WO2020139999A1 - Pancreatic cancer treatment - Google Patents

Abstract

Methods and composition of treatment of pancreatic cancer are disclosed. Certain embodiments are directed to methods for treating pancreatic cancer comprising administering an effective amount of a composition comprising palmatine or palmatine derivatives to a patient that has cancer. In certain embodiments a chemotherapy agents is administered in combination with palmatine. Certain embodiments are directed to an anti-pancreatic cancer composition comprising palmatine and a chemotherapy agent.

Description

PANCREATIC CANCER TREATMENT

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application 62/785,965 filed December 28, 2018, which is incorporated herein by reference in its entirety.

STATEMENT REGARDING FEDERALLY FUNDED RESEARCH

[0002] This invention was made with government support under AT007448 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

A. Field of the Invention

[0003] Embodiments of this invention are directed generally to biology and medicine. Certain aspects are directed to a therapy for pancreatic cancer.

B. Description of Related Art

[0004] Late stage diagnosis and lack of early detection markers contribute to the near equal rates of pancreatic cancer incidence and mortality. Twenty percent (20%) of patients are eligible for surgical resection and 3 to 4% remain disease-free following surgical resection while about 80% will relapse and die of the disease (Ryan et ah, N Engl J Med., 2014). Gemcitabine (GEM)-monotherapy has been the standard of care for advanced pancreatic ductal adenocarcinoma (PD AC) for more than a decade although overall survival of patients on GEM is an average of 6 months. Therapeutic approaches based on combination of GEM with additional chemotherapy agents such as oxaliplatin, irinotecan, leucovorin and 5-FU (FOLFIRINOX™) have provided modest survival benefit with significant toxicity, and is reserved for a select group of patients (Sclafani et ah, CritRev Oncol Hematol., 2015). A barrier to improving therapeutic efficacy lies in part to the dense desmoplastic reaction (DR) in the tumor microenvironment (TME) that precludes effective drug delivery. Accordingly, targeting tumor- stromal interactions led to the approval of Nab-pae!itaxel (Abraxane™) that in combination with GEM marginally increased survival of pancreatic cancer patients from 6.7 to 8.5 months. In addition, one of the limitations of this combination is toxicity-associated effects. [0005] Therefore, there remains a need for additional therapies for treatment of pancreatic cancer.

SUMMARY OF THE INVENTION

[0006] Certain embodiments are directed to methods for treating pancreatic cancer comprising administering an effective amount of a composition comprising palmatine or palmatine derivatives to a patient that has cancer. As used herein, the term“derivative” refers to a compound that is chemically modified to form a derivative or variant compound wherein one or more atom or substituent is added or replaces an atom or substituent of the parent compound ( e.g ., palmatine) while maintaining the general structure of the parent compound. In certain aspects, the composition further comprises a pharmaceutically acceptable carrier. In certain aspects, the pancreatic cancer is advanced pancreatic ductal adenocarcinoma (PD AC).

[0007] In certain embodiments a chemotherapy agents is administered in combination with palmatine. In certain aspects the chemotherapy agent is gemcitabine, oxaliplatin, irinotecan, leucovorin or 5-FU (FOLFIRINOX). In certain particular aspects the chemotherapy agent is gemcitabine. In certain aspect, the chemotherapy agent is administered simultaneously or about 1, 2, 3, 4, 5, 6, 7, 8, 9 10, seconds, minutes, hours, days or weeks before or after administration of palmatine. In other aspects the chemotherapy agent is administered before; during; after; before and during; before and after; during and after; or before, during, and after administration of a palmatine or palmatine derivative composition.

[0008] Certain embodiments are directed to an anti-pancreatic cancer composition comprising palmatine and a chemotherapy agent. In certain aspect, the chemotherapy agent is gemcitabine, oxaliplatin, irinotecan, leucovorin, 5-FU (FOLFIRINOX) or combination thereof. In certain particular aspect, the chemotherapy agent is gemcitabine.

[0009] As used herein, an “inhibitor” can be any chemical compound, peptide, or polypeptide that can reduce the activity or function of a protein. An inhibitor, for example, can inhibit directly or indirectly the activity of a protein. Direct inhibition can be accomplished, for example, by binding to a protein and thereby preventing the protein from binding an intended target, such as a receptor, or by inhibiting an enzymatic or other activity of the protein, either competitively, non-competitively, or uncompetitively. Indirect inhibition can be accomplished, for example, by binding to a protein's intended target, such as a receptor or binding partner, thereby blocking or reducing activity of the protein. [0010] The term“effective amount” means an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result.

[0011] An“effective amount” of an anti-cancer agent in reference to decreasing cancer cell growth, means an amount capable of decreasing, to some extent, the growth of some cancer or tumor cells. The term includes an amount capable of invoking a growth inhibitory, cytostatic and/or cytotoxic effect and/or apoptosis of the cancer or tumor cells. An effective amount in reference to the treatment of cancer, means an amount capable of invoking one or more of the following effects: (1) inhibition, to some extent, of cancer or tumor growth, including slowing down growth or complete growth arrest; (2) reduction in the number of cancer or tumor cells; (3) reduction in tumor size; (4) inhibition (i.e., reduction, slowing down, or complete stopping) of cancer or tumor cell infiltration into peripheral organs; (5) inhibition (i.e. , reduction, slowing down, or complete stopping) of metastasis; (6) enhancement of anti-tumor immune response, which may, but is not required to, result in the regression or rejection of the tumor, or (7) relief, to some extent, of one or more symptoms associated with the cancer or tumor. The therapeutically effective amount may vary according to factors such as the disease state, age, sex and weight of the individual and the ability of one or more anti- cancer agents to elicit a desired response in the individual. An effective amount is also one in which any toxic or detrimental effects are outweighed by the therapeutically beneficial effects.

[0012] The phrases“treating cancer” and“treatment of cancer” or“treatment of pancreatic cancer” mean to decrease, reduce, or inhibit the replication of cancer cells; decrease, reduce or inhibit the spread (formation of metastases) of cancer; decrease tumor size; decrease the number of tumors (i.e., reduce tumor burden); lessen or reduce the number of cancerous cells in the body; prevent recurrence of cancer after surgical removal or other anti-cancer therapies; or ameliorate or alleviate the symptoms of the disease caused by the cancer.

[0013] Other embodiments of the invention are discussed throughout this application. Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well and vice versa. Each embodiment described herein is understood to be embodiments of the invention that are applicable to all aspects of the invention. It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the invention, and vice versa. [0014] The use of the word“a” or“an” when used in conjunction with the term“comprising” in the claims and/or the specification may mean“one,” but it is also consistent with the meaning of“one or more,”“at least one,” and“one or more than one.”

[0015] The term“about” or“approximately” are defined as being close to as understood by one of ordinary skill in the art. In one non-limiting embodiment the terms are defined to be within 10%, preferably within 5%, more preferably within 1%, and most preferably within 0.5%.

[0016] The term“substantially” and its variations are defined to include ranges within 10%, within 5%, within 1%, or within 0.5%.

[0017] The terms“wt. %,”“vol. %,” or“mol. %” refers to a weight, volume, or molar percentage of a component, respectively, based on the total weight, the total volume, or the total moles of material that includes the component. In a non-limiting example, 10 moles of component in 100 moles of the material is 10 mol. % of component.

[0018] The use of the term“or” in the claims is used to mean“and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and“and/or.”

[0019] As used in this specification and claim(s), the words“comprising” (and any form of comprising, such as“comprise” and“comprises”),“having” (and any form of having, such as “have” and“has”),“including” (and any form of including, such as“includes” and“include”) or“containing” (and any form of containing, such as“contains” and“contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0020] The compositions and methods of making and using the same of the present invention can“comprise,”“consist essentially of,” or“consist of’ particular ingredients, components, blends, method steps, etc., disclosed throughout the specification.

[0021] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

[0022] Any embodiment disclosed herein can be implemented or combined with any other embodiment disclosed herein, including aspects of embodiments for compounds can be combined and/or substituted and any and all compounds can be implemented in the context of any method described herein. Similarly, aspects of any method embodiment can be combined and/or substituted with any other method embodiment disclosed herein. Moreover, any method disclosed herein may be recited in the form of“use of a composition” for achieving the method. It is specifically contemplated that any limitation discussed with respect to one embodiment of the invention may apply to any other embodiment of the invention. Furthermore, any composition of the invention may be used in any method of the invention, and any method of the invention may be used to produce or to utilize any composition of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the specification embodiments presented herein.

[0024] FIG. 1A-L. Palmatine (PMT) modulates cellular homeostasis by inhibiting GLI, survivin, COL1A1 in human pancreatic stellate cells (PSCs). (A-B). Total RNA (A) and whole cell protein extracts (B) prepared from logarithmically growing human pancreatic stellate cells (PSCs) treated with 0, 75, or 150 pg/mL PMT for 24 and 48 h. (C.) Logarithmically growing PSCs were transfected with GLI-luciferase reporter (containing 8 GLI binding sites) and Renilla luciferase plasmids. Following 24 h transfection, cells were treated with 75 and 150 pg/mL PMT for additional 24 h and luciferase activity was measured. Firefly luciferase normalized to renilla luciferase is shown. (D-E). Total RNA (D) and whole cell protein extracts (E) prepared from logarithmically growing PSCs treated with 0, 75, or 150 pg/mL PMT for 24 and 48 h was used to analyze mRNA expression by Real-Time PCR and protein levels by immunoblot analysis of GLI downstream targets including IkBe, PTCH1 and COL1A1. b-actin was used as a loading control. (F). PSCs were transfected with scrambled or siRNA specific for GLI 1 or GLI2. 48 h after transfection, total RNA was prepared and used in Real-Time PCR to analyze expression changes of GLI1 and COL1A1. Data presented is an average + sd of three or more independent experiments conducted in triplicate. (G). Logarithmically growing PSCs were treated with increasing doses of PMT for 24 or 48 h and cell proliferation was measured using MTT assay as described in methods. Data presented is an average + sd of 2 independent experiments conducted in triplicate. (H). Logarithmically growing PSCs were treated with PMT (50 and 75 pg/mL) for 24 h. Following treatment, cells were washed and media replaced with no PMT. Cells were allowed to grow for 7-10 days and stained with crystal violet to monitor colony formation. Briefly, cells were seeded in 6-well plates at low density (500 cells per well). 24 h later cells were treated with PMT for 24 and 48 h. Following treatment with PMT, cells were washed with PBS and maintained for 7-10 days in complete media till colonies were formed. The colonies were fixed and stained with 1% methanol-crystal violet mixture. A representative picture of three independent experiments is shown. I-J. Total RNA (I) and whole cell protein extracts (J) prepared from logarithmically growing PSCs treated with 0, 75, or 150 pg/mL PMT for 24 h was used to analyze Survivin mRNA expression by Real-Time PCR and protein levels by immunoblot analysis b-actin was used as a loading control. (K). Whole cell protein extracts prepared from logarithmically growing PSCs treated with 0, 75, or 150 pg/mL PMT for 24 h in the absence or presence of 5 pM chloroquine (CQ) was used to analyze levels of LC3, p62 and cleaved PARP by immunoblot analysis b-actin was used as a loading control. (L). For cell invasion assay, 50,000 PSCs resuspended in serum- free media with or without PMT was added in triplicate to the top chamber of the invasion assay assembly. 150 pi of serum containing media was added to the lower chamber. The plate was incubated at 37 °C overnight. Following 24 h incubation, cells that had migrated to the bottom were lysed using detachment buffer and fluorescence was detected with a fluorescence plate reader. Data presented is an average + sd of three independent experiments conducted in triplicate. Statistical significance was evaluated using student t-test and p values < .05 was considered significant (* = p < .05, ** = p < .001). Western blots shown are representative blot of three independent immunoblot images. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.) Source of antibodies are as follows: GLI2, PATCHED 1 (Santa Cruz Biotechnology, Santa Cruz, CA), IKBKE, Survivin, LC3B (Cell Signaling Technology, Beverly MA), p62 (Enzo life Science, Farmingdale, NY), and GLI1 (Thermo Fisher Scientific, Rockford, IL). Odyssey® Infrared Imaging System was used for detecting GLI2 and PTCH1 and IRDye® 800CW and IRDye® 680rd conjugated secondary antibodies (LI-COR Biotechnology, Lincoln, NE) were used. Other proteins were developed using chemiluminescence as previously described. Forward (F) and reverse (R) primer sequences used are: 1. GLI (F- CTGGATCGGATAGGTGGTCT (SEQ ID NO: l) and R-

CAGAGGTTGGGAGGTAAGGA (SEQ ID NO:2))

2. GL2 (F-GCCCTTCCTGAAAAGAAGAC (SEQ ID NOG) and R-

CATTGGAGAAACAGGATTGG (SEQ ID NO:4)

3. PTCH1 (F- TGACCTAGTCAGGCTGGAAG (SEQ ID NOG) and R-

GAAGGAGATTATCCCCCTGA (SEQ ID NO:6))

4. COL1A1 (F- AACATGACCAAAAACCAAAAGTG (SEQ ID NOG) and R-

CATTGTTTCCTGTGTCTTCTGG (SEQ ID NO: 8))

5. GAPDH (F- ACCCACTCCTCCACCTTG (SEQ ID NO:9) and R-

CTCTTGTGCTCTTGCTGGG SEQ ID NO: 10)

6. IKBKE Taqman probe HS0106385

7. Survivin Taqman probe Hs0015335

8. GAPDH Taqman probe Hs02758991

[0025] FIG. 2A-G. Palmatine (PMT) inhibits growth of human pancreatic cancer cells through modulation of autophagy. (A-C). Logarithmically growing HPNE (n = 3), HPNE-Ras (n = 2), MIA PaCa-2 (n = 3), and PANC-1 (n = 3) were treated with increasing doses of PMT for 24 and/or 48 h and cell proliferation was measured using MTT assay as described in methods. Data presented is an average + sd of 2-3 independent experiments conducted in triplicate. (D-E). Whole cell protein extracts prepared from logarithmically growing human MIA PaCa-2 (30 h), and PANC-1 (48 h) cells treated with 0, 75, or 150 pg/mL PMT was used to analyze GLI2, PTCH1, Survivin, Cleaved PARP by immunoblot analysis b-actin was used as a loading control. Quantification of changes in survivin expression is shown in E. (F-G). Whole cell protein extracts prepared from logarithmically growing MIA PaCa-2, and PANC-1 cells treated with 0, 75, or 150 pg/mL PMT for 48 h in the absence or presence of 5 pM chloroquine (CQ) to measure autophagic flux. Levels of LC3 and p62 as a measure of autophagy and cleaved PARP as a measure of apoptosis were analyzed using immunoblot analysis (F). b-actin was used as a loading control in immunoblot analysis. Cell viability using trypan blue exclusion assay is shown (G). Data presented is an average ± sd of three independent experiments conducted in triplicate. Statistical significance of the data presented is evaluated using student t-test and p values < .05 was considered significant (* = p < .05, ** = p < .001). Western blots shown are representative blot from three independent immunoblot images. [0026] FIG. 3A-F. Palmatine (PMT) inhibits stellate-cancer cell communication. (A-D). Conditioned media (CM) generated from PSCs increases migratory ability of pancreatic cancer cells MIA PaCa-2 and PANC-1 cells (A and B) while CM generated from PSCs treated with Palmatine (PMT) reduces their migratory ability (C and D) as evidenced by wound scratch assay. PSCs with 70% confluency were used for generation of CM. The media was then replaced with serum free media containing 25 mM glucose and cells were incubated for 48 h. The supernatant centrifuged for 10 min at 10,000 G to remove debris and stored at -80 °C until use as CM. Serum free CM was used for wound scratch assays. PMT conditioned media (PMT CM) was generated by treating PSCs with PMT in media containing 10% FBS. For wound scratch assays, following attachment of cells, a scratch was made using a 200-pl tip. The wells were then rinsed with PBS and fresh media containing PMT was added. Cells were incubated for 20-24 h and monitored for gap closure using a Zeiss Primo Vert microscope attached to a Sony Camera. Images captured were scanned and distance migrated was measured by a ruler. Percent migration was calculated based on distance migrated by untreated cells, which was set at 100%. Data presented is an average ± sd of 3 independent experiments conducted in triplicate. (E-F). Whole cell protein extracts prepared from MIA PaCa-2, and PANC-1 cells growing with CM generated from PSCs (left panel (E) and (F)) or CM generated from PSCs treated with PMT (75, or 150 pg/mL) for 24 and 48 h was used to analyze protein levels of SNAIL and b-catenin by immunoblot analysis b-actin was used as a loading control. All data presented was derived from three individual experiments. WB images are representative images. (* = p < .05).

[0027] FIG. 4A-B. Identification of glutamine and glucose as secretory factors involved in stellate cancer cell communication. Heat maps and representative box plots of secretory (A) and intracellular (B) metabolites. In the heat map, numerical values indicate relative fold change for the given comparison. Red (p < .05) boxes represent significantly increased biochemicals. Green (p < .05) boxes represent significantly decreased biochemicals. Pink and light green boxes represent biochemicals that are trending (.05 < p < .10) up or down, respectively.

[0028] FIG. 5A-E. Palmatine (PMT) inhibits Glutamine mediated effects in MIA-PaCa-2 cells derived from primary tumor and CFPaC- 1 cells derived from liver metastasis. (A-B). Box plots are used to convey the spread of the three key metabolites (a-ketoglutarate, glutamine and glutamate) with the middle 50% of the data represented by the shaded boxes and the whiskers reporting the range of the data. The solid bar across the box represents the median value of those measured while the + is the mean. Data are scaled such that the median value measured across all samples was set to 1.0. Any outliers are shown as dots outside the whiskers of the plot. Panel (A) and (B) represents secretory and intracellular metabolites respectively. (C-D). Logarithmically growing MIA PaCa-2 cells were treated with 10 mM glucose (GLC) or 2 mM glutamine alone (GLN) or in combination was used to determine proliferative (C) and migratory (D) ability following 24 and 48 h incubation. Data presented is an average + sd of 3 independent experiments conducted in triplicate. (E). Whole cell extracts prepared from MIA PaCa-2 cells treated with 10 mM glucose (GLC) or 2 mM glutamine alone (GLN) or their combination for 24 and 48 h. Changes in levels of GLI1, GLI2, SNAIL and Survivin were determined by immunoblot analysis b-actin was used as a loading control.

[0029] FIG. 6A-C. Palmatine (PMT) inhibits Glutamine mediated effects in MIA-PaCa-2 cells. (A). Logarithmically growing MIA PaCa-2 cells were treated with 10 mM glucose (GLC) or 2 mM glutamine alone (GLN) or their combination in the presence and absence of PMT (50 and 75 pg/mL). 24 and 48 h after treatment, whole cell extracts were prepared to analyze changes in levels of GLI1, GLI2, SNAIL and Survivin by immunoblot analysis b-actin was used as a loading control. All data presented was derived from three individual experiments. WB images are representative images. (* = p < .05). (B). Logarithmically growing MIA PaCa- 2 cells were treated with 10 mM glucose (GLC) or 2 mM glutamine alone (GLN) or their combination in the presence and absence of PMT (50 and 75 pg/mL). MTT assay was used to determine proliferation. Data presented is an average ± sd of 3 independent experiments conducted in triplicate. All data presented was derived from three individual experiments. WB images are representative images. (* = p < .05). (C). Logarithmically growing CFPaC-1 cells were treated with 10 mM glucose (GLC) or 2 mM glutamine alone (GLN) or their combination in the presence and absence of PMT (50 and 75 pg/mL). MTT assay was used to determine proliferation. Data presented is an average ± sd of 3 independent experiments conducted in triplicate. All data presented was derived from three individual experiments. WB images are representative images. (* = p < .05).

[0030] FIG. 7A-D. PMT potentiates gemcitabine (GEM) activity in PSCs and MIA PaCa-2 cells. (A-B). PMT potentiates GEM-mediated growth inhibition in PSCs (A) and in MIA PCa- 2 (B) cells. Respective cells were treated with increasing concentrations of PMT (0, 25, 50, 75 and 100 pg/mL), Gemcitabine (GEM; 0, 0.05, 0.1, 0.25, 0.5 pM), or a combination of both PMT and GEM. 24 h later, cell proliferation was measured using MTT assay. Combination index analysis was used to calculate combinatorial growth inhibitory activity essentially as described in methods. A representative Cl data from three independent experiments for each cell line conducted in triplicate is shown. (C_. PMT alone inhibits proliferation of PANC-1 cells but does not potentiate Gemcitabine (GEM) activity. Experimental details are essentially similar to panel A. (D). Logarithmically growing PSCs were treated with 25 pg/mL PMT alone, 0.1 mM GEM or combination of both PMT and GEM (doses that ware synergistic). 24 h later whole cell extracts were prepared and examined for changes in COL1A1 and Survivin proteins by immunoblot analysis b-actin was used as a loading control. A representative immunoblot from three independent experiments is shown.

[0031] FIG. 8. Hypothetical model. In the tumor microenvironment glutamine secreted from stellate cells activates cancer cell survival possibly by up regulating Survivin. Glutamine also up regulates COL1A1 transcriptionally via GLI in stellate cells leading to collagen accumulation. Palmatine inhibits GLI/COLl A 1 in stellate cells and Survivin in cancer cells. Further, palmatine inhibits glutamine mediated stellate-cancer cell communication. These events possibly contribute to growth inhibition and sensitivity to gemcitabine. Pink circles represent glutamine.

[0032] FIG. 9A-J Levels of markers (A-H) and effects (I-J) in PSC exposed to various amounts of PMT.

[0033] FIG. 10A-D. (A-D) Levels of markers and effects in MIA PaCa-2 and PANC-1 cells exposed to various amounts of PMT.

[0034] FIG. 11 A-E. Levels of markers (A-C) and effects (D-E) in MIA PaCa-2 and PANC-

1 cells exposed to various amounts of PMT.

[0035] FIG. 12A-D. (A-D) Effects in MIA PaCa-2 and PANC-1 cell migration assay when exposed to PMT.

[0036] FIG. 13A-B. (A-B) illustration of metabolome analysis.

[0037] FIG. 14A-B. Cell migration (A) and biomarker effects (B) due to GLC and/or GLN.

[0038] FIG. 15. PMT effects on various biomarkers. [0039] FIG. 16A-D. (A-D) Effects of PMT and GEM alone and in combination.

[0040] FIG. 17A-C. PMT treatment decreases PDAC tumor weight with no significant change in body weight in CaPan-2 orthotopic tumors. 4-6 week old nude mice were orthtopically implanted with Capan-2 cells. Following implantation mice were randomized in to 3 groups each of 13-15. Three groups of mice received escalating doses of PMT (0, 50 and 300 mg/kg). (A). Body weight changes during the study. (B). Detection of palpable tumors. (C). Average pancreas tumor weight. Representative pancreas or tumor is shown below the graph.

[0041] FIG. 18. STAT3 dimer bound to DNA. The four identified binding sites are highlighted with circles.

[0042] FIG. 19A-B. Predicted binding poses of PMT to STAT3. PMT shown in green ball- n-sticks. (A). PMT bound to site3. Its location overlaps with pTyr705 (shown in pink sticks). (B). PMT bound to site4 in the linker domain. A cavity provides extensive interactions with polycyclic core of PMT and causes steric clash with DNA phosphate backbone.

[0043] FIG. 20A-C. (A) Logarithmically growing MIA PaCa-2 were transfected with Survivin reporter plasmid along with Renilla luciferase using standard protocols. 24h after transfection cells were treated with or without PMT (75 mg/ml) for 6h and luciferase activity was measured. Normalized luciferase activity (average+sd) of three independent experiments is shown; (B) Immunoblot analysis of total and pStat3 in extracts prepared from MIA PaCa-2 cells treated with increasing doses of PMT for 24h. b-actin was used as loading control; (C) Protein levels of survivin and cleaved PARP (bottom) following treatment with increasing concentrations of PMT (50 and 75 mg/ml) for 30h.

[0044] FIG. 21A-C. (A) PMT, (B) #26 (Straital B) and (C) GEM single treatment in different cell lines.

DETAILED DESCRIPTION OF THE INVENTION

[0045] Embodiments of the current disclosure provides novel cancer therapies for treating pancreatic cancer.

[0046] Palmatine has the chemical structure of formula I.

[0047] Palmatine (PMT) is protoberberine alkaloid commonly found in plants such as Berberis Aristata, Tinospora cordifolia and Phellodendron amurense. PMT has reasonable “drug-like" physical and chemical properties including molecular mass below 500 Daltons and topological polar surface area (tPSA) PMT also has a favorable number of hydrogen bond donors and acceptors (HBA and HBO). The charged nature decreases the logP to -1.08, however based on the PK data, PMT has a reasonable rate of absorption and bioavailability. The compound shows good metabolic and chemical stability and PK with half-life of 12h. Overall. PMT follows several of the criteria in Lipinskrs 5 rule suggesting that it could be developed as an oral drug.

[0048] The inventors have found that PMT can inhibit multiple pancreatic cancer hallmarks including but not limited to inhibition of proliferation, fibrosis, migration, invasion, autophagic cell survival, inflammation, interaction between stromal and cancer cells in tumor microenvironment and can restore anti tumor immune function. PMT alone or combination with gemcitabine or other chemotherapies results in inhibition of growth of pancreatic stellate cells and pancreatic cancer cells. In particular PMT potentiates gemcitabine activity.

[0049] PMT receiving animals implanted with pancreatic cancer cells showed reduced tumor growth and fibrosis (as evidenced by decreased trichrome staining and a-SMA levels) relative to animals not receiving PMT. Importantly, PMT inhibited growth of primary cells isolated from pancreatic tumor specimens from patients undergoing surgical resection (PDEX). PMT -based combination regimen increases therapeutic efficacy by decreasing tumor- associated fibrosis and restoring anti-tumor immune function. It was observed PMT-related compound inhibits growth of pancreatic cancer cells at much lower doses. [0050] A dense stroma or desmoplastic reaction (DR) in the tumor microenvironment (TME) plays a critical role in tumor maintenance and in limiting therapeutic efficacy by decreasing drug delivery (Feig et ah, Clin Cancer Res., 2012; Duner et ah, Pancreatology. 2010). This constitutes about 90% of the tumor area and is comprised of a variety of cells including stellate cells (PSCs), fibroblasts, endothelial cells, myeloid cells, and extracellular matrix (ECM) components such as collagens (Apte et ah, Curr Opin Gastroenterol ., 2015). PSCs, considered to be the driver of pancreatic fibrosis, are usually quiescent in the normal pancreas, but can be activated by a number of factors including inflammation. Once activated, these cells exhibit a myofibroblastic phenotype including expression of alpha smooth muscle actin (a-SMA), and collagen 1 type 1 alpha 1 (COL1A1) (Masamune et al., Gut, 2009). Pancreatic cancer cells (PCCs) also activate PSCs in a paracrine fashion by secreting a variety of cytokines and growth factors including Sonic hedgehog (SHH). Such paracrine interactions between PSCs and PCCs promote tumor progression by regulating a plethora of oncogenic processes including proliferation, migration, invasion and apoptosis of cancer cells [Vonlaufen et al., Cancer Res., 2008; Bachem et al., Gastroenterology, 2005; Yoshida et al., Cancer, 2005; Bailey et al., Clin Cancer Res., 2008).

[0051] Given the importance of DR in tumor progression and therapeutic resistance, the inventors have developed a strategy for pancreatic cancer (e.g., PD AC) treatment using agents that inhibit growth of activated PSCs and PCCs as well as their synergistic interactions in the TME.

[0052] One reason for the high mortality of PD AC and development of GEM resistance could be that most therapeutic strategies are focused on targeting tumor cells alone. As demonstrated herein, PMT inhibits growth of PSCs, PCCs and PSC-PCC interaction in vitro models. Suppressing COL1A1 with the novel hydrophilic agent, PMT, not only inhibits growth of PSCs but also potentiates GEM activity synergistically. PMT treatment affects cell fate by inhibiting growth of pancreatic cancer cells through downregulation of survivin and induction of apoptosis. Remarkably, PMT treatment potentiates GEM-induced growth inhibition in PCCs and inhibits growth of GEM-resistant PCCs. PMT can inhibit GLI mediated activation of COL1A1 and survivin to suppress proliferation and invasion while enhancing sensitivity to GEM. Alternatively, PMT can inhibit PCC-mediated reprogramming of PSCs to secrete glutamine into the extracellular environment thereby preventing PSC-PCC interaction. Experiments using conditioned media and inhibitory effects of PMT on the frequency of colony formation support the possibility that PMT inhibits PSC-PCC interactions (FIG. 8). PSC- secreted COL1A1 can promote invasion and migration of pancreatic cancer cells (Ikenaga et ah, PLoS One, 2012; Lu et ah, Br J Cancer, 2014; Duan et ah, Curr Cancer Drug Targets, 2014). COL1A1 has also been shown to induce SNAIL and GLI signaling in PCCs (Duan et al., Curr Cancer Drug Targets, 2014; Shields et al., J Biol Chem., 2011). Pancreatic cancer cells cultured on organotypic gels consisting of COL1A1, matrigel and stromal cells showed increased expression of b-catenin (Froeling et al., Am J Pathol., 2009). The association between survivin and poor prognosis in pancreatic cancer patients is well established and survivin inhibition is known to promote apoptosis and enhance GEM sensitivity (Han et al., Apoptosis, 2016; Dong et al., World J Surg Oncol. , 2015). Surprisingly evidence for induction of apoptosis was not observed despite downregulation of survivin in response to PMT suggesting a role that is independent of apoptosis induction. It is noteworthy to mention that silencing survivin along with XIAP caused partial mesenchymal epithelial transition and enhanced sensitivity to GEM in PANC-1 cells (Yi et al., Mol Med Rep., 2015). Increased SNAIL and b-catenin expression in pancreatic tumors was positively associated with lymph node invasion and distant metastasis (Yin et al., J Surg Res., 2007). Accordingly, it is possible that by down regulating survivin, PMT may influence EMT in PSCs. Given the reports showing that carbon and nitrogen from glutamate can be used to produce proline, which plays a key role in the production of extracellular matrix protein, collagen, PMT possibly suppresses COL1A1 via glutamine (Altman et al., Nat Rev Cancer, 2016). Recently, it was shown that PSC-derived alanine functions as an alternative carbon source to support cancer cell growth in the tumor microenvironment (Sousa et al., Nature, 2016). Observation that glutamine facilitates interaction between PSC-PCC is consistent with these published findings. Results presented in the current disclosure also demonstrate that PMT augments GEM-induced growth inhibitory activity in PSCs, PCCs and inhibited growth of inherently GEM resistant pancreatic cancer cells. These findings strongly suggest that PMT alone or in combination with GEM may be beneficial in the clinical management of PD AC.

Treatments

[0053] Some embodiments of the present invention concern methods of treating a patient. The patient may have pancreatic cancer. In certain aspect pancreatic cancer is advanced pancreatic ductal adenocarcinoma. [0054] The term“cancer” as referred to herein relates to any neoplastic disease which is characterized by abnormal and uncontrolled cell division causing malignant growth or tumor. Cancer cells, unlike benign tumor cells, exhibit the properties of invasion and metastasis and are highly anaplastic. In some embodiments, said cancer is a solid tumor ( i.e ., essentially solid neoplasmic growth, with low liquid content that is other than a cyst) or tumor metastasis {i.e., at its metastatic stage of disease).

[0055] Treatments and method of treating include administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition. For example, a pharmaceutical composition that includes palmatine or palmatine derivate may be administered to a subject having pancreatic cancer.

[0056] Therapeutic benefit or therapeutically effective includes anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease.

Routes of Administration and Formulations

[0057] Administration of compositions comprising palmatine or palmatine derivative can be by any number of routes including, but not limited to oral, intravenous, intramuscular, intra arterial, intramedullary, intrathecal, intraventricular, intradermal, intratracheal, intravesicle, intraocular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.). In certain embodiments, palmatine or a palmatine derivative is formulated for oral administration.

[0058] Where clinical applications are contemplated, pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.

[0059] One will generally desire to employ appropriate salts and buffers to render delivery formulations stable and allow for uptake by target cells. Aqueous compositions of the present invention can comprise an effective amount of the compound(s), dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The phrase "pharmaceutically” or “pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, "pharmaceutically acceptable carrier" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients of the present invention, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions, provided they do not inactivate the other active ingredients of the compositions.

[0060] The active compositions of the present invention can include classic pharmaceutical preparations. Administration of these compositions according to the present invention may be via any common route so long as the target tissue is available via that route. This includes oral, nasal, or buccal. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into cardiac tissue. Such compositions would normally be administered as pharmaceutically acceptable compositions, as described supra.

[0061] The active compounds can also be administered parenterally or intraperitoneally. By way of illustration, solutions of the active compounds as free -base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally contain a preservative to prevent the growth of microorganisms.

[0062] The pharmaceutical forms suitable for injectable use can include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that easy injectability exists. Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial an antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum mono stearate and gelatin.

[0063] For oral administration the compounds of the present invention generally may be incorporated with excipients and used in the form of ingestible tablet, pill, capsule, etc.

[0064] The compositions of the present invention generally may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts include, for example, acid addition salts derived from inorganic acids (e.g. , hydrochloric or phosphoric acids), or from organic acids (e.g. , acetic, oxalic, tartaric, mandelic, and the like). Salts formed with can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine and the like).

[0065] Upon formulation, solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure. By way of illustration, a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.

[0066] Another aspect of this invention provides methods of treating patients by delivering the pharmaceutical compositions set forth herein as a controlled release formulation. As used herein, the terms "controlled," "extended," "sustained," or “prolonged” release of the composition of the present invention will collectively be referred to herein as“controlled release," and includes continuous or discontinuous, and linear or non-linear release of the composition of the present invention. There are many advantages for a controlled release formulation of palmatine.

[0067] Tablets - A non-limiting controlled release tablet suitable for purposes of this invention is disclosed in U.S. Patent No. 5,126,145, which is incorporated by reference herein. This tablet comprises, in admixture, about 5-30% high viscosity hydroxypropyl methyl cellulose, about 2-15% of a water-soluble pharmaceutical binder, about 2-20% of a hydrophobic component such as a waxy material, e.g., a fatty acid, and about 30-90% active ingredient.

[0068] Medical Devices - Another embodiment contemplates the incorporation of palmatine or a composition comprising palmatine as set forth herein into a medical device that is then positioned to a desired target location within the body, whereupon the palmatine elutes from the medical device. As used herein, "medical device" refers to a device that is introduced temporarily or permanently into a mammal for the prophylaxis or therapy of a medical condition. These devices include any that are introduced subcutaneously, percutaneously or surgically to rest within an organ, tissue or lumen. Medical devices include, but are not limited to, stents, synthetic grafts, artificial heart valves, artificial hearts and fixtures to connect the prosthetic organ to the vascular circulation, venous valves, abdominal aortic aneurysm (AAA) grafts, inferior venal caval filters, catheters including permanent drug infusion catheters, embolic coils, embolic materials used in vascular embolization (e.g., PVA foams), mesh repair materials, a Dracon vascular particle orthopedic metallic plates, rods and screws and vascular sutures.

[0069] The amount of palmatine or palmatine derivative or composition comprising palmatine that is administered to a subject can be about, at least about, or at most about 0.1,

0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,

78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480,

490, 500 mg of total palmatine or palmatine derivative, or any range derivable therein. Alternatively, the amount administered may be about, at least about, or at most about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07,

0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7. 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,

22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,

47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,

72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,

97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500 mg/kg of palmatine, or any range derivable therein, with respect to the weight of the subject.

[0070] When provided in a discrete amount, each intake of palmatine or palmatine derivative or composition comprising palmatine can be considered a“dose.” A medical practitioner may prescribe or administer multiple doses over a particular time course (treatment regimen) or indefinitely.

[0071] The pharmaceutical composition may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, or more times or any range derivable therein. It is further contemplated that palmatine may be taken for an indefinite period of time or for as long as the patient exhibits symptoms of the medical condition for which the therapeutic agent was prescribed. Also, palmatine may be administered every 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, or 1, 2, 3, 4, 5, 6, 7 days, or 1, 2, 3, 4, 5 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months or more, or any range derivable therein. Alternatively, it may be administered systemically over any such period of time and be extended beyond more than a year. Other Therapeutic Options

[0072] In certain embodiments, it is envisioned to use palmatine in combination with other therapeutic modalities. In certain aspects palmatine can be combined or co-administered with any of a variety chemotherapeutic agents. In certain aspects, the chemotherapeutic agent is gemcitabine, oxaliplatin, irinotecan, leucovorin, 5-FU (FOLFIRINOX) or combination thereof. In certain particular aspect palmatine is administered in combination with gemcitabine.

[0073] The amount of chemotherapeutic ( e.g ., gemcitabine or composition comprising gemcitabine) that is administered to a subject can be about, at least about, or at most about 0.1,

0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77,

78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480,

490, 500 mg of total gemcitabine, or any range derivable therein. Alternatively, the amount administered may be about, at least about, or at most about 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4,

0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7. 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,

81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500 mg/kg of gemcitabine, or any range derivable therein, with respect to the weight of the subject.

[0074] Combinations may be achieved by administering to a subject, a single composition or pharmacological formulation that includes both agents, or by administering two distinct compositions or formulations, at the same time, wherein one composition includes palmatine and the other includes the other agent. Alternatively, the therapy using palmatine may precede or follow administration of the other agent(s) by intervals ranging from minutes to weeks. [0075] It also is conceivable that more than one administration of either palmatine, or the other agent will be desired. In this regard, various combinations may be employed. By way of illustration, where the palmatine is "A" and the other agent is "B", the following permutations based on 3 and 4 total administrations are exemplary:

A/B/A, B/A/B, B/B/A, A/A/B, B/A/A, A/B/B, B/B/B/A, B/B/A/B, A/A/B/B, A/B/A/B, A/B/B/A, B/B/A/A, B/A/B/A, B/A/A/B, B/B/B/A, A/A/A/B, B/A/A/A, A/B/A/A, A/A/B/A, A/B/B/B, B/A/B/B, B/B/A/B, or other combinations are likewise contemplated.

EXAMPLES

[0076] The following examples as well as the figures are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples or figures represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1 - Palmatine suppresses glutamine-mediated interaction between pancreatic cancer and stellate cells through simultaneous inhibition of survivin and COL1A1

A. Results

[0077] Palmatine inhibits sonic hedgehog pathway and growth of pancreatic stellate cells. Palmatine (PMT) has been identified as a hydrophilic compound with potential with antitumorigenic activity (Hambright et al, Mol Carcinog. 2015; Muralimanoharan et ah, Prostate, 2009). PMT is one of the biologically active components of Nexrutine® which was reported to reduce fibrosis in an inflammation-driven pancreatic cancer mouse model (BK5- Cox-2) (Gong et ah, Clin Cancer Res., 2014). Since Hh signaling is active in both stroma and tumor cells and because GLI plays an important role in tumor-stromal interaction, effect of PMT on the expression of Hh effector molecules, GLI1 and GLI2 was examined. GLI reporter activity and downstream targets including COL1A1, which is involved in collagen deposition and plays a critical role in aggressive behavior of PD AC was also examined. PMT treatment (48 h) decreased the expression and protein levels of GLI1 and GLI2 in PSCs (FIG. 1A and B and protein levels of GLI1 and GLI2 in PSCs; quantification data shown in FIG. 9A and B). A decrease in GLI reporter activity was also seen in response to PMT treatment (FIG. 1C). PMT- mediated decreased reporter activity was reflected by the decrease in message and protein levels of downstream targets: PTCH1 (patched 1), IKBKE (inhibitor of nuclear factor kappa-B kinase subunit epsilon) and COL1A1 (collagen type 1 alpha 1 chain; FIGs. ID and E; quantification data shown in FIG. 9C-E). Inhibition of GLI1 and GLI2 using RNAi inhibited COL1A1 message suggesting that PMT reduces COL1A1 via GLI (FIG. IF). These results taken together suggest that PMT inhibits SHH pathway in PSCs. To determine the biological significance of these observations the effect of PMT on cellular homeostasis was determined by assessing growth, apoptosis, autophagy and invasive potential in PSCs. PMT caused dose- dependent decreases in proliferation and colony forming ability (measured by clonogenic survival assays) in PSCs with -IC50 of 75 pg/mL (FIGs. 1G and H). Treatment with PMT significantly reduced mRNA expression and protein levels of survivin (FIGs. II and 1J). Despite decreased levels and expression of survivin, changes in apoptosis was not observed as determined by PARP cleavage or Annexin V staining under these experimental conditions (FIG. IK and FIG. 9F). It is well established that tumors grow in severe hypoxic, nutrient deprived microenvironments and show elevated levels of autophagy (Ackerman et ah, Trends Cell Biol., 2014). Since there was no significant change in apoptotic cells, it was reasoned that PMT might use autophagy to regulate PSC growth. Changes in cell survival and turnover of LC3BII following PMT treatment in the presence and absence of chloroquine (CQ) was determined. Analysis of these data showed a marginal yet significant decrease in LC3BII turnover suggesting that it is not delivered to lysosome for degradation resulting in decreased autophagy in the presence of PMT (FIG. IK, FIG. 9G, and FIG. 9H). Remarkably, PMT inhibited invasive ability of PSCs with no significant effect on migration (FIG. 1L and FIG. 91). Trypan blue viability assessment of PSCs treated with PMT in the presence and absence of CQ corroborated apoptosis data; that PMT does not induce apoptotic cell death (FIG. 9J). Collectively, these data suggest that PMT is a cytostatic agent with a propensity to inhibit clonogenicity, invasion and possibly autophagy- mediated survival of PSCs.

[0078] Palmatine inhibits growth of pancreatic cancer cells. To determine the effect of PMT on other pancreatic cells, its effects on the growth of normal HPNE, mutant KRAS transformed HPNE (HPNE-Ras) cells, and PCC lines: MIA PaCa-2 and PANC-1, was evaluated. HPNE-Ras cells were sensitive to growth inhibitory effects of PMT with IC50 values of 50 mg/mL (FIG. 2A; dashed line). In contrast, HPNE cells were comparatively resistant to PMT treatment as doses of 150 pg/mL or greater were required to see growth inhibitory effects (FIG. 2A; solid line and data not shown). Similar to HPNE-Ras cells, PMT-mediated growth inhibitory effects were observed in the cancer cell lines, MIA PaCa-2 and PANC-1 (FIG. 2B and FIG. 2C). PMT reduced the protein levels of GLI2 and PTCH1 in MIA PaCa-2 cells (FIG. 2D, FIG. 10A, and FIG. 10B). However, these effects were not observed in PANC-1 cells (FIG. 2D, FIG. IOC and FIG. 10D). PMT treatment significantly reduced expression and levels of survivin in MIA PaCa-2, but not PANC-1 cells (FIG. 2D and FIG. 2E). Consistent with this observation, PMT treatment induced apoptosis in MIA PaCa-2 and not PANC-1 cells as indicated by the appearance of cleaved PARP and Annexin V staining (FIG. 2D and FIG. 11 A).

[0079] Examination of autophagic activity following PMT treatment showed no significant effect on LC3B cleavage or p62 levels in MIA PaCa-2 and PANC-1 cells (FIG. 2F; quantification data is shown in FIG. 11B and FIG. 11C). Significant decrease in viability and induction of PARP cleavage was observed in MIA PaCa-2 but not in PANC-1 cells when autophagy was inhibited using CQ (FIG. 2F and FIG.2G). These data suggest that autophagy primarily functions as a cell survival mechanism in these cells, which is consistent with published reports (Yang et al., Genes Dev., 2011). Inhibition of autophagy using an autophagic inhibitor lowers the autophagic threshold in MIA PaCa-2 cells leading to decreased cell viability and induction of apoptosis (FIG. 2F and FIG. 2G). The effects of PMT on PANC-1 cells are not evident possibly due to a higher autophagic threshold (FIG. 2G right panel). Consistent with this speculation, basal LC3BII levels are significantly higher in PANC-1 compared to MIA PaCa-2 cells (data not shown). Interestingly, PMT marginally inhibited the migratory ability of MIA PaCa-2 cells with no effect on PANC-1 cells. In addition, PMT had no significant effect on invasive ability of PCCs under these experimental conditions (FIG. 11D, FIG. 11E, and data not shown). Taken together, these data suggest that PMT inhibits growth of cancer cell lines, albeit differentially possibly depending on the cellular context. It inhibits growth and induces apoptosis in MIA PaCa-2 cells and pharmacological inhibition of autophagy using CQ enhances PMT-induced apoptosis in MIA PaCa-2 cells. Additionally, although PMT reduces growth of PANC-1 cells, they are resistant to apoptosis induction.

[0080] PMT-mediated effects involve secretory factor. Although PSCs have invasive and migratory abilities, in conjunction with PCCs they acquire the ability to invade and migrate in a bi-directional manner (Pancreatic et al., Pancreatic Cancer and Tumor Microenvironment. Transworld Research Network; Trivandrum (India), 2012). It was reasoned that PMT might hinder PSC-PCC communication. Therefore, the migratory ability of PCCs was examined following treatment with conditioned media from PSCs in the absence and presence of PMT (CM and PMTCM respectively). Intriguingly, CM from PSCs enhanced the migratory ability of both MIA PaCa-2 and PANC-1 cells (FIG. 3A and FIG. 3B, FIG. 12A, and FIG. 12B). Interestingly, PMTCM significantly decreased migratory ability of these cells (FIG. 3C and FIG. 3D, FIG. 12C, and FIG. 12D). It is noteworthy that PMT alone decreased migratory ability of MIA PaCa-2 cells approximately 20% with no effect on PANC-1 cells (FIG. 11D and FIG. 1 IE). Intriguingly, CM-mediated enhanced migratory ability of MIA PaCa-2 and PANC-1 cells was associated with increased levels of b-catenin in MIA PaCa-2 cells and SNAIL in PANC-1 cells (FIG. 3E and FIG. 3F, left panel). On the other hand, PMTCM decreased levels of these same markers (FIG. 3E and FIG. 3F, right panel). These results imply the involvement of a secretory factor(s) in mediating PMT-induced effects on migration in cancer cells and that the ability of PMT to inhibit migration of PCCs occurs possibly by reducing the level(s) of such secreted factor(s).

[0081] Palmatine inhibits glutamine-mediated PSC-PCC interaction in vitro. Physiologically tumors grow under hypoxic and nutrient deprived conditions and cancer cells survive in this hostile micro-environment in part through reprogramming their metabolic needs (Kimmelman, Clin Cancer Res., 2015). However, how PSCs growing under such conditions reprogram their metabolic needs to communicate with PCCs to promote their growth and survival remains undefined. To address this, PSCs were cultured in low glucose media (GLM; 5 mM) or glucose-rich media (GRM; 25 mM; generally used in cell culture media) over a time course of 48 h and performed metabolite analysis using spent media and lysates (for intracellular metabolites). Analysis of metabolite profiling data reveled statistically significant alterations in both secretory (20 upregulated and 40 downregulated) and intracellular biochemicals (44 upregulated and 120 down-regulated) involved in glycolysis, glutamine metabolism and TCA cycle (Table 1; FIG. 4A and FIG. 4B; hierarchical clustering of metabolite data is shown in FIG. 13A and FIG. B). Specifically, reductions in the secreted levels of glucose, pyruvate and lactate (involved in glycolytic pathway) and significant increases in glutamine and glutamate (involved in glutamine metabolism) was observed. Interestingly, the levels of citrate increased while a-ketoglutarate (a-KG) and fumarate decreased with minimal effects on other TCA cycle intermediates (FIG. 4A). This could possibly be due to block in conversion of glutamate to a-KG mediated by glutamate dehydrogenase. Accordingly, increased intracellular levels of glutamate was expected. Significant decrease in the intracellular levels of biochemicals involved in glycolysis and increase in a-KG and glutamine (FIG. 4B) was observed. Box plots showing secreted and intracellular levels of a-KG, glutamate and glutamine are shown in FIG. 5A and FIG. 5B respectively. These data reveal that under low glucose conditions, PSCs utilize alternate carbon sources such as glutamine and glutamate to fuel TCA cycle, which is consistent with published findings (Kimmelman, Clin Cancer Res., 2015; Vander et al., Science , 2009; Altman et al., Nat Rev Cancer , 2016; Gao et al., Nature , 2009). These data also indicate that PSCs cultured under reduced glucose conditions secrete significant amounts of glutamine into the extracellular space relative to PSCs growing under glucose enriched conditions, which may facilitate their interaction with PCCs.

[0082] To test whether glutamine from PSCs affects PCC biological functions and affects the SHH pathway, the effect of glutamine (GLN) and glucose (GLC) on cancer cell proliferation, migration, and SHH pathway (FIG. 5C - FIG. 5E) was examined. MIA PaCa-2 cells supplemented with either glucose or glutamine showed increased proliferation (FIG. 5C) and migration (FIG. 5D) as compared to cells deprived of both glucose and glutamine (FIG. 5C and FIG. 5D). Addition of both glucose and glutamine further increased their proliferation (especially at 48 h) and migration indicating that both glucose and glutamine are involved in increasing proliferation of PCCs (FIG. 5C, FIG. 5D and FIG. 13C). Protein levels of GLI1, GLI2, SNAIL, and survivin increased significantly, albeit more prominent at 48 h following supplementation with both glucose and glutamine (FIG. 5E; quantification in FIG. 13D). In addition, treatment with PMT reduced the observed changes in the levels of these proteins especially SNAIL and Survivin (FIG. 6A and FIG. 13E). Further, under these experimental conditions, PMT inhibited glutamine- or glucose plus glutamine-induced proliferation of cells (FIG. 6B). Glucose, glutamine or combination also enhanced proliferation of liver metastatic CFPaC-1 cells, however, PMT inhibited only glutamine but not glucose or combination- induced proliferation in these cells (FIG. 6C). These findings suggest that PSCs residing in the TME communicate with PCCs in part through glutamine and that glutamine and glucose have growth promoting effects on PCCs (possibly in a cell-specific manner), which is consistent with the published literature (Son et al., Nature , 2013). Furthermore, these results show the potential of PMT to disrupt glutamine-mediated effects on PCCs in vitro.

Table 1. Alteration in the levels of secreted and intracellular metabolites in PSCs.

GLM: PSCs grown in low glucose media (5 mM).

GRM: PSCs grown in glucose rich media (25 mM).

Only significantly altered levels of metabolites shown.

[0083] Palmatine works synergistically with gemcitabine to inhibit growth of stellate and cancer cells. It is known that PSCs contribute to therapeutic resistance including GEM resistance by increasing fibrogenesis (Ryan et ah, N Engl J Med. 2014; Sclafani et ah, CritRev Oncol Hematol. 2015; Feig et ah, Clin Cancer Res., 2012; Duner et ah, Pancreatology. 2010; Apte et ah, Curr Opin Gastroenterol., 2015; Masamune et ah, Gut, 2009; Vonlaufen et ah, Cancer Res., 2008; Bachem et ah, Gastroenterology, 2005). COL1A1 is involved in GEM resistance and survivin is increased upon treatment with GEM in PCCs (Armstrong et ah, Clin Cancer Res., 2004; Han et ah, Apoptosis, 2016; Dong et ah, World J Surg Oncol., 2015). These published observations coupled with the ability of PMT to decrease levels of GLI and COL1A1 in PSCs and survivin in cancer cells prompted to test the hypothesis that PMT may potentiate GEM activity against human PSCs and PCCs. PSCs were treated with increasing concentrations of PMT (0-100 pg/mL) and GEM (0-0.5 pM) as single agents and in combination for 24 h before measuring proliferation. Both PMT and GEM alone or in combination decreased proliferation in a dose dependent manner with IC50 of 75 pg/mL for PMT and 0.25 pM for GEM (FIG. 14A). Data generated was subjected to combination index (Cl) analyses using the Chou and Talalay method ( Adv Enzym Regul., 1984). Isobologram analysis of these data indicate that the combination of PMT and GEM is highly synergistic with Cl values reaching less than 0.5 using lower doses of both compounds (0.1 pM GEM plus 25 pg/mL PMT; FIG. 7A). It should be mentioned that single agent dose of 75 pg/mL for PMT and 0.25 pM for GEM is necessary to inhibit proliferation of PSCs by 50%. A similar level of proliferation inhibition was achieved using lower doses of PMT plus GEM (FIG. 14A). It was found that PMT potentiated GEM activity synergistically in MIA PaCa-2, but not PANC-1 cells (FIG. 7B, FIG. 14B, and FIG. 14C). However, PMT alone inhibited proliferation of PANC-1 cells (FIG. 7C and FIG. 14C). Furthermore, a significant decrease was observed in the levels of COL1A1 and survivin in the combination, but not in single agent group (P+G; FIG. 7D; quantification shown in FIG. 14D). In preliminary studies, it was also observed that PMT decreased the colony forming ability of patient derived pancreatic cancers cells (data not shown). Taken together, these data suggest that PMT alone or in combination with GEM is effective against tumor-associated stroma, a major therapeutic barrier as well as pancreatic cancer cells.

B. Methods

[0084] Cell lines and chemicals. Human pancreatic cancer cell lines HPNE, MIA PaCa-2, CFPaC-1 and PANC-1 were obtained from ATCC (Rockville, MD). PSCs (obtained from Dr. Rosa, Hwang, UT MD Anderson Cancer Center, Houston, TX) and PANC-1 cells were cultured in DMEM medium (Mediatech, Inc., Manassas, VA) supplemented with 10% fetal bovine serum (FBS), 100-pg/mL penicillin-streptomycin, and 100 pg/mL amphotericin. HPNE, HPNE-Ras, and MIA PaCa-2 cells were maintained as previously described (Gong et al., Clin Cancer Res., 2014; Gong et al., Mol Carcinog., 2017; Gong et al., Oncotarget, 2014). Palmatine (PMT) was obtained from LKT Laboratories Inc. (St Paul, MN) and all other chemicals were analytical grade.

[0085] Metabolomic profiling. PSCs were treated with 5 mM and 25 mM glucose under serum free conditions with 5 and 25 mM mannitol used as osmotic controls. After 24 or 48 h of incubation, the cell supernatants were harvested; flash frozen for use in metabolomic profiling performed by Metabolon, Inc. (Durham, NC) using standard protocols.

[0086] Biochemical experiments. Cell proliferation was measured 24 and 48 h of incubation with PMT (10, 25, 50, 75, 100, 150 and 200 pg/mL) using CellTiter 96 Aqueous One solution assay (Promega Corporation, Madison, WI) as described previously (Gong et al., Clin Cancer Res., 2014; Gong et al., Mol Carcinog., 2017). Apoptosis was measured using Annexin V Apoptosis Detection Kit APC (eBioscience, Inc., San Diego, CA) following treatment with PMT (30 h) as per manufacturer’ s instructions. Etoposide (Etop) was used as a positive control. Colony forming ability was determined using crystal violet staining. Cell invasion assay was performed according to the manufacturer’s instructions (ECM556, Chemicon, EMD Millipore, Billerica, MA). Immunoblot analysis, Real-Time PCR and transient expression assays were conducted as described previously using either chemiluminescence or Infrared Imaging (Gong et al., Clin Cancer Res., 2014; Gong et al., Mol Carcinog., 2017; Gong et al., Oncotarget, 2014).

[0087] Statistics and ethics statement. All experiments were repeated at least 3 times using either duplicate or triplicate samples. Statistical significance was determined by two-way ANOVA or student’s t-test. Results were considered significant if the p value < .05. Example 2 - Preclinical efficacy of PMT alone in combination with GEM in KPC orthotopic model

[0088] In vivo potential of PMT in combination with GEM using orthotopic implantation model was studied. 4-6 week old C57BL/6 mice were orthotopically implanted with mouse pancreatic cancer cells with mutant Kras and p53 (CaPan-2 cells) in the pancreas. Following tumor cell implantation, mice were randomized into multiple groups (n=7-8 per group) of single agents PMT (0, 50 and 300 mg/kg) or GEM (50 or 100 mg/kg) alone or in combination. In combination studies, animals received PMT in the presence or absence of escalating doses of GEM (50 and 100 mg/kg) intraperitoneally thrice a week. PMT was administered through diet. During the study, the investigators (i) measured body weight changes (to assess toxicity); and (ii) monitored tumor growth (examining palpable tumors) weekly. Upon termination, blood was collected for measuring PMT and tumors were weighed and tissues collected for histopathological evaluation. Analysis of these data indicated significantly decreased mean log 10 tumor weight in response to treatment with PMT plus GEM (0.08+1.13) relative to controls (1.87+0.21) or single agent treatment (1.48+0.67; p<0.001; Table. 2). Cox regression analysis indicated risk of death decreases with intervention (p<0.001; data not shown). Taken together, these data show potential clinical utility for the combination of PMT plus GEM in the treatment of pancreatic cancer. Furthermore, these studies established (i) dose and (ii) lack of toxicity of the combination.

Table 2

PMT in combination with GEM treatment decreases PDAC tumor weight with no significant change in body weight in KPC orthotopic tumors. 4-6 week old C57/BL6 mice were orthtopically implanted with KPC cells. Following 3 weeks of implantation mice were randomized in to groups each of 6-7 to receive no drug, GEM alone (50 and 100 mg/kg body weight), PMT (50 and 300 mg/kg body weight) alone or in combination with escalating doses of GEM. Log 10 tumor weight by treatment (mean+SD) is shown.

Example 3 - PMT interacts in-silico with transcription factor STAT3 in a novel mode

[0089] Transcription factor STAT3 has been reported to be involved in GEM-resistance, an in-silico feasibility test was conducted to identify PMT binding to STAT3. Two algorithms FTMAP and SiteMap were used to detect and evaluate potentially promising small molecule binding sites on surface of the protein. Four consensus binding sites were identified: sitel at the interface of the coil-coiled and DNA binding domain (DBD); site2 in the flexible segment of DBD; site3 at the interface of DNA and the linker domain (FD) and site4 is the pY705 binding site in SH2 domain (FIG. 18).

[0090] Intriguingly, computational molecular modeling studies, showed that PMT can interact with transcription factor STAT3 with surprisingly low docking scores of -6.4 and -5.9 (lower is better) for sites 3 and 4. Such docking scores correspond to Kd in micromolar range and PMT binding to these sites translates into inhibition of DNA binding and pSTAT3 dimerization respectively. In case of SH2 domain, PMT binds to the same position which is occupied by benzene moiety of pY705 in the structure of the activated STAT3 homodimer (FIG. 19A). It forms specific cation-pi interaction with K591, three hydrogen bonds with R609, a salt bridge with E638 and extensive van der Waals contacts with E638 and P639 residues. In this binding state PMT mimics other small molecules that are reported to potently inhibit STAT3. Interestingly, in case of site 3 (FD domain), PMT binds a cavity which is interfacial to DNA. The interaction is stabilized by extensive van der Waals contacts (M331-R335, T515, I467-C468, P471), a salt bridge of PMT N+l with D566 and D570 and three cation-pi interactions of K573 and K574 with polycyclic core of PMT (FIG. 8B). In this binding mode PMT produces a steric clash with phosphate oxygen of DNA thus preventing formation of the putative DNA-STAT3 complex. This is a new pocket with the STAT3 structure and our estimates show a strong rational for PMT interaction. This supports the notion that PMT interacts with STAT3 and reduces its transcriptional activity. Therefore PMT-STAT3 interaction resulting in STAT3 transcriptional activity inhibition may lead to down regulation of STAT3 target genes such as survivin and sensitization to GEM.

Example 4 - PMT downregulates protein STAT3 and survivin activation in PCCs [0091] In pancreatic cancer MIA PaCa-2 cells, treatment with PMT significantly reduced

(i) reporter activity of survivin (FIG. 20A) and (ii) pSTAT3 protein levels with no significant change in total STAT3 (Fig. 20B). PMT treatment also resulted in decreased protein levels of survivin and increased levels of cleaved PARP indicating induction of apoptosis under these experimental conditions (FIG. 20C).

Claims

1. A method for treating pancreatic cancer comprising administering an effective amount of a composition comprising palmatine or palmatine derivative to a patient that has pancreatic cancer.

2. The method of claim 1, wherein the composition further comprises a pharmaceutically acceptable carrier.

3. The method of claim 1, further comprising administering an effective amount of chemotherapy agents.

4. The method of claim 3, wherein the chemotherapy agent is gemcitabine, oxaliplatin, irinotecan, leucovorin, 5-FU (FOLFIRINOX) or combination thereof.

5. The method of claim 4, wherein the chemotherapy agent is gemcitabine.

6. The method of claim 1 , wherein the chemotherapy agent is administered simultaneously or about 1, 2, 3, 4, 5, 6, 7, 8, ,9 10, seconds, minutes, hours or days, before or after administration of palmatine.

7. The method of claim 1, wherein pancreatic cancer is advanced pancreatic ductal adenocarcinoma.

8. An anti-pancreatic cancer composition comprising palmatine and a chemotherapy agent.

9. The composition of claim 1, wherein the chemotherapy agent is gemcitabine, oxaliplatin, irinotecan, leucovorin, 5-FU (FOLFIRINOX) or combination thereof.

10. The composition of claim 9, wherein the chemotherapy agent is gemcitabine.