korea and applicable to microalgae in the genus Tetracelmis, which has high utility value in various industries, has not yet been developed. There is still a need to develop an applicable gene correction method.

An object of the present invention for solving the above problems is a method of correcting a gene by transferring a guide RNA specific to a target gene and an RNA guided endonuclease (RGEN) ribonucleoprotein (RNP) of a Cas protein to microalgae without introducing external DNA; And a gene-modified microalgal variant.

In particular, it is an object of the present invention to provide a gene correction method for microalgae in the genus Tetracelmis, and a mutant of the genus Tetracelmis in which the ability to produce lipids mutated by the correction method is increased.

In addition, it is an object of the present invention to provide a bioenergy composition comprising a method of producing bioenergy and a culture thereof using the microalgal mutant of the genus Tetracelmis with increased lipid production capacity.

In order to achieve the above object, the present inventors have a method for producing a mutant knock-out a target gene through gene editing using RNP by bombardment for transformation of microalgae of the genus Tetracelmis. And completed the present invention. In particular, the present inventors applied the DNA-free RGEN RNP complex to microalgae, in order to use the gene gun method through the gold particle delivery system, the number of cells of the microalgae, the guide RNA concentration, the guide RNA type number, the concentration of the Cas9 protein. , And reaction conditions, etc., were established to develop a method for genetic editing of microalgae.

In this aspect, the present invention introduces a RGEN (RNA guided endonuclease) RNP (ribonucleoprotein) complex of a target gene-specific guide RNA and Cas protein into microalgae in the genus Tetracelmis using a gene gun; microalgae comprising: Provides a method of genetic modification.

In addition, the present invention provides a microalgal variant prepared by the calibration method. The mutant may be one of the lipid content of tetra-cell misses in the AGP gene knockout cells (Tetraselmis sp.) Increases.

Specifically, the present invention provides a variant of the genus Tetraselmis including an AGP gene mutation in which a nucleotide corresponding to the 99th to the 524th in the sequence represented by SEQ ID No. 4 is deleted.

The variant may include the AGP mutant gene of SEQ ID No: 5.

The variant may be a tetracelmis TspAGP-M1 microalgae that has accession number KCTC 13787BP, does not have starch-producing ability, and has improved lipid-producing ability compared to wild-type.

The tetracelmis TspAGP-M1 may have an improved C16:0 and C18:1 fatty acid production ability compared to a wild-type strain.

In addition, the present invention comprises the steps of accumulating lipids by culturing a variant of the genus tetracelmis; And it provides a bioenergy production method comprising the step of isolating the lipids moistened from the culture.

The bioenergy production method of the present invention may further include the step of chemically reacting the isolated fatty acid component.

The variant may be a tetracelmis TspAGP-M1 microalgae that has accession number KCTC 13787BP, does not have starch-producing ability, and has improved lipid-producing ability compared to wild-type.

In addition, the present invention may include a bioenergy composition comprising a culture of the variant of the genus Tetracelmis. The variant may be a tetracelmis TspAGP-M1 microalgae that has accession number KCTC 13787BP, does not have starch-producing ability, and has improved lipid-producing ability compared to wild-type.

The present invention may be modified in various ways and may have various forms, and the specific examples and descriptions described below are only intended to aid understanding of the present invention, and the intention to limit the present invention to a specific disclosure form is no. It is to be understood that the scope of the present invention includes all changes, equivalents, and substitutes included in the spirit and scope of the present invention.

Hereinafter, the present invention will be described in more detail.

The present invention is a gene editing method or gene knockout of microalgae comprising introducing a RGEN (RNA guided endonuclease) RNP (ribonucleoprotein) complex of a target gene-specific guide RNA and Cas protein into the microalgae using a gene gun. out) method.

In the gene editing method of the present invention, the RGEN (RNA guided endonuclease) RNP (ribonucleoprotein) complex of guide RNA and Cas protein is directly in microalgal cells without passing through a DNA carrier such as a plasmid (particle bombardment or particle gun). It characterized in that it is delivered by. Correcting a gene of a microalgae by directly transferring a gene into a microalgal cell by the gene gun method may also be expressed as a gene gun method transformation (Biolistic transformation) in another term.

In the present specification, "gene correction" or "gene knockout" refers to a frameshift mutation through deletion, substitution, duplication and/or insertion of some nucleotides at the target site of the target gene, so that the gene is normal. It refers to any genetic modification that prevents the production of a functioning protein.

In the present specification, the gene gun (method) refers to a method of introducing DNA into cells by aggregating (cutting) DNA on the surface of microparticles of gold or tungsten and shooting them into cells using physical forces such as helium gas pressure (force). it means. Metal microparticles with gene smears (aggregated) used in the gene gun have the advantage of penetrating cells well because they are heavier than their size, but the delivery and success of the gene to the target site are not constant, and the inserted gene is not repeated several times. Due to the problem that it can be overexpressed when inserted, the thickness of the permeable tissue is limited, and because of the use of microparticles, it can cause intracellular toxicity, there has been a difficulty in applying it to the introduction of genes in tetracelmis microalgae. .

However, according to the present invention, by using a gene gun for gene correction together with CRISPR gene scissors (RNA-guided engineered nuclease; RGEN) technology, it is possible to accurately correct the gene at the desired target position for correction or knockout, and The present invention was completed by establishing optimal conditions that do not cause toxicity or the like. In the case of using the present invention, it is meaningful in that gene correction by the RGEN RNP method, which was previously applicable only to some microalgae, can be applied to microalgae in the genus Tetracelmis, and an optimized gene correction method can be provided. .

In the present specification, "microalgae" may be one or more selected from the group consisting of all single-celled organisms that photosynthesize using carbon dioxide and water as raw materials. In one embodiment, the microalgae can be a tetra-cell misses in (Tetraselmis sp.) Microalgae.

The tetra-cell misses in (Tetraselmis sp.) Microalgae tetrahydro cell Miss Ara Chris (Tetraselmis alacris), tetra-cell Miss Bahia Kula other (Tetraselmis apiculata), tetra-cell misses Ars kusu (Tetraselmis ascus), tetra-cell Miss O stigmasterol urticae ( Tetraselmis astigmatica ) , Tetraselmis chui , Tetraselmis convolutae , Tetraselmis cordiformis , Tetraselmis desikacharyi , Tetraselmis desikacharyi room-less (Tetraselmis gracilis), tetra-cell misses and Jenny (Tetraselmis hazeni), tetra-cell misses impel Lucida (Tetraselmis impellucida), tetra-cell misses inkon RY exigua (Tetraselmis inconspicua), tetra-cell Miss Levy's (Tetraselmis levis), tetra-cell Miss Marcoola Te (Tetraselmis maculate), tetra-cell Miss Marina (Tetraselmis marina), tetra-cell misses microwave pillars other (Tetraselmis micropapillata), tetra-cell misses Rubens (Tetraselmis rubens), tetra-cell misses registry Atta (Tetraselmis striata), tetra-cell Miss can Brassica (Tetraselmis suecica), tetra-cell misses tetrahydro bra Escherichia (Tetraselmis tetrabrachia), tetra-cell misses tetrahydro helre (Tetraselmis tetrathele), tetra-cell Miss Belo Kosa (Tetraselmis verrucosa), and tetra-cell Miss West Needle (Tetraselmis wettsteinii) It may be one or more selected from the group consisting of, but is limited thereto no.

In one embodiment, the method for genetic modification of microalgae of the present invention may be specifically carried out, including the following steps:

A reaction mixture containing a guide RNA (sgRNA) specific for a target gene and a Cas protein and fine metal particles are mixed to prepare a composition for RNP-delivery comprising fine metal particles encoded on the surface of ribonucleoprotein (RNP). To prepare;

Drying the RNP-delivery composition on a macro-carrier disk; And

Transforming cells by applying a pressure of 500 psi or more to a rupture disk to launch fine metal particles coated on the surface of the RGEN RNP complex into microalgal cells of the genus Tetracelmis.

The calibration method may further include harvesting microalgal cells after incubating the cells to which the fine metal particles coated on the surface of the RGEN RNP complex are transferred for 2 to 5 days. The reaction mixture may include a guide RNA (sgRNA) specific for a target gene, a Cas protein, and a reaction buffer. In addition, the reaction mixture may further include water including distilled water.

With respect to 10 μL of the reaction mixture, 1 to 5 ug of guide RNA (sgRNA) specific to the target gene and 1 to 5 ug of Cas protein may be included. In addition, 0.5 to 2 μL of the reaction buffer may be further included with respect to 10 μL of the reaction mixture.

The reaction buffer may be any buffer that can be used during Cas nuclease reaction,

The reaction buffer may include an amphoteric buffer, sodium chloride (NaCl), and magnesium chloride (MgCl ₂ ). In addition, the reaction buffer may further include a chelating agent, and the chelating agent may be EDTA, but is not limited thereto.

The reaction buffer is an ionic buffer, for example, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) 10 to 50 mM, sodium chloride 50 to 200 mM, magnesium chloride 2.5 to 10 mM, and chelating agent 0.1 to 1 mM Or; 40-60 mM NaCl, 8-12 mM Tris-HCl, 8-12 mM MgCl ₂ and 80-120 μg/mL BSA; 80 to 120 mM NaCl, 40 to 600 mM Tris-HCl, 8 to 12 mM MgCl ₂ , and 0.8 to 1.2 mM DTT. In addition, commercially available ones may be used as nuclease buffers, and in one embodiment of the present invention, Cas9 Nuclease buffer #M0386 of NEB (New England Biolabs) was used.

The reaction buffer solution of the present invention may have a pH of 6.0 to 8.0.

The reaction mixture may be included in a delivery composition and delivered into cells by a gene gun. In the present invention, the composition for delivery includes fine metal particles coated with ribonucleic acid protein on the surface as a material delivered into the desired cell, and may also be referred to as a composition for RNP-delivery. The delivery composition of the present invention may be prepared by mixing a reaction mixture and fine metal particles.

The delivery composition may include one or more guide RNAs, and specifically may include two or more guide RNAs targeting different targeting sequences. Alternatively, a mixed composition may be prepared in a form containing only one guide RNA, and in this case, at least one mixed composition may be prepared each including guide RNAs targeting different targeting sequences. In this case, the incubation may be performed for each mixed composition. In the case of preparing two or more kinds of mixed compositions containing'one kind of guide RNA', in the step of mixing with microparticles to prepare a composition for RNP-delivery, the'two or more kinds of mixed composition' is used for one RNP-delivery It can be mixed into the composition.

Specifically, the RNP-delivery composition is a first reaction mixture comprising a guide RNA and a Cas protein specific for a first target gene; and a second reaction mixture comprising a guide RNA and a Cas protein specific for a second target gene It may be a composition for RNP-delivery including fine metal particles coated with two or more ribonucleic acid proteins (RNP) by mixing with fine metal particles. In this case, since it is possible to induce a mutation by targeting two or more genes, there is an advantage that the probability of causing a gene knockout mutation can be further improved.

The reaction mixture and the fine metal particles may be mixed in a volume ratio of 1 to 3: 1.

In an embodiment of the present invention, a composition for RNP-delivery was prepared and used by mixing 20uL (1.2mg) gold nanoparticles with 40uL of the reaction mixture.

The fine metal particles may be included in the present invention and used regardless of their components as long as they are particles that can be used in the gene gun method.

The delivery composition may be placed on a macro-carrier and delivered to a gene gun. In this case, the delivery composition may be placed on a macro-carrier, and a gene gun may be fired in a dried form.

The delivery composition may be placed on the macro-carrier disk at a level of 5 to 20 μL, and 1 to 8 macro-carrier disks on which the delivery composition is mounted may be prepared. Drying the macro-disc may be performed by natural drying or artificial drying, and preferably, an air drying (air-dry) method may be used.

The step of firing the RNP-delivery composition may include repeating 1 to 10 times.

In the case of microalgae in the genus Tetracelmis, the rupture disk may be 500 psi or more, and more specifically, the gene gun may be performed using a pressure of 1,000 to 1,500 psi. Preferably, it can be performed at 1100 to 1500 psi most preferably. When the pressure is lower than the above range when performing the gene gun, there is a problem that the gene transfer efficiency is lowered, and when the pressure is higher than the above-described pressure, the tetracelmis microalgal cells burst and die, or pass through the cells, and the intracellular introduction rate is low. There is.

The firing during still screen (stop screen) and may be a distance 1cm to 20cm of containing the microalgal cell plate (cell plate), an embodiment according to the example, tetra-cell misses in the 1100 to, or 1,500 psi to the microalgae When applying pressure, the gene gun can be performed at a distance of 5 cm to 10 cm or 8 cm to 10 cm.

When the method of performing the gene gun of the present invention is applied to microalgae, it is possible to increase the success rate of transformation of microalgae, which has been difficult to transform by conventional CRISPR gene scissors.

The microalgal gene editing method of the present invention may further include preparing a cell plate containing the microalgae to be genetically corrected before the gene introduction. The cell plate is to prepare a cell dish by centrifuging the microalgal cells of the exponential phase, concentrating in a fresh liquid medium, spreading the prepared cell concentrate on a medium plate, and evaporating the liquid medium through drying. Can be Here, the cell concentrate may be spread on a medium plate in a size of 2 to 5 cm in diameter. The cells may be plated on a medium plate in 1x10 ⁶ to 1x10 ⁸ cells.

In the present invention, "medium" includes nutrients required by a culture target, that is, a microorganism used as a culture medium in order to cultivate a microorganism, and may be a mixture by adding a substance for a special purpose. The medium is also referred to as a culture medium or a culture medium, and is a concept including all of a natural medium, a synthetic medium, or a selective medium. The medium may be MBL medium HS medium or TAP medium, but is not limited thereto and may be used differently depending on the target microalgae.

The microalgal gene editing method of the present invention may further include preparing fine metal particles to perform the gene gun method before introducing the gene. In the present invention, the microparticles may be nano or micro-sized particles, and gold, tungsten or other metal microparticles may be used. Specifically, particles of 0.1 to 1.0 μm, or 0.4 to 0.8 μm may be used. The microparticles may be prepared by washing with ethanol and water.

The calibration method of the present invention may further include preparing a guide RNA specific for the target gene.

In the present invention, "RNA guide endonuclease (RGEN)" refers to an endonuclease that forms a complex with single-stranded RNA or double-stranded RNA and cuts the targeting sequence of the gene target site contained in the RNA to perform gene correction. As such, it may be an endonuclease involved in a type II CRISPR/Cas system, such as a typical Cas9 protein (CRISPR associated protein 9).

The Cas9 protein is Streptococcus sp. (Streptococcus sp.), For example, may be a Streptococcus blood yoge Ness (Streptococcus pyogenes) to the derived (SwissProt Accession number Q99ZW2), but is not limited thereto. For example, the Cas9 protein of SEQ ID No: 31 or a Cas9 protein having 80% or more homology thereto may be included.

The Cas9 protein may be isolated from a microorganism or may be non-naturally produced by a recombinant or synthetic method. The Cas9 protein may further include an element commonly used for intranuclear delivery of eukaryotic cells (eg, nuclear localization signal (NLS), etc.), but is not limited thereto.

Purchased from ㈜ tuljen a; (Cat No # TGEN_CP4 Recombinant Cas9 protein) In one embodiment of the invention Streptococcus blood was used Cas9 protein yoge Ness derived from a gene correction of microalgae in tetra cell miss, specifically recombinant Cas9 protein And used.

In general, the guide sequence is a sequence comprising any polynucleotide having sufficient complementarity with the target sequence to hybridize with the target sequence and induce sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between the'sequence of the region having complementarity to the target sequence' and the'its corresponding target sequence' in the guide sequence is about 50%, 60% when optimally aligned using an appropriate alignment algorithm. , 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more. Optimal alignment can be determined by the use of any algorithm suitable for aligning the sequence, non-limiting examples of which are Smith-Waterman algorithm, Needleman-Wunsch algorithm, Burrows- Algorithms based on Burrows-Wheeler Transform (e.g. Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies) , ELAND (Illumina, San Diego, CA, USA), SOAP (available from soap.genomics.org.cn) and Maq (available from maq.sourceforge.net) In some embodiments, guide sequences Has a length of 5 nucleotides or more, and more specifically, may be 5 nucleotides to 500 nucleotides in length, In some embodiments, the guide sequence may be about 10 to 100 nucleotides in length, but is not limited thereto. .

The ability of the guide sequence to induce sequence-specific binding of the CRISPR complex to the target sequence can be assessed by any suitable assay. For example, components of the CRISPR system sufficient to form a CRISPR complex comprising the guide sequence to be tested are assayed using next-generation sequencing techniques, e.g., after transfection with a vector encoding the components of the CRISPR sequence. By evaluation of preferential cleavage within the target sequence by, it can be provided to a host cell having a corresponding target sequence. Similarly, cleavage of a target polynucleotide sequence provides a component of a CRISPR complex comprising a target sequence, a guide sequence to be tested, and a control guide sequence different from the test guide sequence, and binding or cleavage between the test and control guide sequence reactions at the target sequence. It can be evaluated in vitro by comparing the proportions. Other assays are possible and will come to the person skilled in the art. The guide sequence can be selected to target any target sequence. In some embodiments, the target sequence is a sequence within the genome of the cell. Exemplary target sequences include those that are unique in the target genome.

That is, the guide RNA may be appropriately selected according to the target sequence or the type of endonuclease to form a complex and/or the microorganism derived therefrom. For example, the guide RNA may be one or more selected from the group consisting of CRISPR RNA (crRNA), trans- activating crRNA (tracrRNA), and single-stranded guide RNA (sgRNA), and depending on the type of endonucleotide, CRISPR RNA (crRNA) And a double-stranded complex of trans- activating crRNA (tracrRNA), or a single-stranded guide RNA (sgRNA). The sgRNA may include a portion of crRNA and tracrRNA.

For example, the Cas9 protein-containing complex (Cas9 system) has two guide RNAs, that is, a CRISPR RNA (crRNA) having a nucleotide sequence hybridizable with a target site of a gene, and an additional trans- activating crRNA (tracrRNA) to correct a desired gene. ), and these crRNA and tracrRNA can be used in the form of a double-stranded crRNA:tracrRNA complex bonded to each other, or a single-stranded guide RNA (sgRNA) form by being linked through a linker.

The specific sequence of the guide RNA can be appropriately selected according to the type (derived microorganism) of the Cas9 protein, which can be easily recognized by those of ordinary skill in the art.

In one example, the crRNA used in the Cas9 system including the Cas9 protein derived from Streptococcus pyogenes can be expressed by the following general formula 1:

5'-(N _cas9 ) _l -GUUUUAGAGCUA-(X _cas9 ) _m -3' (general formula 1)

In the general formula 1,

N _cas9 is a targeting sequence site comprising a nucleotide sequence capable of hybridizing with a gene target site, and is a site determined according to the target site of the target gene, and l represents the number of nucleotides contained in the targeting sequence site, and is an integer of 18 to 22, May be for example 20;

A region containing 12 consecutive nucleotides (GUUUUAGAGCUA) adjacent to each other in the 3'direction of the targeting sequence region is an essential part of the crRNA.

In addition, X _cas9 is a site containing m nucleotides located on the 3'side of the crRNA (that is, adjacent to the 3'direction of the essential part of the crRNA), where m is an integer from 0 to 12, such as 0 days. I can.

In the present specification, "a sequence of a site having complementarity to a target sequence", that is, a nucleotide sequence capable of hybridizing with a gene target site is 50% or more, 60% or more, 70% or more, 80% or more, It means a nucleotide sequence having sequence complementarity of 90% or more, 95% or more, 99% or more, or 100% (hereinafter, unless otherwise specified, the same meaning is used).

In one example, the X _cas9 may include UGCUGUUUUG, and may be omitted, but is not limited thereto.

In addition, the tracrRNA used in the Cas9 system including the Cas9 protein derived from Streptococcus pyogenes can be expressed by the following general formula 2:

(General formula 2)

5'-(Y _cas9 ) _p -UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC-3'

In the above general formula 2,

The site containing 60 nucleotides (UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC) is an essential part of tracrRNA,

Y _cas9 is a site including p nucleotides located adjacent to the 5'end of the essential part of the tracrRNA, and may be omitted. That is, p may be an integer of 0 to 20, for example, 0 to 5, and the p nucleotides may be the same or different from each other, and may be independently selected from the group consisting of A, U, C, and G.

In addition, the sgRNA used in the Cas9 system including the Cas9 protein derived from Streptococcus pyogenes includes the targeting sequence site of the Cas9 crRNA and the crRNA site including the essential site, and the tracrRNA site including the essential site of the tracrRNA of Cas9 is a nucleotide linker. Through it may be to form a hairpin structure. More specifically, the sgRNA is the 3'end of the crRNA site and the tracrRNA in a double-stranded RNA molecule in which a crRNA site including a targeting sequence site and an essential site of crRNA and a tracrRNA site including an essential site of the tracrRNA of Cas9 are bound to each other. The 5'end of the site may have a hairpin structure connected through a nucleotide linker.

The targeting sequence site and essential site of crRNA and the essential site of tracrRNA are as described above. The nucleotide linker included in the sgRNA refers to a loop portion on the crRNA and tracrRNA, and may include 3 to 5, such as 4 nucleotides, and the nucleotides may be the same or different from each other, A, U, C and Each of the groups consisting of G may be independently selected.

In addition, gRNA used in the Cas9 system including the Cas9 protein derived from Streptococcus pyogenes can be represented by the following general formula 3:

(General formula 3)

5'-NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'

In the general formula 3, 20 consecutive nucleotides indicated by N are target sequence targeting sites (sequences complementary to the targeting site sequence of the target gene).

When synthesizing the gRNA, in the general formula 3, a primer sequence site may be present in front of the targeting site represented by N. For example, in the present invention, a nucleotide containing a TAATACGACTCACTATAG sequence was used as a T7 primer.

The crRNA (eg, represented by Formula 1) or sgRNA may further include 1 to 3 guanines (G) at the 5'end (ie, the 5'end of the targeting sequence site of the crRNA).

The tracrRNA or sgRNA may further include a terminating site including 5 to 7 uracils (U) at the 3'end of the essential portion (60 nt) of the tracrRNA.

In one example, the guide RNA may be prepared by referring to the contents described in "Kim, H. & Kim, J.-S. Nat. Rev. Genet. 15 , 321-334 (2014)".

Another example provides a guide RNA for the correction (replacement, deletion and/or insertion) of specific genes in microalgae.

In the present invention, the target gene may be an endogenous gene. In one embodiment of the present invention, the target gene may be AGP (ADP glucose pyrophosphorylase), FTSY (Chloroplast SRP receptor), ZEP (Zeaxanthin epoxidase), or the like, but is not limited thereto. In particular, in the case of using the correction method of the present invention, when the target site is set based on the genetic information of the target gene in the microalgae for transformation, the gene correction can be made specifically for the target site. It can be used without being limited to the kind of genes contained in birds.

The guide RNA may be a double-stranded complex of crRNA and tracrRNA or sgRNA as described above, and the crRNA contained in the double-stranded complex or sgRNA includes a targeting sequence site capable of hybridizing with any specific site of the gene to be corrected. I can.

Further, with respect to the 1x10 ⁶ cells of tetra Miss cells in gene chongbeop of the invention, when injected once a gene gun, the guide can be transmitted to RNA 0.7 ~ 2 ㎍ and Cas protein 0.7 ~ 2 ㎍. In this case, there is an advantage of increasing the transformation efficiency, since there is no problem in that the tetracelmis cells are damaged or poorly delivered.

In another aspect of the present invention, there is provided a genetically corrected microalgal variant produced by the gene editing method.

In one embodiment, the variant may be a microalgae of the genus Tetracelmis in which the AGP gene has been knocked out. The tetra-cell has a miss in the micro-algae without synthesizing a starch the AGP gene knockout appear for gene correction of the present invention, the microalgae cells are lipid production excellent properties. The variant may be a microalgae of the genus Tetracelmis including a genetically mutated AGP gene having a nucleotide deletion corresponding to the 99th nucleotide to the 524th in the genomic DNA of AGP of SEQ ID No: 4. That is, since the AGP genome of SEQ ID No: 4 represents a partial sequence of AGP, it corresponds to the 99th to 524th in the sequence represented by SEQ ID No.: 4 in the AGP genome sequence of microalgae of the genus Tetracelmis. The deletion of the nucleotide is included in the variation of the present invention.

The variant may include a genetically mutated AGP gene having a nucleotide deletion corresponding to the 301 th to 589 th cDNA of the AGP gene of SEQ ID No: 2. The variant may have an AGP gene comprising the cDNA sequence of SEQ ID No: 5.

In one embodiment of the present invention, the genus Tetracelmis . Using KCTC12432BP as the original strain, the AGP mutant was selected by performing AGP gene knockout according to the gene correction method of the present invention, and the selected mutant was named TspAGP-M1, and the Korea Research Institute of Bioscience and Biotechnology Life Resource Center (KCTC) On January 10, 2019, it was deposited with the accession number KCTC 13787BP.

Tetra cell Miss TspAGP-M1 mutant of the invention has increased properties by the knockout of the AGP gene compared to the wild type strain capability lipid production.

It was confirmed that the lipid content in the dry weight identified in an example of the present invention was improved by 274% (w/w) compared to the wild-type strain, and the lipid content (lipid productivity) per 1 L of the culture medium was improved by 225% compared to the wild-type strain. . In particular, the content of C16:0 and C18:1, which are highly usable saturated fatty acids among fuel components, is remarkably increased, and has excellent utility as a microalgae for biomass production.

If depend on cell-tetrahydro miss mutant production process of the present invention, without the use of carrier DNA, the transformant is possible without any external DNA introduction has the advantage that there is no risk of the transgenic organism. In particular, it is possible to further increase the probability of gene mutation through specific mutations of the desired gene, and the total gene condition of the present invention is optimized for transformation of tetracelmis cells, which is very meaningful in that the efficiency can be further increased. There is. In particular, in the case of the Cas protein guide RNA complex of the present invention, since RNA is temporarily present, not by plasmid overexpression, there is a problem that the transformation efficiency is very low due to repair, etc., but different targeting sequences as described above In the case of performing transformation by the gene gun method including two or more kinds of guide RNAs targeting, mutations occur at two or more sites at the same time, so the probability of causing genetic mutations is very high.

Tetra cell Miss TspAGP-M1 mutant is the lipid content of the dry weight has a very excellent properties as compared to wild-type, in particular, utilization of the high saturated fatty acids of C16 of the fuel component of the present invention: side high 1 content: 0 and C18 It has properties suitable for bioenergy production in In this aspect, the present invention comprises the steps of accumulating lipids by culturing tetracelmis TspAGP-M1 microalgae having accession number KCTC 13787BP, which does not have starch-producing ability, and has improved lipid-producing ability compared to wild-type; And it provides a bioenergy production method comprising the step of isolating the lipids moistened from the culture.

The step of culturing the tetracelmis TspAGP-M1 microalgae can be performed in the culture medium and the culture medium in which the tetracelmis is viable, and the incubator used in the technical field to which the present invention belongs, light source, temperature and time It can be carried out using culture conditions including the like. The culturing may include culturing until the lipid content per dry weight of the tetracelmis TspAGP-M1 microalgae is 20% or more.

Tetracelmis TspAGP-M1 microalgae of the present invention are cultured under conditions of temperature 18 to 25°C, white fluorescent source 40 to 120 μmol photon m ^-2 s ^-1 intensity, 14 to 18 hours light condition, 7 to 9 hours dark condition May be, but is not limited thereto.

The step of isolating the lipid may be performed by lysing the cells and extracting a hydrocarbon containing the lipid. The lysis of the cells may be carried out according to methods such as heat, base, acid, enzyme, physical treatment (eg, mechanical destruction, ultrasonic, osmotic treatment), autolysis by lysis virus or lysis gene expression.

Extracting the hydrocarbon containing the lipid may be performed by centrifuging the hydrocarbon secreted from the cell to separate the hydrocarbon in the hydrophobic layer, or by treating the cell or cell fraction with a protease to degrade the contaminant protein before or after centrifugation.

The bioenergy production method of the present invention may further include the step of chemically reacting the isolated lipid. Lipids can be processed into fuels more suitable for use in industry and life by the above chemical reaction. The chemical reaction may be performed by processing by enzymes or by processing by heat and other catalysts. It can be engineered to reduce the number of carbon-carbon double or triple bonds, remove cyclic structures in hydrocarbons, or increase the hydrogen:carbon ratio. The chemical reaction can be carried out using conventional methods used to produce fuels suitable for use in automobiles or engines from bioenergy.

In addition, the present invention may include a bioenergy composition comprising a culture of tetracelmis TspAGP-M1 microalgae, which has accession number KCTC 13787BP, does not have starch-producing ability, and has improved lipid-producing ability compared to wild type. have.

The culture is obtained by culturing the microalgae of the present invention, and contains a high content of the desired component (e.g., a lipid, a hydrocarbon component) by a form of removing the microalgae after cultivation, a concentrate, a dried product, or a fraction of the culture. It means including all fractions. Tetracelmis TspAGP-M1 microalgae of the present invention has a high content of lipid per dry cell weight of 20% or more, and the content of saturated fatty acids C16:0 and C18:1 among the lipids is particularly high, and the culture of the algae It has an excellent effect as a bio energy composition.

The bio-energy may be a gasoline or diesel composition including lipids produced from the present invention Tetracelmis TspAGP-M1 microalgae, or including a processed component of the lipid as an energy source.

The correction method according to the present invention is to selectively knock out a desired gene using CRISPR gene scissors without introducing foreign DNA, and by introducing RNP into microalgal cells using the gene gun method, the desired gene without introduction of foreign DNA It has the advantage that can be selectively corrected.

Figure 1 shows the result in accordance with an embodiment of the present invention analyzed the base sequence of the AGP gene of tetra-cell microalgae miss in the RNP is introduced by gene chongbeop by PCR. Wt represents a wild - type tetracelmis genus microalgae, and lines 1-1-1 to 2-2-7 each represent a transformed tetracelmis genus microalgae according to an embodiment of the present invention.

Figure 2 is the result confirming the AGP genetic information of the transformed, selected from the tetra-switched cell Miss in micro-algae mutation objects (objects in the line 2-1-6 in the mutant, FIG. 1) in accordance with an embodiment of the invention in the genome level Show. Wt represents the wild - type tetracelmis genus microalgae.

3 is a photograph showing the result confirming the performance of the starch must AGP mutant cell tetrahydro Miss in micro-algae (Mutant) and wild-type cells tetrahydro Miss in micro-algae (WT) selected in accordance with an embodiment of the invention.

Figure 4 is an AGP mutant selected in accordance with an embodiment of the invention tetrahydro cell Miss in micro-algae (AGP mutant) and wild-type tetra cell misses a nitrogen deficiency of microalgae (WT) (ND) / or nitrogen sufficiently (NS) conditions Is a graph showing the results of confirming the intracellular lipid volume through Nile-red staining.

5 is a photograph showing the result confirming the intracellular lipid volume of the AGP mutant tetrahydro cell Miss in micro-algae (AGP) and wild-type tetra cell Miss in micro-algae (WT) selected in accordance with an embodiment of the invention through a Bodipy dye to be.

Figure 6 is an AGP mutant tetrahydro cell Miss in micro-algae selected in accordance with an embodiment of the invention (AGP mutant) and dry weight (DW) the total content and fatty acid type analysis fatty acid per of the wild-type tetra cell Miss in micro-algae (WT) This is a graph showing the results.

7 is a graph showing the fatty acid type content per dry weight (DW) of the AGP mutant tetrahydro cell Miss in micro-algae (AGP mutant) and wild-type tetra cell Miss in micro-algae (WT) selected in accordance with an embodiment of the invention .

Figure 8 shows the cDNA sequence (SEQ ID No: 1) of the AGP gene of wild-type tetracelmis microalgae used in an embodiment of the present invention.

9 shows the full-length cDNA sequence (SEQ ID No: 2) of the AGP gene of wild-type tetracelmis microalgae identified in an example of the present invention.

FIG. 10 shows the protein sequence (SEQ ID No: 3) of the AGP gene of wild-type tetracelmis microalgae identified in an embodiment of the present invention.

11 shows the cDNA sequence (SEQ ID No: 5) of the AGP gene of the tetracelmis genus microalgal mutant TspAGP-M1 isolated in an embodiment of the present invention. In the figure, / indicates the deleted site compared to the wild-type AGP sequence between two target sequences for RGEN RNP.

12 shows the protein sequence (SEQ ID No: 6) of the AGP gene of the tetracelmis genus microalgal mutant TspAGP-M1 isolated in an embodiment of the present invention.

13 is an image of the AGP protein sequence (SEQ ID No: 3) of the wild-type tetracelmis microalgae identified according to an embodiment of the present invention and the AGP protein sequence (SEQ ID No: 12) of Chlamydomonas reinhardti. This is the result of comparing the same sex.

Figure 14 is the AGP protein sequence (SEQ ID No: 3) of the wild-type tetraselmis microalgae identified according to an embodiment of the present invention and the protein sequence of the AGP gene of the tetracelmis microalgae mutant TspAGP-M1 (SEQ This is the result of comparing ID No:6).

Hereinafter, it will be described in detail through an embodiment of the present invention. The following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples. These embodiments are provided to complete the disclosure of the present invention, and to fully inform the scope of the invention to those skilled in the art to which the present invention belongs, and the present invention is defined by the scope of the claims. Only.

[Example]

Experimental Example 1. Cloning of AGP gene of Tetraselmis sp.

In order to secure the ADP glucose pyrophosphorylase (AGP) gene, the main enzyme of the starch synthesis gene as a target gene for transformation, the homology analysis of TR24688_c0_g13 among the genetic information contigs previously obtained in the laboratory of Professor Cheol-gyun Lee of Inha University was conducted. The information on the AGP gene was confirmed through this, and the AGP gene was cloned through PCR using cDNA and genomic DNA as templates.

#455 Forward Primer: 5'-CAGAAGCAGACGGTGAATGC-3' (SEQ ID No: 7)

#456 Reverse Primer: 5'-TGCGCGCTTAAATGATGGTG-3' (SEQ ID No: 8)

CDNA Sequence of AGP1 by #455 &#456 Primers (SEQ ID No: 1)

(Start codon:ATG, stop codon: TAA, position of underlined primers #455, #456)

CAGAAGCAGACGGTGAATGC GGCCACCGTGGAGGAG ATG TGCGCGCCAACGCAAAGATCTCCCACTCCGTTGTGGGCGTGCGTGCGCTGATCTCTGAGAACACCGTCGTGGAGGACTCCATGATCATGGGCGCGGACTACTACGAGACCCTGGAGGAGTGCCAGCTGGTGCCGGGCTGCCTGCCCATGGGCATCGGCCCCAACACGATCGTGAAGAAGGCGATCATCGACAAGAATGCCCGCATCGGCGCCAACTGCCAGATTGTGAACAAGGACAACGTGATGGAGGCCAACGAGGAGGAGAAGGGCTACATCATCAAGGATGGCATCATTGTGGTGTGCAAGGACGCCATTATCCCCGACGG CACCATCATT TAA GCGCGC

Then, in order to confirm the complete cDNA gene, 5'and 3'RACE (rapid amplification cDNA end) PCR was performed. At this time, for 5'-RACE analysis, it is a specific reverse primer (#512, 5'-AGTAGATCTTGTTCACGCCGCT-3', SEQ ID No: 9) and a specific reverse primer (#513, 5'-TCTTCTTGGTCAGCGGGTACAG-3', SEQ ID No: 10) was used. For 3'-RACE analysis, a specific forward primer (#511, GGGAGGACATCGGAACCATC, SEQ ID No: 11) was used. As a result of each RACE analysis, the full length sequence of AGP cDNA of Tetracelmis was confirmed as follows.

Full-length cDNA sequence of AGP through RACE analysis (SEQ ID No: 2)

(Start codon: ATG, stop codon: TAA, underscore-primer position, italic-5'UTR-region and 3'UTR-region, shaded- Cas9 target sequence)

gactctgcgcctctccacggtgctcacacgcgcacgtttcttcctcacgcatcagccgcgtcactgtagccagg ATG GCGACCGCCACCATAGCCCAGGCCCAGCTCGGCGCTCGCGCTAAGACCGCCGGCGTCGGCAGCGTGCGCAGCGTCCGCGGCGTGCGCGTCCCGCAGATCAGCCGCCCTCGTGCTGCCCGCGTCGCACAGAGGCATGTGGTCGCGTCGGCGCAGAAGCAGACGGTGAATGCGGCCACCGTGGAGGAGATGGCCGCCTCCAGTGTGGCTGCCCCTCTACCT GATGGCACCGTGCCCGATAT CAGCAAGACTGTGCTGGGAATCATCCTGGGCGGCGGCGCGGGCACCCGC CTGTACCCGCTGACCAAGAAGA GGGCCAAGCCCGCGGTGCCGCTGGGCGCCAACTACCGCCTGATCGACATCCCCGTGAGCAACTGCATCAAC AGCGGCGTGAACAAGATCTACT GCCTCACGCAGTTCAACTCGGCCTCCCTGAACCGCCACCTCTCCCAGGCCTACAACTCGAACATCGGAGGCTACATGGACAAGGGCTTCGTGGAGGTGCTGGCCG CGCAGCAGAGCCCGAAGAAC CCCAACTGGTTCCAGGGCACGGCCGACGCGGTGCGCCAGTACATGTGGCTGTTTGAGGAGGCGATGGCCAACGGCGTGGAGGACTTCCTCATCCTGTCGGGCGACCACCTGTACCGCATGGACTACCAGGAGTTTGTGGCCGCGCACCGCGCCGCGAAGGCCGCCATCACTGTCGCCGCGCTGCCCTGCGCCGAGAAGCAGGCCGAGGCGTTTGGCCTCATGAAGATCGATGACTCTGGCCGTATCGTCGAGTTTGCGGAGAAGCCCACCGGCGACGCGCTCAAGGCTATGCGCATCGACACCACCGTGCTCGGCCTCGACGCGGAGCGGGCGGCGGAGATGCCGTACCTGGCCTCGATGGGCATCTACGTGATGAAGGGCACGC TGCTGCGCGAGCTGCTGGACGACAACCCGGACGCGAACGACTTCGGCTCGGAGATCATCCCGTTTGCCAAGGACAAGGGATCCAAGGTGCAGGCGTTCCTGTTTGACGGCTACT GGGAGGACATCGGAACCATC GAGGCCTTTTACAGCGCCAACCTGGCCCTCACCGACCCCGACGCCCCCAAATTCAGCTTCTACGAGCGCGAGGCGCCCATCTACACCATGCCGCGCTTCTTGCCGCCCTCCAAGATGCTGGACGCGGACGTGGCCAACAGCATCATCGGCGACGGCTGCGTCGTGCGCGCCAACGCAAAGATCTCCCACTCCGTTGTGGGCGTGCGTGCGCTGATCTCTGAGAACACCGTCGTGGAGGACTCTATGATCATGGGCGCGGACTACTACGAGACCCTGGAGGAGTGCCAGCTGGTGCCGGGCTGCCTGCCCATGGGCATCGGCCCCAACACGATCGTGAAGAAGGCGATCATCGACAAGAATGCCCGCATCGGCGCCAACTGCCAGATTGTGAACAAGGACAACGTGATGGAGGCCAACGAGGAGGAGAAGGGCTACATCATCAAGGATGGCATCATTGTGGTGTGCAAGGACGCCATTATCCCCGACGGCACCATCATT TAA gcgcgcccccatgcataccttcctatcccccctcccctcccctcccctcccctcgtcaatggaaatagcgccgatagttacagagttaccgtgtgacctagtggacctggtgggggtgtaatgaatcccctttttgcgtcaaaaaaaaaaaaaaaaaaaaa

Through the complete cDNA sequence information described above, the amino acid sequence of the AGP protein of wild-type tetracelmis was confirmed as follows.

Wild type AGP protein sequence (SEQ ID No: 3)

MATATIAQAQLGARAKTAGVGSVRSVRGVRVPQISRPRAARVAQRHVVASAQKQTVNAATVEEMAASSVAAPLPDGTVPDISKTVLGIILGGGAGTRLYPLTKKRAKPAVPLGANYRLIDIPVSNCINSGVNKIYCLTQFNSASLNRHLSQAYNSNIGGYMDKGFVEVLAAQQSPKNPNWFQGTADAVRQYMWLFEEAMANGVEDFLILSGDHLYRMDYQEFVAAHRAAKAAITVAALPCAEKQAEAFGLMKIDDSGRIVEFAEKPTGDALKAMRIDTTVLGLDAERAAEMPYLASMGIYVMKGTLLRELLDDNPDANDFGSEIIPFAKDKGSKVQAFLFDGYWEDIGTIEAFYSANLALTDPDAPKFSFYEREAPIYTMPRFLPPSKMLDADVANSIIGDGCVVRANAKISHSVVGVRALISENTVVEDSMIMGADYYETLEECQLVPGCLPMGIGPNTIVKKAIIDKNARIGANCQIVNKDNVMEANEEEKGYIIKDGIIVVCKDAIIPDGTII

As a result of comparing the amino acid sequence of the AGP protein of Tetracelmis with the AGP protein sequence (Sequence ID: XP_001691854.1, SEQ ID No: 12) of Chlamydomonas reinhardtii, 66% identity and 79% It was confirmed to have a homology of.

Based on the gene information, the 5'- side genomic DNA nucleotide sequence where the start codon is located was analyzed by genomic PCR using #488 Forward primer (ACAGAGGCATGTGGTCGC) and #490 Reverse primer (TTCTCCGCAAACTCGACGAT). As a result, the following genetic information could be confirmed.

Genomic DNA genetic information of the 5'-end region of the AGP gene (SEQ ID No: 4)

(Bold: intron; general: exon; underline: primer position)

ACAGAGGCATGTGGTCGC GTCGGCGCAGAAGCAGACGGTGAATGCGGCCACCGTGGAGGAGATGGCCGCCTCCAGTGTGGCTGCCCCTCTACCTGATGGCACCGTGCCCGATATCAGCAAG GTGCTGCTGCACCGCCTCGTGCTGCTCCCTGCCCCAATCACATCCTACCCGCCCAATGAGAGAGTCATCGCCTGCCAGCCGCTCACTGCTTTCTACCCCCATCCACCCCCCTCCTCCACCCTGCTGCCGCCTCGCAG ATCGTCGAGTTTGCGGAGAA

Experimental Example 2. Selection of target site for gRNA and synthesis of sgRNA

In the above AGP gene information, the Cas9 target gene sequence was confirmed by targeting the two nucleotide sequences marked with yellow background, and sgRNA capable of acting on the complementary nucleotide sequence at this position was constructed. For sgRNA synthesis, a target sgRNA was prepared according to the method provided by invitrogen's "GeneArt ^TM Precision gRNA Synthesis Kit".

Target #	RGEN Target (5'-3') (AGP targeting sequence)	Position	Cleavage Positin (%)	direction	GC Contents(%, w/o PAM)	Out-of-frame Score
T1 (SEQ ID No: 15)	ATATCGGGCACGGTGCCATCAGG	92	12.1	-	60.0	67.9
T2 (SEQ ID No: 16)	TGGCCCTCTTCTTGGTCAGCGGG	306	38.8	-	60.0	74.4
T3 (SEQ ID No: 17)	GTTCTTCGGGCTCTGCTGCGCGG	518	65.2	-	65.0	65.8
T4 (SEQ ID No: 18)	CATGTACTGGCGCACCGCGTCGG	563	70.8	-	65.0	68.8

In Table 1 above, four sgRNAs were carefully designed in the coding sequence region of the AGP gene with an out-of-frame score higher than 65 in the whole genome. 'CDS (coding sequence) position' refers to the relative position of the cut point in genomic DNA. The + in the direction is the same direction as the target sequence, that is, the same sequence is the sequence of RGEN, and-is the sequence in the opposite direction to the target sequence, that is, the sequence bound to the target sequence, which is complementary to each other. It means the sequence of relationships. 'Out-of-frame Score' refers to the possibility of a frameshift-induced deletion that occurs when broken double-stranded DNA is repaired by a microhomology-mediated end join (MMEJ) pathway. The oligonucleotide for preparing the target gRNA used at this time is as follows.

Target	Primer	Seuecne (5'-3') ( underlined is the targeting sequence)
AGP target #1	T1-FW (SEQ ID No: 19)	TAATACGACTCACTATAG ATATCGGGCACGGTGCC
	T1-RV (SEQ ID No: 20)	TTCTAGCTCTAAAAC GATGGCACCGTGCCCGATAT
AGP target #2	T2-FW (SEQ ID No: 21)	TAATACGACTCACTATAG TGGCCCTCTTCTTGGTC
	T2-RV (SEQ ID No: 22)	TTCTAGCTCTAAAAC GCTGACCAAGAAGAGGGCCA
AGP target #3	T3-FW (SEQ ID No: 23)	TAATACGACTCACTATAG GTTCTTCGGGCTCTGCT
	T3-RV (SEQ ID No: 24)	TTCTAGCTCTAAAAC CGCAGCAGAGCCCGAAGAAC
AGP target #4	T4-FW (SEQ ID No: 25)	TAATACGACTCACTATAG CATGTACTGGCGCACCG
	T4-RV (SEQ ID No: 26)	TTCTAGCTCTAAAAC ACGCGGTGCGCCAGTACATG

Using the above primers, 10 μL of nuclease-free water was performed through PCR, in vitro transcription, and purification processes for each target sgRNA according to the method provided by the manufacturer. ). The content of these generated sgRNAs was measured using a spectrophotometer at A260nm. The sequence of the final synthesized gRNA is as follows. AGP UargeU #1 (SEQ ID No: 27)

AUAUCGGGCACGGUGCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'

AGP UargeU #2 (SEQ ID No: 28)

UGGCCCUCUUCUUGGUCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'

AGP UargeU #3 (SEQ ID No: 29)

GUUCUUCGGGCUCUGCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'

AGP UargeU #4 (SEQ ID No: 30)

CAUGUACUGGCGCACCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'

In addition, the Cas9 protein to be used in the preparation of the transformant was used by purchasing a recombinant Cas9 protein (Recombinant Cas9 protein; S.pyogenes, Cat No# TGEN_CP4) from Tulgen.

Experimental Example 3. Preparation of gold nanoparticles and microalgal cell plates for bombardment

A wild-type strain to be used for transfection, cell misses in tetra (Tetraselmis sp, deposit number:. KCTC12432BP) microalgae temperature 20 ℃, white fluorescent light source 50 ~ 100 μmol photon m ^-2 s ^-1 and intensity condition 16 hours light condition 8 It was cultured in MBL liquid medium under dark conditions. The composition of the MBL liquid medium is as shown in Table 3.

Components	/L
NaCl	24.7 g
KCl	0.66 g
MgCl 2 6H 2 O	8.48 g
CaCl 2 2H 2 O	1.90 g
MgSO 4 7H 2 O	6.318 g
NaHCO 3	0.18 g
NaNO 3	225 mg
NaH 2 PO 4 H 2 O	15 mg
Tris (pH 7.4)	1.214 g
Trace element solution of f/2 media	1 mL
Vitamin solution of f/2 media	1 mL

After growth is centrifuged at active index step tetrahydro cell misses in (Tetraselmis sp.) Microalgae cells 2000 xg, 5 bun conditions (exponential stage), and concentrated in fresh MBL liquid medium to 1x10 ⁷ cell / mL, prepared 1 mL (1x10 ⁷ cells) of microalgae was placed on the center of an MBL agar (1.2%) plate in a size of about 3 cm in diameter. Then, it was dried and stored in a clean bench until the liquid medium was evaporated and disappeared, and then used for bombardment. Gold particles were washed by vortexing 60 mg of Bio-Rad's Microcarrier, 0.6 μm gold (Cat #165-2262) in 100% EtOH (1 mL) for 2 minutes, and separated by centrifugation. , Washed with DEPC-treated nuclease-free distilled water. This was repeatedly washed 3 times and stored in 1 mL of distilled water (RNAse-free DW) without nucleic acid hydrolase, and used for subsequent tests. Experimental Example 4. Gene correction by genetic gun method transformation (biolistic delivery) by RNP

RGEN (RNA-guided engineered nuclear) RNP (ribonucleoprotein) was prepared in vitro , and it was carried out intracellular delivery (particle biolistic delivery) by gene gun method according to the following method.

a) The sgRNA and Cas9 protein prepared in Test Example 3 were prepared in distilled water (nuclease free DW) without nucleic acid hydrolase, respectively.

b) For the 4th bombardment shot, a mixture as shown in Table 4 was prepared.

c) Incubate each mixture for 30 minutes at room temperature. At this time, two sgRNAs were mixed to perform gene gun at the same time.

d) After mixing Mixture-1 (10 μL) and Mixture-2 (10 μL), add 10 μL of washed gold particles (gold particle concentration: 6 mg/ml) to the mixture, and pipetting immediately. Mixed with.

e) 10 μL of the mixture of d) was placed on a macro-carrier disk (Bio-rad) prepared by washing in advance on a clean benchtop. In the same way, a total of 4 macro carrier disks were prepared. After that, it was dried (Air-dry).

f) After this, particle bombardment was performed 4 times. At this time, the pressure of the rupture disk was 900 psi, 1100 psi, 1350 psi, or 1550 psi disk, respectively, and the distance between the stop screen and the cell plate was 9 cm.

Mixture-1	Mixture-2
Cas9 protein 2 ug reaction buffer (x10) 1 μL sgRNA target #1 2 ug Add distilled water to total 10 μL		Cas9 protein 2 ug, reaction buffer (x10) 1 μL sgRNA target #3 2 ug Add distilled water to total 10 μL

In Table 4, Cas9 protein was used in a form contained in 2 μL distilled water. At this time, the composition of the reaction buffer (x10) is as follows. In this experiment, NEB's buffer (NEB Cas9 Nuclease buffer #M0386) was used.

Reaction buffer (X10)

200 mM HEPES1 M NaCl 50 mM MgCl 2 1 mM EDTA, pH 6.5

Each RNP-transferred cell plate was stored in an incubator at 20° C. for 3 days, and then each microalgal cell was harvested by spreading it with MBL liquid medium. The harvested cells were diluted and plated on a new MBL agar medium so that the harvested cells could be separated into colonies and grown, and cultured at 20° C. for 16 hours and 8 hours in a light-dark cycle. Test Example 1. Tetraselmis sp. using the CRISPR- Cas9 RNP method . Transformant identification

In Experimental Example 4, genomic DNA was first used as a template by PCR method in order to select a mutant in which the AGP gene was knocked out from among microalgae in the genus Tetracelmis into which RNP was introduced by the gene gun method. By securing the target site and analyzing their nucleotide sequence, one type of mutant (individual of line 2-1-6 in FIG. 1) was selected and named TspAGP-M1.

The TspAGP-M1 mutant strain was deposited with the Korea Research Institute of Bioscience and Biotechnology Life Resources Center (KCTC) on January 10, 2019, and was given the accession number KCTC 13787BP.

CDNA sequence of the AGP gene of the identified mutant 2-1-6 line (TspAGP-M1) (SEQ ID No: 5)

(/: the nucleic acid sequence between the two Cas9 target sites used in the wild-type AGP gene sequence was removed)

ATG GCGACCGCCACCATAGCCCAGGCCCAGCTCGGCGCTCGCGCTAAGACCGCCGGCGTCGGCAGCGTGCGCAGCGTCCGCGGCGTGCGCGTCCCGCAGATCAGCCGCCCTCGTGCTGCCCGCGTCGCACAGAGGCATGTGGTCGCGTCGGCGCAGAAGCAGACGGTGAATGCGGCCACCGTGGAGGAGATGGCCGCCTCCAGTGTGGCTGCCCCTCTACCT GATG / AGCAGAGCCCGAAGAA TAA

The AGP gene protein sequence (420 amino acids) of the above mutant is as follows:

MATATIAQAQLGARAKTAGVGSVRSVRGVRVPQISRPRAARVAQRHVVASAQKQTVNAATVEEMAASSVAAPLPDEQSPKNPNWFQGTADAVRQYMWLFEEAMANGVEDFLILSGDHLYRMDYQEFVAAHRAAKAAITVAALPCAEKQAEAFGLMKIDDSGRIVEFAEKPTGDALKAMRIDTTVLGLDAERAAEMPYLASMGIYVMKGTLLRELLDDNPDANDFGSEIIPFAKDKGSKVQAFLFDGYWEDIGTIEAFYSANLALTDPDAPKFSFYEREAPIYTMPRFLPPSKMLDADVANSIIGDGCVVRANAKISHSVVGVRALISENTVVEDSMIMGADYYETLEECQLVPGCLPMGIGPNTIVKKAIIDKNARIGANCQIVNKDNVMEANEEEKGYIIKDGIIVVCKDAIIPDGTII

In addition, as a result of comparative analysis of the wild-type AGP protein and the mutant tetracelmis AGP protein, it was confirmed that 97 amino acids were removed and 1 new amino acid (E) was generated.

Test Example 2. Characterization of the selected AGP mutants

For characterization of the selected AGP mutants, after inducing nitrogen-deficient media (ND) in the stational growth stage, whether or not starch was synthesized through lugol staining. And nile-red staining were used to confirm the degree of formation of intracellular lipid droplets.

Specifically, cells in a healthy state were obtained by culturing the cells in a nitrogen-rich medium and a nitrogen-depleted medium, respectively. 1 μl of Lugol's solution was added to 1 ml of the cell culture solution of OD ₇₅₀ = 1, and the cells were uniformly mixed for 30 seconds, and the colors reacted to the Lugol's solution were compared according to nitrogen conditions.

Under nitrogen-depleted conditions, cells are stressed and accumulate starch and lipids in the cells.As shown in FIG. 3, in the case of the wild-type strain, it can be confirmed that the starch in the cells is stained with Lugol's solution under nitrogen-depleted conditions, resulting in purple color. However, in the AGP mutant, starch synthesis was inhibited due to the knockout of the AGP gene, and the color change reaction by Lugol did not occur even in a nitrogen depleted environment. Therefore, as shown in Figure 3, it can be confirmed that the AGP knockout was well performed in the AGP knockout variant of the present invention.

In addition, the control and mutants that reached the stationary growth phase were cultured for 3 days in a nitrogen-containing medium (Nitrogen sufficient media (NS) and nitrogen-deficient medium (ND)), followed by nile red staining. Was performed, and the fluorescence value was measured to confirm the intracellular lipid droplet.

As shown in FIGS. 4 and 5, it was confirmed that the mutant showed strong fluorescence compared to the control under both NS and ND conditions, and particularly, a stronger fluorescence value was confirmed under the nitrogen deficiency condition (ND). Therefore, it was confirmed that the prepared AGP mutant could promote an increase in lipid content by inhibiting the synthesis of starch.

Test Example 3. Analysis of Lipid Components and Components of Selected AGP Mutants

Tetracelmis genus grown in flask culture conditions. After 3 days of changing the cells to nitrogen-deficient media (ND) in the stationary growth stage, the content and composition of lipid components were analyzed by FAME analysis (Kim Z-Hun, Park Yong- Sung, Ryu Young-Jin, Lee Choul-Gyun. 2017 Enhancing biomass and fatty acid productivity of Tetraselmis sp. in bubble column photobioreactors by modifying light quality using light filters.Biotechnology and Bioprocess Engineering 22:397-404.).

As a result of the analysis, the lipid content of the AGP mutant increased to 21.05% in dry weight, 274% compared to the control.

	Wild type	AGP mutant
Fatty acid content (w/w%)	7.68 (100%)	21.05 (274%)

As a result of confirming the component analysis through FAME analysis among the changes in the analyzed lipid content, as shown in FIGS. 6 and 7, the fatty acid content was higher in the AGP mutant. The contents of C16:0 and C18:1 were significantly increased. The rapid increase in the concentration of these two types of fatty acids and the increase in total lipid productivity compared to the wild type in the mutant can be said to have very important implications for biofuel productivity. Test Example 4. Analysis of Lipid Components and Components of AGP Mutant

Three days after changing the control and mutant cells of the genus Tetracelmis cultured on a 2L column by the BC-PBR (Bubble column photobioreactor) culture method to nitrogen-deficient media (ND) in the stationary growth stage , The content and composition of lipid components were analyzed by FAME analysis method. The content of the lipid component was investigated as the fatty acid content per cell dry weight in mg/g DCW (dry weight) and the fatty acid concentration per culture volume in mg/L (culture medium volume).

The total fatty acid content and composition of wild-type tetracelmis genus microalgae and the present invention TspASP-M1 microalgae were measured under nitrogen starvation for 3 days. The total content of fatty acids was calculated based on dry cell weight (DCW). Values represent the mean ± standard deviation of the three biological replicates of each strain, and statistically significant differences were determined by Student's t-test (* p <0.001).

	Tetraselmis sp.
	Wild Type		TspAGP-M1
Fatty acid component	mg/g DCW (% to total FAs)
C16:0	19.31 ± 0.98	(25.14)	51.23 ± 5.89 *	(24.33)
C16:1	2.52 ± 0.56	(3.28)	11.45 ± 0.54 *	(5.44)
C16:3	0		2.83 ± 0.11 *	(1.34)
C16:4	8.77 ± 1.99	(11.42)	19.42 ± 2.80 *	(9.22)
C18:0	4.99 ± 0.55	(6.50)	5.72 ± 0.40	(2.72)
C18:1	11.09 ± 1.35	(14.44)	60.68 ± 4.31 *	(28.82)
C18:2	5.85 ± 1.08	(7.62)	13.22 ± 1.07	(6.28)
C18:3	9.88 ± 2.12	(12.86)	24.02 ± 1.79 *	(11.41)
etc.	14.38 ± 0.21	(18.73)	22.00 ± 2.58 *	(10.45)
Total fatty acid content	76.78 ± 3.55		210.55 ± 7.18 * (274% increase compared to WT)
FA productivity a (mg/L/day)	11.06 ± 1.56		24.86 ± 2.41 * (225% increase compared to WT)

a: Calculate the productivity (productivity) relative to the lipid content measured in the culture condition for 8 days.

As shown in FIGS. 6 and 7, the total lipid content in the dry weight increased by 274% in the mutant (TspAGP-M1) compared to the control (wild type). However, since the growth rate of the mutant was slower than that of the control, it was confirmed that the productivity of the fatty acid, that is, the total lipid content per culture volume, was increased by 225%. Thus, it can be seen that the total lipid productivity was also increased in the mutant. Even in 2L column culture, it was confirmed that the contents of C16:0 and C18:1, which are highly utilizable saturated fatty acids among the fuel components, were significantly increased in the mutant.

Claims (18)

1. A reaction mixture containing a guide RNA (sgRNA) specific for a target gene and a Cas protein and fine metal particles are mixed to prepare a composition for RNP-delivery comprising fine metal particles encoded on the surface of ribonucleoprotein (RNP). To prepare;

   Drying the RNP-delivery composition on a macro-carrier disk; And

   Applying a pressure of 500 psi or more to a rupture disk to fire the fine metal particles coated on the surface of the RGEN RNP complex into microalgal cells in tetracelmis;

   Using the gene gun to introduce the microalgal cells of the genus Tetracelmis; Gene editing method of the microalgae of the genus Tetracelmis comprising.
2. The method of claim 1,

   The calibration method further comprises harvesting the microalgal cells after incubating the cells to which the fine metal particles coated on the surface of the RGEN RNP complex are transferred for 2 to 5 days, and then harvesting the microalgae.
3. The method of claim 1,

   The step of preparing the RNP-delivery composition includes a first reaction mixture comprising a guide RNA and a Cas protein specific for a first target gene; and a second reaction comprising a guide RNA and a Cas protein specific for a second target gene Mixing the mixture with fine metal particles to prepare a composition for RNP-delivery comprising two or more ribonucleic acid protein (RNP)-coated fine metal particles, the gene editing method of microalgae in the genus Tetracelmis.
4. The method of claim 1,

   The reaction mixture contains a guide RNA (sgRNA) specific for a target gene, a Cas protein, and a reaction buffer,

   The reaction buffer solution includes a zwitterionic buffer, sodium chloride (NaCl), and magnesium chloride (MgCl ₂ ), and the pH is 6.0 to 8.0, a method of genetic editing of microalgae in the genus Tetracelmis.
5. The method of claim 4,

   With respect to 10 μL of the reaction mixture, 1 to 5 ug of guide RNA (sgRNA) specific to the target gene, 1 to 5 ug of Cas protein, 0.5 to 2 μL of reaction buffer, and distilled water are included, Gene editing method.
6. The method of claim 4,

   The reaction buffer solution further comprises a chelating agent,

   Zwitterionic buffer 10mM to 50mM, sodium chloride (NaCl) 50 to 200mM, magnesium chloride (MgCl ₂ ) 2.5 to 10mM, and a chelating agent 0.1 to 1mM, comprising a gene correction method of microalgae in the genus Tetracelmis.
7. The method of claim 1,

   The pressure is 1,000 to 1,500 psi, the gene editing method of microalgae in the genus Tetracelmis.
8. The method of claim 1,

   When the metal particles are fired, the distance between the stop screen and the cell plate including the tetracelmis microalgal cells is 8cm to 10cm.
9. The method of claim 1,

   The macro-carrier disk is to dry 5 to 20 μL of the RNP-delivery composition on the gene editing method of microalgae in the genus Tetracelmis.
10. The method of claim 1,

    The method of genetic editing of microalgae in the genus Tetracelmis by mixing the reaction mixture and the fine metal particles in a volume ratio of 1 to 2: 1.
11. The method of claim 1,

    The metal particle is tungsten or gold, a method for genetic editing of microalgae in the genus Tetracelmis.
12. The method of claim 1,

    The firing is carried out 1 to 10 times, the gene editing method of microalgae in the genus Tetracelmis.
13. SEQ ID No.: A variant of the genus Tetracelmis including an AGP gene mutation in which a nucleotide corresponding to the 99th to the 524th in the sequence represented by 4 is deleted.
14. The method of claim 13,

    The variant is a variant of the genus Tetracelmis comprising the AGP variant gene of SEQ ID No: 5.
15. The method of claim 13,

    Accession number KCTC 13787BP, does not have a starch-producing ability, a variant of the genus Tetracelmis, which is tetracelmis TspAGP-M1, which has an improved lipid-producing ability compared to the wild type.
16. The method of claim 15,

    The tetracelmis TspAGP-M1 has improved C16:0 and C18:1 fatty acid production ability compared to the wild-type strain, tetracelmis genus variant.
17. Accumulating lipids by culturing the tetracelmis genus variant according to any one of claims 13 to 16; And Bioenergy production method comprising the step of isolating the accumulated lipid from the culture.
18. A bioenergy composition comprising a culture of a variant of the genus Tetracelmis according to any one of claims 13 to 16.

Images