WO2020145754A1 - Mass spectrometry using dna polymerase with increased genetic mutation specificity - Google Patents

Abstract

The present invention relates to mass spectrometry using a DNA polymerase with increased genetic mutation specificity and, more specifically, to a DNA polymerase for use in detecting genetic mutation by using mass spectrometry, the DNA polymerase comprising a Taq polymerase with genetic mutation specificity which is increased due to the inducing of mutation at a specific amino acid position, a kit comprising same, and a method for detecting genetic mutation by mass spectrometry using same.

Description

Mass spectrometry using DNA polymerase with increased genetic variation specificity

The present invention relates to mass spectrometry using a DNA polymerase with increased gene variation specificity, and more specifically, a gene using mass spectrometry, including Taq polymerase with increased gene variation specificity due to mutation at a specific amino acid position. It relates to a DNA polymerase for use in mutation detection, a kit containing the same, and a method for detecting gene mutation by mass spectrometry using the same.

Since the first use of mass spectrometry in the early 1900s, various ionization methods have been developed, and EI (Electron Impact) is widely used as a standard ionization method. However, this method can be used only for volatile samples, and has a disadvantage that it cannot be used for samples that are unstable to heat, and is mainly applied to organic small molecules.

For this reason, various ionization methods have been developed for mass spectrometry of materials that are not volatile or thermally stable, such as SIMS, FD, FAB, and MALDI. Among them, MALDI (Matrix Assisted Laser Desorption Ionization) is a method that can vaporize/ionize polymer materials without decomposition of the sample, and is a method that can be applied to biopolymers or synthetic polymers that are large in mass and unstable. In addition, it is the most popular mass spectrometry method for polymer research in combination with a TOF (Time of Flight) analyzer.

In the conventional method of gene amplification through PCR, when ddNTP (Dideoxynucleotide) is added, gene amplification stops at the place where ddNTP is added. Therefore, in the conventional method, a primer that complementarily binds (-1) until a nucleotide having a mutation is designed and used, and PCR is performed by adding ddNTP. Mass spectrometry of these PCR products using MALDI-TOF can confirm the mass difference of the last added ddNTP, thereby detecting gene mutation. However, the mass difference between ddNTPs is not large, and the number of mutant genes is very small compared to the number of normal genes present in a sample (tissue, blood, urine, etc.), so the accuracy or sensitivity of mutation detection is significantly lower.

Thus, the present inventors increased mutation in mass between the normal product and the PCR product of the mutant gene by suppressing the extension of primer ends by mismatch using mutagenesis-specific DNA polymerase, thereby detecting mutation during mass spectrometry using MALDI-TOF. A method was developed to improve the accuracy and sensitivity of.

On the other hand, Republic of Korea Patent Publication No. 10-2011-0008158 relates to a composition and method for mass spectrometry, for a sample analyzed by reducing the formation of adducts in a sample containing an analyte to be analyzed by mass spectrometry A method capable of increasing accuracy, sensitivity, and throughput has been disclosed, but there is no known mass spectrometry method that improves accuracy and sensitivity using DNA polymerase with increased genetic variation specificity.

An object of the present invention is to provide a DNA polymerase with increased genetic variation specificity and a kit comprising the same, for use in detecting gene mutations using mass spectrometry.

Another object of the present invention is to provide a method for detecting gene mutation by mass spectrometry using the above-described DNA polymerase and/or kit.

In order to solve the above-described problem, the present invention is a 507th amino acid residue glutamic acid (E) in the amino acid sequence of SEQ ID NO: 1 is substituted with lysine (K), the 536th amino acid residue arginine (R) is lysine (K) It provides a DNA polymerase for use in detecting gene mutations using mass spectrometry, including Taq polymerase substituted with valine (V) with arginine (R), the 660th amino acid residue.

According to a preferred embodiment of the present invention, the mass spectrometry is a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclo Tron Resonance (ICR) mass spectrometry, Mass Array (MassARRAY) and Fourier transform mass spectrometry.

The present invention also, the DNA polymerase described above; And/or at least one matched primer, at least one mismatched primer, or both at least one matched primer and at least one mismatched primer; provides a kit for use in detecting gene mutations using mass spectrometry .

According to one preferred embodiment of the present invention, the one or more matched primers and one or more mismatched primers can be hybridized with the target sequence.

According to another preferred embodiment of the present invention, the kit may further include dideoxynucleoside triphosphate.

According to another preferred embodiment of the present invention, the kit comprises 25 to 100 mM KCl; And 1 to 7 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

According to another preferred embodiment of the present invention, the kit comprises 40 to 90 mM KCl; 1 to 5 mM (NH ₄ ) ₂ SO ₄ ; And 10 to 40 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.0.

The present invention also provides a method of detecting gene mutation by mass spectrometry using the above-described DNA polymerase.

According to a preferred embodiment of the present invention, the method comprises: (a) extracting a nucleic acid from an isolated biological sample; (b) performing PCR by treating the extracted nucleic acid with the DNA polymerase of the present invention; And (c) analyzing the size or base sequence of the amplification product as a result of the PCR.

According to a preferred embodiment of the present invention, the biological sample in step (a) is whole blood, serum, plasma, urine, stool, sputum, saliva (saliva), tissue, cell, cell extract, and any one or more selected from the group consisting of in vitro cell culture.

According to one preferred embodiment of the present invention, in step (b), one or more matched primers, one or more mismatched primers, or both one or more matched primers and one or more mismatched primers may be processed, and the one or more Matched primers and one or more mismatched primers can hybridize to the target sequence.

According to another preferred embodiment of the present invention, step (c) may be to analyze the mass of the PCR amplification product by mass spectrometry.

According to another preferred embodiment of the present invention, the mass spectrometry is a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, It may be selected from the group consisting of ion cyclotron resonance (ICR) mass spectrometry, mass array (MassARRAY) and Fourier transform mass spectrometry.

According to another preferred embodiment of the present invention, analyzing the mass of the PCR amplification product in step (c) is a dideoxynucleoside tree between the amplification product of the matched primer and the product where primer amplification has not occurred. It may be to confirm the molecular weight difference as much as phosphate.

According to another preferred embodiment of the present invention, the method may be used to diagnose a disease, predict prognosis of a disease, or predict drug responsiveness.

According to another preferred embodiment of the present invention, the method can detect multiple mutations of at least three different targets simultaneously by one PCR.

Mass spectrometry using DNA polymerase with increased genetic variation specificity of the present invention increases the mass difference between PCR products of normal genes and mutant genes by suppressing the extension of primer ends by mismatch, thereby mass spectrometry using MALDI-TOF. It can significantly improve the accuracy and sensitivity of mutant detection. In addition, the quantitative PCR method using a conventional fluorescent probe has technical limitations in multiplexes simultaneously observing multiple mutant targets, but when applying the mass spectrometry method of the present invention, mass differences appear for each designed primer, so one PCR As a result, multiplex technology capable of detecting multiple mutations of up to 30-40 different targets simultaneously is possible.

Figure 1 shows the production process of Taq DNA polymerase containing each of the R536K, R660V and R536K/R660V mutations, (a) schematically shows fragment PCR and overlap PCR, (b) is amplified in fragment PCR The result of confirming the product by electrophoresis, and (c) shows the result of confirming the amplified product by electrophoresis by amplifying the entire length by overlap PCR.

Figure 2 is a result of confirming the overlap PCR product of FIG. 1(c) purified by digestion with the restriction enzyme EcoRI/XbaI and then the SAP-treated pUC19 vector for gel extraction.

Figure 3 is a schematic diagram showing fragment PCR and overlap PCR during the preparation of Taq DNA polymerase containing E507K, E507K/R536K, E507K/R660V and E507K/R536K/R660V mutations, respectively.

FIG. 4 shows the results of confirming by electrophoresis the overlap PCR product of FIG. 3 purified with the pUC19 vector digested with the restriction enzyme EcoRI/XbaI for gel extraction, and then with SAP.

Figure 5 shows the principle of the MALDI-TOF mass spectrometry using the DNA polymerase with increased genetic variation specificity of the present invention compared to the conventional MALDI-TOF mass spectrometry, (A) is a conventional method, (B) Represents the method of the present invention.

Figure 6 shows the results of detecting the mutation by electrophoresis after a single base extension (Single Base Extension) in a sample containing the BRAF p.V600E (c.1799T>A) mutant template.

7A to 7E show the results of mutation detection using MALDI-TOF mass spectrometry according to the concentration of BRAF p.V600E (c.1799T>A) mutant template in samples (0, 0.1, 0.5, 5.0 and 10%, respectively) , The first box corresponds to the loading control for each experiment, the second box indicates the amount of primer not extended, and the third box indicates the amount of extended primer.

Figure 8 shows the results of detecting a mutation by electrophoresis after a single base extension in a sample containing the EGFR p.T790M (c.2369C>T) mutant template, changes in annealing temperature (59, 61.9 , 65.1 and 68°C).

9A to 9E show the results of mutation detection using MALDI-TOF mass spectrometry according to the concentration (0, 0.1, 0.5, 5.0 and 10%, respectively) of the EGFR p.T790M (c.2369C>T) mutant template in the sample. , The first box corresponds to the loading control for each experiment, the second box indicates the amount of primer not extended, and the third box indicates the amount of extended primer.

Figure 10 shows the results of detecting the mutation by electrophoresis after a single base extension (Single Base Extension) in a sample containing the EGFR p.L858R (c.2573T>G) mutant template, annealing temperature changes (59, 61.9 , 65.1 and 68°C).

11A to 11E show the results of mutation detection using MALDI-TOF mass spectrometry according to the concentration (0, 0.1, 0.5, 5.0 and 10%, respectively) of the EGFR p.L858R (c.2573T>G) mutant template in the sample. , The first box corresponds to the loading control for each experiment, the second box indicates the amount of primer not extended, and the third box indicates the amount of extended primer.

12A to 12E are multiplexed for BRAF p.V600E (c.1799T>A), EGFR p.T790M (c.2369C>T) and EGFR p.L858R (c.2573T>G). As a result, the first box shows the amount of primer not extended for the EGFR p.T790M (c.2369C>T) mutation, and the second box extended for the EGFR p.T790M (c.2369C>T) mutation. The amount of primers, the third box corresponds to the experiment-specific loading control, the fourth box represents the amount of unextended primer for the EGFR p.L858R(c.2573T>G) mutation, and the fifth box represents EGFR. p.L858R(c.2573T>G) represents the amount of primer extended for mutation, the sixth box represents the amount of primer not extended for BRAF p.V600E(c.1799T>A) mutation, seventh Box indicates amount of extended primer for BRAF p.V600E (c.1799T>A) mutation.

As described above, mass spectrometry using MALDI-TOF does not show a large mass difference between ddNTPs, and the number of mutant genes is very small compared to the number of normal genes present in a sample (tissue, blood, urine, etc.). The detection accuracy and sensitivity were remarkably low. Accordingly, the present inventors increased the mass difference between the PCR product of the normal gene and the mutant gene by suppressing the extension of the primer end by mismatch using mutagenesis-specific DNA polymerase, thereby detecting mutations during mass spectrometry using MALDI-TOF. By developing a method to improve the accuracy and sensitivity, a solution to the above-described problem was sought.

Hereinafter, terms used in the present application will be described.

"Amino acid" refers to any monomeric unit that can be incorporated into a peptide, polypeptide, or protein. As used herein, the term "amino acid" includes the following 20 natural or genetically encoded alpha-amino acids: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspart Acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan ( Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

Amino acids are typically organic acids, which include substituted or unsubstituted amino groups, substituted or unsubstituted carboxy groups, and one or more side chains or groups, or any analogue of these groups. Exemplary side chains include, for example, thiol, seleno, sulfonyl, alkyl, aryl, acyl, keto, azido, hydroxyl, hydrazine, cyano, halo, hydrazide, alkenyl, alkynyl, ether, Borate, boronate, phospho, phosphono, phosphine, heterocyclic, enone, imine, aldehyde, ester, thio acid, hydroxylamine, or any combination of these groups.

In the DNA polymerase of the present invention, the term "mutant" refers to a recombinant polypeptide comprising one or more amino acid substitutions compared to the corresponding naturally occurring or unmodified DNA polymerase.

The term “thermal stable polymerase” (referring to a heat stable enzyme) is heat resistant, retains sufficient activity to achieve subsequent polynucleotide elongation reactions and is treated with elevated temperature for the time required to achieve denaturation of the double-stranded nucleic acid Does not irreversibly denature (deactivate) when As used herein, it is suitable for use at temperatures cycling reactions such as PCR. Irreversible denaturation herein refers to permanent and complete loss of enzyme activity. For thermostable polymerases, enzymatic activity refers to catalyzing a combination of nucleotides in a suitable way to form a polynucleotide extension product complementary to the template nucleic acid strand. Thermostable DNA polymerases derived from thermophilic bacteria include, for example: Thermomoto maritima, thermos aquaticus, thermos thermophilus, thermos flavus, thermomod philipformis, thermos species DNA polymerase derived from Sps17, Thermos species Z05, Thermos Caldophyllus, Bacillus caldotenax, Thermomoto Neopolitana, and Thermosippo africanus.

The term “thermal activity” refers to an enzyme that maintains catalytic properties at temperatures (ie 45-80° C.) commonly used for reverse transcription or annealing/extension steps in RT-PCR and/or PCR reactions. Thermostable enzymes are those that are not irreversibly inactivated or denatured when treated at elevated temperatures required for nucleic acid denaturation. The thermoactive enzyme may or may not be thermostable. The thermally active DNA polymerase can be DNA or RNA dependent from thermophilic or mesophilic species, including but not limited to:

The term “nucleotide” is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) that exists in the form of a single strand or a double strand, and is not specifically mentioned otherwise. Unless it can contain analogs of natural nucleotides.

The term “nucleic acid” or “polynucleotide” refers to a polymer that can correspond to a DNA or RNA polymer, or analogs thereof. Nucleic acids can be, for example, chromosomal or chromosomal segments, vectors (eg, expression vectors), expression cassettes, naked DNA or RNA polymers, products of polymerase chain reaction (PCR), oligonucleotides, probes, and primers. Or may include it. Nucleic acids can be, for example, single-stranded, double-stranded, or triple-stranded, but are not limited to any particular length. Unless otherwise stated, certain nucleic acid sequences include or encode complementary sequences in addition to any sequence specified.

The term “primer” refers to a polynucleotide that can serve as a starting point for nucleic acid synthesis in the template-direction when placed under conditions where polynucleotide elongation is initiated. Primers can also be used in a variety of other oligonucleotide-mediated synthesis processes, including as initiators of de novo RNA synthesis and in vitro transcription-related processes. Primers are typically single-stranded oligonucleotides (eg, oligodeoxyribonucleotides). The appropriate length of the primer will typically depend on the intended use in the range of 6 to 40 nucleotides, more typically in the range of 15 to 35 nucleotides. Short primer molecules generally require a lower temperature to form a sufficiently stable hybridization complex with the template. Primers are not required to reflect the exact sequence of the template, but must be sufficiently complementary to hybridize with the template for elongation of the primer. In certain embodiments, the term “primer pair” includes a 5′-sense primer that hybridizes complementarily to the 5′-end of the amplified nucleic acid sequence, and a 3′-antisense primer that hybridizes to the 3′ end of the amplified sequence. Means a set of primers comprising Primers can be labeled, if necessary, by incorporating a label that can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means. For example, useful labels include: ³² P, fluorescent dyes, electron-dense reagents, enzymes (usually used in ELISA assays), biotin, or haptens and proteins in which antiserum or monoclonal antibodies can be used. .

The term “5′-nuclease probe” refers to an oligonucleotide comprising at least one luminescent label moiety used in a 5′-nuclease reaction to target nucleic acid detection. In some embodiments, for example, the 5'-nuclease hydrolyzate probe comprises only a single luminescent moiety (eg, fluorescent dye, etc.). In certain embodiments, the 5'-nuclease probe contains a self-complementary region so that the probe can form a hairpin structure under selective conditions. In some embodiments, the 5'-nuclease hydrolyzate probe comprises two or more labeling moieties, and one of the two labels is released from the oligonucleotide after being separated or degraded to increase the emission intensity. In certain embodiments, the 5'-nuclease hydrolase probe is labeled with two different fluorescent dyes, for example a 5'-terminal reporter dye and a 3'-terminal quencher dye or moiety. In some embodiments, the 5'-nuclease probe is labeled in addition to, or at one or more positions other than the terminal position. When the probe is intact, energy transfer typically occurs between the two phosphors such that the fluorescence emission from the reporter dye is partially extinguished. During the elongation phase of the polymerase chain reaction, for example, a 5'-nucleic acid hydrolase probe bound to the template nucleic acid has an activity such that the fluorescence of the reporter dye is no longer quenched, for example, Taq polymerase or other Degraded by the 5'to 3'-nucleic acid hydrolase activity of the polymerase. In some embodiments, a 5'-nuclease probe can be labeled with two or more different reporter dyes and a 3'-terminal quencher dye or moiety.

The term “conventional” or “natural” when referring to a nucleic acid base, nucleoside triphosphate, or nucleotide refers to naturally occurring polynucleotides described (ie, for DNA, they are dATP, dGTP, dCTP and dTTP). In addition, dITP, and 7-deaza-dGTP are frequently used instead of dGTP and can be used instead of dATP in in vitro DNA synthesis reactions such as sequencing.

The term “unconventional” or “modified” when referring to a nucleic acid base, nucleotide, or nucleotide, is a conventional base, nucleotide, or modification, derivative, or nucleotide that occurs naturally in a particular polynucleotide, or Analogs. Certain unusual nucleotides are modified at the 2'position of the ribose sugar compared to conventional dNTP. Thus, even though naturally occurring nucleotides for RNA are ribonucleotides (i.e., ATP, GTP, CTP, UTP, collective rNTP), since nucleotides have hydroxyl groups at the 2'position of the sugar, this is compared to the absence of dNTP, As used herein, ribonucleotides are unusual nucleotides as substrates for DNA polymerases. As used herein, unusual nucleotides include, but are not limited to, compounds used as terminators for nucleic acid sequencing. Exemplary terminator compounds include, but are not limited to, compounds having a 2',3'- dideoxy structure, referred to as dideoxynucleoside triphosphate. Dideoxynucleoside triphosphate ddATP, ddTTP, ddCTP and ddGTP are collectively referred to as ddNTP. Additional examples of terminator compounds include 2'-PO ₄ analogues of ribonucleotides. Other unusual nucleotides are phosphorothioate dNTP ([[α]-S]dNTP), 5'-[α]-borano-dNTP, [α]-methyl-phosphonate dNTP, and ribonucleosides Triphosphate (rNTP). Uncommon bases include radioactive isotopes such as ³² P, ³³ P, or ³⁵ S; Fluorescent labels; A label for chemiluminescence; Bioluminescent markers; Hapten labels such as biotin; Or it can be labeled with an enzyme label such as streptavidin or avidin. Fluorescent labels can include negatively charged dyes, such as the dyes of the fluorescein family, or neutrally charged dyes, such as the dyes of the rhodamine family, or positively charged dyes, such as the dyes of the cyanine family. Dyes of the fluorescein family include, for example, FAM, HEX, TET, JOE, NAN and ZOE. Rhodamine family dyes include Texas Red, ROX, R110, R6G, and TAMRA. Various dyes or nucleotides labeled FAM, HEX, TET, JOE, NAN, ZOE, ROX, R110, R6G, Texas Red and TAMRA are Perkin-Elmer (Boston, MA), Applied Biosystems (Foster City, CA), or Invitrogen /Molecular Probes (Eugene, OR). The cyanine family dyes include Cy2, Cy3, Cy5, and Cy7, and are marketed by GE Healthcare UK Limited (Amersham Place, Little Chalfont, Buckinghamshire, England).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

Hereinafter, the present invention will be described in more detail.

In the present invention, in the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue, glutamic acid (E), is substituted with lysine (K), the 536th amino acid residue, arginine (R), is replaced with lysine (K), and the 660th amino acid residue. Provided is a DNA polymerase for use in detecting gene mutations using mass spectrometry, including Taq polymerase in which phosphorus arginine (R) is substituted with valine (V).

The "Taq polymerase" was a thermophilic DNA polymerase named after the thermophilic bacterium Thermus aquaticus and was first isolated from the bacteria. Thermos Aquaticus is a bacterium inhabiting hot springs and hot water jets, and Taq polymerase has been identified as an enzyme capable of withstanding the protein denaturation conditions (high temperature) required in PCR. The optimum activity temperature of Taq polymerase is 75-80 ℃, has a half-life of 9 hours at 22.5 hours at 92.5 ℃, 40 minutes at 95 ℃, 9 minutes at 97.5 ℃, and replicates 1000 base pair DNA within 10 seconds at 72 ℃ Can. It lacks 3'→5' nucleic acid endonuclease correcting activity, and the error rate is measured in about 1 out of 9,000 nucleotides. For example, using the heat-resistant Taq, PCR can be performed at high temperatures (above 60°C). The amino acid sequence shown in SEQ ID NO: 1 for Taq polymerase is used as a reference sequence.

In the present invention, the 507th amino acid residue in the amino acid sequence of SEQ ID NO: 1 is substituted with lysine (K) in glutamic acid (E), the 536th amino acid residue is substituted with lysine (K) in arginine (R), and the 660th amino acid Taq polymerase in which the residue is substituted with arginine (R) to valine (V) was designated as “E507K/R536K/R660V”, and its amino acid sequence and nucleotide sequence are shown in SEQ ID NO: 2 and SEQ ID NO: 20, respectively.

According to a preferred embodiment of the present invention, the DNA polymerase of the present invention is a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry , Ion cyclotron resonance (ICR) mass spectrometry, Mass Array (MassARRAY) and Fourier transform mass spectrometry.

The present invention also detects gene mutations using mass spectrometry, comprising the DNA polymerase and/or one or more matched primers, one or more mismatched primers, or both one and more matched primers and one or more mismatched primers as described above. It provides a kit for use in.

In the kit of the present invention, the one or more matched primers and one or more mismatched primers can be hybridized with the target sequence, and the mismatched primers contain non-standard nucleotides at the 3'end of the hybridized target sequence. can do.

The mismatched primer is a hybrid oligonucleotide that must be sufficiently complementary to hybridize with the target sequence but does not reflect the exact sequence of the target sequence.

“Standard canonical nucleotides” or “complementary nucleotides” refer to standard Watson-Crick base pairs, A-U, A-T and G-C.

The "non-canonical nucleotide" or "non-complementary nucleotide" means A-C, A-G, G-U, G-T, T-C, T-U, A-A, G-G, T-T, U-U, C-C, C-U in addition to Watson-Crick base pair.

According to another preferred embodiment of the present invention, the kit for mass spectrometry may further include dideoxynucleoside triphosphate (ddNTP) such as ddATP, ddTTP, ddCTP or ddGTP.

The present invention also provides a method of detecting gene mutation by mass spectrometry using the above-described DNA polymerase.

According to one preferred embodiment of the present invention, the method comprises: (a) extracting a nucleic acid from an isolated biological sample; (b) performing PCR by treating the extracted nucleic acid with the polymerase of the present invention; And (c) analyzing the size or base sequence of the amplification product as a result of the PCR.

In the method of the present invention, the biological sample in step (a) is whole blood, serum, plasma, urine, stool, sputum, saliva ), tissues, cells, cell extracts and in vitro cell cultures.

In the method of the present invention, in step (b), one or more matched primers, one or more mismatched primers, or both one or more matched primers and one or more mismatched primers may be processed, and the one or more matched The primer and one or more mismatched primers can hybridize to the target sequence.

In the method of the present invention, in the step (b), a PCR buffer composition for increasing the activity of the DNA polymerase can be processed.

According to a preferred embodiment of the present invention, the PCR buffer composition is 25 to 100 mM KCl; And 1 to 7 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

More preferably, the kit comprises 40 to 90 mM KCl; And 1 to 5 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.0.

According to another preferred embodiment of the present invention, the kit comprises 25 to 100 mM KCl; 1 to 7 mM (NH ₄ ) ₂ SO ₄ ; And 5 to 50 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

More preferably, the kit comprises 40 to 90 mM KCl; 1 to 5 mM (NH ₄ ) ₂ SO ₄ ; And 10 to 40 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.0.

The kit of the present invention may further include TrisCl (pH 8.0 to 9.5), MaCl ₂ , Tween 20, and Bovine serum albumin (BSA) in addition to KCl, (NH ₄ ) ₂ SO ₄ , and TMAC, and these components The concentration of can be used by a person skilled in the art to adjust to an appropriate range.

The PCR buffer composition as described above enables reliable gene mutation-specific amplification by remarkably improving the activity of the DNA polymerase of the present invention.

In the method of the present invention, step (b) may be performed as a single base extension (SBE). The single-base extension reaction is a technique for attaching a primer close to a mutation site to be analyzed to a target gene and identifying a base inserted using DNA polymerase and ddNTP, which is efficient for single-base mutation analysis.

Therefore, the method of the present invention is useful for detecting single nucleotide polymorphism (SNP).

In the method of the present invention, step (c) may be to analyze the mass of the PCR amplification product by mass spectrometry.

In the method of the present invention, the mass spectrometry is a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclotron resonance ( ICR) mass spectrometry, mass array (MassARRAY) and Fourier transform mass spectrometry.

In addition, the method of the present invention is applied to various techniques for analyzing sequencing using PCR amplification products, for example, a microarray chip or various analyzers capable of measuring mass, for example, sequencing analysis techniques such as LC-MS. It should be understood as a possible base technology.

Preferably, the method of the present invention can analyze the mass of the PCR amplification product by MALDI-TOF mass spectrometry. This is a multiplexing analysis method applicable to various genome studies, such as genotyping, and can be used to quickly analyze a large number of samples and targets at a low cost, or to perform a customized analysis only for a specific target. have.

In the method of the present invention, analyzing the mass of the PCR amplification product in step c) differs in molecular weight by dideoxynucleoside triphosphate between the amplification product of the matched primer and the product that is not mismatched and primer amplification has not occurred. It may be to check.

As shown in Figure 5, in the conventional method for amplifying a gene through PCR in the MALDI-TOF molecular weight quantification method (A), when ddNTP (Dideoxynecleotide) is added, gene amplification stops at the place where ddNTP is added. Therefore, the conventional method is to design and use a primer that complementarily binds to (-1) immediately before the nucleotide with mutation, and performs PCR by adding ddNTP. Mass spectrometry of these PCR products using MALDI-TOF confirmed the mass difference of the last added ddNTP, and through this, gene mutation was detected. However, the mass difference between ddNTPs is not large, and the number of mutant genes is very small compared to the number of normal genes present in a sample (tissue, blood, urine, etc.), so the accuracy or sensitivity of mutation detection is significantly lower.

On the other hand, the existing MALDI-TOF molecular weight quantification method of the present invention (FIG. 1(B)) is amplified normally in the case of a mutant gene and ddNTP can bind to the following position, but in the case of a normal gene, the mutant nucleotide position Since amplification is suppressed by mismatch of, a mass difference of ddNTP occurs at the next position, so accuracy and sensitivity can be significantly improved compared to the conventional MALDI-TOF molecular weight quantification method.

Therefore, the method of the present invention can be applied to various genome studies such as genotyping, as well as in-vitro diagnostic (IVD).

Specifically, the method of the present invention can be used for diagnosis of disease, prediction of disease prognosis, or drug reactivity prediction. The disease may be cancer, but is not limited thereto, and any disease that can be diagnosed through detection of genetic variation related to a specific disease may be included without limitation.

In the present invention, the term "prognosis" refers to the act of predicting the course and outcome of a disease in advance. More specifically, the prognosis prediction can be interpreted to mean any action that predicts the course of the disease after treatment by comprehensively taking into account the patient's physiological or environmental conditions. Can be.

The prognosis prediction may be interpreted as an action of predicting the disease-free survival rate or survival rate of a patient in advance by predicting the progress and complete cure of the disease after treatment of a specific disease. For example, predicting that "the prognosis is good" means that the patient has a high probability of being treated without disease or having a high survival rate after treatment of the disease, and predicting that the "prognosis is bad" is a disease After treatment, the patient's disease-free survival rate or survival rate is low, indicating that the disease is likely to recur or die from the disease.

The term "no disease survival rate" of the present invention means the possibility that a patient can survive without recurrence of the disease after treatment of the specific disease.

The term "survival rate" of the present invention means the possibility that a patient can survive regardless of whether or not the disease recurs after treatment of a specific disease.

The method of the present invention can simultaneously detect multiple target mutants of at least 3 different target mutants simultaneously with only one PCR by adjusting the length of the primers for each different target mutant, for example 3 to 40 different Target mutations can be detected simultaneously and multiple times.

Hereinafter, the present invention will be described in more detail by examples. These examples are only for explaining the present invention in more detail, whereby it will be apparent to those skilled in the art that the technical scope of the present invention is not limited to these examples.

[Example 1]

Mutagenesis of Taq polymerase

1-1. Fragment PCR

In this embodiment, Taq DNA polymerase in which the 536th amino acid residue in the amino acid sequence of SEQ ID NO: 1 is substituted with arginine to lysine (hereinafter referred to as "R536K"), Taq DNA polymerase in which the 660th amino acid residue is substituted with valine in arginine. (Hereinafter referred to as “R660V”) and Taq DNA polymerase (hereinafter referred to as “R536K/R660V”) in which the 536th amino acid residue is substituted from arginine to lysine and the 660th amino acid residue is substituted from arginine to valine is prepared as follows. Did.

First, Taq DNA polymerase fragments (F1 to F5) were amplified by PCR using the mutant specific primers listed in Table 1, as shown in Figure 1(a). The reaction conditions are shown in Table 2.

primer	Sequence (5'→3')	Sequence number
Eco-F	GG GGTACC TCA TCA CCC CGG	3
R536K-R	CTT GGT GAG CTC CTT GTA CTG CAG GAT	4
R536K-F	ATC CTG CAG TAC AAG GAG CTC ACC AAG	5
R660V-R	GAT GGT CTT GGC CGC CAC GCG CAT CAG GGG	6
R660V-F	CCC CTG ATG CGC GTG GCG GCC AAG ACC ATC	7
Xba-R	GC TCTAGA CTA TCA CTC CTT GGC GGA GAG CCA	8

10xpfu buffer (solvent)	2.5 μl
dNTP (10 mM each)	1 μl
F primer	1 μl
R primer	1 μl
Distilled water	18 μl
pUC19-Taq (10 ng/μl)	1 μl
Pfu polymerase	0.5 μl
30 cycles (Ta=60℃)	25 μl

As a result of confirming the PCR product on the electrophoresis, as shown in Fig. 1 (b), it was confirmed that the band for each fragment was confirmed and the desired fragment was amplified.

1-2. Overlap PCR

Each fragment amplified in 1-1 was used as a template to amplify the full length using primers at both ends (Eco-F and Xba-R primers). The reaction conditions are shown in Tables 3 and 4.

R660V or R536K

10xpfu buffer (solvent)	5 μl
5x Enhancer (Solent)	10 μl
dNTP (10 mM each)	1 μl
Eco-F primer (10 pmol/μl)	2 μl
Xba-R primer (10 pmol/μl)	2 μl
Distilled water	27 μl
Fragment 1 (or Fragment 3)	1 μl
Short 2 (or Short 4)	1 μl
Pfu polymerase	1 μl
40 cycles (Ta=62℃)	50 μl

R536K/R660V

10xpfu buffer (solvent)	5 μl
5x Enhancer (Solent)	10 μl
dNTP (10 mM each)	1 μl
Eco-F primer (10 pmol/μl)	2 μl
Xba-R primer (10 pmol/μl)	2 μl
Distilled water	26 μl
Short 2	1 μl
Short 3	1 μl
Short 5	1 μl
Pfu polymerase	1 μl
40 cycles (Ta=62℃)	50 μl

As a result, it was confirmed that Taq polymerases of "R536K", "R660V" and "R536K/R660V" were amplified as shown in FIG. 1(c).

1-3. Ligation

pUC19 was digested with the restriction enzyme EcoRI/XbaI at 37°C for 4 hours under the conditions of Table 5 below, and then the DNA was purified and the purified DNA was treated with SAP for 1 hour at 37°C under the conditions of Table 6 to prepare a vector. .

10xCutSmart buffer (NEB)	2.5 μl
pUC19 (500 ng/μl)	21.5 μl
EcoRI-HF (NEB)	0.5 μl
XbaI (NEB)	0.5 μl
	25 μl

10xSAP buffer (Roche)	2 μl
Purified DNA	17 μl
SAP (Roche)	1 μl
	20 μl

In the case of inserts, the overlap PCR product of Example 1-2 was purified, digested with restriction enzyme EcoRI/XbaI at 37°C for 3 hours under the conditions of Table 7, and then gel extracted with the prepared vector (FIG. 2 ). ).

10xCutSmart buffer (NEB)	2 μl
Purified PCR product	17 μl
EcoRI-HF (NEB)	0.5 μl
XbaI (NEB)	0.5 μl
	20 μl

After ligation at room temperature (RT) for 2 hours under the conditions in Table 8, E. coli DH5α was transformed to select from the medium containing ampicillin. The plasmid prepared from the obtained colonies was sequenced to obtain Taq DNA polymerase mutants ("R536K", "R660V" and "R536K/R660V") into which the desired mutation was introduced.

	Vector sole	Vector + insert
10x ligase buffer (solvent)	1 μl	1 μl
vector	1 μl	1 μl
insert	-	3 μl
Distilled water	7 μl	4 μl
T4 DNA ligase (solvent)	1 μl	1 μl
	10 μl	10 μl

[Example 2]

Introduction of E507K mutation

2-1. Fragment PCR

Taq polymerase activity of "R536K", "R660V" and "R536K/R660V" prepared in Example 1 was tested to confirm that the activity was poor (data not shown), R536K, R660V, R536K/R660V, respectively In addition, an E507K mutation (substituting the 507th amino acid residue in the amino acid sequence of SEQ ID NO: 1 with glutamic acid for lysine) was introduced, and an E507K mutation was also introduced into the wild-type Taq DNA polymerase (WT) for use as a control. The production method of Taq DNA polymerase introduced with the E507K mutation is the same as in Example 1.

Taq DNA polymerase fragments (F6 to F7) were amplified by PCR using the mutant specific primers listed in Table 9. The reaction conditions are shown in Table 10.

primer	Sequence (5'→3')	Sequence number
Eco-F	GG GGTACC TCA TCA CCC CGG	3
E507K-R	CTT GCC GGT CTT TTT CGT CTT GCC GAT	9
E507K-F	ATC GGC AAG ACG AAA AAG ACC GGC AAG	10
Xba-R	GC TCTAGA CTA TCA CTC CTT GGC GGA GAG CCA	8

10xpfu buffer (solvent)	2.5 μl
dNTP (10 mM each)	1 μl
F primer (10 pmol/μl)	1 μl
R primer (10 pmol/μl)	1 μl
Distilled water	18 μl
Template plasmid (10 ng/μl)	1 μl
Pfu polymerase	0.5 μl
30 cycles (Ta=60℃)	25 μl

* Template plasmid: pUC19-Taq (WT) pUC19-Taq (R536K)

pUC19-Taq (R660V)

pUC19-Taq (R536K/R660V)

2-2. Overlap PCR

Each fragment amplified in 2-1 was used as a template, and the full length was amplified using primers (Eco-F and Xba-R primers) at both ends. The reaction conditions are shown in Table 11.

10xpfu buffer (solvent)	5 μl
5x Enhancer (Solent)	10 μl
dNTP (10 mM each)	1 μl
Eco-F primer (10 pmol/μl)	2 μl
Xba-R primer (10 pmol/μl)	2 μl
Distilled water	27 μl
Short 6	1 μl
Short 7	1 μl
Pfu polymerase	1 μl
40 cycles (Ta=62℃)	50 μl

2-3. Ligation

pUC19 was digested with the restriction enzyme EcoRI/XbaI at 37°C for 4 hours under the conditions of Table 5, and then the DNA was purified, and the purified DNA was treated with SAP for 1 hour at 37°C under the conditions of Table 6 to prepare a vector. .

In the case of inserts, the overlap PCR product of Example 2-2 was purified, digested with restriction enzyme EcoRI/XbaI at 37°C for 3 hours under the conditions of Table 7, and then gel extracted with the prepared vector (FIG. 4 ). ).

After ligation at room temperature (RT) for 2 hours under the conditions of Table 8, E. coli was transformed into DH5α or DH10β, and was selected in a medium containing ampicillin. The plasmid prepared from the obtained colonies was sequenced to obtain Taq DNA polymerase mutants introduced with E507K mutations (“E507K/R536K”, “E507K/R660V” and “E507K/R536K/R660V”).

[Example 3]

BRAF p.V600E (c.1799T>A) mutation detection

3-1. Production of primer sets

OligoAnalyzer Tool (https://sg.idtdna.com/calc/analyzer) to design primers that generate PCR products for the p.V600E (c.1799T>A) mutation of the BRAF gene but not for the wild-type BRAF gene ) Using a program to check the primer size, Tm value, primer GC content, whether or not there is a self-complementary sequence in the primer, etc., to exclude the possibility of formation of a secondary structure, and then to primer Designed.

Primer information used in this example is shown in Table 12.

Mutant group	primer	Sequence (5'-3')	Sequence number	Length	Tm	Molecular Weight
p.V600E (c.1799T>A)	V600E Fmt24	AGG TGA TTT TGG TCT AGC TAC AG A	11	24nt	64.5℃	7423 KDa

3-2. BRAF p.V600E (c.1799T>A) detection test

BRAF p.V600E from each group in Table 13 using Taq polymerase (SEQ ID NO: 2) and the primer set of Example 3-1, each comprising the "E507K/R536K/R660V" variant obtained in Example 2 above. c.1799T>A) mutations were detected.

The single base extension reaction was performed under the conditions of Table 14, the composition of the 1X D-Taq buffer of Table 14 is shown in Table 15, and the sequence information of the WT and mutant templates is shown in Table 16, PCR The cycle was performed 200 cycles under the conditions of Table 17.

group	sample
WT	WT mold alone (4pmol/)
WT+ mt 0.1%	WT template alone (4 pmol/) + mutant template 0.1% (4 fmol)
WT+ mt 0.25%	WT template alone (4 pmol/) + mutant template 0.25% (10 fmol)
WT+ mt 0.5%	WT template alone (4 pmol/) + mutant template 0.5% (20 fmol)

1 rxn		Final concentration
4.55 ul	NFW	-
2 ul	5X D-Taq buffer	1X
2 ul	Forward primer (10 pmol/ul): V600E Fmt24	2 uM
0.25 ul	ddGTP (4nmol/ul)	100 uM
0.2 ul	Variation specific polymerase, 2.5 U/ul	0.5 U/rxn
1 ul	WT template DNA (4 pmol/ul)	400 nM
1 ul	Mutant template DNA (4f, 10f, 20fmol/ul)	0.5, 1, 2 nM
10 ul	Total reaction volume

			Final concentration
MMX	ADPS buffer	TrisCl (pH 8.8)	50 mM
		MgCl 2	2.5 mM
		KCl	60 mM
		(NH 4 ) 2 SO 4	2.5 mM
		TMAC	25 mM
		Tween 20	0.1%
		BSA	0.01%

template	order	Sequence number
V600E_wt_PE_tmp_+5R_55	ATTTC A CTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAG	12
V600E_mt_PE_tmp_+5R_55	ATTTC T CTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAG	13

step	Temperature		time
One	94℃		10 seconds
2	94℃		5 seconds
	58.4℃		30 seconds
	68℃		5 seconds

10 ul of 2X formamide loading buffer was added to 10 ul of the result, and then heated to 95°C for 5 minutes. Then, after loading on a 20% Aa, 8.3M urea gel, electrophoresis was performed at 250V for 1 hour. Thereafter, the gel was separated and stained with a gel red dye die for 30 minutes, and then a gel photograph taken under UV light was shown in Fig. 6. As shown in Fig. 6, there were 4 pmol of WT template in all 5 lanes, In the WT group without mutations, there was no extension of 25nt. In the group in which 0.1% (4 fmol) of the mutant template was added, it appeared to be slightly extended, but the group in which the distinction was clearly identified was the group in which 0.5% (20 fmol) of the mutant template was added.

3-3. Mass analysis using MassARRAY (agena)

For the sample obtained after the single-base extension reaction in Example 3-2, mass spectrometry was performed with a MassARRAY instrument from agena.

As a result, as can be seen in FIGS. 7A to 7E, it is possible to clearly distinguish the WT group that does not extend from the group in which the mutation template is added 0.1%, and it is found that the mutation is accurately detected with high sensitivity.

[Example 4]

EGFR p.T790M (c.2369C>T) mutation detection

4-1. Production of primer sets

OligoAnalyzer Tool (https://sg.idtdna.com/calc/analyzer) to design primers that generate PCR products for the p.T790M (c.2369C>T) mutation of the EGFR gene but not for the wild type EGFR gene ) Using a program to check the primer size, Tm value, primer GC content, whether or not there is a self-complementary sequence in the primer, etc., to exclude the possibility of formation of a secondary structure, and then to primer Designed.

Primer information used in this example is shown in Table 18.

Mutant group	primer	Sequence (5'-3')	Sequence number	Length	Tm	Molecular Weight
p.T790M(c.2369C>T)	T790M Fmt20	TC CAC CGT GCA GCT CAT CA T	14	20nt	69.5℃	6013 KDa

4-2. EGFR p.T790M (c.2369C>T) detection test according to annealing temperature

EGFR p.T790M (c.2369C>T) using the Taq polymerase (SEQ ID NO: 2) each containing the "E507K/R536K/R660V" variant obtained in Example 2 and the primer set of Example 4-1. Mutations were detected.

A single base extension reaction was performed for a sample containing 2 pmol of WT template and a sample of 0.2 pmol of mutant template added to 2 pmol of WT template. The conditions of the single base extension reaction were the same as in Example 3-2, wherein the annealing temperatures were varied to 59°C, 61.9°C, 65.1°C, and 68°C, respectively. Sequence information for the WT and mutant templates is shown in Table 19.

template	order	Sequence number
T790M_wt_PE_tmpl_+5R_55	GCTGC G TGATGAGCTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACAC	15
T790M_mt_PE_tmpl_+5R_55	GCTGC A TGATGAGCTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACAC	16

As a result, as shown in FIG. 8, in the case of the WT group, it was confirmed that an error occurred within a level visually observable at each annealing temperature, and that a single base extension reaction occurred in the group to which the mutant template was added. Therefore, even though the optimized annealing temperature range for each of several types of targets is widened through the results of this example, there is a problem in constructing a kit that simultaneously identifies multiple targets when using the DNA polymerase of the present invention. It can be confirmed that there is no.

4-3. Mass analysis using MassARRAY (agena)

For the sample obtained after the single-base extension reaction in Example 4-2, mass spectrometry was performed with a MassARRAY device from agena.

As a result, as can be seen in FIGS. 9A to 9E, it is possible to clearly distinguish the WT group from which the mutation template does not extend from the group to which 0.1% of the mutant template is added, and the mutation is accurately detected with high sensitivity.

[Example 5]

EGFR p.L858R (c.2573T>G) mutation detection

5-1. Production of primer sets

OligoAnalyzer Tool (https://sg.idtdna.com/calc/analyzer) to design primers that generate PCR products for the p.L858R(c.2573T>G) mutation of the EGFR gene but not for the wild-type EGFR gene ) Using a program to check the primer size, Tm value, primer GC content, whether or not there is a self-complementary sequence in the primer, etc., to exclude the possibility of formation of a secondary structure, and then to primer Designed.

The primer information used in this example is shown in Table 20.

Mutant group	primer	Sequence (5'-3')	Sequence number	Length	Tm	Molecular Weight
p.L858R(c.2573T>G)	L858R Fmt23	GT CAA GAT CAC AGA TTT TGG GC G	17	23nt	65.1℃	7104 KDa

5-2. EGFR p.L858R(c.2573T>G) detection test according to annealing temperature

EGFR p.L858R (c.2573T>G) using the Taq polymerase (SEQ ID NO: 2) containing the “E507K/R536K/R660V” variant obtained in Example 2 and the primer set of Example 5-1, respectively. Mutations were detected.

A single base extension reaction was performed for a sample containing 2 pmol of WT template and a sample of 0.2 pmol of mutant template added to 2 pmol of WT template. The conditions of the single base extension reaction were the same as in Example 3-2, wherein the annealing temperatures were varied to 59°C, 61.9°C, 65.1°C, and 68°C, respectively. The sequence information for the WT and mutant templates are shown in Table 21.

template	order	Sequence number
T790M_wt_PE_tmpl_+5R_55	GCTGC G TGATGAGCTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACAC	18
T790M_mt_PE_tmpl_+5R_55	GCTGC A TGATGAGCTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACAC	19

As a result, as shown in FIG. 10, in the case of the WT group, it was confirmed that the error that can be visually observed at each annealing temperature was weak, and that the single base extension reaction occurred in the group to which the mutant template was added. Therefore, even though the optimized annealing temperature range for each of several types of targets is widened through the results of this example, there is a problem in constructing a kit that simultaneously identifies multiple targets when using the DNA polymerase of the present invention. It can be confirmed that there is no.

5-3. Mass analysis using MassARRAY (agena)

As a result of Example 5-2, it was confirmed that a single base extension reaction occurred in the group to which the mutant template was added, but it was difficult to determine the maximum sensitivity visually. Therefore, in this example, in order to confirm the sensitivity by detecting the mutation by mass spectrometry using MALDI-TOF, mass spectrometry was performed on a sample obtained after the single-base extension reaction in Example 5-2 with a MassARRAY device from agena. .

As a result, as can be seen in FIGS. 11A to 11E, it is possible to clearly distinguish the WT group from which the mutation template does not extend from the group to which 0.1% of the mutant template is added, and the mutation is accurately detected with high sensitivity.

[Example 6]

Multiplex for 3 different targets

In this example, multiplexing was performed on three target mutations carried out in Examples 3 to 5 above. The experimental procedure is the same as in Example 5, but the BRAF p.V600E mutation is overlapped because the section representing the amount of non-extended primer of BRAF.V600E and the section representing the amount of extended primer of EGFR.L868R overlap between 7400-7500. By extending T to the targeting primer, the section showing the amount of non-extended primer of BRAF.V600E and the section showing the amount of extended primer of BRAF.V600E are shifted to the right by 305 molecular weight to confirm all three targets together. To ensure that.

As a result, as shown in FIGS. 12A to 12E, it is possible to clearly distinguish from the WT group in which extension does not occur from the group in which the mutation template is added at 0.1%, and it is found that three different target mutations are simultaneously and accurately detected. In addition, it can be seen that by adjusting the length of the primer through this example, up to 30 to 40 different target mutations can be detected simultaneously and simultaneously.

Mass spectrometry using DNA polymerase with increased genetic variation specificity of the present invention increases the mass difference between PCR products of normal genes and mutant genes by suppressing the extension of primer ends by mismatch, thereby mass spectrometry using MALDI-TOF. It can significantly improve the accuracy and sensitivity of mutant detection. In addition, the quantitative PCR method using a conventional fluorescent probe has technical limitations in multiplexes simultaneously observing multiple mutant targets, but when applying the mass spectrometry method of the present invention, mass differences appear for each designed primer, so one PCR As a result, multiplex technology capable of detecting multiple mutations of up to 30-40 different targets simultaneously is possible.

Claims (16)

1. In the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue glutamic acid (E) is substituted with lysine (K), the 536th amino acid residue arginine (R) is replaced with lysine (K), and the 660th amino acid residue arginine ( R) is a DNA polymerase for use in the detection of gene mutations using mass spectrometry, including Taq polymerase substituted with valine (V).
2. The method of claim 1, wherein the mass spectrometry is a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclotron resonance (ICR). ) DNA polymerase for use in gene mutation detection using mass spectrometry, which is selected from the group consisting of mass spectrometry, mass array (MassARRAY) and Fourier transform mass spectrometry.
3. In the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue glutamic acid (E) is replaced with lysine (K), the 536th amino acid residue arginine (R) is replaced with lysine (K), and the 660th amino acid residue arginine ( R) Taq polymerase substituted with valine (V); And/or

   At least one matched primer, at least one mismatched primer, or both at least one matched primer and at least one mismatched primer;

   A kit for use in detecting gene mutations using mass spectrometry.
4. The kit of claim 3, wherein the one or more matched primers and one or more mismatched primers hybridize with a target sequence.
5. The kit for use in detecting gene mutations using mass spectrometry according to claim 3, further comprising dideoxynucleoside triphosphate.
6. According to claim 3, 25 to 100 mM KCl; And 1 to 7 mM of (NH ₄ ) ₂ SO ₄ ; and further comprising a PCR buffer composition having a final pH of 8.0 to 9.5, a kit for use in detecting gene mutations using mass spectrometry.
7. According to claim 3, 40 to 90 mM KCl; 1 to 5 mM (NH ₄ ) ₂ SO ₄ ; And 10 to 40 mM TMAC (Tetra methyl ammonium chloride), and further comprising a PCR buffer composition having a final pH of 8.0 to 9.0, a kit for use in detecting gene mutations using mass spectrometry.
8. Method for detecting gene mutation by mass spectrometry using the DNA polymerase of claim 1.
9. The method of claim 8,

   (A) extracting the nucleic acid from the isolated biological sample;

   (b) processing the polymerase of claim 1 on the extracted nucleic acid to perform PCR; And

   (c) A method of detecting gene mutation by mass spectrometry, comprising the step of analyzing the size or base sequence of the amplified product as a result of the PCR.
10. 10. The method of claim 9, wherein the biological sample of step (a) is whole blood, serum, plasma, urine, stool, sputum, saliva , Tissue, cell, cell extract and any one or more selected from the group consisting of in vitro cell culture, a method for detecting gene mutation by mass spectrometry.
11. The method of claim 9, wherein in step (b), one or more matched primers, one or more mismatched primers or both, one or more matched primers and one or more mismatched primers are processed, and the one or more matched primers and one The above mismatched primer hybridizes with the target sequence, a method for detecting gene mutation by mass spectrometry.
12. 10. The method of claim 9, wherein step (c) is to analyze the mass of the PCR amplification product by mass spectrometry, a method of detecting gene mutation by mass spectrometry.
13. The method of claim 12, wherein the mass spectrometry is a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, laser desorption mass spectrometry (LDMS), electrospray (ES) mass spectrometry, ion cyclotron resonance (ICR). ) Mass spectrometry, mass array (MassARRAY) and Fourier transform mass spectrometry is selected from the group consisting of, a method of detecting gene mutation by mass spectrometry.
14. The method of claim 12, wherein in step (c), analyzing the mass of the PCR amplification product is a difference in the molecular weight of dideoxynucleoside triphosphate between the amplification product of the matched primer and the product that has not been mismatched and primer amplification has not occurred. A method of detecting gene mutation by mass spectrometry.
15. The method of claim 8, wherein the method is used for diagnosis of disease, prediction of disease prognosis, or drug reactivity prediction, by mass spectrometry.
16. The method according to claim 8, wherein the method detects gene mutations by mass spectrometry simultaneously by simultaneously detecting at least three or more different target mutations by one PCR.

Images