WO2020121800A1

WO2020121800A1 - Mesenchymal stem cell, therapeutic agent for immune disease, and anti-inflammatory agent

Info

Publication number: WO2020121800A1
Application number: PCT/JP2019/046098
Authority: WO
Inventors: 輝黒木; 真代湯本; 登紀子長村
Original assignee: ロート製薬株式会社; 国立大学法人東京大学
Priority date: 2018-12-14
Filing date: 2019-11-26
Publication date: 2020-06-18
Also published as: CN113164770A; JP7464956B2; JPWO2020121800A1

Abstract

The present invention addresses the problem of providing a novel therapeutic agent for an immune disease and a novel therapeutic agent for an anti-inflammatory agent.　The present invention which can solve the problem is a mesenchymal stem cell characterized by being capable of producing kynurenine in a large amount or capable of secreting kynurenine in a large amount. The present invention also includes a mesenchymal stem cell which is characterized by being capable of producing kynurenine, which is synthesized from tryptophan with IDO induced in a cell by the treatment with IFNγ, in a large amount or being capable of secreting the kynurenine in a large amount, and a mesenchymal stem cell which is characterized in that the JAK/STAT pathway thereof is enhanced in a steady state.

Description

Mesenchymal stem cells, therapeutic agents for immune diseases and anti-inflammatory agents

The present invention relates to mesenchymal stem cells, therapeutic agents for immune diseases and anti-inflammatory agents.

　In immunodeficiency diseases, the inability of the immune system to function normally causes infectious diseases, recurrent episodes, severe symptoms, and prolonged symptoms. Immunodeficiency disorders impair the ability of the immune system to protect the body from invasion by external enemies such as bacteria, viruses, and fungi, and attack of abnormal cells such as cancer cells. As a result, they suffer from infectious diseases and cancers caused by bacteria, viruses, and fungi, which would not occur if their immune functions were normal.

Immunodeficiency diseases include congenital (primary) immunodeficiency diseases that are already present at birth, and acquired (secondary) immunodeficiency diseases that are developed due to some disease in later years. .. Acquired immunodeficiency disease often develops as a result of long-term severe disease, such as cancer, aplastic anemia, leukemia, myelofibrosis, renal failure, diabetes, liver disease, splenic disease. Are exemplified.

Also, as you get older, your immune system becomes weaker, and you gradually lose the ability to distinguish yourself from foreign bodies, and as a result, autoimmune diseases are more likely to occur. There are various autoimmune diseases, and various cells and tissues are targeted for attack. As a treatment for such an autoimmune disease, suppression of the immune system to control an autoimmune reaction has been performed. However, many of the drugs used to control the autoimmune reaction also impede the body's ability to fight infectious diseases and the like, and therefore there is a demand for the development of a new therapeutic drug having only the action of controlling the autoimmune reaction.

Mesenchymal stem cells are pluripotent progenitor cells first isolated from bone marrow by Friedenstein in 1982 (see Non-Patent Document 1). It has been revealed that mesenchymal stem cells are present in various tissues such as bone marrow, umbilical cord, and fat, and mesenchymal stem cell transplantation is expected as a new therapeutic method for various intractable diseases ( See Patent Documents 1 and 2). Recently, it is known that stromal cells such as adipose tissue, placenta, umbilical cord and egg membrane have cells having equivalent functions. Therefore, the mesenchymal stem cells are sometimes referred to as stromal cells (Mesenchymal Stromal Cell).

JP 2012-157263 A Special table 2012-508733 bulletin

The present invention aims to provide a novel therapeutic agent for an immune disease and a novel therapeutic agent for an anti-inflammatory agent in the above situation.

As a result of intensive research to solve the above-mentioned problems, the present inventors have found that mesenchymal stem cells (mesc) are characterized by high kynurenine production or kynurenine secretion. They have found that they are effective in treating immune diseases and inflammatory diseases, and completed the present invention. According to the present invention, a therapeutic agent effective for treating immune diseases and inflammatory diseases can be provided. That is, the gist of the present invention is as follows.

[1] A mesenchymal stem cell having a high kynurenine production amount or a high kynurenine secretion amount.
[2] A mesenchymal stem cell characterized by having a high kynurenine production amount or kynurenine secretion amount synthesized from tryptophan by IDO induced intracellularly by IFNγ treatment.
[3] A mesenchymal stem cell characterized in that the JAK/STAT pathway is activated in a steady state.
[4] The mesenchymal stem cell according to any one of [1] to [3], which is derived from umbilical cord tissue.
[5] A therapeutic agent for an immune disease containing the mesenchymal stem cell according to any one of [1] to [4].
[6] An anti-inflammatory agent containing mesenchymal stem cells according to any one of [1] to [4].
[7] A therapeutic agent for GVHD containing mesenchymal stem cells according to any one of [1] to [4].
[8] A method for treating an immune disease, which comprises using mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount.
[9] A method for treating an immune disease, which comprises using mesenchymal stem cells having a high kynurenine production amount or a kynurenine secretion amount synthesized from tryptophan by IDO induced intracellularly by IFNγ treatment.
[10] A method for treating an immune disease, which comprises using mesenchymal stem cells in which the JAK/STAT pathway is activated in a steady state.
[11] The method for treating an immune disease according to any of [8] to [10], wherein the mesenchymal stem cells are derived from umbilical cord tissue.
[12] A method for treating an inflammatory disease, which comprises using mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount.
[13] A method for treating an inflammatory disease, which comprises using mesenchymal stem cells which have a high kynurenine production amount or a kynurenine secretion amount synthesized from tryptophan by IDO induced intracellularly by IFNγ treatment.
[14] A method for treating an inflammatory disease, which comprises using mesenchymal stem cells in which the JAK/STAT pathway is activated in a steady state.
[15] The method for treating an inflammatory disease according to any of [12] to [14], wherein the mesenchymal stem cells are derived from umbilical cord tissue.
[16] A method for treating GVHD, which comprises using mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount.
[17] A method for treating GVHD, which comprises using mesenchymal stem cells that have a high kynurenine production amount or a kynurenine secretion amount synthesized from tryptophan by IDO induced intracellularly by IFNγ treatment.
[18] A method for treating GVHD, which comprises using mesenchymal stem cells in which the JAK/STAT pathway is activated in a steady state.
[19] The method for treating GVHD according to any of [16] to [18], wherein the mesenchymal stem cells are derived from umbilical cord tissue.

According to the present invention, a novel therapeutic agent for immune diseases and anti-inflammatory agent, and a novel method for treating immune diseases and a method for treating inflammatory diseases can be provided.

FIG. 1 is a diagram showing a comparison of intracellular kynurenine amounts of flat culture cells (ADH) and suspension culture cells (SUS) of mesenchymal stem cells. FIG. 2 is a diagram showing a comparison of the amount of kynurenine in the culture supernatants of mesenchymal stem cell flat culture cells (ADH) and suspension culture cells (SUS). FIG. 3 is a diagram showing a comparison of the amount of kynurenine (IDO activity) in the culture supernatant of mesenchymal stem cell flat culture cells (ADH) and suspension culture cells (SUS). FIG. 4 is a diagram showing a comparison of the amount of kynurenine (IDO activity) in the culture supernatants of mesenchymal stem cell flat culture cells (ADH) and suspension culture cells (SUS). FIG. 5 is a diagram showing a comparison of the amount of kynurenine (IDO activity) in the culture supernatants of mesenchymal stem cell flat culture cells (ADH) and suspension culture cells (SUS). FIG. 6 is a diagram showing a comparison of the amount of kynurenine (IDO activity) in the culture supernatant of mesenchymal stem cell flat culture cells (ADH) and suspension culture cells (SUS). FIG. 7 is a diagram showing a comparison of the amount of kynurenine (IDO activity) in the culture supernatant of mesenchymal stem cell flat culture cells (ADH) and suspension culture cells (SUS). FIG. 8 is a view showing a comparison of the amount of kynurenine (IDO activity) in the culture supernatant of flat culture cells. FIG. 9 is a diagram showing the analysis results (ratio of the expression level in SUS to the expression level in ADH) of gene expression by microarray of flat culture cells (ADH) of mesenchymal stem cells and suspension culture cells (SUS). FIG. 10 is a diagram showing the effect of UC-MSC (EXP-SUS) administration in GVHD model mice. FIG. 11 is a diagram showing the effect of UC-MSC (EXP-SUS) administration in GVHD model mice. FIG. 12 is a graph showing the anti-inflammatory effect of mesenchymal stem cell planar cultured cells (ADH) and suspension cultured cells (SUS). FIG. 13 is a diagram showing the JAK/STAT signal pathway.

The mesenchymal stem cells, therapeutic agents for immune diseases and anti-inflammatory agents of the present invention will be described in detail below.

[Mesenchymal stem cells]
The mesenchymal stem cells of the present invention are characterized by high kynurenine production or kynurenine secretion.

Kynurenine is a metabolite produced by the enzyme indoleamine 2,3-dioxygenase (IDO) when niacin is synthesized from tryptophan in cells. It is known that tryptophan is important for T cell proliferation, and tryptophan is converted to kynurenine by IDO activity and depleted to suppress T cell proliferation and induce immunological tolerance.

The amount of kynurenine produced or the amount of kynurenine secreted is the kynurenine released from the outside of cells after being synthesized from tryptophan intracellularly by indolamine 2,3-dioxygenase (IDO) induced by TNFα or IFNγ treatment under inflammatory conditions. Means quantity.

The mesenchymal stem cells of the present invention need only express kynurenine at a higher level than other cells. Specifically, the mesenchymal stem cells of the present invention are IDO that is induced intracellularly by IFNγ treatment. Therefore, the amount of kynurenine produced from tryptophan or the amount of kynurenine secreted is high.

The mesenchymal stem cells of the present invention need only highly express kynurenine as compared with mesenchymal stem cells obtained by culturing in a conventional medium (for example, MEMα medium containing 10% serum), and preferably 10 1.1 times or more, more preferably 1.2 times or more, still more preferably 1.5 times or more, kynurenine production amount or kynurenine secretion compared with mesenchymal stem cells obtained under culture conditions using MEM α medium containing 10% serum The higher the amount, the better.

Further, the mesenchymal stem cells of the present invention need only highly express kynurenine as compared with other cells, and examples thereof include MRC-5 cells, human neonatal skin fibroblasts (HDF), or human umbilical vein veins. It is sufficient that kynurenine is highly expressed as compared with endothelial cells (HUVEC), preferably 5 times or more, more preferably 10 times or more kynurenine production amount or kynurenine secretion amount is higher than MRC-5 cells, HDF or HUVEC. Good.

For example, compared to mesenchymal stem cells obtained by a conventional culture method (culture by a flat culture method), it is sufficient that kynurenine is highly expressed, and preferably mesenchymal stem cells obtained under conventional culture conditions. 2 times or more, more preferably 5 times or more, further preferably 10 times or more, particularly preferably 100 times or more, as long as the amount of kynurenine production or the amount of kynurenine secretion is high. In addition, the planar culture method may be performed by static culture in which cells are adhered to a flat surface such as a flask or a petri dish, and does not particularly specify a container, a medium or the like.

Note that the high amount of kynurenine produced or the amount of kynurenine secreted above includes high expression or high activity of IDO involved in kynurenine synthesis. The high expression or high activity of IDO is also defined in the same manner as above, and the mesenchymal stem cells of the present invention are mesenchymal cells obtained by culturing in a conventional medium (for example, 10% FBS-containing MEM-α medium). It is sufficient that IDO is highly expressed and/or IDO is highly active as compared to the lineage stem cell. It is preferably 1.1 times or more, more preferably 1.2 times or more, further preferably 1.5 times or more, as compared with mesenchymal stem cells obtained under conventional culture conditions, with high expression and/or activity of IDO ing.

The mesenchymal stem cells of the present invention have higher IDO expression and/or activity than other cells such as MRC-5 cells, human neonatal skin fibroblasts (HDF), and human umbilical vein endothelial cells (HUVEC). Is increasing. Higher expression or activity of IDO than MRC-5 cells, HDF or HUVEC, preferably higher than MRC-5 cells, HDF or HUVEC by 5 times or more, more preferably 10 times or more high expression of IDO and/or The activity is increased.

The IDO of the mesenchymal stem cells of the present invention is highly expressed and/or the activity thereof is higher than that of the mesenchymal stem cells obtained by a conventional culture method (for example, culture by a flat culture method). It is preferably 2 times or more, more preferably 5 times or more, further preferably 10 times or more, particularly preferably 100 times or more compared to mesenchymal stem cells obtained under conventional culture conditions, and high expression and/or activity of IDO is enhanced. doing.

IDO is known to be induced by the The Janus kinase/signal transceivers and activators of transcription (JAK/STAT) signaling pathways. It is known that this JAK/STAT signal pathway is triggered by various cytokines and growth factors and is involved in various actions such as cell proliferation, differentiation, migration, apoptosis and cell survival.

The mesenchymal stem cell of the present invention is characterized by high expression of the following factors in addition to kynurenine.

The mesenchymal stem cells of the present invention highly express CSF3, CSF2, LIF, IL6, IL6R or STAT4. Colony stimulating factor 3 (CSF3) is a cytokine involved in the production and differentiation of granulocytes. Colony stimulating factor 2 (CSF2) is a cytokine involved in the production and differentiation of granulocytes and macrophages. The leukemia inhibitory factor (LIF) is a cytokine that plays an important role in the induction of cell differentiation in the hematopoietic system and the nervous system, the regulation of mesenchymal to epithelial conversion in the development of the kidney, and the maternal-fetal immune tolerance. Interleukin 6 (IL6) is a cytokine having various functions under various inflammatory conditions and B cell maturation. interleukin 6 receptor (IL6R) is a receptor for IL6. The signal transducer and activator of transcription 4 (STAT4) functions as a transcription factor in response to cytokines and growth factors. It is known to play an important role in the response to IL12 in lymphocytes and the differentiation of helper T cells.

Furthermore, the following factors are highly expressed in the mesenchymal stem cells of the present invention.
ciliary neurotrophic factor receptor, growth hormone receptor, Cbl proto-oncogene B, E3 ubiquitin protein ligase, interleukin 15, interleukin 6 signal transducer, interleukin 10, cardiotrophin-like cytokine factor 1, cyclin D2, interleukin 11 receptor, alpha, interleukin 15 receptor , alpha, Pim-1 proto-oncogene, serine / threonine kinase, suppressor of cytokine signaling 1, signal transducer and activator of transcription 2, 113kDa, interleukin 19, interleukin 7, interleukin 24, interleukin 22 receptor, alpha 1, suppressor of cytokine signaling 3, Janus kinase 2, interferon (alpha, beta and omega) receptor 1, interferon (alpha, beta and omega) receptor 2, interferon gamma receptor 2 (interferon gamma transducer 1), prolactin, leukemia inhibitory factor receptor alpha, sprouty homolog 2 (Drosophila), v-akt murine thymoma viral oncogene homolog 3, interleukin 4 receptor, interleukin 2 receptor, alpha, son of sevenless homolog 1 (Drosophila), leptin receptor, v-akt murine thymoma viral oncogene homolog 3, interleukin 24, growth hormone 1, interleukin 7 receptor, phosphatide lininositol -4,5-bisphosphate 3-kinase, catalytic subunit AT ate, and interleukin 21 and protein inhito, and interleukin 21 and protein inbite. It is known. In the mesenchymal stem cells of the present invention, the JAK/STAT pathway is activated in the steady state, and these factors are highly expressed. These factors generally have the positional relationship shown in FIG. 13 in the JAK/STAT pathway.

In the present invention, the mesenchymal stem cells have the ability to differentiate into one or more cells belonging to mesenchymal cells (osteocytes, cardiomyocytes, chondrocytes, tendon cells, adipocytes, etc.) and maintain the ability. A cell that can grow. The term mesenchymal stem cells used in the present invention means the same cells as stromal cells, and does not particularly distinguish between the two. Further, it may be simply referred to as a mesenchymal cell. The tissue containing mesenchymal stem cells, for example, adipose tissue, umbilical cord, bone marrow, cord blood, endometrium, placenta, amniotic membrane, chorion, decidua, dermis, skeletal muscle, periosteum, dental follicle, periodontal ligament, Examples include dental pulp and tooth germ. For example, adipose tissue-derived mesenchymal stem cells mean mesenchymal stem cells contained in adipose tissue, and may be referred to as adipose tissue-derived stromal cells. Of these, adipose tissue-derived mesenchymal stem cells, umbilical cord-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, placenta-derived mesenchymal cells, from the viewpoint of efficacy for treatment of neuropathic diseases, availability, etc. Stem cells and dental pulp-derived mesenchymal stem cells are preferable, adipose tissue-derived mesenchymal stem cells and umbilical cord-derived mesenchymal stem cells are more preferable, and umbilical cord-derived mesenchymal stem cells are most preferable.

The mesenchymal stem cells in the present invention may be derived from the same species as the subject (subject) to be treated or may be derived from different species. Examples of the mesenchymal stem cells of the present invention include humans, horses, cows, sheep, pigs, dogs, cats, rabbits, mice, and rats, preferably cells derived from the same species as the subject (subject) to be treated. .. The mesenchymal stem cells in the present invention may be derived from a subject (subject) to be treated, that is, autologous cells, or may be derived from another subject of the same species, that is, allogeneic cells. Allogeneic cells are preferred.

Since mesenchymal stem cells are unlikely to cause rejection even in an allogeneic subject, cells of a previously prepared donor are expanded and cryopreserved, and the mesenchymal stem cells in the therapeutic agent for diseases of the present invention are used. It can be used as a stem cell. Therefore, compared to the case of preparing and using autologous mesenchymal stem cells, the mesenchymal stem cells of the present invention are easy to commercialize, and from the viewpoint that stable and constant effects are easily obtained, It is more preferable that they are allogeneic.

In the present invention, the mesenchymal stem cells mean any cell population containing mesenchymal stem cells. The cell population is at least 20% or more, preferably 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 96%, 97%, 98. % Or 99% are mesenchymal stem cells.

In the present invention, the umbilical cord is a white tubular tissue that connects the fetus and the placenta, and is composed of umbilical vein, umbilical artery, glue-like tissue (Wharton's Jelly), umbilical cord matrix itself, and the like, and mesenchymal stem cells. Including a lot. The umbilical cord is preferably obtained from an animal of the same species as the subject (administration subject) using the disease therapeutic agent of the present invention, and more preferably human in consideration of administration of the disease therapeutic agent of the present invention to human. Umbilical cord.

In the present invention, the adipose tissue means a tissue containing stromal cells including adipocytes and microvascular cells, and is, for example, a tissue obtained by surgically excising or aspirating subcutaneous fat of a mammal. Adipose tissue can be obtained from subcutaneous fat. It is preferably obtained from an animal of the same species as the subject to which the adipose tissue-derived mesenchymal stem cells described below are administered, and in view of administration to humans, human subcutaneous fat is more preferred. Although the subcutaneous fat supplying individual may be alive or dead, the adipose tissue used in the present invention is preferably a tissue collected from a living individual. When collected from an individual, examples of liposuction include PAL (power assist) liposuction, Eruconia laser liposuction, body jet liposuction, and the like, and ultrasonic waves are used from the viewpoint of maintaining the state of cells. Is preferably not used.

In the present invention, the bone marrow refers to a soft tissue that fills the inner cavity of a bone and is a hematopoietic organ. Bone marrow fluid is present in the bone marrow, and the cells present therein are called bone marrow cells. Bone marrow cells include erythrocytes, granulocytes, megakaryocytes, lymphocytes, adipocytes and the like, as well as mesenchymal stem cells, hematopoietic stem cells, vascular endothelial precursor cells and the like. Bone marrow cells can be obtained, for example, from human iliac bone, long bone bone, or other bone.

In the present invention, each tissue-derived mesenchymal stem cell such as adipose tissue-derived mesenchymal stem cell, umbilical cord-derived mesenchymal stem cell, bone marrow-derived mesenchymal stem cell is adipose tissue-derived mesenchymal stem cell, umbilical cord-derived mesenchymal system, respectively. It means any cell population containing mesenchymal stem cells derived from each tissue such as stem cells and bone marrow-derived mesenchymal stem cells. The cell population is at least 20% or more, preferably 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 93%, 96%, 97%, 98. % Or 99% of each tissue-derived mesenchymal stem cell such as adipose tissue-derived mesenchymal stem cell, umbilical cord-derived mesenchymal stem cell, bone marrow-derived mesenchymal stem cell.

The mesenchymal stem cells of the present invention have a high kynurenine production amount or a high kynurenine secretion amount, and, for example, growth characteristics (for example, population doubling ability from passage to aging, doubling time), karyotype analysis (for example, , Normal karyotype, maternal or neonatal lineage, surface marker expression by flow cytometry (eg FACS analysis), immunohistochemistry and/or immunocytochemistry (eg epitope detection), gene expression profiling (eg genes Chip array; reverse transcription PCR, real-time PCR, polymerase chain reaction such as conventional PCR), miRNA expression profiling, protein array, protein secretion such as cytokine (eg, plasma coagulation analysis, ELISA, cytokine array), metabolite (metabolome analysis) ), by other methods known in the art, and the like.

(Method for preparing mesenchymal stem cells)
The method for preparing mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount is not particularly limited, but can be prepared, for example, as follows. That is, from tissues such as fat, umbilical cord and bone marrow, according to a method known to those skilled in the art, mesenchymal stem cells are separated and cultured, cells with high kynurenine production amount or kynurenine secretion amount, cell sorter with IDO expression as an index, It can be obtained by separating with magnetic beads or the like. In addition, mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount in mesenchymal stem cells can be obtained by culturing using a specific medium. In the cell population obtained by this induction, it is preferable that 50% or more of the cell population is a cell having a high kynurenine production amount or a high kynurenine secretion amount, and 70% or more is a cell having a high kynurenine production amount or a high kynurenine secretion amount. More preferably, 80% or more is a cell having a high kynurenine production amount or a high kynurenine secretion amount, and more preferably 90% or more is a cell having a high kynurenine production amount or a high kynurenine secretion amount. Most preferably, it is a uniform cell population of cells having a high kynurenine production amount or a high kynurenine secretion amount. Hereinafter, a method for preparing mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount will be specifically described.

The mesenchymal stem cells can be prepared by a method well known to those skilled in the art. The method for preparing umbilical cord tissue-derived mesenchymal stem cells and adipose tissue-derived mesenchymal stem cells will be described below as an example.

The umbilical cord can be collected by appropriately removing the placenta from the postpartum tissue including the placenta and umbilical cord delivered by vaginal delivery and cesarean section. Aseptic or bacteriostatic treatment may be performed after removing the cord blood from the collected umbilical cord. Removal of cord blood is accomplished by rinsing with an anticoagulant solution such as a heparin-containing solution. Aseptic or bacteriostatic treatment is not particularly limited, but is a medium supplemented with povidone-iodine or a medium supplemented with one or more antibiotics and/or antifungal agents such as penicillin, streptomycin, amphotericin B, gentamicin, and nystatin. Alternatively, it may be immersed in a buffer. In addition, a step of selectively lysing red blood cells may be included if necessary. As a method for selectively lysing red blood cells, a method well known in the art can be used, for example, incubation in a hypertonic medium or a hypotonic medium by lysis with ammonium chloride.

The umbilical cord-derived cell of the present invention means a cell population prepared using umbilical cord as a raw material, and may be obtained by a known production method, for example, a method including the following steps (i) to (iii) can do:
(I) cutting the umbilical cord;
(Ii) a step of culturing the umbilical cord obtained in the step (i); and (iii) a step of subculture.

Further, as another method for preparing the cells, instead of (i) the step of cutting the umbilical cord, (i′) the step of dissociating the tissue by enzymatic treatment of the umbilical cord may be included. Further, in addition to (i) the step of cutting the umbilical cord, (i') the step of dissociating the tissue by enzymatic treatment of the umbilical cord may be included.

In the step (i) of cutting the umbilical cord of the present invention, the umbilical cord obtained by the above method is cut by mechanical force (shredding force or shearing force) in a state including amniotic membrane, blood vessel, perivascular tissue and Walton jelly. It can be done by Although not particularly limited, examples of the umbilical cord section obtained by cutting have a size of 1 to 10 mm ³ , 1 to 5 mm ³ , 1 to 4 mm ³ , 1 to 3 mm ³ or 1 to 2 mm ³ . In the step (i') of dissociating the tissue from the umbilical cord by the enzyme treatment of the present invention, the umbilical cord obtained by the above-mentioned method is treated with the enzyme in a state containing amniotic membrane, blood vessel, perivascular tissue and Walton jelly to remove the tissue. It can be performed in the step of dissociating. The enzyme treatment is not particularly limited, but an enzyme treatment using one or more enzymes such as collagenase, dispase and hyaluronidase is exemplified.

In the step of culturing the umbilical cord obtained in the step (ii) (i) of the present invention, the umbilical cord obtained in the step (i) is used at an appropriate cell density and culture conditions by using an appropriate cell culture medium. Incubate.

The umbilical cord tissue-derived mesenchymal stem cells of the present invention can be produced using a suspension culture production method. As a suspension culture production method, a method of stirring culture of sphere-shaped cell clusters formed by any method in a culture container, stirring culture in a culture tank by adhering cells on the microcarrier and stirring the microcarrier There are ways to do it. The stirring can be carried out by rotating a stirring blade in a container with a stirrer, placing a bag containing the culture solution and cells on a shaker, and shaking the bag to suspend the culture solution. Further, the medium used in the suspension culture production method is not particularly limited as long as it is a medium capable of culturing mesenchymal stem cells, and the medium as described above is exemplified. The microcarrier is not particularly limited as long as it can be used in suspension culture, and examples thereof include polyester, polystyrene, glass, dextran, gelatin, collagen and the like. Specific examples of available microcarriers include GE Healthcare's Cytodex1, Cytodex3, cytopore1, Cytopore2, Cultisphere, Cytoline1, Cytoline2, CornBing's positive concentration, low concentration SynthemaxII and high concentration. Examples thereof include microcarriers, collagen-coated microcarriers, soluble microcarriers, and SoloHill microcarriers manufactured by Pall. The material of the microcarrier preferably has properties such as solubility and biodegradability, and more preferably xeno-free and animal-free in addition to these.

The adipose tissue-derived mesenchymal stem cells may be obtained by, for example, the production method described in US Pat. No. 6,777,231, and may be produced by a method including the following steps (i) to (iii), for example. it can:
(I) a step of obtaining a cell suspension by digesting adipose tissue with an enzyme;
(Ii) sedimenting the cells and resuspending the cells in a suitable medium; and (iii) culturing the cells on a solid surface to remove cells that do not show binding to the solid surface.

It is preferable to use washed adipose tissue for the step (i). Washing can be accomplished by using a physiologically compatible saline solution (eg, phosphate buffered saline (PBS)) and stirring vigorously to allow precipitation. This is because impurities (also called debris, for example, damaged tissue, blood, red blood cells) contained in adipose tissue are removed from the tissue. Therefore, washing and sedimentation are generally repeated until the debris have been totally removed from the supernatant. Remaining cells exist as clumps of various sizes, and in order to dissociate them while minimizing damage to the cells themselves, the washed cell clumps are weakened by an enzyme that weakens intercellular bonds or destroys them (for example, Treatment with collagenase, dispase or trypsin) is preferred. The amount of such enzymes and the duration of treatment vary depending on the conditions used, but are known in the art. A method of using cells that naturally exude from the cell mass instead of or in combination with such enzyme treatment is also preferable (improved explant method and the like). Further, the cell mass can be decomposed by other treatment methods such as mechanical stirring, ultrasonic energy, and heat energy, but it is preferable to perform only the enzyme treatment in order to minimize damage to the cells. When an enzyme is used, it is desirable to deactivate the enzyme using a medium or the like after an appropriate period of time in order to minimize harmful effects on cells.

The cell suspension obtained in step (i) contains a slurry or suspension of aggregated cells, and various types of contaminant cells such as erythrocytes, smooth muscle cells, endothelial cells, and fibroblasts. Therefore, the cells in an aggregated state and these contaminating cells may be subsequently separated and removed, but since they can be removed by adhesion and washing in step (iii) described later, the separation and removal are omitted. May be. The separation and removal of contaminating cells can be accomplished by centrifugation, which forces the cells into a supernatant and a precipitate. The resulting precipitate containing contaminating cells is suspended in a physiologically compatible solvent. The suspended cells may contain red blood cells, but the red blood cells are excluded by the selection by adhesion to the surface of the solid body, which will be described later, and thus the lysis step is not always necessary. As a method for selectively lysing red blood cells, methods well known in the art can be used, for example, incubation in a hypertonic medium or a hypotonic medium by lysis with ammonium chloride. After lysis, the lysate may be separated from the desired cells by, for example, filtration, centrifugation, or density fractionation.

In step (ii), in order to increase the purity of mesenchymal stem cells in the cells in suspension, they may be washed once or continuously several times, centrifuged, and resuspended in the medium. Alternatively, cells may be separated based on cell surface marker profile or based on cell size and granularity.

The medium used for resuspension is not particularly limited as long as it is a medium capable of culturing mesenchymal stem cells, but such a medium includes serum added to a basal medium, and/or albumin, transferrin, fatty acid, It may be prepared by adding one or more serum substitutes such as insulin, sodium selenite, cholesterol, collagen precursor, trace elements, 2-mercaptoethanol, 3′-thiolglycerol. If necessary, lipids, amino acids, proteins, polysaccharides, vitamins, growth factors, low molecular weight compounds, antibiotics, antioxidants, pyruvic acid, buffers, inorganic salts, and other substances are added to these media, if necessary. May be.

Subsequently, in step (iii), on the solid surface without differentiating the cells in the cell suspension obtained in step (ii), using the appropriate cell culture medium described above, an appropriate cell density and Culture under culture conditions. In the present invention, the “solid surface” means any material capable of binding and adhering the adipose tissue-derived mesenchymal stem cells of the present invention. In a particular embodiment, such material is a plastic material that has been treated to promote the attachment and adhesion of mammalian cells to its surface. The shape of the culture vessel having a solid surface is not particularly limited, but a petri dish, a flask and the like are preferably used. The cells are washed after incubation to remove unbound cells and cell debris.

In the present invention, cells that finally remain bound and adhered to a solid surface can be selected as a cell population of adipose tissue-derived mesenchymal stem cells.

In order to confirm that the selected cells are the mesenchymal stem cells of the present invention, surface antigens may be analyzed by a conventional method using flow cytometry or the like. In addition, the ability to differentiate into each cell lineage may be tested and such differentiation may be performed by conventional methods.

The medium used for culturing the cells of the present invention is not particularly limited as long as it is a medium capable of culturing mesenchymal stem cells, but such a medium includes serum added to a basal medium and/or albumin and transferrin. , Serum fatty acid, insulin, sodium selenite, cholesterol, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiol glycerol, etc. If necessary, lipids, amino acids, proteins, polysaccharides, vitamins, growth factors, low molecular weight compounds, antibiotics, antioxidants, pyruvic acid, buffers, inorganic salts, and other substances are added to these media, if necessary. May be.

Examples of the basal medium include IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, MEM-α medium, Dulbecco's modified Eagle's Medium (DMEM) medium, Ham's medium, and Ham's medium. Examples include RPMI 1640 medium, Fischer's medium, MCDB201 medium and mixed medium thereof.

Examples of the above-mentioned serum include, but are not limited to, human serum, fetal bovine serum (FBS), bovine serum, calf serum, goat serum, horse serum, pig serum, sheep serum, rabbit serum, rat serum and the like. .. When using serum, 5 v/v% to 15 v/v%, preferably 10 v/v% may be added to the basal medium.

Examples of the above fatty acids include, but are not limited to, linoleic acid, oleic acid, linoleic acid, arachidonic acid, myristic acid, palmitic acid, palmitic acid, stearic acid and the like. Examples of the lipid include, but are not limited to, phosphatidylserine, phosphatidylethanolamine, and phosphatidylcholine. Amino acids include, but are not limited to, for example, L-alanine, L-arginine, L-aspartic acid, L-asparagine, L-cysteine, L-cystine, L-glutamic acid, L-glutamine, L-glycine and the like. Examples of the protein include, but are not limited to, ecotin, reduced glutathione, fibronectin, β2-microglobulin and the like. Glycosaminoglycans are exemplified as the polysaccharide, and hyaluronic acid, heparan sulfate, and the like are particularly exemplified among the glycosaminoglycans, but are not limited thereto. The growth factor is, for example, platelet-derived growth factor (PDGF), basic fibroblast growth factor (bFGF), transforming growth factor beta (TGF-β), hepatocyte growth factor (HGF), epidermal growth factor (EGF). , Connective tissue growth factor (CTGF), vascular endothelial cell growth factor (VEGF) and the like, but are not limited thereto. From the viewpoint of using the umbilical cord-derived mesenchymal stem cells obtained in the present invention for cell transplantation, it is preferable to use a (Zeno-free) medium containing no xeno-derived components such as serum. Such a medium is provided as a medium prepared in advance for mesenchymal stem cells (stromal cells) from PromoCell, Lonza, Biological Industries, Veritas, R&D Systems, Corning, and Rohto, for example. Has been done.

The mesenchymal stem cells of the present invention can be prepared as described above, but may be defined as cells having the following characteristics;
(1) Adhesiveness to plastic under culture conditions in standard medium,
(2) Surface antigens CD44, CD73, and CD90 are positive, CD31 and CD45 are negative, and (3) Differentiation into osteocytes, adipocytes, and chondrocytes is possible under culture conditions.

From the mesenchymal stem cells obtained by the above step, cells having a high IDO expression amount, kynurenine production amount, or kynurenine secretion amount are selectively separated by an immunological method using a cell sorter, magnetic beads, or the like, It is possible to obtain mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount. In addition, kynurenine production, or a specific culture method capable of inducing kynurenine secretion, or by culturing with a specific medium or the like, induces kynurenine production in mesenchymal stem cells, or kynurenine secretion, efficiently produces kynurenine, or It is also possible to obtain mesenchymal stem cells with high kynurenine secretion. As an example, a specific method of selective separation by an immunological method using a cell sorter, a method of adhering cells to a microcarrier and stirring the microcarrier to perform stirring culture in a culture tank will be described below.

The above-prepared mesenchymal stem cells are treated with a trypsin/EDTA solution or the like, and the cell suspension obtained is centrifuged (room temperature, 400 G, 5 minutes) to remove the supernatant. Staining Buffer (1% BSA-PBS) was added to the cells to prepare 1×10 ⁶ cells/500 μL, the cell suspension concentration was made uniform by pipetting, and then 50 μL was added to a new 1.5 mL microtube. Dispense each. A primary antibody (anti-IDO antibody, anti-kynurenine antibody, etc.) is added to the dispensed cell suspension at a concentration of 5 to 20 μg/mL and suspended, and then reacted for 30 minutes to 1 hour under light-shielding and refrigeration. After washing 3 times with 1 mL of Staining Buffer, add 50 μL of Staining Buffer to make the volume 50 μL, and add the secondary antibody at a concentration of 1-10 μg/mL to suspend, then react for 30 minutes to 1 hour under light-shielding and refrigeration. .. After washing 3 times with 1 mL of Staining Buffer, 300 μL of PI Buffer (Staining buffer 14.4 mL with 28.8 μL of Propium iodide solution (manufactured by SIGMA, P4864) was added thereto) and well suspended, and the cell strainer was added. Separation can be performed by passing through an attached tube and using fluorescence activated cell sorting (FACS).

The cell suspension containing the prepared mesenchymal stem cells and a microcarrier are mixed, added to a culture tank, stirred culture is performed using a serum-free medium for mesenchymal stem cells, and suspension culture is performed for a certain period. By carrying out, it is possible to obtain cells having a higher IDO expression amount, kynurenine production amount, or kynurenine secretion amount, as compared with the conventional flat culture in a flask or the like.

(Cryopreservation of mesenchymal stem cells)
The mesenchymal stem cells of the present invention may be cells that have been repeatedly cryopreserved and thawed as long as they have an immune disease therapeutic effect and an inflammatory disease therapeutic effect. In the present invention, cryopreservation can be performed by suspending mesenchymal stem cells in a cryopreservation solution well known to those skilled in the art and cooling. Suspension can be performed by detaching cells with a detaching agent such as trypsin if necessary, transferring to a cryopreservation container, appropriately treating and then adding a cryopreservation liquid.

The cryopreservation liquid may contain DMSO (Dimethyl sulfoxide) as a cryoprotective agent, but DMSO has the property of inducing differentiation of mesenchymal stem cells in addition to cytotoxicity, so the DMSO content is Is preferably reduced. As an alternative to DMSO, glycerol, propylene glycol or polysaccharides are exemplified. When DMSO is used, it contains a concentration of 5% to 20%, preferably a concentration of 5% to 10%, more preferably a concentration of 10%. In addition to these, the additives described in WO2007/058308 may be included. As such a cryopreservation liquid, for example, cryopreservation provided by BioVerde, Japan Genetics, Reprocell, Xenoac, Cosmo Bio, Kojin Bio, Thermo Fisher Scientific, etc. A liquid may be used.

When the suspended cells described above are cryopreserved, they may be frozen at a temperature between −80° C. and −100° C. (for example, −80° C.), using any freezer capable of attaining the temperature. obtain. Although not particularly limited, the cooling rate may be appropriately controlled using a program freezer in order to avoid a rapid temperature change. The cooling rate may be appropriately selected depending on the components of the cryopreservation liquid, and may be performed according to the manufacturer's instruction of the cryopreservation liquid.

The storage period is not particularly limited as long as the cells that have been cryopreserved under the above conditions are thawed and retain the same properties as those before freezing, for example, 1 week or more, 2 weeks or more, 3 weeks or more, 4 weeks or more, 2 months or more, 3 months or more, 4 months or more, 5 months or more, 6 months or more, 1 year or more, or more. Since cell damage can be suppressed by storing it at a lower temperature, it may be stored in a gas phase on liquid nitrogen (from about −150° C. or lower to −180° C. or higher). When storing in the gas phase on liquid nitrogen, it can be performed using a storage container well known to those skilled in the art. Although not particularly limited, for example, when storing for 2 weeks or more, it is preferable to store in a gas phase on liquid nitrogen.

The thawed mesenchymal stem cells may be appropriately cultured until the next cryopreservation. Culturing of mesenchymal stem cells is performed using a medium capable of culturing the above-mentioned mesenchymal stem cells, and is not particularly limited, but at a culture temperature of about 30 to 40° C., preferably about 37° C., CO ₂ -containing air is used. It may be done in an atmosphere. The CO ₂ concentration is about 2-10%, preferably about 5-10%. In culture, after reaching an appropriate confluency with respect to the culture container (for example, 50% to 80% of the cells are occupied in the culture container), the cells are detached with an exfoliating agent such as trypsin. Alternatively, the culture may be continued by seeding it in a separately prepared culture container at an appropriate cell density. When cells are seeded, typical cell densities are 100 cells/cm ² to 100,000 cells/cm ² , 500 cells/cm ² to 50,000 cells/cm ² , 1,000 to 10,000 cells. /Cm ² , 2,000 to 10,000 cells/cm ^{2, and the} like. In a particular embodiment, the cell density is 2,000-10,000 cells/cm ² . It is preferable to adjust the time until reaching appropriate confluency to 3 to 7 days. During the culturing, the medium may be appropriately replaced as necessary.

Thawing of cryopreserved cells can be performed by a method well known to those skilled in the art. For example, a method of carrying out by standing or shaking in a 37° C. constant temperature bath or in a hot water bath is exemplified.

The mesenchymal stem cells of the present invention may be cells in any state, for example, cells recovered by peeling cells in culture, or cells frozen in a cryopreservation solution Good. It is preferable to use cells of the same lot obtained by expansion culture that have been divided into small portions and frozen and stored, because the same effects and advantages can be stably obtained, and handling is excellent. The cryopreserved mesenchymal stem cells may be thawed immediately before use and may be directly mixed with a solution such as an infusion solution or a medium while being suspended in the cryopreservation solution. Alternatively, the cryopreservation solution may be removed by a method such as centrifugation and then suspended in an infusion solution or a solution such as a medium. Here, the “infusion” in the present invention refers to a solution used in the treatment of humans, and is not particularly limited, and examples thereof include physiological saline, Japanese Pharmacopoeia physiological saline, 5% glucose solution, and Japanese Pharmacopoeia. Glucose injection, Ringer's solution, Japanese Ringer's solution, Lactated Ringer's solution, Acetate Ringer's solution, 1st solution (starting solution), 2nd solution (dehydration replenishment solution), 3rd solution (maintenance solution), 4th solution (postoperative recovery solution) Etc.

[Immune disease therapeutic agent and anti-inflammatory agent]
The therapeutic agent for an immune disease or the anti-inflammatory agent of the present invention contains the mesenchymal stem cells of the present invention, which have a high kynurenine production amount or a high kynurenine secretion amount. According to the therapeutic agent for immune diseases or the anti-inflammatory agent of the present invention, the therapeutic agent for immune diseases and the anti-inflammatory agent can be used for prevention, suppression or treatment. Regarding the mesenchymal stem cells containing the therapeutic agent for immune diseases and the anti-inflammatory agent of the present invention, the above description of the mesenchymal stem cells can be applied.

The therapeutic agent for immune diseases and the anti-inflammatory agent of the present invention are pharmaceutically acceptable according to a conventional method according to their use and morphology, in addition to the above mesenchymal stem cells, as long as the effects of the present invention are not impaired. A carrier or an additive may be included. Examples of such carriers and additives include isotonic agents, thickeners, sugars, sugar alcohols, preservatives (preservatives), bactericides or antibacterial agents, pH regulators, stabilizers, chelating agents. , Oily base, gel base, surfactant, suspending agent, binder, excipient, lubricant, disintegrating agent, foaming agent, fluidizing agent, dispersing agent, emulsifying agent, buffering agent, solubilizing agent , Antioxidants, sweeteners, acidulants, coloring agents, flavoring agents, flavoring agents, and cooling agents, but are not limited thereto. Typical components include, for example, the following carriers and additives.

As the carrier, for example, an aqueous carrier such as water or hydrous ethanol; as the tonicity agent (inorganic salt), for example, sodium chloride, potassium chloride, calcium chloride, magnesium chloride or the like; as the polyhydric alcohol, for example, , Glycerin, propylene glycol, polyethylene glycol, etc.; Examples of the thickener include carboxyvinyl polymer, hydroxyethyl cellulose, hydroxypropylmethyl cellulose, methyl cellulose, alginic acid, polyvinyl alcohol (completely or partially saponified product), polyvinylpyrrolidone, macrogol. Etc.; as sugars, for example, cyclodextrin, glucose, etc.; as sugar alcohols, for example, xylitol, sorbitol, mannitol, etc. (these may be d-form, l-form or dl-form); preservatives As the bactericide or antibacterial agent, for example, dibutylhydroxytoluene, butylhydroxyanisole, alkyldiaminoethylglycine hydrochloride, sodium benzoate, ethanol, benzalkonium chloride, benzethonium chloride, chlorhexidine gluconate, chlorobutanol, sorbic acid, sorbin Potassium acid, trometamol, sodium dehydroacetate, methyl paraoxybenzoate, ethyl paraoxybenzoate, propyl paraoxybenzoate, butyl paraoxybenzoate, oxyquinoline sulfate, phenethyl alcohol, benzyl alcohol, biguanide compound (specifically, polyhexanide hydrochloride ( Polyhexamethylene biguanide), etc.), Glowkill (trade name, manufactured by Rhodia), etc.; examples of the pH adjusting agent include hydrochloric acid, boric acid, aminoethylsulfonic acid, epsilon-aminocaproic acid, citric acid, acetic acid, sodium hydroxide. , Potassium hydroxide, calcium hydroxide, magnesium hydroxide, sodium hydrogen carbonate, sodium carbonate, borax, triethanolamine, monoethanolamine, diisopropanolamine, sulfuric acid, magnesium sulfate, phosphoric acid, polyphosphoric acid, propionic acid, shu Acid, gluconic acid, fumaric acid, lactic acid, tartaric acid, malic acid, succinic acid, gluconolactone, ammonium acetate and the like; as the stabilizer, for example, dibutyl hydroxytoluene, trometamol, sodium formaldehyde sulfoxylate (Rongalit), Tocopherol, sodium pyrosulfite, monoethanolamine, aluminum monostearate, glyceryl monostearate, Sodium bisulfite, sodium sulfite, etc.; as the oily base, for example, vegetable oil such as olive oil, corn oil, soybean oil, sesame oil, cottonseed oil, medium-chain fatty acid triglyceride, etc.; as the aqueous base, for example, Macrogol 400 Etc.; as the gel base, for example, carboxyvinyl polymer, gum, etc.; as the surfactant, for example, polysorbate 80, hydrogenated castor oil, glycerin fatty acid ester, sorbitan sesquioleate, etc.; suspending agent As, for example, beeswax wax and various surfactants, gum arabic, gum arabic powder, xanthan gum, soybean lecithin and the like; as the binder, for example, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, sodium carboxymethyl cellulose, polyvinyl Pyrrolidone, polyvinyl alcohol, etc.; Excipients, for example, sucrose, lactose, starch, corn starch, crystalline cellulose, light anhydrous silicic acid, etc.; Lubricants, for example, sucrose fatty acid ester, magnesium stearate , Talc and the like; disintegrators such as low-substituted hydroxypropylcellulose, crospovidone, croscarmellose sodium and the like; foaming agents such as sodium hydrogencarbonate and the like; fluidizing agents such as Examples thereof include sodium aluminometasilicate and light anhydrous silicic acid.

The therapeutic agent for immune diseases or the anti-inflammatory agent of the present invention can be provided in various forms depending on the purpose, for example, various dosage forms such as solid dosage forms, semi-solid dosage forms and liquid dosage forms. For example, solid agents (tablets, powders, powders, granules, capsules, etc.), semi-solid agents [ointments (hard ointments, ointments, etc.), creams], liquids [lotions, extracts, suspensions] Suspensions, emulsions, syrups, injections (including infusions, embedded injections, continuous injections, ready-to-use injections), dialysis agents, aerosols, soft capsules, drinks, etc.], patches It can be used in the form of agents, poultices and the like. The therapeutic agent for immune diseases or anti-inflammatory agent of the present invention can also be used in the form of a solution or emulsion in an oily or aqueous vehicle. Further, the therapeutic agent or anti-inflammatory agent for immune diseases of the present invention can be applied to the affected area by spraying, and the therapeutic agent or anti-inflammatory agent for immune diseases of the present invention is gelated or formed into a sheet at the affected area after spraying. But it can be used. The immune disease therapeutic agent or anti-inflammatory agent of the present invention can be applied to the affected area after the mesenchymal stem cells are formed into a sheet or a three-dimensional structure.

The immunological disease therapeutic agent or anti-inflammatory agent of the present invention is physiological saline, Japanese saline solution, 5% glucose solution, Japanese glucose injection solution, Ringer's solution, Japanese Ringer's solution, lactated Ringer's solution, acetate Ringer's solution, bicarbonate Ringer's solution, Solution 1 (starting solution), solution 2 (dehydration replenisher), solution 3 (maintenance solution), solution 4 (postoperative recovery solution), or a cell culture medium such as DMEM, It can be used by suspending or diluting, and is preferably suspended in physiological saline, 5% glucose solution, No. 1 solution (starting solution), more preferably in 5% glucose solution, No. 1 solution (starting solution), or It can be diluted and used.

When the therapeutic agent for immune diseases and the anti-inflammatory agent of the present invention are liquids, the pH of the therapeutic agent for immune diseases and the anti-inflammatory agent is within a pharmaceutically, pharmacologically (pharmaceutically) or physiologically acceptable range. It is not particularly limited as long as it is present, but an example is a range of 2.5 to 9.0, preferably 3.0 to 8.5, and more preferably 3.5 to 8.0.

When the therapeutic agent for immune diseases and the anti-inflammatory agent of the present invention are liquids, the osmotic pressure of the therapeutic agent for immune diseases and the anti-inflammatory agent is not particularly limited as long as it is within the range that is acceptable for the living body. An example of the osmotic pressure ratio of the composition of the present invention is a range of preferably 0.7 to 5.0, more preferably 0.8 to 3.0, and further preferably 0.9 to 1.4. The osmotic pressure can be adjusted by a method known in the art using an inorganic salt, a polyhydric alcohol, a sugar alcohol, a saccharide or the like. The osmotic pressure ratio is the ratio of the osmotic pressure of the sample to the osmotic pressure of 286 mOsm (0.9 w/v% sodium chloride aqueous solution) based on the 15th revised Japanese Pharmacopoeia, and the osmotic pressure is the osmotic pressure measurement method described in the Japanese Pharmacopoeia ( Freezing point depression method) The standard solution for measuring the osmotic pressure ratio (0.9 w/v% sodium chloride aqueous solution) was dried in sodium chloride (Japanese Pharmacopoeia standard reagent) at 500 to 650° C. for 40 to 50 minutes, and then in a desiccator (silica gel). Allow to cool, measure exactly 0.900 g of it, dissolve in purified water to prepare exactly 100 mL, or use a commercially available standard solution for osmotic pressure ratio measurement (0.9 w/v% sodium chloride aqueous solution).

The route of administration of the therapeutic agent for immune diseases and the anti-inflammatory agent of the present invention to the subject is oral administration, subcutaneous administration, intramuscular administration, intravenous administration, intraarterial administration, umbilical cord intravenous administration, intracerebroventricular administration, intrathecal administration. , Intraperitoneal administration, sublingual administration, transrectal administration, transvaginal administration, intraocular administration, nasal administration, inhalation, transdermal administration, implant, direct administration by spraying on the surface of an organ and sticking a sheet, etc. However, from the viewpoint of the efficacy of the therapeutic agent for immune diseases and the anti-inflammatory agent of the present invention, it is preferably intraarterial administration, intravenous administration and intraventricular administration, and more preferably intravenous from the viewpoint of reducing the burden on the subject. Inner administration, intramuscular administration, intranasal administration are preferred.

In the therapeutic agent for immune diseases and anti-inflammatory agent of the present invention, the dose (dosage) depends on the patient's condition (weight, age, symptoms, physical condition, etc.), and the dosage form of the therapeutic agent for anti-inflammatory diseases and anti-inflammatory agent of the present invention. Although it may vary depending on the like, from the viewpoint of exhibiting sufficient therapeutic effect of the therapeutic agent for immune diseases and anti-inflammatory agent, the larger amount tends to be preferable, while the amount from the viewpoint of suppressing the occurrence of side effects is A smaller amount tends to be preferable. Usually, when administered to an adult, the number of cells is 1×10 ³ to 1×10 ¹² cells/time, preferably 1×10 ⁴ to 1×10 ¹¹ cells/time, more preferably 1×10 ⁵ to It is 1×10 ¹⁰ pieces/time, more preferably 5×10 ⁶ to 1×10 ⁹ pieces/time. The dose per body weight of the patient is 1×10 to 5×10 ¹⁰ cells/kg, preferably 1×10 ² to 5×10 ⁹ cells/kg, and more preferably 1×10 ³ to 5×10 5. ⁸ pieces/kg, more preferably 1×10 ⁴ to 5×10 ⁷ pieces/kg. When administered to a newborn, the number of cells is 1×10 ³ to 1×10 ¹¹ cells/time, preferably 1×10 ⁴ to 1×10 ¹⁰ cells/time, more preferably 1×10 ⁵ to 1×. The number is 10 ⁹ pieces/time, more preferably 5×10 ⁵ to 5×10 ⁸ pieces/time. The dose per body weight of the patient is 1×10 to 5×10 ¹⁰ cells/kg, preferably 1×10 ² to 5×10 ⁹ cells/kg, and more preferably 1×10 ³ to 5×10 5. ⁸ pieces/kg, more preferably 1×10 ⁴ to 5×10 ⁷ pieces/kg. It should be noted that this dose may be a single dose and may be administered in multiple doses, or the dose may be administered in multiple doses.

The therapeutic agent for immune diseases and the anti-inflammatory agent of the present invention may be administered together with one or more other drugs. The other drug includes any drug that can be used as a therapeutic agent for immune disorders or an anti-inflammatory agent, and examples thereof include abciximab, adalimumab, alemtuzumab, basiliximab, bavacizumab, cetuximab, daclizumab, efalizumab, gemtuzumab, infliximab, infliximab, infliximab, and infliximab. Monoclonal antibodies such as mepolizumab, OKT3, omaluzumab, palivizumab, pexelizumab, rituximab, tositumomab, trastuzumab, alefacept, fusion protein such as denileukin diftitox, etanercept, soluble cytokine receptors such as anakinra, IFN-IF, IFN-β, IFN-IF. -Γ, IL-2, IL-11, G-CSF, GM-CSF, and other cytokines, azatadine maleate, brompheniramine maleate, chlorpheniramine maleate, clemastine fumarate, cyproheptadine hydrochloride, d chlorphene maleate Lamin, diphenhydramine hydrochloride, diphenylpyraline hydrochloride, hydroxyzine hydrochloride, metzirazine hydrochloride, promethazine hydrochloride, trimeprazine tartrate, loeiperenamine citrate, triperenamine hydrochloride, triprrolidine hydrochloride, acrivastine, cetirizine, desloratadine, ebastine, fexofenadine , H1 blockers such as levocetirizine, loratadine and mizolastine, H2 blockers such as cimetidine, beclomethasone dipropionate, budesonide, flunisolide, fluticasone, corticosteroids such as triamcinolone acetonide, dexamethasone, methylprednisolone, obesity cell stable such as cromolyn, nedocromil, etc. Drugs, β-agonists such as albuterol, cytotoxic drugs such as daunomycin, etoposide, 6-mercaptopurine, antihistamines, NSAIDs, epinephrine, glucagon, and aspirin. In addition, cryotherapy can be combined with administration of the therapeutic agent for immune diseases or anti-inflammatory agent of the present invention.

The mesenchymal stem cells of the present invention can be used for various autoimmune diseases and inflammatory diseases. Specific diseases include GVHD, cartilage degradation, rheumatoid arthritis, systemic lupus erythematosus, psoriatic arthritis, spondyloarthritis, and deformity. Osteoarthritis, gout, psoriasis, multiple sclerosis, amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, congestive heart failure, stroke, aortic stenosis, renal failure, nephrotic syndrome, uremia, lupus, pancreatitis , Allergy, fibrosis, anemia, atherosclerosis, restenosis, chemotherapy/radiation related complications, type I diabetes, type II diabetes, liver failure, autoimmune hepatitis, hepatitis C, primary biliary cirrhosis , Primary sclerosing cholangitis, fulminant hepatitis, celiac disease, nonspecific colitis, intestinal lymphangiectasia, protein-losing enteropathy, Crohn's disease, allergic conjunctivitis, diabetic retinopathy, Sjogren's syndrome, atopic Disease, uveitis, allergic rhinitis, food allergy, anaphylaxis, autoimmune disease, drug hypersensitivity, mastocytosis, asthma, asbestosis, silicosis, chronic obstructive pulmonary disease, chronic granulomatous inflammation, cystic fibrosis , Histiocytosis, sarcoidosis, glomerulonephritis, vasculitis, dermatitis, HIV-related cachexia, cerebral malaria, ankylosing spondylitis, leprosy, COPD, pulmonary fibrosis, fibromyalgia, esophageal cancer, etc. , Gastroesophageal reflux disease, Barrett's esophagus, aplastic anemia, graft-versus-host disease, sickle cell disease, CVID, high IgM syndrome, IgA deficiency, transient hypogammaglobulinemia, X-linked agammaglobulinemia Disease, chronic cutaneous mucosal candidiasis, Di George syndrome, X-linked lymphoproliferative syndrome, ataxia-telangiectasia, cartilage dysplasia, combined immunodeficiency, high IgE syndrome, MHC deficiency, severe combined immunity Deficiency, Viscott-Aldrich syndrome, Chediak-East syndrome, chronic granulomatous disease, leukocyte adhesion deficiency, IFN-γ receptor deficiency, interleukin (IL)-12 deficiency, IL-12 receptor β1 deficiency, Examples include ZAP-70 deficiency and angioedema.

The present invention is characterized by using mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount, a method for treating an immune disease, kynurenine synthesized from tryptophan by IDO induced intracellularly by IFNγ treatment. A method for treating an immune disease, characterized by using mesenchymal stem cells having high production or kynurenine secretion, characterized by using mesenchymal stem cells in which JAK/STAT pathway is activated in a steady state Also included are methods of treating immune disorders. Further, the present invention is characterized by using mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount, a method for treating an inflammatory disease, and IDO induced intracellularly by IFNγ treatment to synthesize from tryptophan. Method for treating inflammatory diseases, characterized by using mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount, and using mesenchymal stem cells in which the JAK/STAT pathway is activated in a steady state Also included is a method for treating an inflammatory disease, which is characterized in that Furthermore, the present invention is characterized by using mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount, a method for treating GVHD, and IDO induced intracellularly by IFNγ treatment to synthesize from tryptophan. A method for treating GVHD, characterized by using mesenchymal stem cells having a high kynurenine production amount or a high kynurenine secretion amount, characterized by using mesenchymal stem cells in which the JAK/STAT pathway is activated in a steady state, The method of treating GVHD is also included. In addition, regarding the description of each wording, the description regarding the mesenchymal stem cells, the therapeutic agent for immune diseases, the anti-inflammatory agent, and the therapeutic agent for GVHD can be applied.

Hereinafter, the present invention will be described in detail with reference to Examples and Test Examples, but the present invention is not limited to these Examples and the like.

[Preparation and culture of umbilical cord-derived mesenchymal stem cells (UCMSC-EXP, UCMSC-CP)]
Umbilical cord-derived cells were collected by the method described in Cytotherapy, 18, 229-241, 2016. Briefly, with the approval of the Ethics Committee of the Institute of Medical Science, the University of Tokyo, the umbilical cord collected with the consent of the donor was shredded into 1 to 2 mm ³ pieces and seeded on a culture dish. Then, cell amigo (Tsubakimoto Chain Co., Ltd.) is covered, and the cells are cultured in α-minimal essential medium (MEM-α) supplemented with 10% fetal bovine serum (FBS) and antibiotics by the “improved explant method”. Umbilical cord-derived mesenchymal stem cells (hereinafter referred to as "UCMSC-EXP") were obtained.

Similarly, umbilical cord-derived cells were collected by the method described in Cytotherapy, 18, 229-241, 2016, and after obtaining the approval of the Ethics Committee of the Institute of Medical Science, University of Tokyo, with the consent of the donor. The collected umbilical cord was cut into a size of 1 to 2 mm ³ , treated with collagenase, and then centrifuged (400×g for 5 minutes) to obtain cells, which were then used as serum-free medium for mesenchymal stem cells (Rohto Umbilical cord-derived mesenchymal stem cells (hereinafter referred to as "UCMSC-CP") were obtained by "collagenase method" in which the cells were adherently cultured in a culture flask.

Regarding the passage number, the cells obtained from the umbilical cord tissue by the above-mentioned improved explant method or collagenase method were used as the first passage cells (P1). Cell (P2), third passage cell (P3), etc.

The obtained UCMSC-EXP and UCMSC-CP were detached using a cell detachment solution (TrypLE Select (1X)), transferred to a centrifuge tube, and centrifuged at 400×g for 5 minutes to obtain a cell precipitate. .. After removing the supernatant, an appropriate amount of cell cryopreservation solution (STEM-CELLBANKER (Zenoac)) was added and suspended. The cell suspension solution was dispensed into a cryotube and stored at -80°C in a freezer. Then, it moved to the vapor phase on liquid nitrogen, and continued preservation.

[Measurement of intracellular kynurenine amount in flat culture cells (ADH) and suspension culture cells (SUS)]
UMCSC-EXP, which is the umbilical cord tissue-derived frozen cells obtained by the improved explant method described above, were put to sleep, and the cell suspension containing the cells and the microcarriers were mixed, added to the culture tank, and the mesenchyme was added. Stirring culture was performed using a serum-free medium for line stem cells (Rohto) to obtain suspension-cultured cells (hereinafter referred to as “EXP-SUS”) for 8 days. Similarly, the above-described UCMSC-EXP was put to sleep, cells were seeded in a cell culture flask, subjected to flat culture using a serum-free medium for mesenchymal stem cells (Rohto), and cultured for 8 days to obtain flat culture cells ( Hereinafter referred to as "EXP-ADH"). The cell contents of flat culture cells (EXP-ADH) or suspension culture cells (EXP-SUS) obtained by a culture period of 8 days by the above method were extracted, and the cells were intracellularized by capillary electrophoresis and LC-MS. A comprehensive analysis (metabolome analysis) of accumulated metabolites was performed. As a result, it was found that the intracellular kynurenine accumulation amount was higher in EXP-SUS than in EXP-ADH (FIG. 1). In addition, the amount of kynurenine in the culture supernatant was quantified by an ELISA method (Immundiagnostic GmbH, product number K7728). This quantification method also resulted in a higher intracellular kynurenine accumulation amount after 8 days of culture in EXP-SUS than in EXP-ADH (FIG. 2). This revealed that intracellular kynurenine production was enhanced by suspension culture in the steady state.

[Measurement of kynurenine production and IDO activity of suspension culture cells (SUS) and flat culture cells (ADH) 1]
The above-mentioned frozen cells of umbilical cord tissue-derived UCMSC-CP obtained by the collagenase method were put to sleep, and the cell suspension containing the cells and the microcarriers were mixed and added to a culture tank to give mesenchymal stem cells. Stirring culture was performed using a serum-free medium (Rohto) for 4 days to obtain suspension-cultured cells (hereinafter referred to as "CP-SUS"). Similarly, the aforementioned UCMSC-CP was put to sleep, the cells were seeded in a cell culture flask, and the cells were subjected to flat culture using a serum-free medium for mesenchymal stem cells (Rohto), and cultured for 4 days to obtain flat culture cells ( Hereinafter, referred to as "CP-ADH"). IFNγ (product number: AF-300-02, manufactured by PeproTeck, Inc.) was added in an amount to give final concentrations of 100 ng/mL and 200 ng/mL, and the amount of kynurenine in the cell supernatant after 48 hours was determined using the Ehrlich reagent. (IFNγ concentration of 100 ng/mL group and 200 ng/mL group). In addition, in order to confirm that this reaction was mediated by IDO, IFNγ (100 ng/mL) was added, and at the same time, an IDO inhibitor (30 nM, Epacadostat, CAS No: 1204669-58-8) was added. A group (inhibitor group) was also set up. As a control, kynurenine in the culture supernatant was also quantified for a control group to which IFNγ was not added. In addition, the cell activity of each mesenchymal stem cell was measured by WST-8 (Cell Counting Kit-8, Dojindo Laboratories) to correct the measured value of kynurenine. Results are shown in FIG. Since the kynurenine production was suppressed by the IDO inhibitor, the IDO activity can be evaluated using the kynurenine production ability of each sample as an index.

It was revealed that CP-SUS released more kynurenine in response to IFNγ stimulation into the culture supernatant than CP-ADH under all conditions. From this, it was found that CP-SUS was higher than CP-ADH in the induction and activation of IDO by IFNγ stimulation, the accompanying production of kynurenine in the cell, and the higher secretion ability into the culture supernatant (Fig. 3).

[Measurement of kynurenine production and IDO activity of suspension culture cells (SUS) and flat culture cells (ADH) 2]
The above-mentioned umbilical cord tissue-derived frozen cells (UCMSC-EXP) were put to sleep, the cell suspension containing the cells and the microcarriers were mixed, added to a culture tank, and serum-free medium for mesenchymal stem cells (Rohto ) Was used to carry out agitation culture to obtain suspension-cultured cells for 8 days (hereinafter referred to as "EXP-SUS"). Similarly, the above-mentioned umbilical cord tissue-derived frozen cells (UCMSC-EXP) were put to sleep, and the cells were seeded in a cell culture flask and subjected to flat culture using a serum-free medium for mesenchymal stem cells (Rohto). After culturing for one day, the cells were subcultured and further cultivated for 4 days to obtain flat-cultured cells (hereinafter referred to as "EXP-ADH"). IFNγ (product number: AF-300-02, manufactured by PeproTeck, Inc.) was added in an amount to give final concentrations of 50 ng/mL and 100 ng/mL, and the amount of kynurenine in the cell supernatant after 64 hours was determined by the Ehrlich reagent. (IFNγ concentration of 50 ng/mL group and 100 ng/mL group). As a control, kynurenine in the culture supernatant was also quantified for a control group to which IFNγ was not added. In addition, the cell activity of each mesenchymal stem cell was measured by WST-8 (Cell Counting Kit-8, Dojindo Laboratories), the kynurenine production value was corrected, and the kynurenine-producing ability of each sample was used as an index for the IDO activity. Was evaluated. The IDO activity ratio was calculated by setting the IDO/WST8 value of the EXP-ADH control group to 1 (FIG. 4).

It was revealed that EXP-SUS has higher IDO activity under any condition than EXP-ADH. From this, it was found that EXP-SUS was higher than EXP-ADH in the induction and activation of IDO by IFNγ stimulation, the accompanying production of kynurenine in the cell, and the higher secretion ability into the culture supernatant.

[Measurement of kynurenine production and IDO activity of suspension culture cells (SUS) and flat culture cells (ADH) 3]
The above-mentioned umbilical cord tissue-derived frozen cells (UCMSC-CP) were put to sleep, the cell suspension containing the cells and the microcarriers were mixed, added to a culture tank, and serum-free medium for mesenchymal stem cells (Rohto) ) Was used to carry out agitation culture to obtain suspension-cultured cells for 8 days (hereinafter referred to as "CP-SUS"). Similarly, UCMSC-CP was put to sleep, the cells were seeded in a cell culture flask, and the cells were subjected to flat culture using a serum-free medium for mesenchymal stem cells (Rohto), and cultured for 8 days. , "CP-ADH") was obtained. IFNγ (product number: AF-300-02, manufactured by PeproTeck, Inc.) was added in an amount to give final concentrations of 50 ng/mL and 100 ng/mL, and the amount of kynurenine in the cell supernatant after 64 hours was determined by the Ehrlich reagent. (IFNγ concentration of 50 ng/mL group and 100 ng/mL group). The IDO activity was also measured for a control group to which IFNγ was not added as a comparison target. In addition, the cell activity of each mesenchymal stem cell was measured by WST-8 (Cell Counting Kit-8, Dojindo Laboratories), the kynurenine production value was corrected, and the kynurenine-producing ability of each sample was used as an index for the IDO activity. Was evaluated. The IDO activity ratio was calculated by setting the IDO/WST8 value of the CP-ADH control group to 1 (FIG. 5).

It was revealed that CP-SUS has higher IDO activity under all conditions than CP-ADH. From this, it was found that CP-SUS was higher than CP-ADH in the induction and activation of IDO by IFNγ stimulation, the accompanying production of kynurenine in cells, and the secretion ability into the culture supernatant.

[Measurement of kynurenine production and IDO activity of suspension culture cells (SUS) and flat culture cells (ADH) 4]
The above-mentioned umbilical cord tissue-derived frozen cells (UCMSC-CP) were put to sleep, the cell suspension containing the cells and the microcarriers were mixed, added to a culture tank, and serum-free medium for mesenchymal stem cells (Rohto) ) Was used to carry out agitation culture to obtain suspension-cultured cells for 8 days (hereinafter referred to as "CP-SUS"). Similarly, the above-mentioned umbilical cord tissue-derived frozen cells (UCMSC-CP) were put to sleep, and the cells were seeded in a cell culture flask and subjected to flat culture using a serum-free medium for mesenchymal stem cells (Rohto). The cells were cultured for one day to obtain flat culture cells (hereinafter referred to as "CP-ADH"). IFNγ (product number: AF-300-02, manufactured by PeproTeck, Inc.) was added in an amount to give final concentrations of 50 ng/mL and 100 ng/mL, and the amount of kynurenine in the cell supernatant 90 hours later was determined by the Ehrlich reagent. (IFNγ concentration of 50 ng/mL group and 100 ng/mL group). The IDO activity was also measured for a control group to which IFNγ was not added as a comparison target. In addition, the cell activity of each mesenchymal stem cell was measured by WST-8 (Cell Counting Kit-8, Dojindo Laboratories), the kynurenine production value was corrected, and the kynurenine-producing ability of each sample was used as an index for the IDO activity. Was evaluated. The IDO activity ratio was calculated by setting the IDO/WST8 value of the CP-ADH control group to 1 (FIG. 6).

[Measurement of kynurenine production and IDO activity of suspension culture cells (SUS) and flat culture cells (ADH) 5]
The above-mentioned umbilical cord tissue-derived frozen cells (UCMSC-EXP) were put to sleep, the cell suspension containing the cells and the microcarriers were mixed, added to a culture tank, and serum-free medium for mesenchymal stem cells (Rohto ) Was used to carry out agitation culture to obtain suspension-cultured cells for 8 days (hereinafter referred to as "EXP-SUS"). Similarly, the above-mentioned umbilical cord tissue-derived frozen cells (UCMSC-EXP) were put to sleep, and the cells were seeded in a cell culture flask and subjected to flat culture using a serum-free medium for mesenchymal stem cells (Rohto) for 8 days. The cells were cultured to obtain flat culture cells (hereinafter referred to as "EXP-ADH"). IFNγ (product number: AF-300-02, manufactured by PeproTeck, Inc.) was added in an amount to give final concentrations of 50 ng/mL and 100 ng/mL, and the amount of kynurenine in the cell supernatant 90 hours later was determined by the Ehrlich reagent. Was measured by a colorimetric method using (50 ng/mL group and 100 ng/mL group). The IDO activity was also measured for a control group to which IFNγ was not added as a comparison target. In addition, the cell activity of each mesenchymal stem cell was measured by WST-8 (Cell Counting Kit-8, Dojindo Laboratories), the kynurenine production value was corrected, and the kynurenine-producing ability of each sample was used as an index for the IDO activity. Was evaluated. The IDO activity ratio was calculated by setting the IDO/WST8 value of the EXP-ADH control group to 1 (FIG. 7).

[Measurement of kynurenine production and IDO activity of umbilical cord tissue-derived mesenchymal stem cells and other cells]
The above-mentioned umbilical cord tissue-derived frozen cells (UCMSC-CP) were put to sleep, and the cells were seeded in a cell culture flask and then plated using a serum-free medium for mesenchymal stem cells (Rohto) or a MEMα medium containing 10% serum. The cells were cultured and cultured for 8 days to obtain flat-cultured cells (hereinafter referred to as "UCMSC-SF" and "UCMSC-MEM", respectively). In addition, MRC-5 cells (ATCC) and human newborn-derived skin fibroblasts (HDF, ScienceCell Research Laboratories) were thawed and subjected to flat culture for 3 days using MEMα medium containing 10% serum. Obtained. Further, human umbilical vein endothelial cells (HUVEC, PromoCell) were thawed and subjected to planar culture for 3 days using Endotherial cell growth medium (PromoCell, product number C-22210) to obtain planar cultured cells. UCMSC-SF, UCMSC-MEM, MRC-5, HDF and HUVEC were each cultured at 30,000 cells/cm ² for 4 days, and the culture supernatant was recovered. The amount of kynurenine in the culture supernatant was measured by a colorimetric method using Ehrlich reagent. In addition, the cell activity of each mesenchymal stem cell was measured by WST-8 (Cell Counting Kit-8, Dojindo Laboratories), the kynurenine production value was corrected, and the kynurenine-producing ability of each sample was used as an index for the IDO activity. Was evaluated (FIG. 8).

UCMSC-SF was found to have higher IDO activity than UCMSC-MEM. Further, it was revealed that UCMSC-SF and UCMSC-MEM have higher IDO activity than MRC-5, HDF and HUVEC. As a result, umbilical cord tissue-derived mesenchymal stem cells cultured in a serum-free medium for mesenchymal stem cells produced kynurenine in cells and cultured compared to umbilical cord tissue-derived mesenchymal stem cells cultured in MEMα containing 10% serum. It was found that the secretory ability into the supernatant was high. Further, it was found that umbilical cord tissue-derived mesenchymal stem cells have higher intracellular kynurenine production and higher secretory ability into the culture supernatant than MRC-5, HDF and HUVEC.

[Comparison of flat culture cells (ADH) and suspension culture cells (SUS) by microarray analysis]
Total RNA was extracted from the flat-cultured cells (EXP-ADH) or the suspension-cultured cells (EXP-SUS) obtained by the above method for a culture period of 8 days according to a conventional method to synthesize cDNA. Agilent SurePrint G3 Human GE Microarray 8x60K Ver. The expressed genes were comprehensively analyzed by 3.0. As a result, 33 out of 155 genes related to the JAK-STAT signal pathway registered in Kyoto Encyclopedia of Genes and Genomes (KEGG) were compared to EXP-ADH in the steady state, and in EXP-SUS, 1. The expression was higher than 5-fold. When arranged in descending order of the ratio of the expression level in EXP-ADH to the expression level in EXP-SUS (expression ratio), CSF3, CSF2, LIF, IL6, IL6R, STAT4, CNTFR, GHR, CBLB, IL15, IL6ST, IL10, The order was CLCF1, CCND2, IL11RA, IL15RA, PIM1, SOCS1, STAT2, IL19, IL7, IL24, IL22RA1, SOCS3, JAK2, IFNAR1, IFNAR2, IFNGR2, PRL, LIFR, SPRY2, AKT3, IL4R. FIG. 9 shows the expression level ratios of the top 9 genes.

[Quantitative analysis of IDO expression in IFNγ-stimulated UC-MSC]
According to the above method, a frozen stock of flat culture cells (EXP-ADH) or suspension culture cells (EXP-SUS) obtained by culturing for 7, 14 or 21 days was thawed, seeded on a cell culture plate, and IFNγ ( No. 300-02, manufacturer PEPROTECH) was added, and the cells were cultured for 2 days. Then, total RNA was extracted using NucleoSpin RNA (product number 740955.50, manufacturer MACHERY-NAGEL), and PrimeScript (registered trademark) RT reagent kit (Primescript (registered trademark) RT reagent kit RR037B, manufactured by manufacturer RR0ar). After synthesizing, real-time PCR was performed using SYBR (registered trademark) Premix Ex Taq (trademark) II (part number RR081A, manufacturer Takara) with PikoReal96 (manufacturer Thermo), and analyzed with PikoReal Software 2.0 (manufacturer Thermo). The IDO expression level of SUS was calculated when the IDO expression level of ADH in each culture period was set to 1 (Table 1). The primer sequences used are as follows.

IDO: GGG ACA CTT TGC TAA AGG CG (F; SEQ ID NO: 1) and GTC TGA TAG CTG GGG GTT GC (R; SEQ ID NO: 2)
GAPDH: AGC CTC AAG ATC ATC AGC AAT G (F; SEQ ID NO: 3) and ATG GAC TGT GGT CAT GAG TCC TT (R; SEQ ID NO: 4)

EXP-SUS was higher than EXP-ADH in the expression of IDO by IFNγ stimulation in cells of any culture days.

[Evaluation of UC-MSC administration effect in GVHD model mouse]
Human PBMCs were transplanted into NOG mice (5×10 ⁶ cells/body), and 1 week later, once a week, a total of 4 suspension culture cells (EXP-SUS) were administered through the tail vein. The high-dose group (EXP-SUS high) and the low-dose group (EXP-SUS low) each received 1×10 ⁷ cells/kg and 2×10 ⁶ cells/kg of the single administration. As a result of the follow-up observation for a total of 6 weeks, suppression of weight loss due to GVHD (FIG. 10) and suppression of decrease in survival rate due to GVHD were observed in the EXP-SUS administration group as compared with the control group (FIG. 11). From this, it was found that EXP-SUS was effective against GVHD.

[Study of anti-inflammatory effect in UC-MSC]
Human-derived monocytic THP1 cells were seeded in a 12-well plate at 3×10 ⁴ cells/well, and Phorbol 12-Myristate 13-Acetate (PMA, product number 162-23591, FUJIFILM Wako Pure Chemical Industries, Ltd.) at 100 nM. The cells were added and cultured for 3 days. By the above-mentioned method, a frozen stock of flat culture cells (EXP-ADH) or suspension culture cells (EXP-SUS) obtained by culturing for 8 days was thawed and seeded at 40,000 cells/well on a cell culture insert. , PMA-stimulated THP1 cells were placed in the seeded well, and 1 μg/mL of Lipopolysaccharide (LPS, product number 14874-24, InvivoGen) was added. Two days later, total RNA was extracted from THP1 cells, and the CCL2 gene expression level was analyzed by the real-time PCR method (FIG. 12). The primer sequences used are as follows.

CCL2: AAGAAGCTGTGATCTTCAAGAC (F; SEQ ID NO: 5) and CCATGGAATCCTGAACCCA (R; SEQ ID NO: 6)

Compared to the case without LPS stimulation (untreated group), LPS stimulation increased CCL2 mRNA expression (LPS group), but its expression was suppressed by co-culture with EXP-SUS and EXP-ADH. Furthermore, the result that EXP-SUS had a larger inhibitory ability was obtained (FIG. 12). From this, it was found that EXP-SUS and EXP-ADH are effective against inflammation, and especially EXP-SUS has an excellent anti-inflammatory effect.

According to the present invention, a therapeutic agent for immune diseases and an anti-inflammatory agent can be provided.

Claims

A mesenchymal stem cell characterized by high kynurenine production or high kynurenine secretion.
A mesenchymal stem cell characterized by having a high amount of kynurenine synthesized from tryptophan or a high amount of kynurenine secreted by IDO induced intracellularly by IFNγ treatment.
A mesenchymal stem cell characterized in that the JAK/STAT pathway is activated in a steady state.
The mesenchymal stem cell according to any one of claims 1 to 3, which is derived from umbilical cord tissue.
An agent for treating an immune disease, which comprises the mesenchymal stem cells according to any one of claims 1 to 4.
An anti-inflammatory agent containing the mesenchymal stem cells according to any one of claims 1 to 4.
A therapeutic agent for GVHD, comprising mesenchymal stem cells according to any one of claims 1 to 4.