WO2020141498A1

WO2020141498A1 - Nanomolecular detection of aflatoxin b 1

Info

Publication number: WO2020141498A1
Application number: PCT/IB2020/051821
Authority: WO
Inventors: Pooria GILL; Adele RAFATI; Nafiseh DOROSTI
Original assignee: Gill Pooria; Rafati Adele
Priority date: 2020-03-04
Filing date: 2020-03-04
Publication date: 2020-07-09

Abstract

The invention relates to the design and development of a rapid and sensitive nanomolecular detection of aflatoxin B1 (AFB1) concentrations in food samples. This innovation includes the main part: (1) biotin-modified G-quadruplex aptamer against AFB1, (2) streptavidin-coated magnetic nanoparticles, and (3) The colorimetric measurement of aflatoxin B1 in a biologically or food samples.

Description

[Claim 1] Title of Invention: j Nanomolecular Detection of Aflatoxin Bi | iTechnical Field

[0001] Nanodiagnostics; Food safety

Background Art

[0002] Always different contaminants in food have been a major concern for the international

community, making it more sensitive and dangerous in times of crisis and deprived areas that make regular, rapid and accessible monitoring available to prevent the epidemic of foodborne illnesses(l, 2) and complications, it has become essential(3, 4).

[0003] Among the risk factors for food contamination, aflatoxins are of particular importance in all types of foods, especially rice and cereals, as key energy sources that play a vital role in the general health of human society and even livestock. AFBi (5)is a secondary metabolite found by

Aspergillus(6) flavus and parasiticus, especially in deprived areas. While this is very carcinogenic(7, 8).

[0004] Overwhelming integration of nanostructures(9, 10) in the design of aptasensors(l l) has provided special merit for the development of quantitative biosensors of biomarkers and food contaminants. The importance of this integration is extremely valuable in terms of limit detection, linear range, assays stability, low production cost. Nanoparticles can act as immobilization support, signal amplifier, mediator and artificial enzyme label in the construction of aptasensors(12).

[0005] Since even a small concentration of aflatoxin in foods has high potential for morbidity and even death, it is essential to develop high sensitivity and selectivity probes that any amateur user can easily and rapidly measure. Aptasensors for AFB i detection have been further extended to colorimetric, electrochemical, SERS¹, and fluorescent. Recently, Chemiluminescence-based aptasensors, PCR², Microring resonator and Electrochemical aptasensors have been used as highly sensitive methods for detecting and measuring AFBi concentrations. (13, 14)

[0006] Li's team developed a microfluidic system(15) using the LSPR property of conjugated gold and silver nanoparticles with dedicated antibody to measure AFBi, which, with the help of the smartphone, can analyze target concentration much like complex and expensive devices. Whereas earlier this work was partially designed on the lateral flow test strip(16, 17).

[0007] In 2018 Xiaojun et.al an electrochemical aptanano sensor based on tetrahedral-functionalized nano structured DNA with three-dimensional microbial film hybrid gold nanoparticles with molybdenum disulfide was designed to measure AFBi concentration. Quantitative detection of aflatoxin AFB 1 using electrochemical aptananosensor This invention is accomplished with easy application, high precision, high precision, high sensitivity, high specificity and stability, high repeatability and other advantages. This aptananosensor has three electrodes, the surface of which is modified by three-dimensional microbial porous film of hybrid gold nanoparticles with molybdenum disulfide. Tetrahedral DNA nanostructures were immunoblotted as specific aptamer carriers and cDNAs on the surface of the modified electrode. The HRP enzyme also functions as a magnetic signal amplifier. The aptamers are released from the electrode surface after reacting with AFB i and then form non-hybridized TDNs. The presence of more AFBI in the investigated sample, more Hl/HRP-AuNPs-Si0_2@Fe₃0₄, is combined with 3DOM MoS2-AuNPs on the surface. The current response to the reduction of HRP catalyzed by hydrogen peroxide (H2O2) using thionine (Thi) as electrochemical probe was commensurate with AFBi concentration. At optimum conditions, this sensor showed high specificity, with a good linear range of 0.1 to 1 pg/ml and a detection limit of 0.01 fg/ml. Has shown. This developed technology has been applied to detect AFBi content in rice and wheat flour samples and has achieved favorable results in accordance with the results of High Performance Liquid Chromatography Mass Spectrometry (HPLC-MS)(18, 19).

[0008] In 2019 Li et.al developed an aptasensor with an electrochemical optical mechanism using the resonance energy transfer phenomenon between Ce-Ti0₂ @ MoSe2 hetero structure and gold nanoparticle. The photoelectrochemical (PEC) aminated aptasensor is made by immobilizing a Ce- Ti02 @ MoSe2 composite on an ITO electrode(20).

[0009] In 2015, Liao et.al employed a specific aptamer of conjugated magnetic nanoparticles was able to isolate aflatoxin B1 from the sample matrix. Its components consist of three layers: (1) central layer containing paramagnetic Fe304 magnetic nanoparticles (2) A silanization layer has an epoxy functional group with reactive activity at the tail end that surrounds the nucleus. This sequence contains 5’-NH2-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3.(21).

[0010] Liu et.al selected the 5'-

CCTGCCACGCTCCGCAAGCTTATAGGGCACGTGTTGTCTTCCTGTGTCTCGTGCCCATCG CTAGGTTTACATAAGCTTGGCACCCGCATC GT-3 nucleotide sequence for the detection and isolation of aflatoxin B(22).

[0011] In 2019 Yang et.al designed highly sensitive aptasensor based on localized surface plasmon

resonance (LSPR) using intercalation agents such as berberine (BB), thioflavin T (TFT), crystal violet (CV), thiazole orange (TO), malachite green (MG) and Zn-PPix can detect and measure either ochratoxin A (OTA) or aflatoxin Bi (AFBi) from 1 pM to 10 mM. The use of gold rod

nanostructures has increased the sensitivity of the sensor. Silver or platinum nanoparticles can also be used in this sensor(23).

[0012]

Summary of Invention

Technical Problem

[0013] Foodborne illnesses have long been a major challenge for human society in the past. According to reports by the World Health Organization and the Centers for Disease Control and Prevention, annually more than 600 million people become infected after eating contaminated foods and Finally 3,000 people have died. Food contaminants are classified into two broad categories of biological and chemical agents(24). Among the natural chemical contaminants of food and feed, aflatoxin Bl is one of the most dangerous mycotoxins produced by Aspergillus flavus, Aspergillus parasitic, which can grow in moist environments and release aflatoxin Bl. The carcinogenic, hepatotoxic, teratogenic, and mutagenic effects of aflatoxins have been demonstrated. Aflatoxins may play a major role in 4.6-28.2% of total global hepatocellular carcinoma (HCC) cases(25).The study of the latest statistics of the prevalence of aflatoxin contamination in a variety of plant(26) and meat(27) foods, especially in developing countries, has highlighted the importance of rapid measurement of it by scientists and inventors around the world(26-32). Due to the challenges related to elimination of aflatoxin contamination(33), its rapid detection is very important. Common reference methods in the measurement and measurement of aflatoxins concentration are chromatography, immunochemistry and spectroscopy by various techniques(25, 34). These instruments and techniques are expensive and require a skilled and professional operator. It is also time consuming and limited to the laboratory for analysis, difficult extraction and purification of the sample, which poses major challenges for the use of this tool for common risk factors, especially in food. This mycotoxin is even known as a bioterrorism agent, which necessitates rapid, in-place evaluation by any amateur user of all foods(35). Solution to Problem

[0014] Aptamer, G-quadruplex: Aptamers are single- stranded nucleic acid sequences that have

advantages over other recognition elements because of their unique characteristics such as small size, rapid and inexpensive production process, low immunogenicity, and high chemical and thermal stability. It has made the molecules attractive in designing and manufacturing dedicated sensors for diagnostics and treatment with a new approach, quickly and economically(36-39). G-quadruplex - based aptamers can enhance the hemin peroxidation property after trapping the target molecule and ultimately increase the sensitivity of the detection(40, 41).

[0015] Nano: Nano-scale materials increase the loading capability of the indicator elements due to

increasing surface-to-volume ratios and ultimately increase the sensitivity of the biosensors. Hybrid nanostructures with nanoparticles (NPs) based on Au / Ag, carbon (CBNs), magnetic (MNPs), Quantum dots (QDs), up-conversion Metal-organic frameworks (UCNPs) and metal-organic frameworks (MOFs) have been widely used to identify and measure aflatoxin concentrations(42-44).

[0016] MNP: Among various nanomaterials, magnetic nanoparticles can be used in the food industry to identify and isolate pollutants due to their supermagenetic properties, as well as the ability to catalyze oxidation and color production reactions in the presence of chromogen substrates(45, 46).

[0017] SPR- Colorimetric- Smartphone: Nowadays, aptamers have been suggested as good substitutes for antibodies due to their specific advantages over other identifiable elements, but we still need equipment such as spectrophotometers in the laboratory to identify target biomarkers using aptamers. The use of hybrid nanomaterials with aptamers has been instrumental in generating and amplifying color and fluorescent signals, which we can detect and measure with smartphone surface plasmon resonance. Finally, it is possible to quickly evaluate the essential measurements required by using conjugated aptamers with magnetic nanoparticles at each location (16,35, 47-51).

Advantageous Effects of Invention

[0018] Most lateral flow test strips are specific to the antibody for the intended purpose, but the

antibody, despite its high cost, has low stability, which is a major drawback to these rapid detection kits. Recently, nucleic acid-based marker elements such as aptamers have been used as alternative candidates for antibodies in colorimetric tests. They can find specific folds by binding to their target molecule.

[0019] Meanwhile, peroxidase property of G-quadruplex structures can dramatically increase

sensitivity, accuracy, and ease of use for the amateur user of colorimetric sensors. [0020] The use of proprietary propellant conjugated with magnetic nanoparticles can provide more stability in addition to reducing the cost of the finished product and increasing the surface-to-volume ratio can dramatically increase the sensitivity. On the other hand, magnetic nanoparticles can also help detoxify and remove pollutants.

[0021] It can also be made available to anyone on a portable smartphone using an optical sensor based on a digital camera and Android app. Finally, the ease of rapid, reliable, and low-cost testing can greatly contribute to food safety and human health by controlling the use of this toxin, thereby reducing the risk of liver cancer and other disorders resulting from its unauthorized use.

[0022] Therefore, the cost of regular monitoring is drastically reduced and is very effective in promoting public health, given its rapid response and ease of analyzing its results for the public.

[0023] Citation List

[0024] 1. Sharif MK, Javed K, Nasir A. Foodborne illness: Threats and control. Foodbome

Diseases: Elsevier; 2018. p. 501-23.

[0025] 2. Farooq F, Ali U, Shoukat S, Paray AR, Ali M. Bacteriophages as biocontrol agents for foodborne diseases. 2019.

[0026] 3. Khera A. Surveillance of foodborne illnesses. Food Safety in the 21st Century: Elsevier;

2017. p. 41-51.

[0027] 4. Horn AL, Friedrich H. Locating the source of large-scale outbreaks of foodbome disease.

Journal of the Royal Society Interface. 2019; 16( 151):20180624.

[0028] 5. Waite H-G, Schwake-Anduschus C, Geisen R, Fritsche J. Aflatoxin: food chain transfer from feed to milk. Springer; 2016.

[0029] 6. Patial V, Asrani RK, Thakur M. Food-bome mycotoxicoses: pathologies and public

health impact. Foodbome Diseases: Elsevier; 2018. p. 239-74.

[0030] 7. Ali N. Aflatoxins in rice: Worldwide occurrence and public health perspectives.

Toxicology Reports. 2019;6: 1188.

[0031] 8. Thanushree M, Sailendri D, Yoha K, Moses J, Anandharamakrishnan C. Mycotoxin

contamination in food: an exposition on spices. Trends in Food Science & Technology. 2019. [0032] 9. Srivastava M, Srivastava N, Mishra D, Gupta VK, Mishra P, Hesham AE-L, et al.

Nanomaterials-Based Electrochemical Biosensors for Aflatoxin-Bl Detection: Application in Food Safety. Food Applications of Nanotechnology: CRC Press; 2019. p. 433-47.

[0033] 10. Rashidi L, Khosravi-Darani K. The applications of nanotechnology in food industry.

Critical reviews in food science and nutrition. 2011;51(8):723-30.

[0034] 11. Xia X, He Q, Dong Y, Deng R, Li J. Aptamer-based homogeneous analysis for food control. Curr Anal Chem. 2018.

[0035] 12. Rhouati A, Bulbul G, Latif U, Hayat A, Li Z-H, Marty JL. Nano-aptasensing in

mycotoxin analysis: Recent updates and progress. Toxins. 2017;9(11):349.

[0036] 13. Jia Y, Zhou G, Liu P, Li Z, Yu B. Recent Development of Aptamer Sensors for the

Quantification of Aflatoxin Bl. Applied Sciences. 2019;9(11):2364.

[0037] 14. Danesh NM, Bostan HB, Abnous K, Ramezani M, Youssefi K, Taghdisi SM, et al.

Ultrasensitive detection of aflatoxin Bl and its major metabolite aflatoxin Ml using aptasensors: A review. TrAC Trends in Analytical Chemistry. 2018;99:117-28.

[0038] 15. Li X, Yang F, Wong JX, Yu H-Z. Integrated smartphone-app-chip system for on-site parts-per-billion-level colorimetric quantitation of aflatoxins. Analytical chemistry.

2017;89(17):8908-16.

[0039] 16. Lee S, Kim G, Moon J. Performance improvement of the one-dot lateral flow

immunoassay for aflatoxin Bl by using a smartphone-based reading system. Sensors.

2013; 13(4):5109-16.

[0040] 17. XIAOLIANG LXYFYHZ, inventorRapid aflatoxin Bl detecting method based on

smartphone detecting system2016

[0041] 18. Peng G, Li X, Cui F, Qiu Q, Chen X, Huang H. Aflatoxin Bl Electrochemical

Aptasensor Based on Tetrahedral DNA Nanostructures Functionalized Three Dimensionally Ordered Macroporous MoS2-AuNPs Film. ACS applied materials & interfaces. 2018; 10(21): 17551-9.

[0042] 19. QIANYING CXCFHHLXPGQ, inventorElectrochemical aptamer sensor for

quantificationally detecting aflatoxin Bl and application thereof2018

[0043] 20. LIWEI LLLXTYY, inventorPhoto electrochemistry aptamer sensor construction method capable of taking energy resonance energy transfer between heterojunction and gold nanoparticle as mechanism2019. [0044] 21. LINGUANG LQL, inventorPreparation and application of aptamer-magnetic

nanoparticle used for enrichment and separation of aflatoxin B 12015.

[0045] 22. LING LJQYWHWJWJYHZJZLZ, inventorAflatoxin B1 nucleic acid aptamer and

application thereof in magnetic separation of sample2015.

[0046] 23. Kim M-G PJ-h, BYUN JY. , inventorLSPR-based high sensitivity aptamer sensor using intercalation agent. 2019.

[0047] 24. Cisse G. Food-bome and water-borne diseases under climate change in low-and middle- income countries: further efforts needed for reducing environmental health exposure risks. Acta tropica. 2019.

[0048] 25. Mahfuz M, Gazi MA, Hossain M, Islam MR, Fahim SM, Ahmed T. General and

advanced methods for the detection and measurement of aflatoxins and aflatoxin metabolites: a review. Toxin Reviews. 2018:1-15.

[0049] 26. Ismail A, Riaz M, Gong YY, Akhtar S, Sun J. Aflatoxins in Plant-Based Foods. Plant and Human Health, Volume 2. 2019:313.

[0050] 27. Thuita F, Tuitoek J, King'ori A, Obonyo M. Prevalence of aflatoxins contamination in commercial broiler feeds in Kenya. Livestock Research for Rural Development. 2019;31(1).

[0051] 28. Asare Bediako K, Dzidzienyo D, Ofori K, Offei S, Asibuo J, Adu Amoah R, et al.

Prevalence of fungi and aflatoxin contamination in stored groundnut in Ghana. 2019.

[0052] 29. Echodu R, Maxwell GM, Moriku JK, Ovuga E, Haesaert G. Prevalence of aflatoxin, ochratoxin and deoxynivalenol in cereal grains in northern Uganda: Implication for food safety and health. Toxicology reports. 2019;6:1012-7.

[0053] 30. Omotayo OP, Omotayo AO, Babalola OO, Mwanza M. Comparative study of aflatoxin contamination of winter and summer ginger from the North West Province of South Africa.

Toxicology reports. 2019.

[0054] 31. Mahfuz M, Alam MA, Fahim SM, Gazi MA, Raihan MJ, Hossain M, et al. Aflatoxin exposure in children living in Mirpur, Dhaka: data from MAL-ED companion study. Journal of exposure science & environmental epidemiology. 2019;29(5):655-62.

[0055] 32. Nabizadeh S, Shariatifar N, Shokoohi E, Shoeibi S, Gavahian M, Fakhri Y, et al.

Prevalence and probabilistic health risk assessment of aflatoxins B 1, B 2, G 1, and G 2 in Iranian edible oils. Environmental Science and Pollution Research. 2018;25(35):35562-70. [0056] 33. Singh S, Patel M, Thakker B, Barad A, Gogoi R, Hooda K. An overview of challenges and elimination of aflatoxin contamination in maize (Zea mays). Journal of Pharmacognosy and Phytochemistry. 2019;8(4):2895-906.

[0057] 34. Mahato DK, Lee KE, Kamle M, Devi S, Dewangan KN, Kumar P, et al. Aflatoxins in food and feed: An overview on prevalence, detection and control strategies. Frontiers in

microbiology. 2019; 10.

[0058] 35. Aydindogan E, Guler Celik E, Timur S. Based Analytical Methods for Smartphone

Sensing with Functional Nanoparticles: Bridges from Smart Surfaces to Global Health. ACS

Publications; 2018.

[0059] 36. Amaya-Gonzalez S, De-los-Santos-Alvarez N, Miranda-Ordieres AJ, Lobo-Castanon MJ.

Aptamer-based analysis: a promising alternative for food safety control. Sensors.

2013;13(12): 16292-311.

[0060] 37. Dong Y, Xu Y, Yong W, Chu X, Wang D. Aptamer and its potential applications for food safety. Critical reviews in food science and nutrition. 2014;54(12):1548-61.

[0061] 38. Liu X, Zhang X. Aptamer-based technology for food analysis. Applied biochemistry and biotechnology . 2015;175(l):603-24.

[0062] 39. Chang Y-C, Yang C-Y, Sun R-L, Cheng Y-F, Kao W-C, Yang P-C. Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles. Scientific reports. 2013;3: 1863.

[0063] 40. Platella C, Riccardi C, Montesarchio D, Roviello GN, Musumeci D. G-quadmplex -based aptamers against protein targets in therapy and diagnostics. Biochimica et Biophysica Acta (BBA)- General Subjects. 2017; 1861(5): 1429-47.

[0064] 41. Taghdisi SM, Danesh NM, Ramezani M, Abnous K. A new amplified fluorescent

aptasensor based on hairpin structure of G-quadmplex oligonucleotide- Aptamer chimera and silica nanoparticles for sensitive detection of aflatoxin B 1 in the grape juice. Food chemistry.

2018;268:342-6.

[0065] 42. Xue Z, Zhang Y, Yu W, Zhang J, Wang J, Wan F, et al. Recent advances in aflatoxin B1 detection based on nanotechnology and nanomaterials-A review. Analytica chimica acta. 2019. [0066] 43. Eivazzadeh-Keihan R, Pashazadeh P, Hejazi M, de la Guardia M, Mokhtarzadeh A.

Recent advances in nanomaterial-mediated bio and immune sensors for detection of aflatoxin in food products. TrAC Trends in Analytical Chemistry. 2017;87:112-28.

[0067] 44. Ragavan K, Neethirajan S. Nanoparticles as Biosensors for Food Quality and Safety Assessment. Nanomaterials for Food Applications: Elsevier; 2019. p. 147-202.

[0068] 45. Zhang K, Yue Y, Wu S, Fiu W, Shi J, Zhang Z. Rapid Capture and Nondestructive

Release of Extracellular Vesicles Using Aptamer-Based Magnetic Isolation. ACS sensors.

2019;4(5): 1245-51.

[0069] 46. Su Y, Shao C, Huang X, Qi J, Ge R, Guan H, et al. Extraction and detection of bisphenol A in human serum and urine by aptamer-functionalized magnetic nanoparticles. Analytical and bioanalytical chemistry. 2018;410(7): 1885-91.

[0070] 47. Lu Y, Shi Z, Liu Q. Smartphone-based Biosensors for Portable Food Evaluation. Current Opinion in Food Science. 2019.

[0071] 48. Jamalipour A, Hossain MA. Smartphone Instrumentations for Public Health Safety:

Springer; 2019.

[0072] 49. Cao Y, Liu Y, Li F, Guo S, Shui Y, Xue H, et al. Portable colorimetric detection of

copper ion in drinking water via red beet pigment and smartphone. Microchemical Journal.

2019;150:104176.

[0073] 50. Jamjamrus P, Meelapsom R, Pencharee S, Obma A, Amatatongchai M, Ditcharoen N, et al. Use of a smartphone as a colorimetric analyzer in paper-based devices for sensitive and selective determination of mercury in water samples. Analytical Sciences. 2018;34( l):75-81.

[0074] 51. Li Z, Li Z, Zhao D, Wen F, Jiang J, Xu D. Smartphone -based visualized microarray detection for multiplexed harmful substances in milk. Biosensors and Bioelectronics. 2017;87:874- 80.

[0075] Brief Description of Drawings

[0076] [Fig.l] Schematic of the strategy for detection of AFBi in this invention

[0077] [Fig.2] Modeling of the secondary structure of oligomer against AFBi in web software of RNA Structure

[0078] [Fig.3] Peroxidase activity of G-quadruplex aptamer with the presence and absence of AFBi [0079] [Fig.4] Evaluation of minimum aptamer concentration required for AFB1 measurement

[0080] [Fig.5] Peroxidase activity of G-quadruplex aptamer conjugated with magnetic nanoparticles for AFB1 measurement

[0081] Description of Embodiments

[0082] DNA oligoaptamer: biotin-5TGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG3', as a biotin-labelled G-quadruplex AFB 1 aptamer were synthesized by Bioneer, Korea. Streptavidin (fluidM AG- Strep tavidin) magnetic nanoparticles of lOOnm diameter size and a Magneto PURE- Micro separator were purchased from Chemicell (Germany). 3, 3_, 5, 5_ tetramethylbenzidine (TMB), hemin (Bioextra, from porcine), AFB1 from Libios Company and stop reagent for the TMB substrate were provided from Sigma, USA. Hemin stock solution was prepared in 1.4 M ammonium hydroxide(NH40H) (50 mg/ml) (purchased from Bio Idea Company, Tehran, Iran), stored in the dark at - 20°C and diluted to the required concentration with buffer solution (PBS (Phosphate- buffered saline) (pH 7.4) = 137 mM NaCl , 2.7 mM KC1, 10 mM Phosphate Buffer).

[0083] Prepare AFB1 G-quadruplex aptamers compound method to comprise the following steps:

[0084] (1) First spin the lyophilized aptamer, (2) then add 357.1 Landau volume of distilled water to its vial to obtain a concentration of 100 pmol/ul = 100 mM. (3) Then place the solution at room temperature for 2 to 5 minutes and (4) with Vertex and spin for 2 and 1 minutes respectively. (5) Put it at 95 ⁰ C for 5 minutes (inside the incubator) to denature unwanted secondary structures. Then we quickly put it in the ice rack for the reactions to avoid forming a secondary structure at ambient temperature and then diluting.

[0085] Fabrication of AFB 1 G-quadruplex aptamer arrays on magnetic nanoparticle to comprise the following steps: (1) 1.9 pM biotin-labelled G-rich aptamers were added to MNP (Streptavidin (fluidM AG- Streptavidin) magnetic nanoparticles); (2) incubated at 37°C for 10 min. (3) The mixture was placed in a Magneto PURE-Micro separator and (4) washed twice with 5mM PBS (lx) to remove additional aptamer molecules.

[0086] To perform the colorimetric detection reaction, the following steps are performed: (1) Add 3.125 to 25 nM serial dilutions of aflatoxin B to the base buffer of PBS; (2) add magnetic nanoparticles conjugated with the specific aptamer; (3)15 minutes incubated at room temperature to form aptamer- AFB1 complex with appropriate structure; (4) 1.5pl of ammonium hydroxide (NH40H) solution was added to the mixture, which was then stored for 15 minutes at room temperature. Were formed to form the AFBl-aptamer-hemin complexes; (5) 15 min incubation in incubator shaker; (6) 75 pi aliquot of TMB-H202 was added and incubated for 30 min at room temperature; (7) the

colorimetric changes were recorded in the wavelength range of 350-600nm using a ELISA reader.

[0087] Examples

Example 1: Studying internationally patents and articles, lists the sequences of specific investigated aptamers for the identification of AFB 1 target factor. Then, with the help of online software such as Mfold and RNA structure, performed the reaction-response modeling to select the most suitable specific aptamer (5' TGGGGTTTTGGTGGCGGGTGGTGTACGGGCGAGGG 3') with the highest affinity for target identification and binding. The effects of binding the biotin group to the 3 or 5 end of the oligonucleotide for folding are investigated. Finally, the oligonucleotide sequence is selected which, in addition to having the highest affinity for aflatoxin Bl, is capable of forming the G- quadruplex structure following the binding of the aptamer to the AFB 1 target.

[0088] Example 2: The enzymatic performance of the G-quadruplex structure formed following the binding of aptamer to AFB1 in the presence of Hemin and chromogen substrates such as 3, 3’, 5, 5’- Tetramethylbenzidine (TMB) at 450 nm is investigated using UV-VIS spectroscopy.

[0089] Example 3: biotin labeled specific aptamer against AFB1 that selected in the previous step

purchased from Bioneer Company. Streptavidin-coated magnetic nanoparticles were purchased as a suitable substrate for binding of Aptazyme sequences through the non-specific binding of biotin- streptavidin from Chemicell GmbH, Germany.

[0090] Example 4: Reaction mixes including base buffer, Hemin, TMB, Stop Reagent (H2S) and

specific oligonucleotides were performed once without AFB land once with AFB1 and compared.

[0091] Example 5: To ensure the enzymatic function of this structure formed after binding to AFB1, the peroxidation reaction was investigated in the presence of Hemin and a chromogen substrate such as TMB. To ensure no false positive response, the reaction was confirmed in the sample without the presence of aflatoxin but only with the presence of chromogenic substrates and hemin enzymatic activity. All absorbances were read in 450 nm by UV-Vis spectroscopy and analyzed.

[0092] Example 6: To determine the minimum G-quadruplex Aptamer concentration required to

determine the highest target identification (highest sensitivity), we examined different concentrations of specific oligonucleotides against the AFB1 in micro tube. A dedicated checker board chart with standard dilutions of AFB 1 determines the concentration of aptamer required for maximum detection.

[0093] Industrial Applicability [0094] Given the high likelihood of contamination of various vegetable grains such as almonds, walnuts and pistachios, as well as cereals such as rice, wheat and maize, which are predominant to aflatoxin, especially in humid climates, on the other hand contamination of livestock feed and transmission It can spread liver cancer and other acute complications through its metabolites in milk and meat products, by informing the public about the importance and side effects of this toxin through the Food and Drug Administration of the country's medical universities. Chronic and burden-reducing medical costs.

Claims

[Claim 1 ] [The invention provides a nanomolecular detection array for aflatoxin B1 in food samples.

[Claim 2] This nanomolecular detection system included the main parts as (1 ) biotin labeled aptamer against AFB1 , (2) streptavidin-coated magnetic nanoparticles, and (3) colorimetric detection using a photometer or ELISA- reader device.

[Claim 3] G-quadruples aptamer was checked and selected for detection of AFB1 using Mfold and RNA structure softwares.

[Claim 4] G-quadruples aptamer was attached to magnetic nanoparticles using streptavidin-biotin bounds.

[Claim 5] AFB1 was captured with Aptamer-MNP complex and that it was separated from the other molecules within washing via a magnetic separator. j