WO2020117867A1 - Darinaparsin and retinoic acid compounds for treatment of idh-associated disorders - Google Patents

Darinaparsin and retinoic acid compounds for treatment of idh-associated disorders Download PDF

Info

Publication number
WO2020117867A1
WO2020117867A1 PCT/US2019/064326 US2019064326W WO2020117867A1 WO 2020117867 A1 WO2020117867 A1 WO 2020117867A1 US 2019064326 W US2019064326 W US 2019064326W WO 2020117867 A1 WO2020117867 A1 WO 2020117867A1
Authority
WO
WIPO (PCT)
Prior art keywords
retinoic acid
leukemia
cells
darinaparsin
acid compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/064326
Other languages
French (fr)
Inventor
Pier Paolo Pandolfi
John Clohessy
Vera MUGONI
Ming Chen
Giulia CHELONI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beth Israel Deaconess Medical Center Inc
Original Assignee
Beth Israel Deaconess Medical Center Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beth Israel Deaconess Medical Center Inc filed Critical Beth Israel Deaconess Medical Center Inc
Publication of WO2020117867A1 publication Critical patent/WO2020117867A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/28Compounds containing heavy metals
    • A61K31/285Arsenic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/20Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A61K31/203Retinoic acids ; Salts thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/24Heavy metals; Compounds thereof
    • A61K33/36Arsenic; Compounds thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia

Definitions

  • Isocitrate dehydrogenase enzymes are key metabolic enzymes. Mutations to IDH1 and IDH2 have been identified as important early events in a variety of tumor types. For example, IDH enzymes are mutated in approximately 20% of human acute myeloid leukemias (AMLs). Pathogenic mutants of IDH enzymes have been identified that give rise to 2-hydroxyglutarate (2-HG), an oncometabolite that contributes to the oncogenic phenotype. Accordingly, 2-HG is a predictive biomarker in cancers having a pathogenic IDH1 or IDH2 allele.
  • 2-HG 2-hydroxyglutarate
  • IDH2-targeting Enasidenib AG-221
  • mIDH2 mutant form of IDH2
  • mIDH i.e., mIDHI and mIDH2
  • leukemias may adjust and evolve in response to treatment. Therefore, there is a need to identify common vulnerabilities in mIDH leukemias, and to develop rational therapies capable of preventing or overcoming resistance that arises in response to therapy.
  • the present invention is based on the discovery of common vulnerabilities in mIDH leukemia.
  • mIDH leukemia exhibits sensitivity to reactive oxygen species (ROS)-producing compounds, such as arsenic trioxide (ATO) and Darinaparsin.
  • ROS reactive oxygen species
  • ATO arsenic trioxide
  • ATRA retinoic acid compound-induced differentiation
  • the inventors have further shown that treatment of leukemia with the combination of a ROS promoting compound (e.g., arsenic trioxide and Darinaparsin) and a compound that promotes differentiation (e.g., a Pinl inhibitor, such as ATRA) provides a synergistic, powerful, and well-tolerated targeted therapy in both mouse and human models of AML.
  • a ROS promoting compound e.g., arsenic trioxide and Darinaparsin
  • a compound that promotes differentiation e.g., a Pinl inhibitor, such as ATRA
  • the present invention therefore features methods of treating cancer by contacting the cells of the cancer with a pharmaceutical compound.
  • the pharmaceutical compound can be Darinaparsin, a retinoic acid compound (e.g., ATRA), or a combination of Darinaparsin and a retinoic acid compound (e.g., Darinaparsin and ATRA).
  • the cancer can be a leukemia (e.g., mIDHl/mIDH2 leukemia) or a solid tumor (e.g., an IDH1- or IDH2-associated solid tumor).
  • a leukemia e.g., mIDHl/mIDH2 leukemia
  • a solid tumor e.g., an IDH1- or IDH2-associated solid tumor.
  • the solid tumors include, but are not limited to, glioma, paraganglioma, astroglioma, colorectal carcinoma, melanoma, cholangiocarcinoma, chondrosarcoma, thyroid carcinomas, prostate cancers, and non-small cell lung cancer.
  • the invention features a method of treating leukemia in a subject.
  • the method includes contacting the cells of said leukemia with (e.g., by administering to said subject) an effective amount of a pharmaceutical compound, the pharmaceutical compound being Darinaparsin, a retinoic acid compound, or a combination thereof, wherein one or more cells of the leukemia has a pathogenic IDH2 allele or has elevated 2- hydroxyglutarate (2-HG) levels; and wherein contacting said cells of said leukemia with said pharmaceutical compound treats said leukemia in said subject.
  • the invention features a method of treating leukemia in a subject, wherein one or more cells of the leukemia has a pathogenic IDH1 allele or has elevated 2-HG levels.
  • the method includes contacting the cells of said leukemia with (e.g., by administering to said subject) an effective amount of a pharmaceutical compound, the pharmaceutical compound being Darinaparsin, a retinoic acid compound, or a combination thereof, wherein contacting said cells of said leukemia with said pharmaceutical compound treats said leukemia in said subject.
  • Elevated 2-HG levels may be considered to include detection of any 2-HG at all.
  • a pathological level of 2-HG associated with an IDH1/IDH2 cancer may be determined by levels of 2-HG at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the 2-HG levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
  • a normal e.g., wild-type and/or disease fee
  • Elevated 2-HG levels can be determined via (i) the detection of D-2-HG in biological fluids detected by LC-MS/MS; (ii) the detection of total 2-HG (including both L-2-HG and D-2- HG) in the serum above 2mM; or (iii) the detection of the presence of mutant variants of IDH1/IDH2.
  • Darinaparsin and the retinoic acid compound results in the remission of the leukemia in the subject (e.g., the symptoms of the leukemia are reduced). In some embodiments, contacting said cells of said leukemia with the Darinaparsin and the retinoic acid compound results in the complete remission of the leukemia (e.g., all signs and symptoms of the leukemia are absent). In some embodiments, contacting said cells of said leukemia with the Darinaparsin and the retinoic acid compound cures the leukemia in the subject (e.g., all signs and symptoms of the leukemia are absent for 1 year or more, for 2 years or more, for 3 years or more, for 4 years or more, or for 5 years or more).
  • the Darinaparsin and the retinoic acid compound operate synergistically to treat said leukemia. In some embodiments, the Darinaparsin and the retinoic acid compound is more effective for treating said leukemia than the same quantities of either said Darinaparsin or said retinoic acid compound alone.
  • Darinaparsin and the retinoic acid compound increases the production of reactive oxygen species (ROS) in one or more cells of said leukemia, e.g., increases the production of ROS by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to production of ROS prior to treatment with the Darinaparsin and the retinoic acid compound.
  • contacting said cells of said leukemia with of the Darinaparsin and the retinoic acid compound increases the production of ROS by at least about 10%.
  • Darinaparsin and the retinoic acid compound promotes differentiation of one or more cells of said leukemia.
  • contacting said cells of said leukemia with of the combination of Darinaparsin and a retinoic acid compound is sufficient to inhibit and/or degrade Pinl in the subject.
  • this may include an increase in degradation of Pinl of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the Darinaparsin and the retinoic acid compound.
  • Darinaparsin and the retinoic acid compound increases the degradation of Pinl of at least about 10%.
  • this may include a reduction in Pinl activity of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the Darinaparsin and the retinoic acid compound.
  • the contacting said cells of said leukemia with of Darinaparsin and a retinoic acid compound is more effective for inhibiting and/or degrading Pinl in the subject than administration of the same quantities of either the Darinaparsin or the retinoic acid compound alone.
  • contacting said cells of said leukemia with the Darinaparsin and the retinoic acid compound is more effective for treating the leukemia than contacting said cells of said leukemia with of the same quantities of either the Darinaparsin or the retinoic acid compound alone.
  • the Darinaparsin and the retinoic acid compound may be administered concurrently (e.g., within about lmin, 2min, 5min, lOmin, 20min, 30min, or 60min) or separately.
  • the Darinaparsin may be administered either prior to or after the retinoic acid compound.
  • the invention features a method of treating leukemia in a subject.
  • the method includes contacting the cells of the leukemia with an effective amount of the Darinaparsin to said subject, wherein one or more cells of the leukemia have a pathogenic IDH1/IDH2 allele or have been previously determined to have elevated 2-hydroxy glutarate (2-HG) levels; and wherein contacting said cells of said leukemia with the Darinaparsin treats the leukemia in the subject.
  • Elevated 2-HG levels may be considered to include levels of 2-HG at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the 2-HG levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
  • a normal e.g., wild-type and/or disease fee
  • Darinaparsin increases the production of reactive oxygen species (ROS) in one or more cells of said leukemia (e.g., increases the production of ROS by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to production of ROS prior to treatment with the Darinaparsin).
  • ROS reactive oxygen species
  • Darinaparsin is sufficient to inhibit and/or degrade Pinl in the subject. In some embodiments, this may include an increase in degradation of Pinl of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the Darinaparsin.
  • this may include a reduction in Pinl activity of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the Darinaparsin.
  • contacting said cells of said leukemia with of the Darinaparsin increases the degradation of Pinl of at least about 5%.
  • the invention features a method of treating leukemia in a subject.
  • the method includes contacting the cells of the leukemia with an effective amount of a retinoic acid compound to the subject, wherein the subject has a pathogenic IDH1/IDH2 allele or wherein one or more cells of the leukemia have been previously determined to have elevated 2-hydroxyglutarate (2-HG) levels; and wherein contacting said cells of said leukemia with the retinoic acid compound treats the leukemia in the subject.
  • Elevated 2-HG levels may be considered to include levels of 2-HG at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the 2-HG levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
  • a normal e.g., wild-type and/or disease fee
  • contacting said cells of said leukemia with the retinoic acid compound promotes differentiation of one or more cells of the leukemia.
  • contacting said cells of said leukemia with the retinoic acid compound is sufficient to inhibit and/or degrade Pinl in the subject.
  • this may include an increase in degradation of Pinl of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with retinoic acid compound.
  • this may include a reduction in Pinl activity of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the retinoic acid compound.
  • contacting said cells of said leukemia with of the retinoic acid compound increases the degradation of Pinl of at least about 5%.
  • the subject has elevated levels of Pinl activity (e.g., has previously been determined to have elevated levels of Pinl activity in one or more cells of the leukemia).
  • Levels of Pinl activity in the subject may be determined by measuring the levels of at least one Pinl marker, wherein elevated levels of the Pinl marker is indicative of elevated Pinl activity.
  • Non-limiting examples of Pinl markers include nucleic acid molecules (e.g., mRNA, DNA) that correspond to some or all of a Pinl gene, peptide sequences (e.g., amino acid sequences) that correspond to some or all of a Pinl protein, nucleic acid sequences which are homologous to Pinl gene sequences, peptide sequences which are homologous to Pinl peptide sequences, alteration of Pinl protein, antibodies to Pinl protein, substrates of Pinl protein, binding partners of Pinl protein, alteration of Pinl binding partners, and activity of Pinl.
  • nucleic acid molecules e.g., mRNA, DNA
  • peptide sequences e.g., amino acid sequences
  • alteration of a Pinl protein may include a post-translational modification (e.g., phosphorylation, acetylation, methylation, lipidation, or any other post-translational modification known in the art) of Pinl.
  • a Pinl marker is the level of Pin expression (e.g., Pinl protein expression levels and/or Pinl mRNA expression levels) in a subject.
  • Elevated levels of a Pinl marker include, for example, levels at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the marker levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
  • elevated levels of a Pinl marker include levels at least about 3% or greater than the marker levels measured in a normal subject, tissue, or cell.
  • the method further comprises contacting said cells of said leukemia with a compound that inhibits Pinl activity (e.g., in combination with the retinoic acid and the Darinaparsin).
  • a compound that inhibits Pinl activity e.g., in combination with the retinoic acid and the Darinaparsin.
  • the subject has decreased levels of lysine-specific demethylase (LSD1) activity.
  • LSD1 activity can be determined by methods known to one of skill in the art, including determining the levels of lysine histone methylation (e.g., H3K4me2 and/or H3K9me2).
  • Decreased levels of LSD 1 activity include, for example, a reduction of LSD1 activity of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the marker levels measured in a normal (e.g., wild- type and/or disease fee) subject, tissue, or cell.
  • decreased levels of LSD1 activity include a reduction of LSD1 activity of about 20% or greater than the marker levels measured in a normal subject, tissue, or cell.
  • the method further comprises contacting said cells of said leukemia with a compound that inhibits LSD1 activity (e.g., reduced LSD1 activity by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to LSD1 activity prior to treatment).
  • a compound that inhibits LSD1 activity e.g., reduced LSD1 activity by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to LSD1 activity prior to treatment.
  • the method further comprises contacting said cells of said leukemia with an inhibitor of IDH1/IDH2.
  • the inhibitor of IDH1/IDH2 may reduce IDH1/IDH2 activity (e.g., as measured by a reduction in 2-HG levels) by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to IDH1/IDH2 activity prior to treatment.
  • the inhibitor of IDH1/IDH2 may be specific for a pathogenic mutant form of IDH1/IDH2. When such an inhibitor targets a mutant form of IDH1/IDH2, it may reduce the aberrant activity of the enzyme by about 20%.
  • the pathogenic IDH1 allele is IDH1 R132C and the pathogenic IDH2 allele is IDH2 R140Q .
  • the method further includes contacting said cells of said leukemia with an effective amount of dexamethasone.
  • the invention features a kit for treating leukemia in a subject, wherein the kit includes: (a) an effective amount of Darinaparsin, (b) an effective amount of a retinoic acid compound, and (c) instructions for the use of the Darinaparsin in combination with the retinoic acid compound for treating the leukemia in the subject, wherein one or more cells of said leukemia has a pathogenic IDH1/IDH2 allele or wherein the subject has been previously determined to have elevated 2-hydroxyglutarate (2-HG) levels.
  • the kit includes: (a) an effective amount of Darinaparsin, (b) an effective amount of a retinoic acid compound, and (c) instructions for the use of the Darinaparsin in combination with the retinoic acid compound for treating the leukemia in the subject, wherein one or more cells of said leukemia has a pathogenic IDH1/IDH2 allele or wherein the subject has been previously determined to have elevated 2-hydroxyglutarate (2-HG) levels.
  • Elevated 2-HG levels may be considered to include levels of 2-HG at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the 2-HG levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
  • the kit further includes an effective amount of a compound that inhibits Pinl activity and instructions for the use of the compound that inhibits Pinl activity in combination with the Darinaparsin and the retinoic acid compound.
  • the kit further includes an effective amount of a compound that inhibits LSD1 activity and instructions for the use of the compound that inhibits LSD1 activity in combination with the Darinaparsin and said retinoic acid compound.
  • the kit further includes an effective amount of a compound that inhibits Pinl activity, an effective amount of a compound that inhibits LSD1 activity, and instructions for the use of the compound that inhibits Pinl activity and the compound that inhibits LSD1 activity in combination with the Darinaparsin and the retinoic acid compound.
  • the retinoic acid compound is administered in a low dose such as about 5 mg/kg body weight or less (e.g., about 0.1, 0.2, 0.5, 0.75, 1, 2, 3, 4, or 5 mg/kg body weight or less), 1.5 ug/g body weight or less (e.g., about 0.1, 0.2, 0.5, 0.75, 1, or 1.5 ug/g body weight or less), less than about 25 mg/m 2 (e.g., less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 mg/m 2 ), or between 25 mg/m 2 and 45 mg/m 2 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 mg/m 2 ).
  • a low dose such as about 5 mg/kg body weight or less (e.g., about 0.1, 0.2, 0.5, 0.75, 1, 2, 3, 4, or 5 mg/kg
  • the low dose of the retinoic acid compound is a nontoxic dose of the retinoic acid compound. In some embodiments, the low dose of the retinoic acid compound is administered in combination with a low dose of retinoic acid. In some embodiments the low dose of the retinoic acid compound and the low dose of the retinoic acid are nontoxic.
  • a low dose of a retinoic acid compound related to in vivo treatments is 1.5 mg/g/day or lower. In some embodiments, a low dose of the retinoic acid compound comprises a dose of about 30 mg/m 2 body surface area or less. For example, a low dose of a retinoic acid compound related to treating a human with leukemia is 10-22.5 mg/m 2 (PO administration, BID). In some embodiments, a low dose of the retinoic acid compound comprises a dose of about 10 mg/m 2 body surface area or less.
  • the Darinaparsin is administered in a low dose, such as 2 mg/kg body weight or less (e.g., about 0.01, 0.02, 0.03, 0.032, 0.04, 0.05, 0.06, 0.07,
  • a low dose of the Darinaparsin is about 0.15, about 0.16, or about 0.032 mg/kg body weight. In some embodiments, the low dose of the Darinaparsin is a nontoxic dose of the Darinaparsin.
  • a low dose of Darinaparsin related to in vitro treatments of leukemia cells is 0.25 mM or lower.
  • a low dose of Darinaparsin related to in vivo treatments e.g., in mice treatments
  • a low dose of Darinaparsin comprises a dose of about 2.5 mg/kg body weight or less (e.g., a dose of between about 0.05 mg/kg body weight and about 2.5 mg/kg body weight).
  • a low dose of Darinaparsin related to treating a human with leukemia is 0.075-0.15 mg/kg (IV administration, QD).
  • a low dose of Darinaparsin comprises a dose of about 0.05 mg/kg body weight or less.
  • the low dose of the Darinaparsin is administered in combination with a low dose of a retinoic acid compound. In some embodiments the low dose of the Darinaparsin and the low dose of retinoic acid compound are nontoxic.
  • the retinoic acid compound is all-trans retinoic acid (ATRA), 13-cis-retinoic acid, retinol, retinyl acetate, retinal, or AC-55640, or is a compound structurally similar to retinoic acid.
  • the retinoic acid compound is a compound selected from Table 1 or Table 2.
  • the retinoic acid compound is ATRA.
  • the leukemia is acute myeloid leukemia (AML).
  • AML acute myeloid leukemia
  • the acute myeloid leukemia may be either relapsed acute myeloid leukemia or refractory acute myeloid leukemia.
  • the leukemia is an IDH1/IDH2 independent (e.g., resistant) leukemia.
  • An IDH2 independent leukemia includes, for example, a leukemia having a pathogenic IDH2 allele which has developed resistance to IDH2- targeting therapies (e.g., Enasidenib).
  • the leukemia described above can be acute promyelocytic leukemia (APL). In some embodiments, the leukemia is not acute promyelocytic leukemia APL.
  • one or more cells of said leukemia has a pathogenic IDH1/IDH2 allele and elevated 2-hydroxyglutarate (2-HG) levels.
  • one or more cells of the leukemia comprise a pathogenic IDH1 or IDH2 allele in combination with one or more other mutants.
  • the other mutants include, but are not limited to, FLT3, NPM1, DNMT3A, RUNX1, TET2, IDH2, CEBPA, TP53, IDH1, NRAS, RARA, PML, TTN, WT1, MYH11, BPIFC, CBFB, KIT, KRAS, KMT2A, PTPN11, MUC16, SMC1A, RUNX1T1, MPO, U2AF1, ABCA6, DMXL2, DNAH3, KLK3, FBX07, SMC3, MXRA5, MUC17, SF3B1, HPS3, PHF6, ASXL1, AHNAK, SENP6, MYCBP2, NF1, PCLO, CSMD3, LRP1B, MED 12, RAD21, AHNAK2, GDI2, PARP14
  • MLLT10 DNAH11, SLIT2, DNAH9, BRINP3, HMCN1, SYNE1, GABRG3, NPAS3, CSMD1, GATA2, ZCRB1, MTFR2, SLC43A1, SLA2, APOB, PRDM1, BTBD10, ABCA5, EP300, TNC, ADGRG4, BSN, IFT74, COL12A1, NUP98, CREBBP, EPG5, KIF1B, ABL1, SLC16A7, RALGPS2, CHL1, SCLT1, LRP2, VWA3B, FRYL, PRUNE2, PLCE1, GRIK4, HIVEP3, RYR3, ANK2, ATRNL1, VPS13B, GPR179, FCGBP, KIF15, and DNAH10.
  • Two exemplary mutants are NPMc+ and FLT3-ITD.
  • one or more cells of the leukemia comprise a pathogenic IDH1 allele in combination with NPMc+, FLT3-ITD, or both.
  • An exemplary pathogenic IDH1 allele is IDH1 R132C .
  • one or more cells of the leukemia comprise a pathogenic IDH2 allele in combination with NPMc+, FLT3-ITD, or both.
  • An exemplary pathogenic IDH2 allele is IDH2 R140Q .
  • the effective amount of the Darinaparsin is a low dose of about 2.5 mg/kg body weight or less
  • the effective amount of the retinoic acid compound is a low dose of about 30 mg/m 2 body surface area or less
  • the retinoic acid compound is selected from the group consisting of all-trans retinoic acid (ATRA), 13-cis-retinoic acid, retinol, retinyl acetate, retinal, and AC-55640.
  • the effective amount of the Darinaparsin is a low dose of between about 0.05 mg/kg body weight and about 2.5 mg/kg body weight
  • the effective amount of the retinoic acid compound is a low dose of about 10 mg/m 2 body surface area or less
  • the retinoic acid compound is ATRA.
  • one or more cells of the leukemia comprise a pathogenic IDH1 or IDH2 allele in combination with NPMc+, FLT3-ITD, or both, in which said pathogenic IDH1 allele is IDH1 R132C and said pathogenic IDH2 allele is IDH2 R140Q .
  • Fig. 1A is an image depicting the approach used to model in vivo independence from mIDH2 (IDH2R140Q) in AML.
  • Mouse model is based on serial transplantation of leukemia cells derived form Tg(M2rt-TA) transgenic mice and overexpressing HoxA9 and Meisla oncoproteins. Red boxes: leukemia. Blue boxes: healthy state.
  • Fig. IB is a series of images depicting Flow cytometry plots of bone marrow samples.
  • X- axis fluorescence Intensity (0 - 105), Y-axis, cell counts.
  • Fig. 1C is a graph depicting the percentage of Leukemic cells in the bone marrow ( BM) of 2 nd and 3 rd recipients maintained on DOX ON or DOX OFF diet. Quantitation is expressed as percentage of leukemic cells showing positivity for GFP and YFP fluorescence.
  • Fig. ID is a series of images showing May-Griinwald-Giemsa staining of peripheral blood (PB) smears at euthanization (6- 9 weeks after transplant).
  • PB peripheral blood
  • Fig. IE is a graph depicting the percentage of blasts in peripheral blood ( PB) in of 2 nd and 3 rd recipients maintained on DOX ON or DOX OFF diet.
  • Fig. IF is a graph depicting the LC- MS quantification of the 2-HG peripheral blood ( PB) in of 2 nd and 3 rd recipients maintained on DOX ON or DOX OFF diet.
  • Fig. 1G is a graph depicting real time quantitative PCR analyses for the expression of mIDH2 (IDH2 R140Q ) in leukemia cells.
  • Fig. 1H is a graph depicting real time quantitative PCR analyses for the expression of HoxA9 in leukemia cells.
  • Fig. II is a graph depicting real time quantitative PCR analyses for the expression of Meisl A in leukemia cells.
  • IDH2R140Q inhibitor IDHi
  • IDHi AGI-6780
  • ImM vehicle
  • Fig. IK is a series of images depicting representative magnification of methylcellulose colonies generated by blasts at 3rd plating.
  • Fig. 1L is a graph depicting the relative LC- MS quantification of the 2-HG from colonies pooled and extracted for metabolites at 3rd-plating.
  • Fig. 2A is an image depicting Hierarchical clustering of leukemia cells’ metabolites isolated from Dox+ cohorts. Rows: metabolites; columns: samples; color key indicates metabolite abundance level (blue: lowest; red: highest). Clustering generated by MetaboAnalyst’ s annotation tool.
  • Fig. 2B is an image depicting the Pathway enrichment analysis of altered metabolic pathways between sensitive (2nd RECIPIENT - derived cells) and resistant (3rd RECIPIENT - derived) leukemia cells.
  • Fig. 2C is an image depicting the bar chart showing metabolic pathways enriched in resistant leukemia cells isolated from 3rd RECIPIENTS.
  • Fig. 2D is a graph depicting Fold changes of Cysteine (CYS) and Glutathione (GSH) metabolites in resistant leukemia cells compared with sensitive leukemia cells.
  • CYS Cysteine
  • GSH Glutathione
  • Fig. 2E is a graph depicting Fold change of the NAD+/NADH and
  • NADP+/NADPH ratio in resistant leukemia cells compared with sensitive leukemia cells NAD+: nicotinamide adenine dinucleotide oxidized, NADP+: nicotinamide adenine dinucleotide phosphate oxidized, NADH: nicotinamide adenine dinucleotide reduced, NADPH: nicotinamide adenine dinucleotide phosphate reduced.
  • X- axis Fluorescence intensity levels;
  • Y-axis percentage of cell counts.
  • Fig. 2G is a graph depicting the percentage of cells showing high levels of ROS (ROSHi) in sensitive (derived from 2nd RECIPIENTS) and resistant (derived from 3rd RECIPIENT) cells shown in (2F).
  • ROS ROS
  • Fig. 21 is a series of images depicting IHC for gH2A.C in mouse spleen sections and percentage of infiltrating blasts showing positivity for the gH2A.C marker.
  • Fig. 2J(a-e) a series of graphs showing the transcriptional rewiring of mIDH leukaemia at early (sensitive) stage, characterized by altered MAPK and ATRA associated pathways a. Bar chart showing the most significantly up-regulated KEGG pathways in HoxA9/Meisla/mIDH2 cells. The pathways are ranked on the basis of the gene set size indicating activation b-c.
  • GSE Gene Set Enrichment
  • GSE Gene Set Enrichment plots of Tretinoin related Signature in HoxA9/Meisla/mIDH2 vs HoxA9/Meisla.
  • d-e Gene Set Enrichment (GSE) plots of LSD1 Signature in HoxA9/Meisla/mIDH2 vs HoxA9/Meisla.
  • Fig. 3A is an image depicting the heat map of differentially expressed genes (P ⁇ 0.05) in sensitive and resistant samples or Hoxa9/Meisla leukemia, not primed by mIDH2.
  • the columns represent the samples and the rows represent the genes.
  • Gene expression is shown with pseudocolor scale (-3 to 3) with upregulated genes shown as a shade of blue and downregulated genes as a shade of red.
  • Fig. 3B is an image depicting the bar chart showing the most significantly up- regulated pathways (multiple test corrected p-value ⁇ 0.05) in resistant leukemia cells. The pathways are ranked on the basis of Z score indicating activation.
  • Fig. 3C is an image depicting Gene Set Enrichment (GSE) plots of MAPK
  • TNFcr TNFcr
  • Fig. 3D is an image depicting the Venn Plot showing shared genes between mouse mIDH2 leukemia and Schenken et ak; 2013 gene sets.
  • Fig. 3E is an image depicting the Heat map showing shared genes shown in (3D) are regulated concordantly in Resistant and Sensitive clone with respect to ATRA+TCP gene sets reported by Schenken et ak; 2013.
  • the figure legend ( right panel) describes representative images of leukemia cells at different stages of differentiation ( blasts, intermediate, differentiated)
  • Fig. 3G is a graph depicting relative LC-MS/MS quantitation of 2-HG in TF1 cells overexpressing IDH2R140Q or respective controls
  • Fig. 3H is a series of images and graphs depicting Cytospin images and quantitation of human TF1 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) to the respective controls (CTRL) that have been treated with pharmacological concentrations of ATRA (10-6M) or vehicle (DMSO).
  • Fig. 3J is a series of images depicting different culture media color of TF1 cell line stably overexpressing mIDH2 or respective control (CTRL).
  • the asterisks indicate mIDH2-TFl leukemia cells treated with treated with ATRA (10-6M).
  • 1-4 flasks show cultured TF1 cell line (CTRL)
  • 5-8 flasks show cultured TF1 cell line overexpressing the mutant variant R140Q of IDH2 (mIDH2).
  • Fig. 3K(a-e) a series of graphs showing mouse HoxA9/Meisla/ mIDH2 leukaemia at early (sensitive) stage, marked by switching to One-Carbon metabolism and increased oxidative stress a.
  • Hierarchical clustering of leukaemia cells’ metabolites isolated from Dox-i- cohorts. Rows: metabolites; columns: samples; colour key indicates metabolite abundance level (blue: lowest; red: highest). Clustering generated by
  • MetaboAnalyst’ s annotation tool.
  • Pathway enrichment analysis shows altered metabolic pathways between HoxA9/Meisla/mIDH2 and respective HoxA9/Meisla control cells
  • c. LC-MS/MS fold change levels of precursors for One-Carbon metabolism isolated from HoxA9/Meisla/mIDH2 and respective HoxA9/Meisla control cells. Data are mean ⁇ SD.
  • Fig. 4A is an image depicting Western blot analysis for ATRA targets (Pinl), ATRA receptors (RARcr,RXRcr), and factors associated with ATRA - related differentiation pathway in hematopoietic cells (c/EBPer, c/EBRe).
  • Fig. 4B is an image depicting the Western blot analysis for factors associated with ATRA-related pathway in TF1 cell line, stably overexpressing the mIDH2) or the empty vector (CTRL).
  • Fig. 4C is an image depicting the Western blot analysis for factors associated with ATRA-related pathway in U937 cell line, stably overexpressing the mIDH2) or the empty vector (CTRL).
  • Fig. 4D is a graph depicting Percentage of the transferrin receptor (CD71+) positive TF1 cells overexpressing the mIDH2 or respective control (CTRL). Each cell line was treated with the Pinl Inhibitor (Juglone) or vehicle (DMSO) for 3 days.
  • Fig. 4E is a graph depicting the Colony forming assay of TF1 cells overexpressing the mIDH2 or respective control (CTRL) treated with Juglone or vehicle. Colonies were quantitated after 7 days from plating.
  • Fig. 4F is a graph depicting the quantification of the relative transcriptional expression levels of Hemoglobin (HBG) in TF1 cells silenced for Pinl and
  • Fig. 4G is a graph depicting the quantification of the relative transcriptional expression levels of KLF1 in TF1 cells silenced for Pinl and overexpressing the mIDH2 or respective controls (CTRL).
  • Fig. 4H is a graph depicting the quantification of the relative transcriptional expression levels of GATA2 in TF1 cells silenced for Pinl and overexpressing the mIDH2 or respective controls (CTRL).
  • Fig. 41 is a graph depicting the Fold Induction of CD71 in TF1 cells
  • Fig. 4J is a series of graphs depicting the Quantification of the relative transcriptional expression levels of Hemoglobin (HBG), Kruppel like factor 1 (KLF1), in TF1 cells silenced for Pinl and overexpressing the mIDH2 or respective controls (CTRL).
  • HBG Hemoglobin
  • KLF1 Kruppel like factor 1
  • Fig. 4K is an image depicting the scheme of ATO/ ATRA treatments performed in vivo on BL6J recipient mice transplanted with resistant leukemia
  • Fig. 4L is an image deciphering the percent of survival of recipient mice
  • Fig. 4M is an image deciphering the inhibition of LSD 1 contributes to increase intracellular levels of oxidative stress. Histogram reporting the intracellular oxidative stress of TF1 cells treated for 3 weeks with the LSD1 inhibitor (LSDli; GSK2879552, ImM) or DMSO (VHL) as respective control. Measurements were performed by flow cytometry analyses after incubation of TF1 cells with the CellROX molecular probe. Data are mean ⁇ SD.
  • Fig. 5A is a series of images and graphs depicting methylcellulose colony forming assay quantification of human primary AML blasts treated in vitro with pharmacological concentration of ATRA, ATO, a combination of both, or vehicles as control. Treatments were performed in either the presence of mIDH2 or absence of the mutation (CTRL).
  • Data are means ⁇ SD of duplicates.
  • Fig. 5B is an image depicting the Experimental approach to generate PDX for human AML harboring the mutation R140Qin the IDH2 gene
  • Fig. 5C is an image depicting the Scheme of the pharmacological therapy for PDX resembles therapeutic regimen of human APL patients. Treatment regimen was performed in cycles for a total of 65 days resembling APL0406 protocol (Lo-Coco et al; NEJM 2013).
  • Fig. 5E is a series of images depicting the cytospins of cells isolated from BM of PDX mice treated with ATRA and ATO.
  • Fig. 5F is a graph depicting the percentage of morphologically screened human cells isolated from BM of PDX generated by using IDH2R140Q AML.
  • Fig. 5G is an image depicting the scheme of leukemia evolution from mIDH dependent to mIDH2 independent states (e.g. acquisition of resistance to mIDH inhibition). Multiple alterations including genetic mutations, metabolic reprogramming, and transcriptional rewiring are acquired during progression and co-exist in the mIDH2 independent stage.
  • MapK/PI3K pathways upregulated pro-survival and proliferation programs
  • ATRA pro-differenting
  • sensitivity to ATO and ATRA is a vulnerability already present at an early stage in mIDH2 dependent leukemia, which is mantained in later stages of the disease progression.
  • Fig. 6B is a series of images depicting Haemotoxylin and Eosin (H&E) staining of internal organs (spleen, liver, and kidney) from 3rd RECIPIENTS showing infiltrating blasts.
  • H&E Haemotoxylin and Eosin
  • Enlarged images (40x) show perivascular accumulation of infiltrating blasts in spleen, liver, and kidney.
  • Fig. 6C is a series of images depicting H&E and immunohistochemistry (IHC) staining of kidney sections derived from 3 rd RECIPIENTS.
  • the IHC staining shows infiltrating blasts are positive for the antigen Ki-67, a cellular marker for proliferation.
  • Fig. 6D is a series of images depicting H&E staining of internal organs (spleen, liver, and kidney) from 2nd RECIPIENTS. High resolution images show absence or limited infiltrating blasts.
  • Fig. 6E is a series of images depicting H&E and IHC staining of kidney sections derived from 2 nd RECIPIENTS.
  • the IHC staining for the antigen Ki-67 is mostly negative across the examined tissue.
  • Fig. 6H is a graph depicting a methylcellulose colony forming assay of in vitro cultured blasts, derived from 2nd and 3rd RECIPIENTS.
  • mIDH2 IDH2R140Q.
  • Fig. 7 A is an image depicting the scheme of the experiment for metabolites’ analysis
  • Fig. 7B is an image depicting the One-Carbon metabolism pathway. The image is from Locasale J.W. Nature Reviews Cancerl3, 572-583 (2013).
  • Fig. 7C is a graph depicting Fold change of key metabolites in the Methionine pathway in resistant leukemia cells compared to sensitive cells.
  • MET Methionine
  • SAM S-adenosylmethionine
  • SAH Sadenosylhomomocysteine
  • hCYS homocysteine d
  • Fig. 7D is an image depicting the Representative scheme of the De-novo synthesis of Purine (Adenine and Guanine) and Pyrimidine (Thymine, Cytosine and Uracil).
  • Fig. 7E is an image depicting the Fold change of the precursors for Purine biosynthesis in resistant leukemia cells compared with sensitive leukemia cell.
  • IMP inosine monophosphate
  • AMP adenosine monophosphate
  • GMP guanosine
  • Fig. 7F is an image depicting the Fold change of the precursors for Pyrimidine biosynthesis in resistant leukemia cells compared with sensitive leukemia cells.
  • Orotate orotic acid
  • OMP orotidine monophoshate
  • UMP uridine monophosphate
  • UDP uridine diphosphate
  • Fig. 7G is a series of images and graphs depicting Flow cytometry plots and quantitation of the percentage of cells showing high levels of mitochondrial ROS (ROSHi) in blast cells overexpressing HoxA9/Meisl alone (HoxA9/Meisla mIDH2 OFF) or in combination with mutant IDH2 (HoxA9/Meisla mIDH2 ON).
  • ROSHi mitochondrial ROS
  • Fig. 8A is a scheme depicting samples processed for the Whole Exome
  • Fig. 8B is a pie-chart showing frequencies of transversion (2nd_07).
  • mIDH2 IDH2R140Q or transition mutations responsible for non-synonymous mutations in resistant genomes.
  • Pairs of nucleotide indicate different possible transversion (G>T, OA, A>C, T>G, G>C, C>G, A >T, T >A) and transition mutations targeting T or A (A>G, T>C) and C or G (G>A, OT).
  • Fig. 8C is a principal component analysis (PCA) plot showing clustering of WES samples using single nucleotide coverage of sensitive and resistant cells.
  • Fig. 8D is a venn diagram showing the number of mutated genes overlapping between resistant leukemia cells (3rd_08, 3rd_09, 3rd_ll). Mutations in Spl40 gene are shared between all analyzed resistant clones, but not found in the parental sensitive leukemia.
  • Fig. 8E is a series of circular plots of the expression of CNV and fusion genes for sensitive (2nd_07) and resistant (3rd_08, 3rd_09, 3rd_ll) leukemia cells.
  • Circular tracks from inside to outside Trackl: genome positions by chromosomes (black lines are cytobands) that are arranged circularly end to end.
  • Track 2 lines plot (red: positive; blue: negative) showing gene expression data represented as normalized read counts.
  • Track 3 Barplot showing segmented data (CNVs).
  • Track 4 Barplot with positive (gain: blue) and negative values (purple: loss) of called CNVs. Amplifications or deletion of relevant oncogenes such as Flt3, Dok genes, and Trp53 are highlighted.
  • Track 5 Track 5:
  • Interchromosomal translocations are plotted with lines connecting chromosome segments.
  • Fig. 9A is a scheme depicting the samples processed through RNA-Sequencing analysis to characterize the transcriptional changes associated with leukemia progression.
  • Resistant leukemia cells 3rd_09 and 3rd_13 were generated from the parental sensitive 2nd _9A.
  • Resistant leukemia cells 3rd_l l, 3rd_12, 3rd_08, and 3rd_10 were generated from the parental sensitive 2nd_7A.
  • mIDH2 IDH2R140Q.
  • Fig. 9B is a principal component analysis (PCA) plot showing the genes that are the sources with the majority of the variance in resistant leukemia cells, compared with sensitive leukemia cells.
  • the genes are represented by black dots.
  • Mpo myeloperoxidase
  • Lyz2 lysozyme 2
  • Rn45s 45s-pre-ribosomal RNA
  • Ngp neutrophilic granule protein
  • Psap prosaposin
  • Ftll ferritin light polypeptide 1
  • Zfp36 zinc finger protein 36
  • Hspa8 heat shock protein 8
  • Vim vimentin
  • Fosb FBJ osteosarcoma oncogene B
  • Fos FBJ osteosarcoma oncogene
  • Jun jun proto-oncogene.
  • Fig. 9C is a table showing the variance and associated statistical significance of major relevant genes for the Principal Component Analysis (PCA) plot shown in Fig. 9B.
  • Fig. 9D is an image showing the top altered networks in resistant cells generated by Ingenuity Pathways Analysis tool (www.ingenuity.com). The intensity of the node color indicates the degree of up-regulation (red) and down-regulation (green), while white nodes indicate non-modified genes that may be affected in a non-transcriptional manner. All networks shown were significantly affected, with a score >29.
  • Fig. 9E is a series of graph showing the quantification of intracellular flow staining for p-P44/42 (T201, Y204) and p-Akt (T308) in mouse leukemia cells.
  • Fig. 9F is a graph showing an increase in 2-HG levels in a human leukemia U937 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) compared to a U937 control cell line (CTRL).
  • Fig. 9G is a series of images showing the representative cytospins images of blasts, intermediates, and differentiated cells used as reference for the screening.
  • Fig. 9H is a graph showing the quantification of human leukemia U937 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) to the respective U937 controls (CTRL).
  • Fig. 91 is a graph showing the quantification of flow cytometry analysis for the percentage of CD 14 positive cells (CD14+).
  • Fig. 10A is a series of images depicting a western blot assay on TF1 cells overexpressing mutant IDH2 (TF1 IDH2R140Q) or respective control vector (TF1 CTRL) stably silenced for PIN1 expression (shPINl).
  • Non targeting (shSCR) was used as control for non-specific silencing effects.
  • Fig. 10B is a series of images depicting a western blot assay on TF1 cells overexpressing mutant IDH2 (TF1 IDH2R140Q) or respective control vector (TF1 CTRL) treated with the Pinl Inhibitor Juglone for 72h.
  • Fig. IOC is a series of images depicting a western blot assay on TF1 cells stably overexpressing mutant IDH2 (TF1 IDH2R140Q) and Pinl or respective control vector vectors (TF1 CTRL, CTRL).
  • Fig. 11A is a series of images depicting a methylcellulose colony forming assay and colony quantifications of mouse leukemia cells derived from 2 nd RECIPIENTS or leukemia cells overexpressing Hoxa9/Meisla.
  • Fig. 1 IB is a series of images depicting a methylcellulose colony forming assay and colony quantifications of mouse leukemia cells derived from 3 rd RECIPIENTS or leukemia cells overexpressing Hoxa9/Meisla.
  • Fig. llC is a scheme of the in vivo approach to evaluate combination arsenic trioxide (ATO) and ATRA treatment on mIDH2 leukemic cells in C57BL/6J mice.
  • ATO arsenic trioxide
  • Fig. 1 ID is a graph depicting Kaplan- Meier survival curves derived from the experiment shown in Fig. 11C.
  • Fig. 11E is a series of images depicting May-Grunwald-Giemsa staining of BM blasts sorted from recipients treated with ATO and ATRA as shown in Fig. 11C.
  • Fig. 1 IF is a series of images depicting H&E staining of lung tissues. Arrowheads indicate perivascular leukemia cells infiltrates.
  • Fig. 11G is a series of images depicting IHC of lung tissues for myeloperoxidase (MPO), a marker of myeloid cell differentiation. Arrowheads indicate strongly MPO positive cells in perivascular infiltrates.
  • MPO myeloperoxidase
  • Fig. 12A is a scheme of the in vivo experimental approach to evaluate combination ATO and ATRA treatment on mIDH2 U937 human leukemic cell lines.
  • Fig. 12B is a series of graphs depicting Kaplan- Meier survival curves of NSG mice transplanted with mIDH2-U937 or CTRL-U937 leukemia cells and treated with ATO, ATRA or a combination of both.
  • Fig. 12C is a series of graphs showing the percentage of leukemia cells in bone marrow (BM) of NSG mice. Data are means ⁇ SD of samples isolated from different mice.
  • Fig. 12D is a series of images showing morphological screening analysis of U937 cells isolated as GFP+ cells from NSG mice treated with retinoic acid (ATRA), Arsenic Trioxide (ATO), a combination of both, or respective vehicle solution. Arrowheads show cells displaying differentiated morphology
  • Fig. 12E is a series of graphs and images depicting cytospins of mIDH2-U937 or CTRL-U937 leukemia cells isolated as GFP+ cells from BM of NSG mice.
  • Fig. 12F is a series of flow cytometry plots showing CDl lb expression levels in mIDH2-U937 or CTRLU937 leukemia cells.
  • Fig. 12G is a series of graphs showing the quantification of flow cytometry analysis for the percentage of CDl lb positive cells (CDl lb+).
  • U937 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) show about 30% reduced percentage of CD1 lb+ cells compared to the control (CTRL).
  • Fig. 12H is a series of graphs showing the quantification of spleen weight dissected from NSG mice transplanted with mIDH2-U937 or CTRL-U937 leukemia cells and treated with ATO, ATRA or a combination of both.
  • Fig. 13 a- 13k a series of graphs showing the sensitivity of mIDH2 leukaemia to ATRA and ATO.
  • Colonies were quantitated after 12 days from plating g, Colony forming assay of TF1 cells overexpressing the mIDH2 or respective control (CTRL) and treated with the PIN1 inhibitor (Juglone, 1 pM) or respective vehicle (VHL). Colonies were quantitated after 7 days from plating h, Fold induction of cell death (Annexin V/ 7AAD positive cells) in mouse leukaemia cells isolated from 2 nd or 3 rd recipients and in vitro treated with ATO (0.5 pM) for 96h.
  • Data are means ⁇ SD of duplicates k, Quantification of colony forming ability of mouse leukaemia cells harbouring mutations in IDH2 (IDH2 R140Q ) or IDH1 (IDH1 R132C ) in association with different genetic mutant backgrounds such as NPMc+ or FLT3ITD and treated with pharmacological concentrations of ATRA (1 mM), ATO (0.5 mM), a combination of both (ATRA+ATO), or vehicles (VHL) as control.
  • Non mutant IDH2 cells such as MLL-AF9 or NPMc+/ FLT3ITD were also included.
  • Fig. 14a-14h a series of graphs showing the combination of ATO and ATRA targeting mIDH2 human leukaemia cells a, Scheme of the in vivo experimental approach b, Kaplan- Meier survival curves of NSG mice transplanted with mIDH2-U937 or CTRL-U937 leukaemia cells and treated with ATO, ATRA or a combination of both c, Percentage of leukaemia cells in bone marrow (BM) of NSG mice. Data are means ⁇
  • U937 cell line stably overexpressing the mutant variant R140Q of IDH2 show about 30% reduced percentage of CDllb-i- cells compared to the control (CTRL).
  • DS differentiation syndrome
  • VEHICLE solutions Accumulation of human MPO positive cells is a major characteristic of DS.
  • Fig. 15h-15j a series of graphs showing the effect of ATO and ATRA
  • Fig. 16 a schematic depiction of ATO and ATRA targeting mIDH leukaemia.
  • Scheme of leukaemia evolution from mIDH dependent to mIDH2 independent states e.g. acquisition of resistance to mIDH inhibition.
  • Multiple alterations including metabolic reprogramming, and transcriptional rewiring are acquired during progression and co-exist in the mIDH2 independent stage.
  • PIN1, deregulated LSD1 signaling and high ROS levels as key factors of upregulated pro survival and proliferation programs (MAPK/PI3K pathways), alterations to functional ATRA signalling, and altered metabolic state (One-Carbon metabolism and increased nucleic acid synthesis).
  • mIDH2 IDH2 R140Q ; BM: bone marrow; ATRA: Retinoic acid; ATO: Arsenic Trioxide.
  • the term“about” refers to a value that is within 10% above or below the value being described.
  • any values provided in a range of values include both the upper and lower bounds, and any values contained within the upper and lower bounds.
  • Arsenic trioxide and“an arsenic trioxide compound” refer to a compound having the formula AS2O3 and derivatives thereof.
  • Arsenic trioxide generally has the following structure:
  • arsenic trioxide may include, for example, arsenic ores, such as, e.g., arsenopyrite (grey arsenic; FeAsS), realgar (also known as sandarach or red arsenic;
  • arsenic trioxide exhibits high toxicity in mammals, such as humans.
  • arsenic trioxide ingestion can result in severe side effects, including vomiting, abdominal pain, diarrhea, bleeding, convulsions, cardiovascular disorders, inflammation of the liver and kidneys, abnormal blood coagulation, hair loss, and death.
  • arsenic trioxide poisoning may rapidly lead to death. Chronic exposure to even low levels of arsenic trioxide can result in arsenicosis and skin cancer.
  • Arsenic trioxide is therefore desirably administered to a subject at low enough doses to minimize toxicity.
  • arsenic trioxide and derivatives thereof may be effective at treating leukemia.
  • administration of arsenic trioxide to a subject having leukemia may increase the production of reactive oxygen species in one or more leukemic cells of said subject.
  • organic arsenic compounds are converted to inorganic compounds when absorbed in a biological system (see, e.g., Frith, J. Military Vet. Health 21(4): 11-17, 2013).
  • Arsenic derivatives and uses thereof are described, for example, in Wax man et al. (Oncologist 6: 3-10, 2001).
  • Darinaparsin and“a Darinaparsin compound” refer to dimethylarsinic glutathione having the formula C12H22ASN3O6S and derivatives thereof.
  • Darinaparsin generally has the following structure:
  • exemplary retinoic acid compounds described herein include, without limitation, all-trans retinoic acid (ATRA), 13-cis retinoic acid (13cRA), and retinoic acid compounds, and derivatives thereof, e.g., as described herein. Examples of retinoic acid compounds include those shown in Tables 1 and 2 below.
  • retinoic acid compounds include any retinoic acid compounds, or derivatives thereof, known in the art, including those described in PCT Publication Nos. WO 2013/185055, WO 2015/143190, and WO 2016/145186, each of which is incorporated herein with respect to the compounds described therein.
  • the term“diterpene retinoic acid” encompasses any stereoisomer of retinoic acid (e.g., the retinoic acid may be in the all-trans configuration (ATRA) or one or more of the double bonds may be in the cis configuration, for example, 13cRA.
  • Derivatives of the diterpene retinoic acid include reduced forms such as retinal, retinol, and retinyl acetate.
  • each of Ar 1 and Ar 2 is, independently, optionally substituted aryl or an optionally substituted heteroaryl;
  • R 1 is H, an optionally substituted alkyl group, an optionally substituted alkenyl group, or an optionally substituted alkynyl group;
  • C1-C6 alkoxy represents a chemical substituent of formula -OR, where R is an optionally substituted C1-C6 alkyl group, unless otherwise specified.
  • the alkyl group can be substituted, e.g., the alkoxy group can have 1, 2, 3, 4, 5 or 6 substituent groups as defined herein.
  • alkyl As used herein, the term“alkyl,”“alkenyl” and“alkynyl” include straight-chain, branched-chain and cyclic monovalent substituents, as well as combinations of these, containing only C and H when unsubstituted. Examples include methyl, ethyl, isobutyl, cyclohexyl, cyclopentylethyl, 2 propenyl, 3 butynyl, and the like.
  • cycloalkyl represents a monovalent saturated or unsaturated non-aromatic cyclic alkyl group having between three to nine carbons (e.g., a C3-C9 cycloalkyl), unless otherwise specified, and is exemplified by cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicyclo[2.2.1.]heptyl, and the like.
  • the cycloalkyl is a polycyclic (e.g., adamantyl).
  • Cycloalkyl groups may be unsubstituted or substituted with, e.g., 1, 2, 3, or 4 substituent groups as defined herein.
  • the cycloalkyl group can be referred to as a“cycloalkenyl” group.
  • Exemplary cycloalkenyl groups include
  • the alkyl, alkenyl and alkynyl groups contain 1-12 carbons (e.g., Cl- C12 alkyl) or 2-12 carbons (e.g., C2-C12 alkenyl or C2-C12 alkynyl).
  • the alkyl groups are C1-C8, C1-C6, C1-C4, C1-C3, or C1-C2 alkyl groups; or C2-C8, C2-C6, C2-C4, or C2-C3 alkenyl or alkynyl groups.
  • any hydrogen atom on one of these groups can be replaced with a substituent as described herein.
  • aryl represents a mono- or bicyclic C6-C14 group with [4 n + 2] p electrons in conjugation and where n is 1, 2, or 3.
  • Aryl groups also include ring systems where the ring system having [4 n + 2] p electrons is fused to a non-aromatic cycloalkyl or a non-aromatic heterocyclyl.
  • Phenyl is an aryl group where n is 1.
  • Aryl groups may be unsubstituted or substituted with, e.g., 1, 2, 3, or 4 substituent groups as defined herein.
  • Still other exemplary aryl groups include, but are not limited to, naphthyl, 1,2-dihydronaphthyl, 1,2,3,4-tetrahydronaphthyl, fluorenyl, indanyl, and indenyl.
  • heteroaryl represents an aromatic (i.e., containing An+2 pi electrons within the ring system) 5- or 6-membered ring containing one, two, three, or four heteroatoms independently selected from the group consisting of nitrogen, oxygen, and sulfur, as well as bicyclic, tricyclic, and tetracyclic groups in which any of the aromatic ring is fused to one, two, or three heterocyclic or carbocyclic rings (e.g., an aryl ring).
  • heteroaryls include, but are not limited to, furan, thiophene, pyrrole, thiadiazole (e.g., 1,2,3-thiadiazole or 1,2,4-thiadiazole), oxadiazole (e.g., 1,2,3-oxadiazole or 1,2,5-oxadiazole), oxazole, isoxazole, isothiazole, pyrazole, thiazole, triazole (e.g., 1,2,4-triazole or 1,2,3-triazole), pyridine, pyrimidine, pyrazine, pyrazine, triazine (e.g, 1,2,3-triazine 1,2,4-triazine, or 1,3,5-triazine), 1,2,4,5-tetrazine, indolyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzothiazolyl, and benzoxazolyl.
  • Heteroaryls may be unsubstituted or substituted with, e.g., 1, 2, 3, or 4 substituents groups as defined herein.
  • the term“heterocyclyl,” as used herein represents a non-aromatic 5-, 6- or 7- membered ring, unless otherwise specified, containing one, two, three, or four heteroatoms independently selected from the group consisting of nitrogen, oxygen, and sulfur.
  • Heterocyclyl groups may be unsubstituted or substituted with, e.g., 1, 2, 3, or 4 substituent groups as defined herein.
  • aryloxy refers to aromatic or heteroaromatic systems which are coupled to another residue through an oxygen atom.
  • O-aryl A typical example of an O-aryl is phenoxy.
  • thioaryloxy refers to aromatic or heteroaromatic systems which are coupled to another residue through a sulfur atom.
  • a halogen is selected from F, Cl, Br, and I, and more particularly it is fluoro or chloro.
  • each R or R’ is selected, independently, from H, Ci- 6 alkyl, C2-6 alkenyl, C2-6 alkynyl, aryl, or heteroaryl.
  • a substituent group e.g., alkyl, alkenyl, alkynyl, or aryl (including all heteroforms defined above) may itself optionally be substituted by additional substituents.
  • additional substituents e.g., alkyl, alkenyl, alkynyl, or aryl (including all heteroforms defined above
  • alkyl may optionally be substituted by the remaining substituents listed as substituents where this makes chemical sense, and where this does not undermine the size limit of alkyl per se; e.g., alkyl substituted by alkyl or by alkenyl would simply extend the upper limit of carbon atoms for these embodiments, and is not included.
  • Typical optional substituents on aromatic or heteroaromatic groups include independently halo, CN, N02, CF3, OCF3, COOR’, CONR’2, OR’, SR’, SOR’, S02R’, NR’2, NR’ (CO)R’ ,NR’ C(0)OR’ , NR’C(0)NR’2, NR’S02NR’2, or NR’S02R ⁇ wherein each R’ is independently H or an optionally substituted group selected from alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, heteroaryl, and aryl (all as defined above); or the substituent may be an optionally substituted group selected from alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, aryl, heteroaryl, O-aryl, O-heteroaryl and arylalkyl.
  • non-aromatic groups e.g., alkyl, alkenyl, and alkynyl groups
  • cancer refers to a proliferative disease in a subject (e.g., a human) having a pathogenic IDH1/IDH2 allele or having elevated 2- hydroxyglutarate (2-HG) levels.
  • a subject e.g., a human
  • IDHl/IDH2-associated leukemias IDHl/IDH2-associated solid tumors.
  • An IDHl/IDH2-associated leukemia can contain one or more mutants selected from FLT3, NPM1, DNMT3A, RUNX1, TET2, IDH2, CEBPA, TP53, IDH1, NRAS, RARA, PML, TTN, WT1, MYH11, BPIFC, CBFB, KIT, KRAS, KMT2A, PTPN11, MUC16, SMC1A, RUNX1T1, MPO, U2AF1, ABCA6, DMXL2, DNAH3, KLK3, FBX07, SMC3, MXRA5, MUC17, SF3B1, HPS3, PHF6, ASXL1, AHNAK, SENP6, MYCBP2, NF1, PCLO, CSMD3, LRP1B, MED 12, RAD21, AHNAK2, GDI2, PARP14, KLHL7, BCORL1, SPEN, BRWD1,UBR4, STAG2, LNX1, FREM2, MLLT10, DNAH11,
  • An IDHl/IDH2-associated solid tumor can be glioma, paraganglioma, astroglioma, colorectal carcinoma, melanoma, cholangiocarcinoma, chondrosarcoma, thyroid carcinomas, prostate cancers, or non-small cell lung cancer.
  • pathogenic IDH2 allele is meant to include any allele encoding an IDH2 protein having a mutation associated with increased cellular proliferation, associated with increased likelihood or severity of cancer, associated with increased likelihood or severity of leukemia, or associated with increased levels of the oncometabolite, 2-hydroxyglutarate (2-HG) compared with a wild-type cell, tissue, or subject.
  • Pathogenic alleles of IDH2 may encode, for example, any of the following mutations in the corresponding IDH2 protein: R140Q, R140W, R172K, R172M, R172G, or R172W.
  • the term“IDH2 inhibitor” is meant to include any compound that reduces the level of IDH2 activity or expression in a cell, tissue, or subject.
  • a reduction in IDH2 expression or activity may be measured by methods known to one of skill in the art, including the reduction in corresponding IDH2 mRNA or protein levels in a cell (e.g., a reduction of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater) or the reduction of 2-HG levels in a cell (e.g., a reduction of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater).
  • the IDH2 inhibitor may include the reduction in
  • Pinl activity refers to binding of the protein Pinl to a substrate (e.g., a substrate protein) and Pinl -catalyzed isomerization of the substrate.
  • Pinl generally acts as a peptidyl-prolyl isomerase (PPIase) that catalyzes prolyl isomerization of the substrate (e.g., conversion of a peptidyl-prolyl group on the substrate from a trans conformation to a cis conformation, or vice versa).
  • PPIase peptidyl-prolyl isomerase
  • “Elevated Pinl activity” or“elevated levels of Pinl activity,” as used herein, generally refer to an increase in Pinl-catalyzed isomerization of one or more Pinl substrates, for example, relative to a reference level of Pinl activity.
  • the reference level of Pinl activity is the level of Pinl activity in a wild-type cell (e.g., a wild-type cell of the same cell type as a cell of interest). In some embodiments, the reference level of Pinl activity is the level of Pinl activity in a wild-type subject (e.g., a subject not having leukemia), such that an increase in Pinl activity in a subject of interest relative to a wild-type subject indicates that the subject of interest has elevated Pinl activity. In some embodiments, alteration in Pinl activity can be assessed by determining the levels of a Pinl marker in a cell and/or a subject of interest, relative to a reference cell or subject (e.g., a wild-type cell or subject).
  • Elevated levels of Pinl activity include, for example, Pinl activity levels at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the activity level measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
  • a normal e.g., wild-type and/or disease fee
  • a decrease in Pinl activity includes a reduction of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000% in the Pinl activity of a subject, tissue, or cell (e.g., after treatment by any of the
  • Pinl marker refers to a marker which is capable of being indicative of Pinl activity levels (e.g., in a sample obtained from a cell or subject of interest).
  • Non-limiting examples of Pinl markers include nucleic acid molecules (e.g., mRNA, DNA) that correspond to some or all of a Pinl gene, peptide sequences (e.g., amino acid sequences) that correspond to some or all of a Pinl protein, nucleic acid sequences which are homologous to Pinl gene sequences, peptide sequences which are homologous to Pinl peptide sequences, alteration of Pinl protein, antibodies to Pinl protein, substrates of Pinl protein, binding partners of Pinl protein, alteration of Pinl binding partners, and activity of Pinl.
  • nucleic acid molecules e.g., mRNA, DNA
  • peptide sequences e.g., amino acid sequences
  • alteration of a Pinl protein may include a post-translational modification (e.g., phosphorylation, acetylation, methylation, lipidation, or any other post- translational modification known in the art) of Pinl.
  • a Pinl marker is the level of Pin expression (e.g., Pinl protein expression levels and/or Pinl mRNA expression levels) in a subject.
  • elevated levels of a Pinl marker is meant a level of Pinl marker that is altered, which may, in some instances, indicate the presence of elevated Pinl activity.
  • Elevated levels of a Pinl marker include, for example, levels at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than, or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% less than the marker levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
  • a normal e.g., wild-type and/or disease fee
  • the terms“compound that inhibits LSD1” or“LSD1 inhibitor” are meant to include any compound that reduces the level of LSD1 activity or expression in a cell, tissue, or subject.
  • a reduction in LSD1 expression or activity may be measured by methods known to one of skill in the art, including the reduction in corresponding LSD1 mRNA or protein levels in a cell (e.g., a reduction of about 1%, 2%, 3%, 4%, 5%, 6%,
  • LSD 1- specific histone methylation such as H3K4me2 and/or H3K9me2 histone methylation (e.g., a reduction of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater).
  • “synergy” or“synergistic,” as used herein, refers to an improved effect when two agents are administered that is greater than the additive effects of each of the two agents when administered alone.
  • administration of an arsenic trioxide and a retinoic acid compound (e.g., ATRA) to a subject may result in a greater than additive effect on the subject than administration of either arsenic trioxide or the retinoic acid compound alone.
  • a“low dose” or“low dosage” is meant a dosage of at least 5% less (e.g., at least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%,
  • a low dosage of an agent formulated for oral administration may differ from a low dosage of the agent formulated for intravenous administration.
  • a low dosage of an agent may be selected to be a nontoxic dosage of the agent.
  • a low dosage may be selected as a dosage that minimizes particular side effects of an agent, but which may still retain some side effects.
  • a dosage may be selected that minimizes or eliminates side effects that can lead to significant mortality or severe illness among subjects while still permitting more tolerable side effects, such as headache.
  • a low dose of arsenic trioxide is a dose of about 2 mg/kg body weight or less (e.g., about 0.01, 0.02, 0.03, 0.032, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.25, 1.5, 1,75, or 2 mg/kg).
  • a low dose of arsenic trioxide is about 0.15, about 0.16, or about 0.032 mg/kg body weight. In other instances, a low dose of arsenic trioxide is a dose between about 0.5 mg/kg and about 12 mg/kg body weight (e.g., about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/kg). In some instances, a low dose of a retinoic acid compound is a dose of about 5 mg/kg body weight or less (e.g., about 0.1, 0.2, 0.5, 0.75, 1, 2, 3, 4, or 5 mg/kg).
  • a low dose of a retinoic acid compound is a dose of about 25 mg/m 2 or less (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 mg/m 2 ). In other instances, the low dose of the retinoic acid compound is a dose of between 25 mg/m 2 and 45 mg/m 2 (e.g.,
  • A“nontoxic” dose of an agent is a dosage low enough to minimize or eliminate toxic side effects of the agent on the subject to which the agent is administered.
  • a nontoxic dosage may be achieved by reducing the quantity of the agent administered per dose and/or increasing the length of time between deliveries of individual doses.
  • the term“effective amount” or an amount“sufficient to” as used interchangeably herein, refers to a quantity of an agent that, when administered alone or with one or more additional therapeutic agents, induces a desired response or confers a therapeutic effect on the treated subject.
  • the desired response may be a therapeutic response.
  • the desired response is decreasing the signs or symptoms of a disorder described herein (e.g., leukemia).
  • the desired response is decreasing the risk of developing or decreasing the risk of recurrence of a disorder described herein (e.g., leukemia).
  • An effective amount of an agent may desirably provide a therapeutic effect without causing substantial toxicity in the subject.
  • an effective amount of a composition administered to a human subject will vary depending upon a number of factors associated with that subject, for example, the overall health of the subject, the condition to be treated, and/or the severity of the condition.
  • An effective amount of a composition can be determined by varying the dosage of the product and measuring the resulting therapeutic response. The effective amount can be dependent, for example, on the source applied, the subject being treated, the severity and type of the condition being treated, and the manner of administration.
  • “treat”,“treating”, or“treatment” refers to application or administration of a pharmaceutical compound by any route, e.g., orally, topically, or by inhalation to a subject with the purpose to cure, alleviate, relieve, alter, remedy, improve, or affect the disease, the symptom, or the predisposition.
  • the compound can be administered alone or in combination with one or more additional compounds. Treatments may be sequential, with a compound being administered before or after the administration of other agents. Alternatively, compounds may be administered concurrently.
  • the subject e.g., a patient, can be one having a disorder (e.g., a leukemia), a symptom of a disorder, or a disorder (e.g., a leukemia), a symptom of a disorder, or a
  • Treatment is not limited to curing or complete healing, but can result in one or more of alleviating, relieving, altering, partially remedying, ameliorating, improving or affecting the disorder, reducing one or more symptoms of the disorder or the predisposition toward the disorder.
  • the treatment at least partially) alleviates or relieves symptoms related to a fibrotic disease.
  • the treatment at least partially alleviates or relieves symptoms related to an inflammatory disease.
  • the treatment reduces at least one symptom of the disorder or delays onset of at least one symptom of the disorder. The effect is beyond what is seen in the absence of treatment.
  • Treatment of leukemia may be considered to include administration of any of the compounds described herein resulting in the remission of the leukemia in the subject (e.g., the symptoms of the leukemia are reduced). Treatment of the leukemia may further be considered to include administration of any of the compounds described herein resulting in the complete remission of the leukemia (e.g., all signs and symptoms of the leukemia are absent). Treatment of the leukemia may further be considered to include administration of any of the compounds described herein, wherein the treatment cures the leukemia in the subject (e.g., all signs and symptoms of the leukemia are absent for 1 year or more, for 2 years or more, for 3 years or more, for 4 years or more, or for 5 years or more).
  • subject refers to any organism or portion thereof to be administered a composition as described herein (e.g., arsenic trioxide, a retinoic acid compound, and combinations or derivatives thereof).
  • a subject may be an animal, such as a mammal (e.g., a human, mouse, rat, rabbit, dog, cat, goat, pig, and horse).
  • the subject is human.
  • administering may also be considered to include contacting.
  • a compound is administered to a cell, it may be considered to be equivalent to contacting the cell with the compound.
  • the term“contacting one or more cells” with a compound of the invention is meant to include administering a compound of the invention to a subject, such that the compound contacts one or more cells of the subject.
  • the present invention is based on the discovery of common vulnerabilities in mIDH2 leukemia.
  • mIDH2 leukemia exhibits sensitivity to reactive oxygen species (ROS)-producing compounds, such as arsenic trioxide (ATO).
  • ROS reactive oxygen species
  • ATO arsenic trioxide
  • mIDH2 leukemia exhibits sensitivity to retinoic acid compound- induced differentiation (e.g., ATRA-induce differentiation).
  • a ROS-promoting compound e.g., arsenic trioxide
  • a compound that promotes differentiation e.g., a Pinl inhibitor, such as ATRA
  • the present invention therefore features methods, compositions, and kits relating to the treatment of mIDH2 leukemia by administering an arsenic trioxide compound (e.g., ATO), a retinoic acid compound (e.g., ATRA), or a combination of an arsenic trioxide and a retinoic acid compound (ATO and ATRA).
  • an arsenic trioxide compound e.g., ATO
  • a retinoic acid compound e.g., ATRA
  • ATO and ATRA retinoic acid compound
  • Isocitrate dehydrogenases are enzymes (IDH enzymes) are metabolic enzymes that catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate.
  • the protein encoded by the IDH2 gene is the NADP(+) -dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production.
  • IDH enzymes have been identified as important early events in a variety of tumor types. For example, IDH enzymes are mutated in approximately 20% of human acute myeloid leukemias (AMLs). Pathogenic mutants of IDH2 enzymes have been identified that give rise to 2-hydroxyglutarate (2-HG), an oncometabolite that contributes to the oncogenic phenotype. Accordingly, 2-HG is a predictive biomarker in cancers having a pathogenic IDH2 allele. In some embodiments of the invention, the methods described herein are used to treat a subject having a disorder associated with a mutation in the IDH2 enzyme
  • the mIDH2 disorder is associated with a pathogenic IDH2 allele, wherein a pathogenic IDH2 allele is meant to include any allele encoding an IDH2 protein having a mutation associated with increased cellular proliferation, associated with increased likelihood or severity of cancer, associated with increased likelihood or severity of leukemia, or associated with increased levels of the oncometabolite, 2-hydroxyglutarate (2-HG) compared with a wild-type cell, tissue, or subject.
  • Pathogenic alleles of IDH2 may encode, for example, any of the following mutations in the corresponding IDH2 protein: R140Q, R140W, R172K, R172M, R172G, or R172W.
  • the methods described herein are used to a subject having a leukemia, wherein the leukemia is associated with a mutation in the IDH2 enzyme.
  • the subject having a leukemia has a pathogenic IDH2 allele and/or has elevated 2-hydroxyglutarate (2-HG) levels (e.g., in one or more cells of the leukemia).
  • the leukemia is an IDH2 sensitive leukemia (e.g., a leukemia that is responsive to IDH2 inhibitors).
  • the leukemia is an IDH2 independent or resistant leukemia (e.g., leukemia resistant to known IDH2 inhibitors, such as, Enasidenib).
  • the present invention features methods of treating leukemia (e.g., mIDH2- associated leukemia) using arsenic trioxide and/or a retinoic acid compounds, and derivatives thereof.
  • leukemia e.g., mIDH2- associated leukemia
  • subject is treated with arsenic trioxide in combination with a retinoic acid compound (e.g., as described herein).
  • Arsenic trioxide generally has the following structure:
  • Arsenic trioxide exhibits high toxicity in subjects of the invention, including mammals (e.g., humans).
  • subjects of the invention including mammals (e.g., humans).
  • arsenic trioxide ingestion can result in severe side effects, including vomiting, abdominal pain, diarrhea, bleeding, convulsions, cardiovascular disorders, inflammation of the liver and kidneys, abnormal blood coagulation, hair loss, and death.
  • Chronic exposure to even low levels of arsenic trioxide can result in arsenicosis and skin cancer.
  • Arsenic trioxide is therefore desirably administered to a subject at low enough doses to minimize toxicity.
  • Arsenic trioxide and derivatives thereof may be effective at increasing the production of reactive oxygen species in a cell, tissue, or subject.
  • Arsenic trioxide and derivatives thereof may also be effective in reducing Pinl activity in a cell, tissue, or subject.
  • arsenic trioxide may operate synergistically with a retinoic acid compound to treat a disorder described herein.
  • the combination of arsenic trioxide and the retinoic acid compound are administered in amounts that result in minimal toxicity.
  • Retinoic acid compounds are generally derivatives of the diterpene retinoic acid (e.g., as described herein). Retinoic acid compounds may be effective in promoting differentiation in a cell (e.g., a leukemic cell). Retinoic acid compounds may also be effective in reducing Pinl activity in a cell, tissue, or subject. Exemplary retinoic acid compounds of the invention include all-trans retinoic acid (ATRA), 13-cis retinoic acid (13cRA), and retinoic acid compounds, and derivatives thereof, e.g., as described herein. Retinoic acid compounds of the invention may be a y compound selected from Table 1 or Table 2. In some instances, a retinoic acid compound is administered in combination with arsenic trioxide. In certain instances, the combination of arsenic trioxide and the retinoic acid compound are administered in amounts that result in minimal toxicity.
  • ATRA all-trans retinoic acid
  • 13cRA 13
  • Certain embodiments of the invention feature a deuterated retinoic acid compound that is made by replacing some or all hydrogen with deuterium using state of the art techniques (e.g., as described herein and at www.concertpharma.com).
  • arsenic trioxide and/or retinoic acid compound(s) of the invention may be further combined with additional therapeutic agents for treatment of any of the disorders described herein (e.g., leukemia).
  • such compounds may act synergistically with arsenic trioxide and/or a retinoic acid compound to treat the disorder (e.g., leukemia). Additionally, co administration with arsenic trioxide and/or a retinoic acid compound may result in the efficacy of the additional therapeutic agent at lower and safer doses (e.g., at least 5% less, for example, at least 10%, 20%, 50%, 80%, 90%, or even 95% less) than when the additional therapeutic agent is administered alone.
  • the additional therapeutic agent e.g., leukemia
  • the arsenic trioxide and/or retinoic acid compounds may be combined with anti-proliferative and other anti-cancer compounds (e.g., anti- angiogenic compounds) for treating a disorder (e.g., leukemia).
  • anti-proliferative agents that can be used in combination with a retinoic acid compound include, without limitation, microtubule inhibitors, topoisomerase inhibitors, platins, alkylating agents, and anti metabolites.
  • anti-proliferative agents that are useful in the methods and compositions of the invention include, without limitation, paclitaxel, gemcitabine, doxorubicin, vinblastine, etoposide, 5-fluorouracil, carboplatin, altretamine,
  • Pinl is an enzyme that catalyzed the cis-trans isomerization of phosphorylated Ser/Thr-Pro motifs and which has been shown to be involved in an increasing number of diseases. Elevated Pinl activity has been associated with the development and progression of cancer. For example, Pinl is overexpressed in some human cancer samples and the levels of Pinl are correlated with the aggressiveness of tumors. Moreover, inhibition of Pinl by various approaches, including the Pinl inhibitor, Pinl antisense polynucleotides, or genetic depletion, kills human and yeast dividing cells by inducing premature mitotic entry and apoptosis.
  • Pinl upon phosphorylation, Pinl latches onto phosphoproteins and twists the peptide bond next to the proline, which regulates the function of phosphoproteins and participates in controlling the timing of mitotic progression.
  • Pinl has been shown to regulate the expression and/or activity of a diverse array of proteins associated with cancer progression.
  • known Pinl substrates include, without limitation, Her2, PKM2, FAK, Raf-1, AKT, b-catenin, c-Myc, p53, and numerous other proteins known to play roles in cancer progression.
  • the arsenic trioxide and/or retinoic acid compounds may be combined with a compound that inhibits Pinl activity or expression.
  • the arsenic trioxide and/or retinoic acid compounds may be combined with a compound known to interact with other proteins implicated in Pinl signaling pathways (see, e.g., the targets and compounds in Table 3).
  • Table 3 Exemplary Additional Therapeutic Agents
  • Lysine-specific histone demethylase 1 is a flavin-dependent monoamine oxidase, which can demethylate mono- and di-methylated lysines, specifically H3K4 and H3K9).
  • the LSD1 enzyme has roles critical in embryogenesis and tissue-specific differentiation, as well as oocyte growth.
  • the inventors have also identified a shared set of ATRA responsive genes previously reported to be regulated by inhibition of the demethylase LSD1 and associated with ATRA sensitivity.
  • the arsenic trioxide and/or retinoic acid compounds may be combined with a compound that inhibits LSD1 activity or expression.
  • Treatment may be performed alone or in conjunction with another therapy and may be provided at home, the doctor’s office, a clinic, a hospital’s outpatient department, or a hospital. Treatment optionally begins at a hospital so that the doctor can observe the therapy’s effects closely and make any adjustments that are needed, or it may begin on an outpatient basis.
  • the duration of the therapy depends on the type of disease or disorder being treated, the age and condition of the patient, the stage and type of the patient’s disease, and how the patient responds to the treatment.
  • Routes of administration for the various embodiments include, but are not limited to, topical, transdermal, nasal, and systemic administration (such as, intravenous, intramuscular, subcutaneous, inhalation, rectal, buccal, vaginal, intraperitoneal, intraarticular, ophthalmic, otic, or oral administration).
  • systemic administration refers to all nondermal routes of administration, and specifically excludes topical and transdermal routes of administration ⁇
  • each component of the combination can be controlled independently.
  • one or more of the compounds may be administered three times per day, while another compound or compounds may be administered once per day.
  • one compound may be administered earlier and another compound may be administered later.
  • Combination therapy may be given in on-and-off cycles that include rest periods so that the patient’s body has a chance to recover from any as yet unforeseen side effects.
  • the compounds may also be formulated together such that one administration delivers both compounds.
  • Each compound of the combination may be formulated in a variety of ways that are known in the art.
  • a plurality of therapeutic agents e.g., arsenic trioxide, a retinoic acid compound, and/or an additional therapeutic agent, as described herein
  • multiple agents are formulated together for the simultaneous or near simultaneous administration of the agents.
  • co-formulated compositions can include the drugs together in the same pill, ointment, cream, foam, capsule, liquid, etc.
  • the formulation technology employed is also useful for the formulation of the individual agents of the combination, as well as other combinations of the invention.
  • the pharmacokinetic profiles for each agent can be suitably matched.
  • Certain embodiments of the invention feature formulations of arsenic trioxide and/or a retinoic acid compound for, e.g., controlled or extended release.
  • Many strategies can be pursued to obtain controlled and/or extended release in which the rate of release outweighs the rate of metabolism of the therapeutic compound.
  • controlled release can be obtained by the appropriate selection of formulation parameters and ingredients (e.g., appropriate controlled release compositions and coatings). Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, nanoparticles, patches, and liposomes.
  • the release mechanism can be controlled such that the arsenic trioxide and/or retinoic acid compound is released at period intervals, the release could be simultaneous, or a delayed release of one of the agents of the combination can be affected, when the early release of one particular agent is preferred over the other.
  • kits that contain, e.g., a plurality of pills (e.g., two pills or three pills), a pill and a powder, a suppository and a liquid in a vial, two topical creams, ointments, foams etc.
  • the kit can include optional components that aid in the administration of the unit dose to patients, such as vials for reconstituting powder forms, syringes for injection, customized IV delivery systems, inhalers, etc.
  • the unit dose kit can contain instructions for preparation and administration of the compositions.
  • the kit may be manufactured as a single use unit dose for one patient, multiple uses for a particular patient (at a constant dose or in which the individual compounds may vary in potency as therapy progresses), or the kit may contain multiple doses suitable for administration to multiple patients (“bulk packaging”).
  • the kit components may be assembled in cartons, blister packs, bottles, tubes, and the like.
  • the Hoxa9-Meisl- IDH2R140Q model of murine leukaemia cells was generated by the retroviral transduction of KSL (c-Kit+, Sca-1+, Lin-) cells as reported in Quek et a , Nat. Med., 2018, 24: 1167-1177.
  • the generation of murine leukaemia cells showing independence by the mutant IDH2 was casually generated after three serial bone marrow transplantations of murine leukaemia cells.
  • Serial bone marrow transplantation experiments were started by harvesting leukemic bone marrow cells from a single donor mouse and transplanting 5-10 * 10 4 cells into 8-10 recipients. The recipients were age- matched, female C57BL/6J (6-8 weeks old).
  • hematopoietic stem cells LSK were isolated from the bone marrow of a single Tg (M2rt/TA, IDH2R140Q) donor (3-5 months old) maintained on doxycycline diet.
  • Tg M2rt/TA, IDH2R140Q
  • PBS medium containing bone marrow extracts was filtered and purified from red blood cells by incubation on ACK Lysing Buffer (Gibco).
  • Lineage negative cells were immunostained using Lineage Cell Detection Cocktail- Biotin, mouse (Miltenyi Biotec) and streptavidin - APC-Cy7.
  • LSK cells Lineage-, cKit+, Sca-1+
  • BD FACSAria II high speed cell sorters Becton Dickinson
  • IL3 25ng/ml
  • IL6 25ng/ml
  • TPO 50 ng/ml
  • SCF 50ng/ml
  • FLT3Ligand 50ng/ml
  • Sorted LSK were transduced by spinoculation with Hoxa9-IRES-GFP and Meisla-IRES-YFP retroviruses and maintained in culture for no more than 72 hours before transplantation on a primary host (1 st RECIPIENT, C57BL/6J females).
  • Age-matched C57BL/6J recipient female mice (age 8-10 weeks, Jackson Laboratories) were injected intravenously (tail vein) or retro-orbitally with 5-10 x 10 5 leukaemia cells in a volume of 200 pi of sterile PBS. All recipient animals received 650 cGy of radiation 24 hours prior to injection of leukemic cells.
  • Leukemic bone marrow cells harvested from 2 nd and 3 rd RECIPIENTS were ex vivo expanded in RPMI media (Gibco) supplemented with murine SCF, FLT3 Ligand, IL-3, and IL-6 (2.5 ng/mL) for subsequent studies.
  • Intravenous Xenograft Leukaemia model Intravenous Xenograft Leukaemia model.
  • mice 6-8 weeks of age Female NSG (NOD.CgPrkde scld I12 lslni 1 W
  • Cells 25 x 10 4 ) were introduced intravenously by tail vein injection.
  • Mice were treated with ATRA (lOmg/mouse) by subcutaneous implantation of ATRA pellets (5mg/pellet /21 days release), Arsenic trioxide (2.5 mg/Kg/day), or respective vehicle solutions via intraperitoneal injection. The experiment, as well as all treatments, were stopped after 21 days following the exhaustion of ATRA pellets.
  • AML patient - derived xenograft (PDX) model AML patient - derived xenograft (PDX) model.
  • NSG mice engrafted with human AML blasts were purchased from Jackson Laboratories (NOD scid gamma, NOD -scid IL2Rg nu11 , NOD3 scid IL2Rgamma nu11 ).
  • Female NSG mice (age: 4-5 weeks old) were irradiated (400 cGy) 24 hours prior to the retro-orbital transplantation of sorted human AML blasts. Engraftment and disease progression was detected as evidence of human CD45- positive cells in the peripheral blood. Mice were randomly divided into groups before starting of the treatments.
  • Treatment regimen was performed in cycles for a total of 65 days resembling APL0406 protocol (Lo-Coco et al; NEJM 2013). Accordingly, each cycle (65-71 days) was as follows: 15-21 days combination of ATO and ATRA, 10 days no therapy administered (off period) followed by two rounds of single drug administration: 10 days of ATO therapy before 10 days of ATRA therapy. Before the starting of a new cycle, no therapy was administered for 10 days.
  • ATO 2.5 pg/g
  • ATRA 1.5 pg/g
  • the Hoxa9/Meisla/IDH2R140Q murine primary leukaemia cells were cultured and expanded in RPMI media supplemented with murine SCF (2.4 ng/mL), FLT3 Ligand (5ng/mL), IL-3 (2 ng / mL), and IL6 (2.5 ng/mL) (PeproTech).
  • murine SCF 2.4 ng/mL
  • FLT3 Ligand 5ng/mL
  • IL-3 2 ng / mL
  • IL6 2.5 ng/mL
  • doxycycline Sigma
  • Conditioned media (1:2) was used for serial re-plating.
  • Methylcellulose colony assay Methylcellulose colony assay.
  • Methocult M3434 medium MethoCult H4434 Classic (Stem Cell Technologies). According to specific conditions, methylcellulose medium was supplemented with Doxycycline (Gibco), Arsenic Trioxide (Sigma), Tretinoin (Sigma), AGI-6780 or AG-221 (Cay
  • Mouse leukaemia cells were isolated from bone marrow as GFP+ cells and plated at 5000 cells / dish. Then, 2500 cells/dish were used for serial plating. Human AML blasts (1.5 -2.5 *104 cells/dish) were plated in 35-mm Petri dishes and incubated in a humidified CO2 incubator. Colonies were counted as units of at least 30 cells were generated after plating (2 - 4 weeks).
  • KLF1, PIN1, ITGAM, LILRA5, RARA, PRAM1 and GAPDH gene expression were measured using the Taqman assay (Invitrogen) according to manufacturer’s instruction. 2HG treatments.
  • Human TF1 cells TF-1 cells were treated with vehicle (0.1% EtoH) or 0.1 mM (2R)-Octyl-2-HG and harvested at indicated time for Western blot analyses.
  • Cell Proliferation and viability Assay Cells (TF1 or U937, 8-10 *10 3 cells) were plated in complete medium on multiwell plates and treated with ATRA and/or ATO for 4 days. Cells were assayed every 24h for cell viability or proliferation by using CellTiter Glo, MTS Assay (Promega) according with manufacturer protocols.
  • mice were euthanized and single-cell suspensions from the bone marrow were generated by bone crushing in PBS supplemented with 2% FBS.
  • Cell suspensions were passed through IOOmM cell strainers, centrifuged, and then re- suspended in 1-2 ml ACK red cell lysis buffer (GIBCO). Red blood cells were lysed on ice for lmin. Cell suspension were then washed in 2%FBS/PBS, centrifuged, and then re-suspended in 1ml of 2%FBS in PBS1X.
  • Cells were subsequently processed for GFP+/YFP+ sorting, KLS isolation, or intracellular flow staining. Staining with specific antibodies (1:100) or Annexin V/ 7AAD was performed for 15 - 30 minutes at room temperature in the dark, following the protocol reported in Carracedo et ak, Nat Rev Cancer 2013, 13:227-232. For intracellular phosphoflow cytometry on mouse leukaemia blasts, the cells were fixed in 4% PFA at
  • Human AML blasts (2-5*10 4 cells) were fixed in 4%PFA for 5 minutes at 37 °C, washed twice with cold PBS and permeabilized with 90% methanol ( ice-cold). Pellets were washed twice in ice cold PBS and resuspended in Staining buffer (0.5%BSA in PBS1X) and incubated (at 4 °C) with anti - PIN1 antibody ( Rb mAh to PIN1, ab76309, abeam) or respective IgG control (Rb IgG monoclonal isotype control, abl72730, abeam). Cells were washed twice and incubated with Donkey anti - rabbit Alexa Fluor 647 for 1 hour at room temperature. Pellets were washed three times before flow analysis.
  • Tissues were fixed in 4% paraformaldehyde overnight, paraffin embedded, and then sectioned at 5 pm. After deparaffinization and rehydration, antigen retrieval was performed in a pressure cooker with sodium citrate buffer at 95 °C for 25 minutes. Sections were incubated in a 0.3% H2O2 solution in lx PBS, and then a 10% serum solution in lx PBS for 30 minutes each solution was used to block endogenous peroxidase and background from the secondary antibody, respectively.
  • the sections were stained with the primary antibodies: Ki67 (1:200, Thermo Fisher Scientific, #MA5-14520) or Anti-Myeloperoxidase antibody (1:50, abeam #ab9535), or Phospho- Histone H2A.X (1:200, Cell Signalling #9718S) and incubated in a biotinylated secondary antibody in lx PBS (1:500-1:1000) at room temperature for 30 minutes.
  • the Vectastain ABC Elite kit was used to enhance specific staining, and the staining was visualized using a 3’-diaminobenzidine (DAB) substrate.
  • DAB 3’-diaminobenzidine
  • Blocking was performed for one hour using a 5% bovine serum albumin solution in lx PBS.
  • the sections were stained with the P-Histone H2A.X primary antibody (1:200) in a 2% bovine serum albumin and lx PBS solution at 4 °C overnight, and then incubated with a goat anti-rabbit IgG Alexa Fluor 546 conjugate (1:1000) in PBS IX at room temperature for 1 hour before staining with DAPI (1: 1000) in lx PBS for 10 minutes.
  • Cells were washed with lx PBS and milli-Q water before being sealed with a coverslip with Fluorescence Mounting Medium.
  • RNA derived from resistant and sensitive leukaemia cells was subjected to next- generation sequencing (NGS) to generate deep coverage RNASeq data.
  • NGS next- generation sequencing
  • Sequencing libraries of Poly A selected mRNA were generated from the double- stranded cDNA, using the Illumina TruSeq kit according to the manufacturer's protocol. Library quality control was checked using the Agilent DNA High Sensitivity Chip and qRT-PCR. High quality libraries were sequenced on an Illumina HiSeq 4000. To achieve comprehensive coverage for each sample, we generated about 30-35 million single end reads.
  • the raw sequencing data was processed to remove any adaptors, PCR primers, and low quality transcripts using FASTQC and fastx. These provided a very comprehensive estimate of sample quality on the basis of read quality, read length, GC content, uncalled based, ratio of bases called, sequence duplication, adaptors, and PCR primer contamination.
  • These high quality, cleaned reads were aligned against the mouse transcriptome (mmlO) using bowtiel with parameters: p 12 -q -n 2 -m 1 -S -best.
  • Gene expression measurement was performed from aligned reads by counting the unique reads using htseq-count (vO.6.1) with parameters: -a 10 -m intersection_strict.
  • the read count based gene expression data was normalized and analyzed using the“DESEq2 R package”.
  • the differentially expressed genes were identified on the basis of FDR value and fold change. Genes were considered significantly differentially expressed if the multiple hypothesis test-t corrected p-value was ⁇ 0.05.
  • the resulting gene expression matrix was subsequently subjected to gene set enrichment analysis (F-GSEA, https://bioconductor.org/packages/release/bioc/html/fgsea.html) and then visualized through the R pheatmap package. WES sequencing and read alignment.
  • SNPs and indels were identified using the SAMtools mpileup function and variants were called using VarScan suite (v.2, varscan.sourceforge.net). Variants were filtered using an in-house Perl script, to account for SNVs and indels not included in the control sample (wild type), for mapping quality, number of mismatches, read depth, and known variants (Mouse genome project, mgp v.3). Finally, variants were annotated using Annovar (http://annovar.openbioinformatics.org, v.20150322)
  • Copy number variations were called using the binary segmentation algorithm implemented in the“DNACopy R package”.
  • the default parameters and segmented data were merged suing mergeSegments.pl from VarScan suite.
  • mIDH2 R140Q mIDH2 dependent AML model was used to predict mechanisms promoting resistance to mIDH2 inhibitors in patients.
  • mIDH2 dependency was manipulated in a model of mouse bone marrow (BM) cells overexpressing mIDH2 transduced with Hoxa9-GFP and Meisla-IRES-YFP retroviruses transplanted in a primary host in the presence or absence of doxycycline to induce mIDH2 expression.
  • BM mouse bone marrow
  • Meisla-IRES-YFP retroviruses transplanted in a primary host in the presence or absence of doxycycline to induce mIDH2 expression.
  • Dependence on mIDH2 in secondary transplanted disease was confirmed (Figs.
  • Example 2 De novo resistance is associated with a distinct metabolic switch to one- carbon metabolism and altered redox balance
  • mIDH2 Since the expression of mIDH2 directly impacts cellular metabolism, polar metabolites were extracted from sensitive and resistant AML cells from both 2 nd and 3 rd transplanted mice (Fig. 7A). Comparison of metabolite abundance established multiple metabolic processes altered between the mIDH2 leukemic states (Fig. 2A and 2B). Resistant cells were significantly enriched in glycerophospholipid, pyrimidine, purine, cysteine and methionine metabolism pathways (Fig. 2B). These pathways can be fueled by one-carbon metabolism, which consists of both the folate and the methionine cycles (Figs. 7B and 1C).
  • one-carbon metabolism is a main cellular engine contributing to nucleotide metabolism and global methylation, as well as cellular redox status. Similar to recent findings for purine metabolism in cancer, a general increase in purine precursors in 3 rd compared to 2 nd recipient AMLs was observed (Figs. 7D-F).
  • Glutathione metabolism was the most significant and highly enriched metabolic pathway in resistant AML cells (Fig. 2C). 3 rd recipient AML cells demonstrated high levels of glutathione and cysteine, glutathione’s major precursor (Fig. 2D), suggesting that these cells may have an altered redox balance. Indeed, altered NADPH/NADP+ and NADH/NAD+ ratios confirm this oxidative stress (Fig. 2E), and excessive ROS levels were visualized using MitoSOXTM Red staining (Figs. 2F-G), especially relative to Hoxa9/Meisla driven leukemias lacking mIDH2 (Fig. 7G).
  • HoxA9/Meisla/mIDH2 leukemia at early (sensitive) stage were marked by the same features of late (resistant) leukemia. See Figs. 2J(a-e) and 3K(a-e). This evidenced that the mutant IDH leukemia at early stage show the same characteristics/features of the late stage leukemia, when using ATO combined with ATRA, providing a rational for the utilization of ATO and ATRA not only in mutant IDH2 leukemia at late sage (when cells became resistant to the inhibitor), but also at early stage (when cells are sensitive to the inhibitor).
  • Fig. 8A To determine if such genotoxic stress may contribute to AML evolution through targeted mutation whole exome sequencing (WES) of a 2 nd recipient and three of its derived 3 rd recipient‘daughter’ leukemias was performed (Fig. 8A).
  • WES targeted mutation whole exome sequencing
  • Fig. 8B Non-synonymous base substitutions and both G>A:C>T and A>G:T>C transitions accounted for two- thirds of the single base substitutions (SBS) observed, as is frequently found in cancers without biased substitution
  • PCA principal component analysis
  • translocations involve known hematopoietic genes including Rael ( Rael;Pappa t(4;2)), Meisl ( EeahMeis P, t(l 1 ; 10)), and both Ppplrl3b (Asppl) and Cadps2 (Ppplrl 3b:Cadps2 t(6;12)) (Fig. 8E).
  • Rael Rael;Pappa t(4;2)
  • Meisl EeahMeis P, t(l 1 ; 10)
  • Ppplrl3b Asppl
  • Cadps2 Ppplrl 3b:Cadps2 t(6;12)
  • RNAseq analysis was performed to create a global picture of leukemia progression from a state of mIDH2 dependence to independence (Fig. 9A).
  • Primary leukemias derived from Hoxa9;Meisl overexpression without mIDH2 was used for comparison.
  • PCA analysis identified distinct clusters of 2 nd and 3 rd recipient leukemias (Fig. 9B). Differential gene expression patterns highlighted clear differences between sensitive and resistant leukemias (Fig. 3A), suggestive of common pathways leading to independence from mIDH2.
  • a gene-centric PCA identified genes associated with the Jun/Fos AP-1 transcription factor family (Jim, Fos, Fosb), granulopoiesis and myeloid differentiation ( My a, Lyz2, Ngp ), and inflammation ( Zfp36 ) as differential (Fig. 9C). Altered expression status of myeloid granule components also suggested that 2 nd and 3 rd recipient leukemias may represent different stages of myeloid development (Fig. 9C).
  • GSEA Gene set enrichment analysis identified similar pathways altered in resistant AMLs, including enrichment of Kras, MAPK, TNF signaling and response to Tretinoin (aka. all-trans retinoic acid; ATRA) (Fig. 3C), while an interactive network of all differentially regulated genes highlighted the central role of Erk/MAPK signaling in defining the signatures associated with resistant disease (Fig. 8C) consistent with previously published data, suggesting that the present model recapitulates mechanisms relevant to human AML. Indeed, cancer signaling pathway activation was confirmed by flow cytometry analysis (Fig. 8E).
  • ATRA has been recently established as a specific inhibitor of the PIN 1 proto-oncogene.
  • PIN 1 has been reported to be upregulated by C/EBPa-p30, and can promote activation of MAPK. Similarly, it promotes PI3K activity and regulates AKT’s stability and phosphorylation.
  • ATRA is a specific inhibitor of PIN1, it is also important to note that PIN1 itself can be a negative regulator of ATRA, and there is an expanding role for PIN 1 as a negative regulator of hematopoietic differentiation.
  • PIN 1 may contribute to proliferative signaling (MAPK and PI3K dependent), increased survival to ROS-mediated apoptosis, and the ATRA mediated differentiation block observed.
  • a marked upregulation of Pin 1 protein in both Dox ON and OFF mIDH2 leukemias at late stages of progression Fig. 4A, Lanes 5-8. This suggested that 3 rd recipient leukemias may be sensitized to ATRA and that targeting PIN 1 may relieve both the oncogenic signaling and the differentiation block in these cells.
  • ATRA-sensitive retinoic acid receptors were upregulated in mIDH2 2 nd recipient AML, as well as increased C/EBRa and C/EBRe (Fig. 4A, Lanes 3 and 4).
  • PIN1 itself, the negative regulator of the pathway, was also concomitantly induced (Fig. 4A, Lanes 3 and 4).
  • validated Rara/Rxra responsive genes were not transcriptionally activated, suggesting that RARs are transcriptionally inactive.
  • mIDH2 overexpressing TF- 1 and U937 cell lines were used to understand if the same was true for human leukemia. Indeed, both TF- 1 (Fig. 4B) and U937 (Fig. 4C) lines demonstrated upregulation of PIN1 in the presence of mIDH2, along with retinoic acid receptors and C/EBRa. Inhibition of PIN1 by using a specific inhibitor (Juglone) clearly demonstrated PIN 1 to be required for blocking differentiation driven by erythropoietin (EPO) (Fig. 4D) and reduced their clonogenic ability (Figs. 4E, 10A, and 10B).
  • EPO erythropoietin
  • a mIDH2 independent (e.g, resistant) mouse AML was transplanted into BL6 (Fig. 11C) and placed mice on a treatment regime as outlined in Fig. 4K. Both single agent and combination treatments demonstrated efficacy as measured by increase in mean survival of mice treated (Fig. 11D). Strikingly, a number of mice treated with the ATO/ ATRA combination demonstrated a strong differentiation response in the leukemic blasts associated with an excessive infiltration of mature myeloid cells in the lung (Fig. 11E-G). Thus, steroid dexamethasone was also administered. As outlined in Figs. 4K-L, dexamethasone treatment successfully overcame the differentiation syndrome, and enabled extensive survival benefits upon treatment with the ATO/ ATRA combination.
  • a panel of human primary AMLs was treated with ATO/ATRA to evaluate their potential for clinical efficacy, as measured by colony formation in methylcellulose.
  • AML harboring mIDH2 showed a significantly reduced number of colonies upon treatment, and strong synergy was observed in combination treatments (Fig. 5A).
  • NSG mice transplanted with human primary mIDH2 positive AML (Fig. 5B) were subjected to the treatment protocol as outlined in Fig. 5C to evaluate in vivo efficacy. To minimize onset of DS a metronomic dosing schedule was utilized.
  • mIDH2- overexpression in TF1 cells inhibited the induction of the differentiation marker CD71 upon differentiation driven by erythropoietin (EPO), while specific targeting of PIN 1 with Juglone restored the upregulation of this marker. Also similarly, these findings were mimicked by genetic targeting of PIN 1 in mIDH2- overexpressing TF1 cells, with up-regulation of the CD71 and CD44 markers detected by flow cytometry and the differentiation associated HGB and KLF1 genes
  • the therapeutic opportunity afforded by ROS induction was evaluated in this model through the use of arsenic trioxide, hypothesizing that the pro oxidant activity of ATO could cause genotoxic stress and cell death.
  • the murine AML model demonstrated increased apoptosis in both a sensitive mIDH2 dependent and resistant mIDH2 independent setting (Fig. 13h), while the expression of mIDH2 in TF1 cells conferred sensitivity to induction of apoptosis upon treatment with ATO that was not observed in control infected cells (Fig. 13i).
  • Example 9 ATRA and ATO combination for treatment of mIDH AML
  • Fig. 14a 21 days after initiating treatment mice engrafted with mIDH2- overexpressing U937 treated with the ATO/ATRA combination remained alive, while all control mice had succumbed to disease (Fig. 14b).
  • Bone marrow (BM) analysis demonstrated a significant decrease in the percentage of human leukemic blasts, and increased differentiation, in both the ATRA and ATO/ATRA treated cohorts of mice transplanted with mIDH2-overexpressing cells (Fig. 14c-14e).
  • mIDH2 expressing U937 cells treated with the combination therapy demonstrated the mature myeloid CDllb marker amongst all the cohorts analysed (Fig. 14f and 14g).
  • Reduced spleen weights were observed in mice transplanted with mIDH2-expressing U937 cells treated with ATO/ATRA, demonstrating the power of this treatment combination to impact the severity of disease (Fig. 14h).
  • NSG mice transplanted with human primary mIDH2 positive AML were subjected to the treatment protocol, and to minimize onset of differentiation syndrome (DS), we utilized a metronomic dosing schedule, as for APL patients’ treatment protocols.
  • DS onset of differentiation syndrome
  • the ATRA/ ATO combination selectively targets the PINl-PML-RARa oncogenic node, while in mIDH-leukemia, the ATRA/ ATO combination treatment selectively targets the oncogenic mIDH-PINl-RARa node.
  • mIDH-leukemia a cohort of primary human AML cells that harbor either mIDHI or mIDH2
  • Our analysis points to the ability of these oncogenes to sensitize to the effects of ATRA plus ATO.
  • the combination of these agents with specific mIDH targeting agents may in turn potentiate and extend the efficacy of these inhibitors.

Landscapes

  • Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Inorganic Chemistry (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

The present invention features methods and kits relating to the treatment of mIDH1 leukemia, mIDH2 leukemia, and mIDH-associated solid tumors by administering Darinaparsin, a retinoic acid compound, or a combination of an arsenic compound and a retinoic acid compound.

Description

DARINAPARSIN AND RETINOIC ACID COMPOUNDS FOR TREATMENT OF
IDH-ASSOCIATED DISORDERS
CROSS-REFERENCE TO RELATED APPLICATIONS
The present application claims the benefit of U.S. Provisional Patent
Application Serial No. 62/774,709 entitled“DARINAPARSIN AND RETINOIC ACID COMPOUNDS FOR TREATMENT OF IDH-ASSOCIATED DISORDERS filed on December 3, 2018, the disclosure of which is hereby incorporated by reference in its entirety for all purposes.
BACKGROUND
Isocitrate dehydrogenase enzymes (IDH1 and IDH2) are key metabolic enzymes. Mutations to IDH1 and IDH2 have been identified as important early events in a variety of tumor types. For example, IDH enzymes are mutated in approximately 20% of human acute myeloid leukemias (AMLs). Pathogenic mutants of IDH enzymes have been identified that give rise to 2-hydroxyglutarate (2-HG), an oncometabolite that contributes to the oncogenic phenotype. Accordingly, 2-HG is a predictive biomarker in cancers having a pathogenic IDH1 or IDH2 allele.
Specific inhibitors targeting IDH mutants have been identified. For example, the mutant IDH2-targeting Enasidenib (AG-221) has been approved by the FDA for the treatment of relapsed or refractory AML with a mutant form of IDH2 (mIDH2).
However, targeting strong oncogenic drivers often leads to resistance. In particular, little is known about how mIDH (i.e., mIDHI and mIDH2) leukemias may adjust and evolve in response to treatment. Therefore, there is a need to identify common vulnerabilities in mIDH leukemias, and to develop rational therapies capable of preventing or overcoming resistance that arises in response to therapy.
SUMMARY
The present invention is based on the discovery of common vulnerabilities in mIDH leukemia.
The inventors have shown that mIDH leukemia exhibits sensitivity to reactive oxygen species (ROS)-producing compounds, such as arsenic trioxide (ATO) and Darinaparsin. The inventors have also shown that mIDHl/mIDH2 leukemia exhibits sensitivity to retinoic acid compound-induced differentiation (e.g., ATRA-induce differentiation). The inventors have further shown that treatment of leukemia with the combination of a ROS promoting compound (e.g., arsenic trioxide and Darinaparsin) and a compound that promotes differentiation (e.g., a Pinl inhibitor, such as ATRA) provides a synergistic, powerful, and well-tolerated targeted therapy in both mouse and human models of AML.
The present invention therefore features methods of treating cancer by contacting the cells of the cancer with a pharmaceutical compound. The pharmaceutical compound can be Darinaparsin, a retinoic acid compound (e.g., ATRA), or a combination of Darinaparsin and a retinoic acid compound (e.g., Darinaparsin and ATRA).
The cancer can be a leukemia (e.g., mIDHl/mIDH2 leukemia) or a solid tumor (e.g., an IDH1- or IDH2-associated solid tumor). Examples of the solid tumors include, but are not limited to, glioma, paraganglioma, astroglioma, colorectal carcinoma, melanoma, cholangiocarcinoma, chondrosarcoma, thyroid carcinomas, prostate cancers, and non-small cell lung cancer.
In one aspect, the invention features a method of treating leukemia in a subject. The method includes contacting the cells of said leukemia with (e.g., by administering to said subject) an effective amount of a pharmaceutical compound, the pharmaceutical compound being Darinaparsin, a retinoic acid compound, or a combination thereof, wherein one or more cells of the leukemia has a pathogenic IDH2 allele or has elevated 2- hydroxyglutarate (2-HG) levels; and wherein contacting said cells of said leukemia with said pharmaceutical compound treats said leukemia in said subject.
In another aspect, the invention features a method of treating leukemia in a subject, wherein one or more cells of the leukemia has a pathogenic IDH1 allele or has elevated 2-HG levels. The method includes contacting the cells of said leukemia with (e.g., by administering to said subject) an effective amount of a pharmaceutical compound, the pharmaceutical compound being Darinaparsin, a retinoic acid compound, or a combination thereof, wherein contacting said cells of said leukemia with said pharmaceutical compound treats said leukemia in said subject.
Elevated 2-HG levels may be considered to include detection of any 2-HG at all. In some assays where background 2-HG is detected, a pathological level of 2-HG associated with an IDH1/IDH2 cancer may be determined by levels of 2-HG at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the 2-HG levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell. Elevated 2-HG levels can be determined via (i) the detection of D-2-HG in biological fluids detected by LC-MS/MS; (ii) the detection of total 2-HG (including both L-2-HG and D-2- HG) in the serum above 2mM; or (iii) the detection of the presence of mutant variants of IDH1/IDH2.
In some embodiments, contacting said cells of said leukemia with the
Darinaparsin and the retinoic acid compound results in the remission of the leukemia in the subject (e.g., the symptoms of the leukemia are reduced). In some embodiments, contacting said cells of said leukemia with the Darinaparsin and the retinoic acid compound results in the complete remission of the leukemia (e.g., all signs and symptoms of the leukemia are absent). In some embodiments, contacting said cells of said leukemia with the Darinaparsin and the retinoic acid compound cures the leukemia in the subject (e.g., all signs and symptoms of the leukemia are absent for 1 year or more, for 2 years or more, for 3 years or more, for 4 years or more, or for 5 years or more).
In some embodiments, the Darinaparsin and the retinoic acid compound operate synergistically to treat said leukemia. In some embodiments, the Darinaparsin and the retinoic acid compound is more effective for treating said leukemia than the same quantities of either said Darinaparsin or said retinoic acid compound alone.
In some embodiments, contacting said cells of said leukemia with of the
Darinaparsin and the retinoic acid compound increases the production of reactive oxygen species (ROS) in one or more cells of said leukemia, e.g., increases the production of ROS by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to production of ROS prior to treatment with the Darinaparsin and the retinoic acid compound. Preferably, contacting said cells of said leukemia with of the Darinaparsin and the retinoic acid compound increases the production of ROS by at least about 10%.
In some embodiments, contacting said cells of said leukemia with of the
Darinaparsin and the retinoic acid compound promotes differentiation of one or more cells of said leukemia.
In some embodiments, contacting said cells of said leukemia with of the combination of Darinaparsin and a retinoic acid compound is sufficient to inhibit and/or degrade Pinl in the subject. In some embodiments, this may include an increase in degradation of Pinl of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the Darinaparsin and the retinoic acid compound. Preferably, contacting said cells of said leukemia with of the
Darinaparsin and the retinoic acid compound increases the degradation of Pinl of at least about 10%.
In some embodiments, this may include a reduction in Pinl activity of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the Darinaparsin and the retinoic acid compound. In some embodiments, the contacting said cells of said leukemia with of Darinaparsin and a retinoic acid compound is more effective for inhibiting and/or degrading Pinl in the subject than administration of the same quantities of either the Darinaparsin or the retinoic acid compound alone. In some embodiments, contacting said cells of said leukemia with the Darinaparsin and the retinoic acid compound is more effective for treating the leukemia than contacting said cells of said leukemia with of the same quantities of either the Darinaparsin or the retinoic acid compound alone.
In some embodiments, the Darinaparsin and the retinoic acid compound may be administered concurrently (e.g., within about lmin, 2min, 5min, lOmin, 20min, 30min, or 60min) or separately. The Darinaparsin may be administered either prior to or after the retinoic acid compound.
In some embodiments, the invention features a method of treating leukemia in a subject. The method includes contacting the cells of the leukemia with an effective amount of the Darinaparsin to said subject, wherein one or more cells of the leukemia have a pathogenic IDH1/IDH2 allele or have been previously determined to have elevated 2-hydroxy glutarate (2-HG) levels; and wherein contacting said cells of said leukemia with the Darinaparsin treats the leukemia in the subject. Elevated 2-HG levels may be considered to include levels of 2-HG at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the 2-HG levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
In some embodiments, contacting said cells of said leukemia with the
Darinaparsin increases the production of reactive oxygen species (ROS) in one or more cells of said leukemia (e.g., increases the production of ROS by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to production of ROS prior to treatment with the Darinaparsin).
In some embodiments, contacting said cells of said leukemia with the
Darinaparsin is sufficient to inhibit and/or degrade Pinl in the subject. In some embodiments, this may include an increase in degradation of Pinl of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the Darinaparsin. In some embodiments, this may include a reduction in Pinl activity of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the Darinaparsin. Preferably, contacting said cells of said leukemia with of the Darinaparsin increases the degradation of Pinl of at least about 5%.
In some embodiments, the invention features a method of treating leukemia in a subject. The method includes contacting the cells of the leukemia with an effective amount of a retinoic acid compound to the subject, wherein the subject has a pathogenic IDH1/IDH2 allele or wherein one or more cells of the leukemia have been previously determined to have elevated 2-hydroxyglutarate (2-HG) levels; and wherein contacting said cells of said leukemia with the retinoic acid compound treats the leukemia in the subject. Elevated 2-HG levels may be considered to include levels of 2-HG at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the 2-HG levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell.
In some embodiments, contacting said cells of said leukemia with the retinoic acid compound promotes differentiation of one or more cells of the leukemia.
In some embodiments, contacting said cells of said leukemia with the retinoic acid compound is sufficient to inhibit and/or degrade Pinl in the subject. In some
embodiments, this may include an increase in degradation of Pinl of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with retinoic acid compound. In some embodiments, this may include a reduction in Pinl activity of at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to Pinl activity prior to treatment with the retinoic acid compound.
Preferably, contacting said cells of said leukemia with of the retinoic acid compound increases the degradation of Pinl of at least about 5%.
In some embodiments, the subject has elevated levels of Pinl activity (e.g., has previously been determined to have elevated levels of Pinl activity in one or more cells of the leukemia). Levels of Pinl activity in the subject may be determined by measuring the levels of at least one Pinl marker, wherein elevated levels of the Pinl marker is indicative of elevated Pinl activity. Non-limiting examples of Pinl markers include nucleic acid molecules (e.g., mRNA, DNA) that correspond to some or all of a Pinl gene, peptide sequences (e.g., amino acid sequences) that correspond to some or all of a Pinl protein, nucleic acid sequences which are homologous to Pinl gene sequences, peptide sequences which are homologous to Pinl peptide sequences, alteration of Pinl protein, antibodies to Pinl protein, substrates of Pinl protein, binding partners of Pinl protein, alteration of Pinl binding partners, and activity of Pinl. In some embodiments, alteration of a Pinl protein may include a post-translational modification (e.g., phosphorylation, acetylation, methylation, lipidation, or any other post-translational modification known in the art) of Pinl. In some embodiments, a Pinl marker is the level of Pin expression (e.g., Pinl protein expression levels and/or Pinl mRNA expression levels) in a subject.
Elevated levels of a Pinl marker include, for example, levels at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the marker levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell. Preferably, elevated levels of a Pinl marker include levels at least about 3% or greater than the marker levels measured in a normal subject, tissue, or cell.
In some embodiments, the method further comprises contacting said cells of said leukemia with a compound that inhibits Pinl activity (e.g., in combination with the retinoic acid and the Darinaparsin).
In some embodiments, the subject has decreased levels of lysine-specific demethylase (LSD1) activity. Levels of LSD1 activity can be determined by methods known to one of skill in the art, including determining the levels of lysine histone methylation (e.g., H3K4me2 and/or H3K9me2). Decreased levels of LSD 1 activity include, for example, a reduction of LSD1 activity of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the marker levels measured in a normal (e.g., wild- type and/or disease fee) subject, tissue, or cell. Preferably, decreased levels of LSD1 activity include a reduction of LSD1 activity of about 20% or greater than the marker levels measured in a normal subject, tissue, or cell.
In some embodiments, the method further comprises contacting said cells of said leukemia with a compound that inhibits LSD1 activity (e.g., reduced LSD1 activity by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to LSD1 activity prior to treatment).
In some embodiments, the method further comprises contacting said cells of said leukemia with an inhibitor of IDH1/IDH2. The inhibitor of IDH1/IDH2 may reduce IDH1/IDH2 activity (e.g., as measured by a reduction in 2-HG levels) by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater relative to IDH1/IDH2 activity prior to treatment. The inhibitor of IDH1/IDH2 may be specific for a pathogenic mutant form of IDH1/IDH2. When such an inhibitor targets a mutant form of IDH1/IDH2, it may reduce the aberrant activity of the enzyme by about 20%.
In some embodiments, the pathogenic IDH1 allele is IDH1R132C and the pathogenic IDH2 allele is IDH2R140Q.
In some embodiments, the method further includes contacting said cells of said leukemia with an effective amount of dexamethasone.
In a further aspect, the invention features a kit for treating leukemia in a subject, wherein the kit includes: (a) an effective amount of Darinaparsin, (b) an effective amount of a retinoic acid compound, and (c) instructions for the use of the Darinaparsin in combination with the retinoic acid compound for treating the leukemia in the subject, wherein one or more cells of said leukemia has a pathogenic IDH1/IDH2 allele or wherein the subject has been previously determined to have elevated 2-hydroxyglutarate (2-HG) levels. Elevated 2-HG levels may be considered to include levels of 2-HG at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the 2-HG levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell. In some embodiments, the kit further includes an effective amount of a compound that inhibits Pinl activity and instructions for the use of the compound that inhibits Pinl activity in combination with the Darinaparsin and the retinoic acid compound.
In some embodiments, the kit further includes an effective amount of a compound that inhibits LSD1 activity and instructions for the use of the compound that inhibits LSD1 activity in combination with the Darinaparsin and said retinoic acid compound.
In some embodiments, the kit further includes an effective amount of a compound that inhibits Pinl activity, an effective amount of a compound that inhibits LSD1 activity, and instructions for the use of the compound that inhibits Pinl activity and the compound that inhibits LSD1 activity in combination with the Darinaparsin and the retinoic acid compound.
In some embodiments, the retinoic acid compound is administered in a low dose such as about 5 mg/kg body weight or less (e.g., about 0.1, 0.2, 0.5, 0.75, 1, 2, 3, 4, or 5 mg/kg body weight or less), 1.5 ug/g body weight or less (e.g., about 0.1, 0.2, 0.5, 0.75, 1, or 1.5 ug/g body weight or less), less than about 25 mg/m2 (e.g., less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 mg/m2), or between 25 mg/m2 and 45 mg/m2 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 mg/m2). In some embodiments, the low dose of the retinoic acid compound is a nontoxic dose of the retinoic acid compound. In some embodiments, the low dose of the retinoic acid compound is administered in combination with a low dose of retinoic acid. In some embodiments the low dose of the retinoic acid compound and the low dose of the retinoic acid are nontoxic.
In some embodiments, a low dose of a retinoic acid compound related to in vivo treatments (e.g., in mice treatments) is 1.5 mg/g/day or lower. In some embodiments, a low dose of the retinoic acid compound comprises a dose of about 30 mg/m2 body surface area or less. For example, a low dose of a retinoic acid compound related to treating a human with leukemia is 10-22.5 mg/m2 (PO administration, BID). In some embodiments, a low dose of the retinoic acid compound comprises a dose of about 10 mg/m2 body surface area or less.
In some embodiments, the Darinaparsin is administered in a low dose, such as 2 mg/kg body weight or less (e.g., about 0.01, 0.02, 0.03, 0.032, 0.04, 0.05, 0.06, 0.07,
0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.25, 1.5, 1,75, or 2 mg/kg body weight or less), between about 0.5 mg/kg and about 12 mg/kg body weight (e.g., about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/kg body weight), or less than about 6 ug/g body weight (e.g., less than about 0.1, 0.2, 0.5, 0.75, 1, 2, 3, 4, 5, or 6ug/g body weight). In some embodiments, a low dose of the Darinaparsin is about 0.15, about 0.16, or about 0.032 mg/kg body weight. In some embodiments, the low dose of the Darinaparsin is a nontoxic dose of the Darinaparsin.
In some embodiments, a low dose of Darinaparsin related to in vitro treatments of leukemia cells is 0.25 mM or lower. In some embodiments, a low dose of Darinaparsin related to in vivo treatments (e.g., in mice treatments) is 2.5 mg/g/day or lower. In some embodiments, a low dose of Darinaparsin comprises a dose of about 2.5 mg/kg body weight or less (e.g., a dose of between about 0.05 mg/kg body weight and about 2.5 mg/kg body weight). For example, a low dose of Darinaparsin related to treating a human with leukemia is 0.075-0.15 mg/kg (IV administration, QD). In some embodiments, a low dose of Darinaparsin comprises a dose of about 0.05 mg/kg body weight or less.
In some embodiments, the low dose of the Darinaparsin is administered in combination with a low dose of a retinoic acid compound. In some embodiments the low dose of the Darinaparsin and the low dose of retinoic acid compound are nontoxic.
In some embodiments, the retinoic acid compound is all-trans retinoic acid (ATRA), 13-cis-retinoic acid, retinol, retinyl acetate, retinal, or AC-55640, or is a compound structurally similar to retinoic acid. In some embodiments, the retinoic acid compound is a compound selected from Table 1 or Table 2. In a preferred embodiment, the retinoic acid compound is ATRA.
In some embodiments, the leukemia is acute myeloid leukemia (AML). The acute myeloid leukemia may be either relapsed acute myeloid leukemia or refractory acute myeloid leukemia. In some embodiments, the leukemia is an IDH1/IDH2 independent (e.g., resistant) leukemia. An IDH2 independent leukemia includes, for example, a leukemia having a pathogenic IDH2 allele which has developed resistance to IDH2- targeting therapies (e.g., Enasidenib).
The leukemia described above can be acute promyelocytic leukemia (APL). In some embodiments, the leukemia is not acute promyelocytic leukemia APL.
In some embodiments, one or more cells of said leukemia has a pathogenic IDH1/IDH2 allele and elevated 2-hydroxyglutarate (2-HG) levels.
Referring to the method or kit described above, in some embodiments, one or more cells of the leukemia comprise a pathogenic IDH1 or IDH2 allele in combination with one or more other mutants. Examples of the other mutants include, but are not limited to, FLT3, NPM1, DNMT3A, RUNX1, TET2, IDH2, CEBPA, TP53, IDH1, NRAS, RARA, PML, TTN, WT1, MYH11, BPIFC, CBFB, KIT, KRAS, KMT2A, PTPN11, MUC16, SMC1A, RUNX1T1, MPO, U2AF1, ABCA6, DMXL2, DNAH3, KLK3, FBX07, SMC3, MXRA5, MUC17, SF3B1, HPS3, PHF6, ASXL1, AHNAK, SENP6, MYCBP2, NF1, PCLO, CSMD3, LRP1B, MED 12, RAD21, AHNAK2, GDI2, PARP14, KLHL7, BCORL1, SPEN, BRWD1,UBR4, STAG2, LNX1, FREM2,
MLLT10, DNAH11, SLIT2, DNAH9, BRINP3, HMCN1, SYNE1, GABRG3, NPAS3, CSMD1, GATA2, ZCRB1, MTFR2, SLC43A1, SLA2, APOB, PRDM1, BTBD10, ABCA5, EP300, TNC, ADGRG4, BSN, IFT74, COL12A1, NUP98, CREBBP, EPG5, KIF1B, ABL1, SLC16A7, RALGPS2, CHL1, SCLT1, LRP2, VWA3B, FRYL, PRUNE2, PLCE1, GRIK4, HIVEP3, RYR3, ANK2, ATRNL1, VPS13B, GPR179, FCGBP, KIF15, and DNAH10. Two exemplary mutants are NPMc+ and FLT3-ITD.
In some embodiments of the above method or kit, one or more cells of the leukemia comprise a pathogenic IDH1 allele in combination with NPMc+, FLT3-ITD, or both. An exemplary pathogenic IDH1 allele is IDH1R132C.
In some embodiments of the above method or kit, one or more cells of the leukemia comprise a pathogenic IDH2 allele in combination with NPMc+, FLT3-ITD, or both. An exemplary pathogenic IDH2 allele is IDH2R140Q.
In some embodiments of the above method or kit, the effective amount of the Darinaparsin is a low dose of about 2.5 mg/kg body weight or less, the effective amount of the retinoic acid compound is a low dose of about 30 mg/m2 body surface area or less, and the retinoic acid compound is selected from the group consisting of all-trans retinoic acid (ATRA), 13-cis-retinoic acid, retinol, retinyl acetate, retinal, and AC-55640.
In some embodiments of the above method or kit, the effective amount of the Darinaparsin is a low dose of between about 0.05 mg/kg body weight and about 2.5 mg/kg body weight, the effective amount of the retinoic acid compound is a low dose of about 10 mg/m2 body surface area or less, and the retinoic acid compound is ATRA.
In some embodiments of the above method or kit, one or more cells of the leukemia comprise a pathogenic IDH1 or IDH2 allele in combination with NPMc+, FLT3-ITD, or both, in which said pathogenic IDH1 allele is IDH1R132C and said pathogenic IDH2 allele is IDH2R140Q. BRIEF DESCRIPTION OF THE DRAWINGS
The application file contains at least one drawing executed in color. Copies of this patent or patent application with color drawings will be provided by the Office upon request and payment of the necessary fee.
Fig. 1A is an image depicting the approach used to model in vivo independence from mIDH2 (IDH2R140Q) in AML. Mouse model is based on serial transplantation of leukemia cells derived form Tg(M2rt-TA) transgenic mice and overexpressing HoxA9 and Meisla oncoproteins. Red boxes: leukemia. Blue boxes: healthy state.
Fig. IB is a series of images depicting Flow cytometry plots of bone marrow samples. X- axis, fluorescence Intensity (0 - 105), Y-axis, cell counts.
Fig. 1C is a graph depicting the percentage of Leukemic cells in the bone marrow ( BM) of 2nd and 3rd recipients maintained on DOX ON or DOX OFF diet. Quantitation is expressed as percentage of leukemic cells showing positivity for GFP and YFP fluorescence.
Fig. ID is a series of images showing May-Griinwald-Giemsa staining of peripheral blood (PB) smears at euthanization (6- 9 weeks after transplant).
Fig. IE is a graph depicting the percentage of blasts in peripheral blood ( PB) in of 2nd and 3rd recipients maintained on DOX ON or DOX OFF diet.
Fig. IF is a graph depicting the LC- MS quantification of the 2-HG peripheral blood ( PB) in of 2nd and 3rd recipients maintained on DOX ON or DOX OFF diet.
Fig. 1G is a graph depicting real time quantitative PCR analyses for the expression of mIDH2 (IDH2R140Q) in leukemia cells.
Fig. 1H is a graph depicting real time quantitative PCR analyses for the expression of HoxA9 in leukemia cells.
Fig. II is a graph depicting real time quantitative PCR analyses for the expression of Meisl A in leukemia cells.
Fig. 1J is a graph depicting the number of methylcellulose colonies generated at 3rd plating by leukemia cells (GFP+/YFP+) isolated from n=3 bone marrow samples. IDH2R140Q inhibitor (IDHi): AGI-6780, ImM, vehicle: DMSO. Data are means ± SD of n=3 replicates for each sample.
Fig. IK is a series of images depicting representative magnification of methylcellulose colonies generated by blasts at 3rd plating. Fig. 1L is a graph depicting the relative LC- MS quantification of the 2-HG from colonies pooled and extracted for metabolites at 3rd-plating. vehicle: DMSO, IDHi: AGI- 6780, ImM
Fig. 2A is an image depicting Hierarchical clustering of leukemia cells’ metabolites isolated from Dox+ cohorts. Rows: metabolites; columns: samples; color key indicates metabolite abundance level (blue: lowest; red: highest). Clustering generated by MetaboAnalyst’ s annotation tool.
Fig. 2B is an image depicting the Pathway enrichment analysis of altered metabolic pathways between sensitive (2nd RECIPIENT - derived cells) and resistant (3rd RECIPIENT - derived) leukemia cells.
Fig. 2C is an image depicting the bar chart showing metabolic pathways enriched in resistant leukemia cells isolated from 3rd RECIPIENTS.
Fig. 2D is a graph depicting Fold changes of Cysteine (CYS) and Glutathione (GSH) metabolites in resistant leukemia cells compared with sensitive leukemia cells.
Fig. 2E is a graph depicting Fold change of the NAD+/NADH and
NADP+/NADPH ratio in resistant leukemia cells compared with sensitive leukemia cells. NAD+: nicotinamide adenine dinucleotide oxidized, NADP+: nicotinamide adenine dinucleotide phosphate oxidized, NADH: nicotinamide adenine dinucleotide reduced, NADPH: nicotinamide adenine dinucleotide phosphate reduced.
Fig. 2F is an image depicting flow cytometry plots for fluorescence intensity of sensitive (n=4) and resistant (n=5) leukemia cells incubated with the redox sensitive probe, MitoSox. X- axis: Fluorescence intensity levels; Y-axis: percentage of cell counts.
Fig. 2G is a graph depicting the percentage of cells showing high levels of ROS (ROSHi) in sensitive (derived from 2nd RECIPIENTS) and resistant (derived from 3rd RECIPIENT) cells shown in (2F).
Fig. 2H is a series of images depicting Immunofluorescence for the DNA damage marker gH2A.C (red) and DNA (blue) and relative quantitation of positive nuclei. Data are mean ± SD of n=3 different fields of n=3 different evaluated samples.
Fig. 21 is a series of images depicting IHC for gH2A.C in mouse spleen sections and percentage of infiltrating blasts showing positivity for the gH2A.C marker.
Fig. 2J(a-e): a series of graphs showing the transcriptional rewiring of mIDH leukaemia at early (sensitive) stage, characterized by altered MAPK and ATRA associated pathways a. Bar chart showing the most significantly up-regulated KEGG pathways in HoxA9/Meisla/mIDH2 cells. The pathways are ranked on the basis of the gene set size indicating activation b-c. Gene Set Enrichment (GSE) plots of Tretinoin related Signature in HoxA9/Meisla/mIDH2 vs HoxA9/Meisla. d-e, Gene Set Enrichment (GSE) plots of LSD1 Signature in HoxA9/Meisla/mIDH2 vs HoxA9/Meisla.
Fig. 3A is an image depicting the heat map of differentially expressed genes (P<0.05) in sensitive and resistant samples or Hoxa9/Meisla leukemia, not primed by mIDH2. The columns represent the samples and the rows represent the genes. Gene expression is shown with pseudocolor scale (-3 to 3) with upregulated genes shown as a shade of blue and downregulated genes as a shade of red.
Fig. 3B is an image depicting the bar chart showing the most significantly up- regulated pathways (multiple test corrected p-value <0.05) in resistant leukemia cells. The pathways are ranked on the basis of Z score indicating activation.
Fig. 3C is an image depicting Gene Set Enrichment (GSE) plots of MAPK,
TNFcr, and ATRA related signature in resistant (3rd RECIPIENT) vs sensitive (2nd RECIPIENT) leukemia cells (left panel) and the associated Heat maps (right panels).
Fig. 3D is an image depicting the Venn Plot showing shared genes between mouse mIDH2 leukemia and Schenken et ak; 2013 gene sets.
Fig. 3E is an image depicting the Heat map showing shared genes shown in (3D) are regulated concordantly in Resistant and Sensitive clone with respect to ATRA+TCP gene sets reported by Schenken et ak; 2013.
Fig. 3F is a series of graphs and images depicting the quantifications of morphological screening of murine leukemia cells isolated from the bone marrow of sensitive (2nd RECIPIENTS, n=2) or resistant (3rd RECIPIENTS, n=3) and treated with physiological (10 9M, 10 8M) or pharmacological (10 7M, 106M) concentrations of ATRA. Hoxa9/Meisla leukemia cells (n=l) were included as the control. For each sample n=100 cells were counted n=3 times for statistical analysis. The figure legend ( right panel) describes representative images of leukemia cells at different stages of differentiation ( blasts, intermediate, differentiated)
Fig. 3G is a graph depicting relative LC-MS/MS quantitation of 2-HG in TF1 cells overexpressing IDH2R140Q or respective controls
Fig. 3H is a series of images and graphs depicting Cytospin images and quantitation of human TF1 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) to the respective controls (CTRL) that have been treated with pharmacological concentrations of ATRA (10-6M) or vehicle (DMSO).
Fig. 31 is a graph depicting Cell proliferation assay on TF1 cell line, stably overexpressing the mIDH2 or the empty vector (CTRL). Each cell line was treated with ATRA (10 6M) or vehicle (DMSO) for n=4 days.
Fig. 3J is a series of images depicting different culture media color of TF1 cell line stably overexpressing mIDH2 or respective control (CTRL). Each cell line was treated with ATRA (10-6M) or vehicle (DMSO) for n=6 days in presence or absence of EPO. The asterisks (yellow) indicate mIDH2-TFl leukemia cells treated with treated with ATRA (10-6M). 1-4 flasks show cultured TF1 cell line (CTRL), 5-8 flasks show cultured TF1 cell line overexpressing the mutant variant R140Q of IDH2 (mIDH2). 1, 5: TF1 treated with DMSO; 2,6: TF1 treated with ATRA; 3,7: TF1 treated with DMSO in media supplemented with pro-differentiating stimuli (EPO); 4,8: TF1 treated with ATRA in media supplemented with pro-differentiating stimuli (EPO).
Fig. 3K(a-e): a series of graphs showing mouse HoxA9/Meisla/ mIDH2 leukaemia at early (sensitive) stage, marked by switching to One-Carbon metabolism and increased oxidative stress a. Hierarchical clustering of leukaemia cells’ metabolites isolated from Dox-i- cohorts. Rows: metabolites; columns: samples; colour key indicates metabolite abundance level (blue: lowest; red: highest). Clustering generated by
MetaboAnalyst’ s annotation tool. b. Pathway enrichment analysis shows altered metabolic pathways between HoxA9/Meisla/mIDH2 and respective HoxA9/Meisla control cells c. LC-MS/MS fold change levels of precursors for One-Carbon metabolism isolated from HoxA9/Meisla/mIDH2 and respective HoxA9/Meisla control cells. Data are mean ± SD. d. LC-MS/MS fold change levels of precursors for pyrimidine metabolism. OMP: orotidine -5’-monophosphate, UDP: uridine diphosphate. Data are mean ± SD. e. LC-MS/MS fold change levels of both reduced glutathione (GSH) and oxidized glutathione (GSSH) and their ratio. Data are mean ± SD.
Fig. 4A is an image depicting Western blot analysis for ATRA targets (Pinl), ATRA receptors (RARcr,RXRcr), and factors associated with ATRA - related differentiation pathway in hematopoietic cells (c/EBPer, c/EBRe). The samples are protein extracts from different (n=2) sensitive or resistant leukemia cells. Protein samples isolated from Hoxa9/Meisla leukemic cells (n=2) were included as control. Fig. 4B is an image depicting the Western blot analysis for factors associated with ATRA-related pathway in TF1 cell line, stably overexpressing the mIDH2) or the empty vector (CTRL).
Fig. 4C is an image depicting the Western blot analysis for factors associated with ATRA-related pathway in U937 cell line, stably overexpressing the mIDH2) or the empty vector (CTRL).
Fig. 4D is a graph depicting Percentage of the transferrin receptor (CD71+) positive TF1 cells overexpressing the mIDH2 or respective control (CTRL). Each cell line was treated with the Pinl Inhibitor (Juglone) or vehicle (DMSO) for 3 days.
Fig. 4E is a graph depicting the Colony forming assay of TF1 cells overexpressing the mIDH2 or respective control (CTRL) treated with Juglone or vehicle. Colonies were quantitated after 7 days from plating.
Fig. 4F is a graph depicting the quantification of the relative transcriptional expression levels of Hemoglobin (HBG) in TF1 cells silenced for Pinl and
overexpressing the mIDH2 or respective controls (CTRL).
Fig. 4G is a graph depicting the quantification of the relative transcriptional expression levels of KLF1 in TF1 cells silenced for Pinl and overexpressing the mIDH2 or respective controls (CTRL).
Fig. 4H is a graph depicting the quantification of the relative transcriptional expression levels of GATA2 in TF1 cells silenced for Pinl and overexpressing the mIDH2 or respective controls (CTRL).
Fig. 41 is a graph depicting the Fold Induction of CD71 in TF1 cells
overexpressing mutant IDH2 alone (mIDH2) or in combination with PIN1 (mIDH2 PIN1++) and induced to differentiation after treatment with the IDH inhibitor AG-221 or respective vehicle ( DMSO).
Fig. 4J is a series of graphs depicting the Quantification of the relative transcriptional expression levels of Hemoglobin (HBG), Kruppel like factor 1 (KLF1), in TF1 cells silenced for Pinl and overexpressing the mIDH2 or respective controls (CTRL).
Fig. 4K is an image depicting the scheme of ATO/ ATRA treatments performed in vivo on BL6J recipient mice transplanted with resistant leukemia
Fig. 4L is an image deciphering the percent of survival of recipient mice
transplanted with resistant leukemia cells and treated as shown in 4K. N=10 / arm. Fig. 4M is an image deciphering the inhibition of LSD 1 contributes to increase intracellular levels of oxidative stress. Histogram reporting the intracellular oxidative stress of TF1 cells treated for 3 weeks with the LSD1 inhibitor (LSDli; GSK2879552, ImM) or DMSO (VHL) as respective control. Measurements were performed by flow cytometry analyses after incubation of TF1 cells with the CellROX molecular probe. Data are mean ± SD.
Fig. 5A is a series of images and graphs depicting methylcellulose colony forming assay quantification of human primary AML blasts treated in vitro with pharmacological concentration of ATRA, ATO, a combination of both, or vehicles as control. Treatments were performed in either the presence of mIDH2 or absence of the mutation (CTRL).
Data are means ± SD of duplicates.
Fig. 5B is an image depicting the Experimental approach to generate PDX for human AML harboring the mutation R140Qin the IDH2 gene
Fig. 5C is an image depicting the Scheme of the pharmacological therapy for PDX resembles therapeutic regimen of human APL patients. Treatment regimen was performed in cycles for a total of 65 days resembling APL0406 protocol (Lo-Coco et al; NEJM 2013).
Fig. 5D is an image depicting the , Kaplan-Meyer curve showing the percentage of disease free survival related to ATO /ATRA the pre-clinical study on mIDH2 PDX ( n=5 PDX/ cohort). Data analyzed by Log-Rank (Mentel-Cox) test.
Fig. 5E is a series of images depicting the cytospins of cells isolated from BM of PDX mice treated with ATRA and ATO.
Fig. 5F is a graph depicting the percentage of morphologically screened human cells isolated from BM of PDX generated by using IDH2R140Q AML.
Fig. 5G is an image depicting the scheme of leukemia evolution from mIDH dependent to mIDH2 independent states (e.g. acquisition of resistance to mIDH inhibition). Multiple alterations including genetic mutations, metabolic reprogramming, and transcriptional rewiring are acquired during progression and co-exist in the mIDH2 independent stage. In this multifactorial setting, we unveil Pinl and high ROS levels as key factors of upregulated pro-survival and proliferation programs (MAPK/PI3K pathways), loss of functional ATRA signaling, and altered metabolic state (One-Carbon metabolism and increased nucleic acid synthesis). These features represent targetable vulnerabilities of leukemia cells and highlight the potential for using ATO (pro-oxidant) and ATRA (pro-differenting) drugs. Most importantly, sensitivity to ATO and ATRA is a vulnerability already present at an early stage in mIDH2 dependent leukemia, which is mantained in later stages of the disease progression.
Fig. 6A is a graph depicting Kaplan-Meier survival curves for 3rd RECIPIENTS (Dox+ = mIDH2 ON; Dox- = mIDH2 OFF).
Fig. 6B is a series of images depicting Haemotoxylin and Eosin (H&E) staining of internal organs (spleen, liver, and kidney) from 3rd RECIPIENTS showing infiltrating blasts. Enlarged images (40x) show perivascular accumulation of infiltrating blasts in spleen, liver, and kidney.
Fig. 6C is a series of images depicting H&E and immunohistochemistry (IHC) staining of kidney sections derived from 3rd RECIPIENTS. The IHC staining shows infiltrating blasts are positive for the antigen Ki-67, a cellular marker for proliferation.
Fig. 6D is a series of images depicting H&E staining of internal organs (spleen, liver, and kidney) from 2nd RECIPIENTS. High resolution images show absence or limited infiltrating blasts.
Fig. 6E is a series of images depicting H&E and IHC staining of kidney sections derived from 2nd RECIPIENTS. The IHC staining for the antigen Ki-67 is mostly negative across the examined tissue.
Fig. 6F is a graph depicting the quantification of the IHC staining for the antigen Ki-67, in blasts infiltrating internal organs (spleen, liver, and kidney). Sections of the internal organs from 2nd RECIPIENTS (n=3) and 3rd RECIPIENTS (n=3) were scored for n=3 different fields.
Fig. 6G is a series of graphs depicting the growth curves of primary sensitive and resistant murine leukemia cell lines, respectively generated from bone marrow of 2nd or 3rd RECIPIENTS. Variability of cell growth rate represents heterogeneous samples. Data are reported for n=3 primary murine leukemia cell lines generated by n=3 different recipients.
Fig. 6H is a graph depicting a methylcellulose colony forming assay of in vitro cultured blasts, derived from 2nd and 3rd RECIPIENTS. Primary murine leukemia cells derived from different 2nd and 3rd RECIPIENTS (n=2). For each sample 5000 cells from each line were probed for the ability to generate colonies after 5, 15, 30, and 60 days of culture. Colonies were scored at 7 days after 1st plating. The number of generated colonies is maintained without significant decrease to 30 days of culture. Data are means ± SD of n=2 samples. mIDH2: IDH2R140Q.
Fig. 7 A is an image depicting the scheme of the experiment for metabolites’ analysis
Fig. 7B is an image depicting the One-Carbon metabolism pathway. The image is from Locasale J.W. Nature Reviews Cancerl3, 572-583 (2013).
Fig. 7C is a graph depicting Fold change of key metabolites in the Methionine pathway in resistant leukemia cells compared to sensitive cells. MET: Methionine; SAM: S-adenosylmethionine; SAH, Sadenosylhomomocysteine; hCYS, homocysteine d, Representative scheme of the De-novo synthesis of Purine, (Adenine and Guanine) and Pyrimidine (Thymine, Cytosine and Uracil).
Fig. 7D is an image depicting the Representative scheme of the De-novo synthesis of Purine (Adenine and Guanine) and Pyrimidine (Thymine, Cytosine and Uracil).
Fig. 7E is an image depicting the Fold change of the precursors for Purine biosynthesis in resistant leukemia cells compared with sensitive leukemia cell. IMP: inosine monophosphate; AMP: adenosine monophosphate; GMP: guanosine
monophosphate.
Fig. 7F is an image depicting the Fold change of the precursors for Pyrimidine biosynthesis in resistant leukemia cells compared with sensitive leukemia cells. Orotate: orotic acid; OMP: orotidine monophoshate ; UMP: uridine monophosphate;
UDP: uridine diphosphate.
Fig. 7G is a series of images and graphs depicting Flow cytometry plots and quantitation of the percentage of cells showing high levels of mitochondrial ROS (ROSHi) in blast cells overexpressing HoxA9/Meisl alone (HoxA9/Meisla mIDH2 OFF) or in combination with mutant IDH2 (HoxA9/Meisla mIDH2 ON).
Fig. 8A is a scheme depicting samples processed for the Whole Exome
Sequencing (WES) analysis. Genomic DNA was isolated from resistant leukemia cells (3rd_08, 3rd_09, 3rd_ll) or their common parental sensitive cells (2nd_07).
Fig. 8B is a pie-chart showing frequencies of transversion (2nd_07). Resistant leukemia cells were from different 3rd recipients (n=3), maintained on normal diet (mIDH2 OFF) or Dox-i- diet (mIDH2 ON). Both resistant and sensitive cells were sorted from bone marrow for purity of the GFP+/YFP+ cell population. mIDH2: IDH2R140Q or transition mutations responsible for non-synonymous mutations in resistant genomes. Pairs of nucleotide indicate different possible transversion (G>T, OA, A>C, T>G, G>C, C>G, A >T, T >A) and transition mutations targeting T or A (A>G, T>C) and C or G (G>A, OT).
Fig. 8C is a principal component analysis (PCA) plot showing clustering of WES samples using single nucleotide coverage of sensitive and resistant cells.
Fig. 8D is a venn diagram showing the number of mutated genes overlapping between resistant leukemia cells (3rd_08, 3rd_09, 3rd_ll). Mutations in Spl40 gene are shared between all analyzed resistant clones, but not found in the parental sensitive leukemia.
Fig. 8E is a series of circular plots of the expression of CNV and fusion genes for sensitive (2nd_07) and resistant (3rd_08, 3rd_09, 3rd_ll) leukemia cells. Circular tracks from inside to outside: Trackl: genome positions by chromosomes (black lines are cytobands) that are arranged circularly end to end. Track 2: lines plot (red: positive; blue: negative) showing gene expression data represented as normalized read counts. Track 3: Barplot showing segmented data (CNVs). Track 4: Barplot with positive (gain: blue) and negative values (purple: loss) of called CNVs. Amplifications or deletion of relevant oncogenes such as Flt3, Dok genes, and Trp53 are highlighted. Track 5:
Interchromosomal translocations (fusion genes) are plotted with lines connecting chromosome segments.
Fig. 9A is a scheme depicting the samples processed through RNA-Sequencing analysis to characterize the transcriptional changes associated with leukemia progression. Resistant leukemia cells 3rd_09 and 3rd_13 were generated from the parental sensitive 2nd _9A. Resistant leukemia cells 3rd_l l, 3rd_12, 3rd_08, and 3rd_10 were generated from the parental sensitive 2nd_7A. mIDH2: IDH2R140Q.
Fig. 9B is a principal component analysis (PCA) plot showing the genes that are the sources with the majority of the variance in resistant leukemia cells, compared with sensitive leukemia cells. The genes are represented by black dots. Mpo: myeloperoxidase, Lyz2: lysozyme 2, Rn45s: 45s-pre-ribosomal RNA, Ngp: neutrophilic granule protein, Psap: prosaposin, Ftll: ferritin light polypeptide 1, Zfp36: zinc finger protein 36, Hspa8: heat shock protein 8, Vim: vimentin, Fosb: FBJ osteosarcoma oncogene B, Fos: FBJ osteosarcoma oncogene, Jun: jun proto-oncogene.
Fig. 9C is a table showing the variance and associated statistical significance of major relevant genes for the Principal Component Analysis (PCA) plot shown in Fig. 9B. Fig. 9D is an image showing the top altered networks in resistant cells generated by Ingenuity Pathways Analysis tool (www.ingenuity.com). The intensity of the node color indicates the degree of up-regulation (red) and down-regulation (green), while white nodes indicate non-modified genes that may be affected in a non-transcriptional manner. All networks shown were significantly affected, with a score >29.
Fig. 9E is a series of graph showing the quantification of intracellular flow staining for p-P44/42 (T201, Y204) and p-Akt (T308) in mouse leukemia cells.
Fig. 9F is a graph showing an increase in 2-HG levels in a human leukemia U937 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) compared to a U937 control cell line (CTRL).
Fig. 9G is a series of images showing the representative cytospins images of blasts, intermediates, and differentiated cells used as reference for the screening.
Fig. 9H is a graph showing the quantification of human leukemia U937 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) to the respective U937 controls (CTRL).
Fig. 91 is a graph showing the quantification of flow cytometry analysis for the percentage of CD 14 positive cells (CD14+).
Fig. 9J is a graph showing the quantification of flow cytometry analysis for the percentage of CDl lb positive cells (CDllb+). Data are means ± SD of n=3
measurements.
Fig. 10A is a series of images depicting a western blot assay on TF1 cells overexpressing mutant IDH2 (TF1 IDH2R140Q) or respective control vector (TF1 CTRL) stably silenced for PIN1 expression (shPINl). Non targeting (shSCR) was used as control for non-specific silencing effects.
Fig. 10B is a series of images depicting a western blot assay on TF1 cells overexpressing mutant IDH2 (TF1 IDH2R140Q) or respective control vector (TF1 CTRL) treated with the Pinl Inhibitor Juglone for 72h.
Fig. IOC is a series of images depicting a western blot assay on TF1 cells stably overexpressing mutant IDH2 (TF1 IDH2R140Q) and Pinl or respective control vector vectors (TF1 CTRL, CTRL).
Fig. 11A is a series of images depicting a methylcellulose colony forming assay and colony quantifications of mouse leukemia cells derived from 2nd RECIPIENTS or leukemia cells overexpressing Hoxa9/Meisla. Fig. 1 IB is a series of images depicting a methylcellulose colony forming assay and colony quantifications of mouse leukemia cells derived from 3rd RECIPIENTS or leukemia cells overexpressing Hoxa9/Meisla.
Fig. llC is a scheme of the in vivo approach to evaluate combination arsenic trioxide (ATO) and ATRA treatment on mIDH2 leukemic cells in C57BL/6J mice.
Fig. 1 ID is a graph depicting Kaplan- Meier survival curves derived from the experiment shown in Fig. 11C.
Fig. 11E is a series of images depicting May-Grunwald-Giemsa staining of BM blasts sorted from recipients treated with ATO and ATRA as shown in Fig. 11C.
Fig. 1 IF is a series of images depicting H&E staining of lung tissues. Arrowheads indicate perivascular leukemia cells infiltrates.
Fig. 11G is a series of images depicting IHC of lung tissues for myeloperoxidase (MPO), a marker of myeloid cell differentiation. Arrowheads indicate strongly MPO positive cells in perivascular infiltrates.
Fig. 12A is a scheme of the in vivo experimental approach to evaluate combination ATO and ATRA treatment on mIDH2 U937 human leukemic cell lines.
Fig. 12B is a series of graphs depicting Kaplan- Meier survival curves of NSG mice transplanted with mIDH2-U937 or CTRL-U937 leukemia cells and treated with ATO, ATRA or a combination of both.
Fig. 12C is a series of graphs showing the percentage of leukemia cells in bone marrow (BM) of NSG mice. Data are means ± SD of samples isolated from different mice.
Fig. 12D is a series of images showing morphological screening analysis of U937 cells isolated as GFP+ cells from NSG mice treated with retinoic acid (ATRA), Arsenic Trioxide (ATO), a combination of both, or respective vehicle solution. Arrowheads show cells displaying differentiated morphology
Fig. 12E is a series of graphs and images depicting cytospins of mIDH2-U937 or CTRL-U937 leukemia cells isolated as GFP+ cells from BM of NSG mice.
Fig. 12F is a series of flow cytometry plots showing CDl lb expression levels in mIDH2-U937 or CTRLU937 leukemia cells.
Fig. 12G is a series of graphs showing the quantification of flow cytometry analysis for the percentage of CDl lb positive cells (CDl lb+). U937 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) show about 30% reduced percentage of CD1 lb+ cells compared to the control (CTRL). Data are means ± SD of n=3 measurements.
Fig. 12H is a series of graphs showing the quantification of spleen weight dissected from NSG mice transplanted with mIDH2-U937 or CTRL-U937 leukemia cells and treated with ATO, ATRA or a combination of both.
Fig. 13 a- 13k: a series of graphs showing the sensitivity of mIDH2 leukaemia to ATRA and ATO. a, Quantifications of morphological screening of murine leukaemia cells isolated from the bone marrow of 2nd RECIPIENTS (n=2) or 3rd RECIPIENTS (n=3) and treated with physiological (10 9M, 10 8M) or pharmacological (10 7M, 106M) concentrations of ATRA. Hoxa9/Meisla leukaemia cells (n=l) were included as the control. For each sample n=100 cells were counted n=3 times for statistical analysis b- c, Cytospin images and quantitation of human TF1 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) to the respective controls (CTRL) that have been treated with pharmacological concentrations of ATRA (10 6M) or vehicle (DMSO). d, Cell proliferation assay on TF1 cell line, stably overexpressing the mIDH2 or the empty vector (CTRL). Each cell line was treated with ATRA (10 6M) or vehicle (DMSO) for n=4 days. Data are means of n=3 replicates for each condition and time point e, Cell proliferation assay on U937 cell line, stably overexpressing the mIDH2 or the empty vector (CTRL). Each cell line was treated with ATRA (106M) or vehicle (DMSO) for n=4 days. Data are means of n=3 replicates for each condition and time point f, Colony forming assay of mouse leukaemia cells harbouring mutant or wildtype IDH2 expression and treated with the PIN1 inhibitor (Juglone, 1 mM) or respective vehicle (VHL).
Colonies were quantitated after 12 days from plating g, Colony forming assay of TF1 cells overexpressing the mIDH2 or respective control (CTRL) and treated with the PIN1 inhibitor (Juglone, 1 pM) or respective vehicle (VHL). Colonies were quantitated after 7 days from plating h, Fold induction of cell death (Annexin V/ 7AAD positive cells) in mouse leukaemia cells isolated from 2nd or 3rd recipients and in vitro treated with ATO (0.5 pM) for 96h. i, Fold induction of cell death (Annexin V/7AAD positive cells) in TF1 leukaemia cells overexpressing IDH2R140Q and treated with ATO (0.5 pM) for 96h. j, Representative images of methylcellulose colony forming assay and colonies
quantification of mouse leukaemia cells isolated from 2nd recipients (early stage) treated in vitro with pharmacological concentrations of ATRA (1 pM), ATO (0.5 pM), a combination of both (ATRA+ATO), or vehicles (VHL) as control. Treatments were performed in either the presence of mIDH2 or absence of the mutation (CTRL). Data are means ± SD of duplicates k, Quantification of colony forming ability of mouse leukaemia cells harbouring mutations in IDH2 (IDH2R140Q) or IDH1 (IDH1R132C) in association with different genetic mutant backgrounds such as NPMc+ or FLT3ITD and treated with pharmacological concentrations of ATRA (1 mM), ATO (0.5 mM), a combination of both (ATRA+ATO), or vehicles (VHL) as control. Non mutant IDH2 cells such as MLL-AF9 or NPMc+/ FLT3ITD were also included.
Fig. 14a-14h: a series of graphs showing the combination of ATO and ATRA targeting mIDH2 human leukaemia cells a, Scheme of the in vivo experimental approach b, Kaplan- Meier survival curves of NSG mice transplanted with mIDH2-U937 or CTRL-U937 leukaemia cells and treated with ATO, ATRA or a combination of both c, Percentage of leukaemia cells in bone marrow (BM) of NSG mice. Data are means ±
SD of samples isolated from different mice d, Morphological screening analysis of U937 cells isolated as GFP+ cells from NSG mice treated with retinoic acid (ATRA), Arsenic Trioxide (ATO), a combination of both, or respective vehicle solution e, Cytospins showing mIDH2-U937 or CTRL - U937 leukaemia cells isolated as GFP+ cells from BM of NSG mice. Arrowheads show cells displaying differentiated morphology f, Flow cytometry plots showing CDl lb expression levels in mIDH2-U937 or CTRL-U937 leukaemia cells g, Quantification of flow cytometry analysis for the percentage of CDl lb positive cells (CDl lb+). U937 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) show about 30% reduced percentage of CDllb-i- cells compared to the control (CTRL). Data are means ± SD of n=3 measurements h, Quantification of spleen weight dissected from NSG mice transplanted with mIDH2-U937 or CTRL-U937 leukaemia cells and treated with ATO, ATRA or a combination of both.
Fig. 15a-15g: a series of graphs showing combined ATRA and ATO treatment eradicating mIDH2 leukaemia a, Methylcellulose colony forming assay quantification of human primary mIDH2 AML blasts treated in vitro with pharmacological concentrations of ATRA (1 mM), ATO (0.5 mM), a combination of both ATRA and ATO, or vehicles (VHL) as control. Treatments were performed in either the presence of mIDH2 or absence of the mutation (CTRL). Data are means ± SD of duplicates b and d, Kaplan- Meyer curve showing the percentage of disease free survival related to ATO/ ATRA pre- clinical study on mIDH2 PDX. N=2 different mIDH2 AML were isolated from bone marrow at diagnosis. Data analysed by Log-Rank (Mentel-Cox) test. #DS: mice involved by differentiation syndrome (DS) (aka. ATRA syndrome).
c and e, Representative images of cytospins showing cells isolated from BM of PDX mice treated with ATRA and ATO. n.d: not detected as mice were not euthanized f-g,
Representative images of IHC for the differentiation marker human myeloperoxidase (MPO) on lung tissues isolated from PDX mice treated with ATRA and ATO or
VEHICLE solutions. Accumulation of human MPO positive cells is a major characteristic of DS.
Fig. 15h-15j: a series of graphs showing the effect of ATO and ATRA
combination in limiting leukemia aggressiveness in vivo in a pre-clinical study on PDX generated with AML harboring wild-type IDH1 and IDH2 genes h. Scheme of the experiment: NSG mice were transplanted with human AML blasts harboring mutations in WT1 and KIT genes and chromosomal alterations (invl6), but wild-type IDH1 and IDH2 genes i. Scheme of the ATO and ATRA treatments j. Survival curve shows no significant survival extension for mice treated with ATO, ATRA, or combination of both ATRA and ATO, as compared with the respective VHL treated mice.
Fig. 16: a schematic depiction of ATO and ATRA targeting mIDH leukaemia. Scheme of leukaemia evolution from mIDH dependent to mIDH2 independent states (e.g. acquisition of resistance to mIDH inhibition). Multiple alterations including metabolic reprogramming, and transcriptional rewiring are acquired during progression and co-exist in the mIDH2 independent stage. In this multifactorial setting, we unveil PIN1, deregulated LSD1 signaling and high ROS levels as key factors of upregulated pro survival and proliferation programs (MAPK/PI3K pathways), alterations to functional ATRA signalling, and altered metabolic state (One-Carbon metabolism and increased nucleic acid synthesis). These features represent targetable vulnerabilities of leukaemia cells and highlight the potential for using ATO (pro-oxidant) and ATRA (pro- differenting) drugs. Most importantly, sensitivity to ATO and ATRA is a vulnerability already present at an early stage in mIDH2 dependent leukaemia, which is mantained in later stages of the disease progression. mIDH2: IDH2R140Q; BM: bone marrow; ATRA: Retinoic acid; ATO: Arsenic Trioxide.
DEFINITIONS
To facilitate the understanding of this invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention. Terms such as "a", "an," and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims.
As used herein, the term“about” refers to a value that is within 10% above or below the value being described.
As used here, any values provided in a range of values include both the upper and lower bounds, and any values contained within the upper and lower bounds.
As used interchangeably herein, the terms“arsenic trioxide” and“an arsenic trioxide compound” refer to a compound having the formula AS2O3 and derivatives thereof. Arsenic trioxide generally has the following structure:
Figure imgf000026_0001
Derivatives of arsenic trioxide may include, for example, arsenic ores, such as, e.g., arsenopyrite (grey arsenic; FeAsS), realgar (also known as sandarach or red arsenic;
AsS), orpiment (yellow arsenic; AS2S3), and arsenolite, an oxidation product of arsenic sulphides (white arsenic; AS2O3). Arsenic trioxide exhibits high toxicity in mammals, such as humans. In some instances, arsenic trioxide ingestion can result in severe side effects, including vomiting, abdominal pain, diarrhea, bleeding, convulsions, cardiovascular disorders, inflammation of the liver and kidneys, abnormal blood coagulation, hair loss, and death. In certain instances, arsenic trioxide poisoning may rapidly lead to death. Chronic exposure to even low levels of arsenic trioxide can result in arsenicosis and skin cancer. Arsenic trioxide is therefore desirably administered to a subject at low enough doses to minimize toxicity. As described herein, arsenic trioxide and derivatives thereof may be effective at treating leukemia. In certain instances, administration of arsenic trioxide to a subject having leukemia may increase the production of reactive oxygen species in one or more leukemic cells of said subject. In certain instances, organic arsenic compounds are converted to inorganic compounds when absorbed in a biological system (see, e.g., Frith, J. Military Vet. Health 21(4): 11-17, 2013). Arsenic derivatives and uses thereof are described, for example, in Wax man et al. (Oncologist 6: 3-10, 2001).
As used interchangeably herein, the terms“Darinaparsin” and“a Darinaparsin compound” refer to dimethylarsinic glutathione having the formula C12H22ASN3O6S and derivatives thereof. Darinaparsin generally has the following structure:
Figure imgf000027_0001
By the term“retinoic acid compound” is meant a compound that is either (a) a diterpene retinoic acid, or a derivative thereof, or (b) a compound having the structure R1- Ar1-L1Ar2-L2-C(=0)R3 (Formula I). Exemplary retinoic acid compounds described herein (including derivatives thereof) include, without limitation, all-trans retinoic acid (ATRA), 13-cis retinoic acid (13cRA), and retinoic acid compounds, and derivatives thereof, e.g., as described herein. Examples of retinoic acid compounds include those shown in Tables 1 and 2 below.
Table 1. Exemplary Retinoic Acid Compounds
Figure imgf000027_0002
Figure imgf000028_0001
Figure imgf000029_0001
Figure imgf000030_0001
Figure imgf000031_0001
Figure imgf000032_0001
Figure imgf000033_0001
Figure imgf000034_0001
Figure imgf000035_0001
Figure imgf000036_0001
Figure imgf000037_0001
Figure imgf000038_0001
Figure imgf000039_0001
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Pubchem Compound Identifiers (CIDs) in Table 1 refer to the compound identification number for pubchem.ncbi.nlm.nih.gov
Table 2. Additional retinoic acid compounds
Figure imgf000042_0002
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000045_0001
Figure imgf000046_0001
Figure imgf000047_0001
Figure imgf000048_0001
Figure imgf000049_0001
Figure imgf000050_0001
Figure imgf000051_0001
Figure imgf000052_0001
Figure imgf000053_0001
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
Figure imgf000058_0001
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Figure imgf000070_0001
Figure imgf000071_0001
Figure imgf000072_0001
Figure imgf000073_0001
Figure imgf000074_0001
Figure imgf000075_0001
Figure imgf000076_0001
Figure imgf000077_0001
Figure imgf000078_0001
Figure imgf000079_0001
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
Figure imgf000083_0001
Figure imgf000084_0001
Further examples of retinoic acid compounds include any retinoic acid compounds, or derivatives thereof, known in the art, including those described in PCT Publication Nos. WO 2013/185055, WO 2015/143190, and WO 2016/145186, each of which is incorporated herein with respect to the compounds described therein.
The term“diterpene retinoic acid” encompasses any stereoisomer of retinoic acid (e.g., the retinoic acid may be in the all-trans configuration (ATRA) or one or more of the double bonds may be in the cis configuration, for example, 13cRA. Derivatives of the diterpene retinoic acid include reduced forms such as retinal, retinol, and retinyl acetate. In Formula I, each of Ar1 and Ar2 is, independently, optionally substituted aryl or an optionally substituted heteroaryl; R1 is H, an optionally substituted alkyl group, an optionally substituted alkenyl group, or an optionally substituted alkynyl group; each of L1 and L2 is selected, independently from a covalent bond, an optionally substituted Ci-io alkylene, an optionally substituted C2-10 alkenylene (e.g., -CH=CH-, -COCH=CH- , -CH=CHCO-, a dienyl group, or a trienyl group), optionally substituted C2-10 alkynylene (e.g., -CºC-),or -(CHR4)nCONR5-, -NR5CO-, where n is 0 or 1, R4 is H or OH, and R5 is H or optionally substituted alkyl; and R3 is H, OR4 or N(R4)2, where each R4 is selected, independently, from H, optionally substituted alkyl, or optionally substituted heteroalkyl.
As used herein, the term“C1-C6 alkoxy” represents a chemical substituent of formula -OR, where R is an optionally substituted C1-C6 alkyl group, unless otherwise specified. In some embodiments, the alkyl group can be substituted, e.g., the alkoxy group can have 1, 2, 3, 4, 5 or 6 substituent groups as defined herein.
As used herein, the term“C1-C6 acyl” refers to a C1-C6 alkyl group that includes a C(=0) moiety and which may be further substituted as described herein.
As used herein, the term“alkyl,”“alkenyl” and“alkynyl” include straight-chain, branched-chain and cyclic monovalent substituents, as well as combinations of these, containing only C and H when unsubstituted. Examples include methyl, ethyl, isobutyl, cyclohexyl, cyclopentylethyl, 2 propenyl, 3 butynyl, and the like. The term“cycloalkyl,” as used herein, represents a monovalent saturated or unsaturated non-aromatic cyclic alkyl group having between three to nine carbons (e.g., a C3-C9 cycloalkyl), unless otherwise specified, and is exemplified by cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicyclo[2.2.1.]heptyl, and the like. In some embodiments, the cycloalkyl is a polycyclic (e.g., adamantyl). Cycloalkyl groups may be unsubstituted or substituted with, e.g., 1, 2, 3, or 4 substituent groups as defined herein. When the cycloalkyl group includes one carbon-carbon double bond, the cycloalkyl group can be referred to as a“cycloalkenyl” group. Exemplary cycloalkenyl groups include
cyclopentenyl, cyclohexenyl, and the like.
Typically, the alkyl, alkenyl and alkynyl groups contain 1-12 carbons (e.g., Cl- C12 alkyl) or 2-12 carbons (e.g., C2-C12 alkenyl or C2-C12 alkynyl). In some embodiments, the alkyl groups are C1-C8, C1-C6, C1-C4, C1-C3, or C1-C2 alkyl groups; or C2-C8, C2-C6, C2-C4, or C2-C3 alkenyl or alkynyl groups. Further, any hydrogen atom on one of these groups can be replaced with a substituent as described herein.
The term“aryl,” as used herein, represents a mono- or bicyclic C6-C14 group with [4 n + 2] p electrons in conjugation and where n is 1, 2, or 3. Aryl groups also include ring systems where the ring system having [4 n + 2] p electrons is fused to a non-aromatic cycloalkyl or a non-aromatic heterocyclyl. Phenyl is an aryl group where n is 1. Aryl groups may be unsubstituted or substituted with, e.g., 1, 2, 3, or 4 substituent groups as defined herein. Still other exemplary aryl groups include, but are not limited to, naphthyl, 1,2-dihydronaphthyl, 1,2,3,4-tetrahydronaphthyl, fluorenyl, indanyl, and indenyl.
The term“heteroaryl,” as used herein, represents an aromatic (i.e., containing An+2 pi electrons within the ring system) 5- or 6-membered ring containing one, two, three, or four heteroatoms independently selected from the group consisting of nitrogen, oxygen, and sulfur, as well as bicyclic, tricyclic, and tetracyclic groups in which any of the aromatic ring is fused to one, two, or three heterocyclic or carbocyclic rings (e.g., an aryl ring). Exemplary heteroaryls include, but are not limited to, furan, thiophene, pyrrole, thiadiazole (e.g., 1,2,3-thiadiazole or 1,2,4-thiadiazole), oxadiazole (e.g., 1,2,3-oxadiazole or 1,2,5-oxadiazole), oxazole, isoxazole, isothiazole, pyrazole, thiazole, triazole (e.g., 1,2,4-triazole or 1,2,3-triazole), pyridine, pyrimidine, pyrazine, pyrazine, triazine (e.g, 1,2,3-triazine 1,2,4-triazine, or 1,3,5-triazine), 1,2,4,5-tetrazine, indolyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzothiazolyl, and benzoxazolyl. Heteroaryls may be unsubstituted or substituted with, e.g., 1, 2, 3, or 4 substituents groups as defined herein. The term“heterocyclyl,” as used herein represents a non-aromatic 5-, 6- or 7- membered ring, unless otherwise specified, containing one, two, three, or four heteroatoms independently selected from the group consisting of nitrogen, oxygen, and sulfur. Heterocyclyl groups may be unsubstituted or substituted with, e.g., 1, 2, 3, or 4 substituent groups as defined herein.
As used herein, the term“aryloxy” refers to aromatic or heteroaromatic systems which are coupled to another residue through an oxygen atom. A typical example of an O-aryl is phenoxy. Similarly,“thioaryloxy” refers to aromatic or heteroaromatic systems which are coupled to another residue through a sulfur atom.
As used herein, a halogen is selected from F, Cl, Br, and I, and more particularly it is fluoro or chloro.
Where a group is substituted, the group may be substituted with 1, 2, 3, 4, 5, or 6 substituent groups. Optional substituent groups include, but are not limited to: Ci-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, aryl, heteroaryl, cycloalkyl, heterocyclyl, halogen (-F, -Cl, -Br, or -I), azido(-N3), nitro (-NO2), cyano (-CN), acyloxy(-OC(=0)R’), acyl (-C(=0)R’), alkoxy (-OR’), amido (-NR’C(=0)R” or -C(=0)NRR’), amino (-NRR’), carboxylic acid (-CO2H), carboxylic ester (-CO2R’), carbamoyl (-OC(=0)NR’R” or -NRC(=0)OR’), hydroxy (-OH), oxo (=0), isocyano (-NC), sulfonate (-S(=0)20R), sulfonamide
(-S(=0)2NRR’ or -NRS(=0)2R’), or sulfonyl (-S(=0)2R), where each R or R’ is selected, independently, from H, Ci-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, aryl, or heteroaryl.
In general, a substituent group (e.g., alkyl, alkenyl, alkynyl, or aryl (including all heteroforms defined above) may itself optionally be substituted by additional substituents. The nature of these substituents is similar to those recited with regard to the substituents on the basic structures above. Thus, where an embodiment of a substituent is alkyl, this alkyl may optionally be substituted by the remaining substituents listed as substituents where this makes chemical sense, and where this does not undermine the size limit of alkyl per se; e.g., alkyl substituted by alkyl or by alkenyl would simply extend the upper limit of carbon atoms for these embodiments, and is not included. For example, where a group is substituted, the group may be substituted with 1, 2, 3, 4, 5, or 6 substituents. Optional substituents include, but are not limited to: C1-C6 alkyl or heteroaryl, C2-C6 alkenyl or heteroalkenyl, C2-C6 alkynyl or heteroalkynyl, halogen; aryl, heteroaryl, azido(-N3), nitro (-N02), cyano (-CN), acyloxy( OC(=0)R’), acyl (-C(=0)R’), alkoxy (- OR’), amido (-NR’C(=0)R” or -C(=0)NRR’), amino ( NRR’), carboxylic acid (-C02H), carboxylic ester (-C02R’), carbamoyl ( 0C(=0)NR’R” or -NRC(=0)0R’), hydroxy ( OH), isocyano (-NC), sulfonate ( S(=0)20R), sulfonamide ( S(=0)2NRR’ or - NRS(=0)2R’), or sulfonyl ( S(=0)2R), where each R or R’ is selected, independently, from H, C1-C6 alkyl or heteroaryl, C2-C6 alkenyl or heteroalkenyl, 2C-6C alkynyl or heteroalkynyl, aryl, or heteroaryl. A substituted group may have, for example, 1, 2, 3, 4,
5, 6, 7, 8, or 9 substituents.
Typical optional substituents on aromatic or heteroaromatic groups include independently halo, CN, N02, CF3, OCF3, COOR’, CONR’2, OR’, SR’, SOR’, S02R’, NR’2, NR’ (CO)R’ ,NR’ C(0)OR’ , NR’C(0)NR’2, NR’S02NR’2, or NR’S02R\ wherein each R’ is independently H or an optionally substituted group selected from alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, heteroaryl, and aryl (all as defined above); or the substituent may be an optionally substituted group selected from alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, aryl, heteroaryl, O-aryl, O-heteroaryl and arylalkyl.
Optional substituents on a non-aromatic group (e.g., alkyl, alkenyl, and alkynyl groups), are typically selected from the same list of substituents suitable for aromatic or heteroaromatic groups, except as noted otherwise herein. A non-aromatic group may also include a substituent selected from =0 and =NOR’ where R’ is H or an optionally substituted group selected from alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteralkynyl, heteroaryl, and aryl (all as defined above).
As used herein, the term“cancer” refers to a proliferative disease in a subject (e.g., a human) having a pathogenic IDH1/IDH2 allele or having elevated 2- hydroxyglutarate (2-HG) levels. Such cancer includes IDHl/IDH2-associated leukemias and IDHl/IDH2-associated solid tumors. An IDHl/IDH2-associated leukemia can contain one or more mutants selected from FLT3, NPM1, DNMT3A, RUNX1, TET2, IDH2, CEBPA, TP53, IDH1, NRAS, RARA, PML, TTN, WT1, MYH11, BPIFC, CBFB, KIT, KRAS, KMT2A, PTPN11, MUC16, SMC1A, RUNX1T1, MPO, U2AF1, ABCA6, DMXL2, DNAH3, KLK3, FBX07, SMC3, MXRA5, MUC17, SF3B1, HPS3, PHF6, ASXL1, AHNAK, SENP6, MYCBP2, NF1, PCLO, CSMD3, LRP1B, MED 12, RAD21, AHNAK2, GDI2, PARP14, KLHL7, BCORL1, SPEN, BRWD1,UBR4, STAG2, LNX1, FREM2, MLLT10, DNAH11, SLIT2, DNAH9, BRINP3, HMCN1, SYNE1, GABRG3, NPAS3, CSMD1, GATA2, ZCRB1, MTFR2, SLC43A1, SLA2, APOB, PRDM1, BTBD10, ABCA5, EP300, TNC, ADGRG4, BSN, IFT74, COL12A1, NUP98, CREBBP, EPG5, KIF1B, ABL1, SLC16A7, RALGPS2, CHL1, SCLT1, LRP2, VWA3B, FRYL, PRUNE2, PECE1, GRIK4, HIVEP3, RYR3, ANK2, ATRNE1, VPS13B, GPR179, FCGBP, KIF15, and DNAH10. An IDHl/IDH2-associated solid tumor can be glioma, paraganglioma, astroglioma, colorectal carcinoma, melanoma, cholangiocarcinoma, chondrosarcoma, thyroid carcinomas, prostate cancers, or non-small cell lung cancer.
As used herein, the term“pathogenic IDH2 allele” is meant to include any allele encoding an IDH2 protein having a mutation associated with increased cellular proliferation, associated with increased likelihood or severity of cancer, associated with increased likelihood or severity of leukemia, or associated with increased levels of the oncometabolite, 2-hydroxyglutarate (2-HG) compared with a wild-type cell, tissue, or subject. Pathogenic alleles of IDH2 may encode, for example, any of the following mutations in the corresponding IDH2 protein: R140Q, R140W, R172K, R172M, R172G, or R172W.
As used herein, the term“IDH2 inhibitor” is meant to include any compound that reduces the level of IDH2 activity or expression in a cell, tissue, or subject. A reduction in IDH2 expression or activity may be measured by methods known to one of skill in the art, including the reduction in corresponding IDH2 mRNA or protein levels in a cell (e.g., a reduction of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater) or the reduction of 2-HG levels in a cell (e.g., a reduction of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater). In some embodiments, the IDH2 inhibitor may be specific for a pathogenic mutant form of IDH2 (e.g., Enasidenib).
As used herein,“Pinl activity” refers to binding of the protein Pinl to a substrate (e.g., a substrate protein) and Pinl -catalyzed isomerization of the substrate. Pinl generally acts as a peptidyl-prolyl isomerase (PPIase) that catalyzes prolyl isomerization of the substrate (e.g., conversion of a peptidyl-prolyl group on the substrate from a trans conformation to a cis conformation, or vice versa).“Elevated Pinl activity” or“elevated levels of Pinl activity,” as used herein, generally refer to an increase in Pinl-catalyzed isomerization of one or more Pinl substrates, for example, relative to a reference level of Pinl activity. In some embodiments, the reference level of Pinl activity is the level of Pinl activity in a wild-type cell (e.g., a wild-type cell of the same cell type as a cell of interest). In some embodiments, the reference level of Pinl activity is the level of Pinl activity in a wild-type subject (e.g., a subject not having leukemia), such that an increase in Pinl activity in a subject of interest relative to a wild-type subject indicates that the subject of interest has elevated Pinl activity. In some embodiments, alteration in Pinl activity can be assessed by determining the levels of a Pinl marker in a cell and/or a subject of interest, relative to a reference cell or subject (e.g., a wild-type cell or subject). Elevated levels of Pinl activity include, for example, Pinl activity levels at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than the activity level measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell. A decrease in Pinl activity includes a reduction of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000% in the Pinl activity of a subject, tissue, or cell (e.g., after treatment by any of the
compositions of methods described herein).
As used herein, the term“Pinl marker” refers to a marker which is capable of being indicative of Pinl activity levels (e.g., in a sample obtained from a cell or subject of interest). Non-limiting examples of Pinl markers include nucleic acid molecules (e.g., mRNA, DNA) that correspond to some or all of a Pinl gene, peptide sequences (e.g., amino acid sequences) that correspond to some or all of a Pinl protein, nucleic acid sequences which are homologous to Pinl gene sequences, peptide sequences which are homologous to Pinl peptide sequences, alteration of Pinl protein, antibodies to Pinl protein, substrates of Pinl protein, binding partners of Pinl protein, alteration of Pinl binding partners, and activity of Pinl. In some instances, alteration of a Pinl protein may include a post-translational modification (e.g., phosphorylation, acetylation, methylation, lipidation, or any other post- translational modification known in the art) of Pinl. In some instances, a Pinl marker is the level of Pin expression (e.g., Pinl protein expression levels and/or Pinl mRNA expression levels) in a subject. By“elevated levels of a Pinl marker” is meant a level of Pinl marker that is altered, which may, in some instances, indicate the presence of elevated Pinl activity. Elevated levels of a Pinl marker include, for example, levels at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater than, or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% less than the marker levels measured in a normal (e.g., wild-type and/or disease fee) subject, tissue, or cell. As used herein, the terms“compound that inhibits LSD1” or“LSD1 inhibitor” are meant to include any compound that reduces the level of LSD1 activity or expression in a cell, tissue, or subject. A reduction in LSD1 expression or activity may be measured by methods known to one of skill in the art, including the reduction in corresponding LSD1 mRNA or protein levels in a cell (e.g., a reduction of about 1%, 2%, 3%, 4%, 5%, 6%,
7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater) or the reduction of LSD 1- specific histone methylation, such as H3K4me2 and/or H3K9me2 histone methylation (e.g., a reduction of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 500%, 1000%, or greater).
The term“synergy” or“synergistic,” as used herein, refers to an improved effect when two agents are administered that is greater than the additive effects of each of the two agents when administered alone. In one example, administration of an arsenic trioxide and a retinoic acid compound (e.g., ATRA) to a subject (e.g., a subject having leukemia) may result in a greater than additive effect on the subject than administration of either arsenic trioxide or the retinoic acid compound alone.
By a“low dose” or“low dosage” is meant a dosage of at least 5% less (e.g., at least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or 99% less) than the standard recommended dosage or lowest standard recommended dosage of a particular agent, e.g., a therapeutic agent formulated for a given route of administration for treatment of any human disease or condition. For example, a low dosage of an agent formulated for oral administration may differ from a low dosage of the agent formulated for intravenous administration. In some instances, a low dosage of an agent may be selected to be a nontoxic dosage of the agent. In some instances, a low dosage may be selected as a dosage that minimizes particular side effects of an agent, but which may still retain some side effects. For example, a dosage may be selected that minimizes or eliminates side effects that can lead to significant mortality or severe illness among subjects while still permitting more tolerable side effects, such as headache. In some instances, a low dose of arsenic trioxide is a dose of about 2 mg/kg body weight or less (e.g., about 0.01, 0.02, 0.03, 0.032, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.16, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.25, 1.5, 1,75, or 2 mg/kg). In certain instances, a low dose of arsenic trioxide is about 0.15, about 0.16, or about 0.032 mg/kg body weight. In other instances, a low dose of arsenic trioxide is a dose between about 0.5 mg/kg and about 12 mg/kg body weight (e.g., about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mg/kg). In some instances, a low dose of a retinoic acid compound is a dose of about 5 mg/kg body weight or less (e.g., about 0.1, 0.2, 0.5, 0.75, 1, 2, 3, 4, or 5 mg/kg). In some instances, a low dose of a retinoic acid compound is a dose of about 25 mg/m2 or less (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 mg/m2). In other instances, the low dose of the retinoic acid compound is a dose of between 25 mg/m2 and 45 mg/m2 (e.g.,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 mg/m2).
A“nontoxic” dose of an agent (e.g., arsenic trioxide and/or a retinoic acid compound) is a dosage low enough to minimize or eliminate toxic side effects of the agent on the subject to which the agent is administered. A nontoxic dosage may be achieved by reducing the quantity of the agent administered per dose and/or increasing the length of time between deliveries of individual doses.
The term“effective amount” or an amount“sufficient to” as used interchangeably herein, refers to a quantity of an agent that, when administered alone or with one or more additional therapeutic agents, induces a desired response or confers a therapeutic effect on the treated subject. The desired response may be a therapeutic response. In one example, the desired response is decreasing the signs or symptoms of a disorder described herein (e.g., leukemia). In another example, the desired response is decreasing the risk of developing or decreasing the risk of recurrence of a disorder described herein (e.g., leukemia). An effective amount of an agent may desirably provide a therapeutic effect without causing substantial toxicity in the subject. In general, an effective amount of a composition administered to a human subject will vary depending upon a number of factors associated with that subject, for example, the overall health of the subject, the condition to be treated, and/or the severity of the condition. An effective amount of a composition can be determined by varying the dosage of the product and measuring the resulting therapeutic response. The effective amount can be dependent, for example, on the source applied, the subject being treated, the severity and type of the condition being treated, and the manner of administration.
The term“treat”,“treating”, or“treatment” refers to application or administration of a pharmaceutical compound by any route, e.g., orally, topically, or by inhalation to a subject with the purpose to cure, alleviate, relieve, alter, remedy, improve, or affect the disease, the symptom, or the predisposition. The compound can be administered alone or in combination with one or more additional compounds. Treatments may be sequential, with a compound being administered before or after the administration of other agents. Alternatively, compounds may be administered concurrently. The subject, e.g., a patient, can be one having a disorder (e.g., a leukemia), a symptom of a disorder, or a
predisposition toward a disorder. Treatment is not limited to curing or complete healing, but can result in one or more of alleviating, relieving, altering, partially remedying, ameliorating, improving or affecting the disorder, reducing one or more symptoms of the disorder or the predisposition toward the disorder. In an embodiment the treatment (at least partially) alleviates or relieves symptoms related to a fibrotic disease. In an embodiment the treatment (at least partially) alleviates or relieves symptoms related to an inflammatory disease. In one embodiment, the treatment reduces at least one symptom of the disorder or delays onset of at least one symptom of the disorder. The effect is beyond what is seen in the absence of treatment. Treatment of leukemia may be considered to include administration of any of the compounds described herein resulting in the remission of the leukemia in the subject (e.g., the symptoms of the leukemia are reduced). Treatment of the leukemia may further be considered to include administration of any of the compounds described herein resulting in the complete remission of the leukemia (e.g., all signs and symptoms of the leukemia are absent). Treatment of the leukemia may further be considered to include administration of any of the compounds described herein, wherein the treatment cures the leukemia in the subject (e.g., all signs and symptoms of the leukemia are absent for 1 year or more, for 2 years or more, for 3 years or more, for 4 years or more, or for 5 years or more).
The term“subject,” as used herein, refers to any organism or portion thereof to be administered a composition as described herein (e.g., arsenic trioxide, a retinoic acid compound, and combinations or derivatives thereof). A subject may be an animal, such as a mammal (e.g., a human, mouse, rat, rabbit, dog, cat, goat, pig, and horse). Preferably, the subject is human.
As used herein, the term“administering” may also be considered to include contacting. For example, wherein a compound is administered to a cell, it may be considered to be equivalent to contacting the cell with the compound. As used herein, the term“contacting one or more cells” with a compound of the invention is meant to include administering a compound of the invention to a subject, such that the compound contacts one or more cells of the subject.
DETAILED DESCRIPTION
There is a critical need to develop rational combinations to treat disease and overcome resistance that arises in response to therapy. The present invention is based on the discovery of common vulnerabilities in mIDH2 leukemia. The inventors have shown that mIDH2 leukemia exhibits sensitivity to reactive oxygen species (ROS)-producing compounds, such as arsenic trioxide (ATO). The inventors have also shown that mIDH2 leukemia exhibits sensitivity to retinoic acid compound- induced differentiation (e.g., ATRA-induce differentiation). The inventors have further shown that treatment of leukemia with the combination of a ROS-promoting compound (e.g., arsenic trioxide) and a compound that promotes differentiation (e.g., a Pinl inhibitor, such as ATRA) provides a synergistic, powerful, and well-tolerated targeted therapy in both mouse and human models of AML.
The present invention therefore features methods, compositions, and kits relating to the treatment of mIDH2 leukemia by administering an arsenic trioxide compound (e.g., ATO), a retinoic acid compound (e.g., ATRA), or a combination of an arsenic trioxide and a retinoic acid compound (ATO and ATRA).
Disorders of the invention
Isocitrate dehydrogenases are enzymes (IDH enzymes) are metabolic enzymes that catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. The protein encoded by the IDH2 gene is the NADP(+) -dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production.
Mutations to IDH enzymes have been identified as important early events in a variety of tumor types. For example, IDH enzymes are mutated in approximately 20% of human acute myeloid leukemias (AMLs). Pathogenic mutants of IDH2 enzymes have been identified that give rise to 2-hydroxyglutarate (2-HG), an oncometabolite that contributes to the oncogenic phenotype. Accordingly, 2-HG is a predictive biomarker in cancers having a pathogenic IDH2 allele. In some embodiments of the invention, the methods described herein are used to treat a subject having a disorder associated with a mutation in the IDH2 enzyme
(mIDH2), thereby giving rise to a pathogenic phenotype (e.g., leukemia). In some embodiments, the mIDH2 disorder is associated with a pathogenic IDH2 allele, wherein a pathogenic IDH2 allele is meant to include any allele encoding an IDH2 protein having a mutation associated with increased cellular proliferation, associated with increased likelihood or severity of cancer, associated with increased likelihood or severity of leukemia, or associated with increased levels of the oncometabolite, 2-hydroxyglutarate (2-HG) compared with a wild-type cell, tissue, or subject. Pathogenic alleles of IDH2 may encode, for example, any of the following mutations in the corresponding IDH2 protein: R140Q, R140W, R172K, R172M, R172G, or R172W.
mIDH2 -Associated leukemia
In some embodiments of the invention, the methods described herein are used to a subject having a leukemia, wherein the leukemia is associated with a mutation in the IDH2 enzyme. In some embodiments the subject having a leukemia has a pathogenic IDH2 allele and/or has elevated 2-hydroxyglutarate (2-HG) levels (e.g., in one or more cells of the leukemia). In some embodiments, the leukemia is an IDH2 sensitive leukemia (e.g., a leukemia that is responsive to IDH2 inhibitors). In some embodiments, the leukemia is an IDH2 independent or resistant leukemia (e.g., leukemia resistant to known IDH2 inhibitors, such as, Enasidenib).
Compounds of the Invention
The present invention features methods of treating leukemia (e.g., mIDH2- associated leukemia) using arsenic trioxide and/or a retinoic acid compounds, and derivatives thereof. In some instances, subject is treated with arsenic trioxide in combination with a retinoic acid compound (e.g., as described herein).
Arsenic Trioxide
Arsenic trioxide generally has the following structure:
Figure imgf000094_0001
Arsenic trioxide exhibits high toxicity in subjects of the invention, including mammals (e.g., humans). For example, arsenic trioxide ingestion can result in severe side effects, including vomiting, abdominal pain, diarrhea, bleeding, convulsions, cardiovascular disorders, inflammation of the liver and kidneys, abnormal blood coagulation, hair loss, and death. Chronic exposure to even low levels of arsenic trioxide can result in arsenicosis and skin cancer. Arsenic trioxide is therefore desirably administered to a subject at low enough doses to minimize toxicity. Arsenic trioxide and derivatives thereof (e.g., as described herein) may be effective at increasing the production of reactive oxygen species in a cell, tissue, or subject. Arsenic trioxide and derivatives thereof may also be effective in reducing Pinl activity in a cell, tissue, or subject. In some instances, arsenic trioxide may operate synergistically with a retinoic acid compound to treat a disorder described herein. In certain instances, the combination of arsenic trioxide and the retinoic acid compound are administered in amounts that result in minimal toxicity. Retinoic Acid Compounds
Retinoic acid compounds are generally derivatives of the diterpene retinoic acid (e.g., as described herein). Retinoic acid compounds may be effective in promoting differentiation in a cell (e.g., a leukemic cell). Retinoic acid compounds may also be effective in reducing Pinl activity in a cell, tissue, or subject. Exemplary retinoic acid compounds of the invention include all-trans retinoic acid (ATRA), 13-cis retinoic acid (13cRA), and retinoic acid compounds, and derivatives thereof, e.g., as described herein. Retinoic acid compounds of the invention may be a y compound selected from Table 1 or Table 2. In some instances, a retinoic acid compound is administered in combination with arsenic trioxide. In certain instances, the combination of arsenic trioxide and the retinoic acid compound are administered in amounts that result in minimal toxicity.
Certain embodiments of the invention feature a deuterated retinoic acid compound that is made by replacing some or all hydrogen with deuterium using state of the art techniques (e.g., as described herein and at www.concertpharma.com).
Combination Therapies
The arsenic trioxide and/or retinoic acid compound(s) of the invention may be further combined with additional therapeutic agents for treatment of any of the disorders described herein (e.g., leukemia).
In some instances, such compounds may act synergistically with arsenic trioxide and/or a retinoic acid compound to treat the disorder (e.g., leukemia). Additionally, co administration with arsenic trioxide and/or a retinoic acid compound may result in the efficacy of the additional therapeutic agent at lower and safer doses (e.g., at least 5% less, for example, at least 10%, 20%, 50%, 80%, 90%, or even 95% less) than when the additional therapeutic agent is administered alone.
Anti-proliferative agents
In some instances, the arsenic trioxide and/or retinoic acid compounds may be combined with anti-proliferative and other anti-cancer compounds (e.g., anti- angiogenic compounds) for treating a disorder (e.g., leukemia). Anti-proliferative agents that can be used in combination with a retinoic acid compound include, without limitation, microtubule inhibitors, topoisomerase inhibitors, platins, alkylating agents, and anti metabolites. Exemplary anti-proliferative agents that are useful in the methods and compositions of the invention include, without limitation, paclitaxel, gemcitabine, doxorubicin, vinblastine, etoposide, 5-fluorouracil, carboplatin, altretamine,
aminoglutethimide, amsacrine, anastrozole, azacitidine, bleomycin, busulfan, carmustine, chlorambucil, 2-chlorodeoxyadenosine, cisplatin, colchicine, cyclophosphamide, cytarabine, cytoxan, dacarbazine, dactinomycin, daunorubicin, docetaxel, estramustine phosphate, floxuridine, fludarabine, gentuzumab, hexamethylmelamine, hydroxyurea, ifosfamide, imatinib, interferon, irinotecan, lomustine, mechlorethamine, melphalen, 6- mercaptopurine, methotrexate, mitomycin, mitotane, mitoxantrone, pentostatin, procarbazine, rituximab, streptozocin, tamoxifen, temozolomide, teniposide, 6- thioguanine, topotecan, trastuzumab, vincristine, vindesine, and vinorelbine. The ability of a compound to inhibit the growth of a neoplasm can be assessed using known animal models.
Pin 1 inhibitors
Pinl is an enzyme that catalyzed the cis-trans isomerization of phosphorylated Ser/Thr-Pro motifs and which has been shown to be involved in an increasing number of diseases. Elevated Pinl activity has been associated with the development and progression of cancer. For example, Pinl is overexpressed in some human cancer samples and the levels of Pinl are correlated with the aggressiveness of tumors. Moreover, inhibition of Pinl by various approaches, including the Pinl inhibitor, Pinl antisense polynucleotides, or genetic depletion, kills human and yeast dividing cells by inducing premature mitotic entry and apoptosis. Thus, upon phosphorylation, Pinl latches onto phosphoproteins and twists the peptide bond next to the proline, which regulates the function of phosphoproteins and participates in controlling the timing of mitotic progression. In addition, Pinl has been shown to regulate the expression and/or activity of a diverse array of proteins associated with cancer progression. For example, known Pinl substrates include, without limitation, Her2, PKM2, FAK, Raf-1, AKT, b-catenin, c-Myc, p53, and numerous other proteins known to play roles in cancer progression. In some instances, the arsenic trioxide and/or retinoic acid compounds may be combined with a compound that inhibits Pinl activity or expression. In some instances, the arsenic trioxide and/or retinoic acid compounds may be combined with a compound known to interact with other proteins implicated in Pinl signaling pathways (see, e.g., the targets and compounds in Table 3). Table 3. Exemplary Additional Therapeutic Agents
Figure imgf000097_0001
LSD1 inhibitors
Lysine- specific histone demethylase 1 (LSD1) is a flavin-dependent monoamine oxidase, which can demethylate mono- and di-methylated lysines, specifically H3K4 and H3K9). The LSD1 enzyme has roles critical in embryogenesis and tissue-specific differentiation, as well as oocyte growth. The inventors have also identified a shared set of ATRA responsive genes previously reported to be regulated by inhibition of the demethylase LSD1 and associated with ATRA sensitivity. In some instances, the arsenic trioxide and/or retinoic acid compounds may be combined with a compound that inhibits LSD1 activity or expression.
Methods of Treatment
Therapy according to the invention may be performed alone or in conjunction with another therapy and may be provided at home, the doctor’s office, a clinic, a hospital’s outpatient department, or a hospital. Treatment optionally begins at a hospital so that the doctor can observe the therapy’s effects closely and make any adjustments that are needed, or it may begin on an outpatient basis. The duration of the therapy depends on the type of disease or disorder being treated, the age and condition of the patient, the stage and type of the patient’s disease, and how the patient responds to the treatment.
Routes of administration for the various embodiments include, but are not limited to, topical, transdermal, nasal, and systemic administration (such as, intravenous, intramuscular, subcutaneous, inhalation, rectal, buccal, vaginal, intraperitoneal, intraarticular, ophthalmic, otic, or oral administration). As used herein,“systemic administration” refers to all nondermal routes of administration, and specifically excludes topical and transdermal routes of administration·
In combination therapy (e.g., arsenic trioxide and/or a retinoic acid compound in combination with an additional therapeutic agent), the dosage and frequency of administration of each component of the combination can be controlled independently. For example, one or more of the compounds may be administered three times per day, while another compound or compounds may be administered once per day. Alternatively, one compound may be administered earlier and another compound may be administered later. Combination therapy may be given in on-and-off cycles that include rest periods so that the patient’s body has a chance to recover from any as yet unforeseen side effects. The compounds may also be formulated together such that one administration delivers both compounds.
Each compound of the combination may be formulated in a variety of ways that are known in the art. For example, a plurality of therapeutic agents (e.g., arsenic trioxide, a retinoic acid compound, and/or an additional therapeutic agent, as described herein) may be formulated together or separately. In some instances, multiple agents are formulated together for the simultaneous or near simultaneous administration of the agents. Such co-formulated compositions can include the drugs together in the same pill, ointment, cream, foam, capsule, liquid, etc. It is to be understood that, when referring to the formulation of combinations of the invention, the formulation technology employed is also useful for the formulation of the individual agents of the combination, as well as other combinations of the invention. By using different formulation strategies for different agents, the pharmacokinetic profiles for each agent can be suitably matched.
Certain embodiments of the invention feature formulations of arsenic trioxide and/or a retinoic acid compound for, e.g., controlled or extended release. Many strategies can be pursued to obtain controlled and/or extended release in which the rate of release outweighs the rate of metabolism of the therapeutic compound. For example, controlled release can be obtained by the appropriate selection of formulation parameters and ingredients (e.g., appropriate controlled release compositions and coatings). Examples include single or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, nanoparticles, patches, and liposomes. The release mechanism can be controlled such that the arsenic trioxide and/or retinoic acid compound is released at period intervals, the release could be simultaneous, or a delayed release of one of the agents of the combination can be affected, when the early release of one particular agent is preferred over the other.
The individually or separately formulated agents can be packaged together as a kit. Non-limiting examples include kits that contain, e.g., a plurality of pills (e.g., two pills or three pills), a pill and a powder, a suppository and a liquid in a vial, two topical creams, ointments, foams etc. The kit can include optional components that aid in the administration of the unit dose to patients, such as vials for reconstituting powder forms, syringes for injection, customized IV delivery systems, inhalers, etc. Additionally, the unit dose kit can contain instructions for preparation and administration of the compositions. The kit may be manufactured as a single use unit dose for one patient, multiple uses for a particular patient (at a constant dose or in which the individual compounds may vary in potency as therapy progresses), or the kit may contain multiple doses suitable for administration to multiple patients (“bulk packaging”). The kit components may be assembled in cartons, blister packs, bottles, tubes, and the like.
Examples
Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific examples, i.e., Examples 1-9, are therefore to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference in their entirety.
Materials and methods
Murine Leukaemia animal model.
The Hoxa9-Meisl- IDH2R140Q model of murine leukaemia cells was generated by the retroviral transduction of KSL (c-Kit+, Sca-1+, Lin-) cells as reported in Quek et a , Nat. Med., 2018, 24: 1167-1177. The generation of murine leukaemia cells showing independence by the mutant IDH2 was casually generated after three serial bone marrow transplantations of murine leukaemia cells. Serial bone marrow transplantation experiments were started by harvesting leukemic bone marrow cells from a single donor mouse and transplanting 5-10 * 104 cells into 8-10 recipients. The recipients were age- matched, female C57BL/6J (6-8 weeks old).
In brief, hematopoietic stem cells LSK were isolated from the bone marrow of a single Tg (M2rt/TA, IDH2R140Q) donor (3-5 months old) maintained on doxycycline diet. For LSK isolation, bones from hind limbs and hips were collected and crushed in PBS1X using a mortar and pestle. PBS medium containing bone marrow extracts was filtered and purified from red blood cells by incubation on ACK Lysing Buffer (Gibco). Lineage negative cells were immunostained using Lineage Cell Detection Cocktail- Biotin, mouse (Miltenyi Biotec) and streptavidin - APC-Cy7.
While anti-cKit-APC and anti-Sca-l-PE antibodies were used to stain cKit and Sca-1 positive populations. LSK cells (Lineage-, cKit+, Sca-1+) were sorted on a BD FACSAria II high speed cell sorters (Becton Dickinson) at the Hematologic Neoplasia and Jimmy Fund Cores (Dana Farber) and collected on StemSpan medium (Stem Cell Technologies) supplemented with cytokines (PeproTech): IL3 (25ng/ml), IL6 (25ng/ml), TPO (50 ng/ml), SCF (50ng/ml), FLT3Ligand (50ng/ml). Sorted LSK were transduced by spinoculation with Hoxa9-IRES-GFP and Meisla-IRES-YFP retroviruses and maintained in culture for no more than 72 hours before transplantation on a primary host (1st RECIPIENT, C57BL/6J females).
After a period of incubation (6-8 weeks), the leukemic cells were harvested from the bone marrow of a single donor, sorted as GFP+/YFP+ population and transplanted into a cohort of mice (2nd RECIPIENTS, C57BL/6J females). After 72 hours, the transplanted 2nd RECIPIENTS were divided into two groups and fed with doxycycline food to maintain the expression of the mutant enzyme (Dox-i- = IDH2R140Q ON) or normal diet to avoid the expression of mutant IDH2 (Dox- = IDH2R140Q OFF). Leukaemia cells were collected from the Dox+ = IDH2R140Q ON group after 6-8 weeks and transplanted into a new cohort of mice (3rd RECIPIENTS, C57BL/6J females). At this time point both Dox-i- = IDH2R140Q ON and Dox- = IDH2R140Q OFF cohorts were euthanized to evaluate disease state. As before, leukaemia cells were allowed to engraft for 72 hours and mice divided into two cohorts (Dox-i- = IDH2R140Q ON and Dox- = IDH2R140Q OFF). After 6-9 weeks, both Dox-i- = IDH2R140Q ON and Dox- = IDH2R140Q OFF cohorts were euthanized and bone marrow, peripheral blood or internal organs were harvested to evaluate disease penetrance. Age-matched C57BL/6J recipient female mice (age 8-10 weeks, Jackson Laboratories) were injected intravenously (tail vein) or retro-orbitally with 5-10 x 105 leukaemia cells in a volume of 200 pi of sterile PBS. All recipient animals received 650 cGy of radiation 24 hours prior to injection of leukemic cells. Leukemic bone marrow cells harvested from 2nd and 3rd RECIPIENTS were ex vivo expanded in RPMI media (Gibco) supplemented with murine SCF, FLT3 Ligand, IL-3, and IL-6 (2.5 ng/mL) for subsequent studies.
Intravenous Xenograft Leukaemia model.
Female NSG (NOD.CgPrkdescld I12lslni 1 W|l/SzJ ) recipient mice 6-8 weeks of age were used for the U937 in vivo model. Cells (25 x 104) were introduced intravenously by tail vein injection. Mice were treated with ATRA (lOmg/mouse) by subcutaneous implantation of ATRA pellets (5mg/pellet /21 days release), Arsenic trioxide (2.5 mg/Kg/day), or respective vehicle solutions via intraperitoneal injection. The experiment, as well as all treatments, were stopped after 21 days following the exhaustion of ATRA pellets.
AML patient - derived xenograft (PDX) model.
NSG mice engrafted with human AML blasts were purchased from Jackson Laboratories (NOD scid gamma, NOD -scid IL2Rgnu11, NOD3 scid IL2Rgammanu11). Female NSG mice (age: 4-5 weeks old) were irradiated (400 cGy) 24 hours prior to the retro-orbital transplantation of sorted human AML blasts. Engraftment and disease progression was detected as evidence of human CD45- positive cells in the peripheral blood. Mice were randomly divided into groups before starting of the treatments.
Preclinical Testing of AT Ό and ATRA.
All in vivo treatments started after assessment of leukaemia engraftment and detection of blasts in PB of transplanted NSG or C57BL/6J. The Scheme of the pharmacological therapy resembles therapeutic regimen of human APL patients.
Treatment regimen was performed in cycles for a total of 65 days resembling APL0406 protocol (Lo-Coco et al; NEJM 2013). Accordingly, each cycle (65-71 days) was as follows: 15-21 days combination of ATO and ATRA, 10 days no therapy administered (off period) followed by two rounds of single drug administration: 10 days of ATO therapy before 10 days of ATRA therapy. Before the starting of a new cycle, no therapy was administered for 10 days. ATO (2.5 pg/g) and ATRA (1.5 pg/g) were administered by intraperitoneal injection as previously established methods (Rego, E. M., He, L.-Z., Warrell, R. P., Jr, Wang, Z.-G., & Pandolfi, P. P. (2016). Retinoic acid (RA) and As203 treatment in transgenic models of acute promyelocytic leukemia (APL) unravel the distinct nature of the leukemogenic process induced by the PML-RAR and PLZF-RAR oncoproteins).
In vitro culture of murine primary leukaemia cells.
The Hoxa9/Meisla/IDH2R140Q murine primary leukaemia cells were cultured and expanded in RPMI media supplemented with murine SCF (2.4 ng/mL), FLT3 Ligand (5ng/mL), IL-3 (2 ng / mL), and IL6 (2.5 ng/mL) (PeproTech). When needed, doxycycline (Sigma) was added to the media to maintain the expression of the IDH2R140Q allele in vitro. Conditioned media (1:2) was used for serial re-plating.
Methylcellulose colony assay.
Colony assay and re-plating of mouse or human leukaemia cells, respectively, were performed with Methocult M3434 medium or MethoCult H4434 Classic (Stem Cell Technologies). According to specific conditions, methylcellulose medium was supplemented with Doxycycline (Gibco), Arsenic Trioxide (Sigma), Tretinoin (Sigma), AGI-6780 or AG-221 (Cayman Chemical), Juglone (Cayman Chemical) or respective vehicle solutions. Single colonies were picked up 1- 2 weeks after culture and then processed by cytospin, assayed for cell viability, flow cytometry analysis, and/ or harvested for nucleic acids extraction. Mouse leukaemia cells were isolated from bone marrow as GFP+ cells and plated at 5000 cells / dish. Then, 2500 cells/dish were used for serial plating. Human AML blasts (1.5 -2.5 *104 cells/dish) were plated in 35-mm Petri dishes and incubated in a humidified CO2 incubator. Colonies were counted as units of at least 30 cells were generated after plating (2 - 4 weeks).
Differentiation Assay. Human TF1 cells were pre-treated for 12 days with AG-221 (1 mM) or vehicle and washed with PBS to remove residual GM-CSF. Cells were then induced to differentiate using EPO (2 unit/ml, StemCell Technologies) and Hemin (10 mM, Sigma). Induction continued for 12 days and the cell pellets were collected and subjected to real-time qPCR to detect fatal haemoglobin (HBG) and KLF-1 gene expression or flow cytometry to quantify CD71.
Analysis of intracellular polar metabolites extraction and 2-HG measurements.
Metabolites extractions and 2-HG measurements were performed as reported in Pinton et al., Science 2007, 315:659-663. In brief, viable mouse or human cells (1*105 - 3*106 viable cells) or peripheral blood (200 pi) were collected and extracted for polar metabolites. Dried metabolites were suspended into lOOpl of deionized water or methanol, and analysed by liquid chromatography-mass spectrometry. Calculations of 2- HG were subsequently normalized based on the number of cells or volumes extracted. Real-time qPCR analysis of leukaemia cell lines and primary blasts.
Total RNA was extracted using Trizol Reagent (Invitrogen) and RNA Isolation Kit (Ambion). cDNA synthesis and PCR amplification were performed using
Superscript™ One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen). Universal SYBR Green quantitative PCR assay (Sigma) was used to quantify gene expression by using the following specific oligos: mouse HoxA9 (fw: 5’- TCCTCCAGTTGATAGAGAAAAACA-3’ , rw: 5’- GCGAGC ATGTAGCC AGTTG-3’ ) ; MeislA (fw: 5’- GGGGATAACAGCAGTGAGCA -3’, rw: 5’- CCACGCTTTTTGTGA CGCTT-3’); Hprt (fw: 5’- GGTGGAGATGATCTCTCAACTT-3’ , rw:5’-CCAGCA AGCTTGCAACCTTAAC-3’ ) ; Tbp (fw:5’- GAAGAACAATCCAGACTAGCAGCA-3’ , rw:5’ -CCTTATAGGGAACTTCACATCACAG-3’) ; IDH2 (fw:5’- GCAGAGCC TCAGGCTCGCG-3’ , rw: 5’- GGCTGCTCTTGCGAGGT-3’ ), RPL0 (fw:5’- GCTTCC TGGAGGGTGTCC-3’ , rw: 5 -GG ACTCGTTTGT ACCCGTTG-3 ). Human HBG,
KLF1, PIN1, ITGAM, LILRA5, RARA, PRAM1 and GAPDH gene expression were measured using the Taqman assay (Invitrogen) according to manufacturer’s instruction. 2HG treatments.
Human TF1 cells TF-1 cells were treated with vehicle (0.1% EtoH) or 0.1 mM (2R)-Octyl-2-HG and harvested at indicated time for Western blot analyses.
Cell Proliferation and viability Assay. Cells (TF1 or U937, 8-10 *103 cells) were plated in complete medium on multiwell plates and treated with ATRA and/or ATO for 4 days. Cells were assayed every 24h for cell viability or proliferation by using CellTiter Glo, MTS Assay (Promega) according with manufacturer protocols.
FACS Analysis of mouse and human leukaemia cells.
FACS analyses on human and mouse leukaemia cells were performed according to standard protocols. See, e.g., Pinton et al., Science 2007, 315:659-663. In brief, mice were euthanized and single-cell suspensions from the bone marrow were generated by bone crushing in PBS supplemented with 2% FBS. Cell suspensions were passed through IOOmM cell strainers, centrifuged, and then re- suspended in 1-2 ml ACK red cell lysis buffer (GIBCO). Red blood cells were lysed on ice for lmin. Cell suspension were then washed in 2%FBS/PBS, centrifuged, and then re-suspended in 1ml of 2%FBS in PBS1X. Cells were subsequently processed for GFP+/YFP+ sorting, KLS isolation, or intracellular flow staining. Staining with specific antibodies (1:100) or Annexin V/ 7AAD was performed for 15 - 30 minutes at room temperature in the dark, following the protocol reported in Carracedo et ak, Nat Rev Cancer 2013, 13:227-232. For intracellular phosphoflow cytometry on mouse leukaemia blasts, the cells were fixed in 4% PFA at
37°C, 5% C02 for 10 minutes and permeabilized with 90% ice-cold methanol and processed as reported in Pandolfi et ak, Cancer Cell 2017, 32:552-560. Flow cytometry data were collected on a J LSR II (VF415) or LSR J-Fortessa (JF415) flow cytometer (Becton Dickinson). Resulting profiles were further processed and analysed using the FlowLogic or FloJo software. FACS Cell sorting was performed on a JF Aria II SORP or Sony SH800z Cell Sorter, with the support of the Dana-Farber Cancer Institute Flow Cytometry Core Facility.
The following antibodies were used for Flow Cytometry analyses:
Figure imgf000105_0001
Figure imgf000105_0002
Intracellular Flowcytometry on patient’s samples.
Human AML blasts (2-5*104 cells) were fixed in 4%PFA for 5 minutes at 37 °C, washed twice with cold PBS and permeabilized with 90% methanol ( ice-cold). Pellets were washed twice in ice cold PBS and resuspended in Staining buffer (0.5%BSA in PBS1X) and incubated (at 4 °C) with anti - PIN1 antibody ( Rb mAh to PIN1, ab76309, abeam) or respective IgG control (Rb IgG monoclonal isotype control, abl72730, abeam). Cells were washed twice and incubated with Donkey anti - rabbit Alexa Fluor 647 for 1 hour at room temperature. Pellets were washed three times before flow analysis.
Cytospins and May-Grunwald -Giemsa Staining.
Blood smears and bone marrow cytospin slides were prepared according to the methods reported in Mason et al., Am J Hematol 2018, 93:504-510. Slides were fixed in 100% methanol for 10 minutes and air dried completely before staining. Slides were stained in May-Griinwald solution (Sigma; 1:20 dilution in dFFO) for 5 minutes, washed twice in dFFO, and then stained with the Giemsa solution (Sigma; 1:20 dilution in dPpO) for 15 minutes. Finally, slides were washed in dFFO and air dried. Slides were sealed with Cytoseal and then analysed on a Nikon Eclipse 50i microscope or Olympus BX41 equipped with an Olympus Q Color 5 camera.
Immunohistochemistry of mouse tissues.
Tissues were fixed in 4% paraformaldehyde overnight, paraffin embedded, and then sectioned at 5 pm. After deparaffinization and rehydration, antigen retrieval was performed in a pressure cooker with sodium citrate buffer at 95 °C for 25 minutes. Sections were incubated in a 0.3% H2O2 solution in lx PBS, and then a 10% serum solution in lx PBS for 30 minutes each solution was used to block endogenous peroxidase and background from the secondary antibody, respectively. The sections were stained with the primary antibodies: Ki67 (1:200, Thermo Fisher Scientific, #MA5-14520) or Anti-Myeloperoxidase antibody (1:50, abeam #ab9535), or Phospho- Histone H2A.X (1:200, Cell Signalling #9718S) and incubated in a biotinylated secondary antibody in lx PBS (1:500-1:1000) at room temperature for 30 minutes. The Vectastain ABC Elite kit was used to enhance specific staining, and the staining was visualized using a 3’-diaminobenzidine (DAB) substrate. Stained sections were counterstained using hematoxylin and dehydrated before they were sealed with a coverslip with Richard- Allan Scientific® Cytoseal™ XYL Mounting Medium.
Immunofluorescence.
Cells were fixed at room temperature in 4% paraformaldehyde for 20 minutes and permeabilized for 10 minutes using a 0.5% Triton X-100 solution in lx PBS.
Blocking was performed for one hour using a 5% bovine serum albumin solution in lx PBS. The sections were stained with the P-Histone H2A.X primary antibody (1:200) in a 2% bovine serum albumin and lx PBS solution at 4 °C overnight, and then incubated with a goat anti-rabbit IgG Alexa Fluor 546 conjugate (1:1000) in PBS IX at room temperature for 1 hour before staining with DAPI (1: 1000) in lx PBS for 10 minutes. Cells were washed with lx PBS and milli-Q water before being sealed with a coverslip with Fluorescence Mounting Medium.
Transcriptome profiling using RNA quantification sequencing.
RNA derived from resistant and sensitive leukaemia cells was subjected to next- generation sequencing (NGS) to generate deep coverage RNASeq data. For each treatment and control group, sequencing was performed on several biological samples (mIDH2-DEPENDENT leukaemia n=7, mIDH2-INDEPENDENT leukaemia n=6, Hoxa9/Meisla leukaemia n=3). Sequencing libraries of Poly A selected mRNA were generated from the double- stranded cDNA, using the Illumina TruSeq kit according to the manufacturer's protocol. Library quality control was checked using the Agilent DNA High Sensitivity Chip and qRT-PCR. High quality libraries were sequenced on an Illumina HiSeq 4000. To achieve comprehensive coverage for each sample, we generated about 30-35 million single end reads.
RNA-Seq / Gene expression analysis.
The raw sequencing data was processed to remove any adaptors, PCR primers, and low quality transcripts using FASTQC and fastx. These provided a very comprehensive estimate of sample quality on the basis of read quality, read length, GC content, uncalled based, ratio of bases called, sequence duplication, adaptors, and PCR primer contamination. These high quality, cleaned reads were aligned against the mouse transcriptome (mmlO) using bowtiel with parameters: p 12 -q -n 2 -m 1 -S -best. Gene expression measurement was performed from aligned reads by counting the unique reads using htseq-count (vO.6.1) with parameters: -a 10 -m intersection_strict. The read count based gene expression data was normalized and analyzed using the“DESEq2 R package”. The differentially expressed genes were identified on the basis of FDR value and fold change. Genes were considered significantly differentially expressed if the multiple hypothesis test-t corrected p-value was <0.05. The resulting gene expression matrix was subsequently subjected to gene set enrichment analysis (F-GSEA, https://bioconductor.org/packages/release/bioc/html/fgsea.html) and then visualized through the R pheatmap package. WES sequencing and read alignment.
Sequencing reads from each sample were aligned to the C57BL/6J reference genome (GRCm38) using BWA, and then merged into a single BAM file using Picard tools (v. 1.119). To improve SNP and indel calling, the Genome Analysis Toolkit (GATK) TndelRealigner’ (www.broadinstitute.org/gatk/) was used to realign reads near indels from the Mouse Genomes Project (v5). The BAM files were then re-sorted and quality scores were recalibrated using GATK‘Table Recalibration’ and PCR duplicates were marked using Picard‘MarkDuplicates’.
Variant Calling.
SNPs and indels were identified using the SAMtools mpileup function and variants were called using VarScan suite (v.2, varscan.sourceforge.net). Variants were filtered using an in-house Perl script, to account for SNVs and indels not included in the control sample (wild type), for mapping quality, number of mismatches, read depth, and known variants (Mouse genome project, mgp v.3). Finally, variants were annotated using Annovar (http://annovar.openbioinformatics.org, v.20150322)
Copy Number analysis.
Copy number variations (CNVs) were called using the binary segmentation algorithm implemented in the“DNACopy R package”. The default parameters and segmented data were merged suing mergeSegments.pl from VarScan suite.
Example 1. Development of cell autonomous resistance to mIDH2 targeting by serial transplantation of mouse AML
A previously generated mIDH2 (IDH2R140Q) dependent AML model was used to predict mechanisms promoting resistance to mIDH2 inhibitors in patients. Using a serial transplantation protocol (Fig. 1A) mIDH2 dependency was manipulated in a model of mouse bone marrow (BM) cells overexpressing mIDH2 transduced with Hoxa9-GFP and Meisla-IRES-YFP retroviruses transplanted in a primary host in the presence or absence of doxycycline to induce mIDH2 expression. Dependence on mIDH2 in secondary transplanted disease was confirmed (Figs. 1B-D, 2nd Recipients), and mIDH2 independent (resistant) disease was observed upon transplant of blast cells from Dox-i- 2nd recipient mice (Figs. 1B-D, 3rd Recipients). Importantly, no differences were observed in the survival of mIDH2 ON or mIDH2 OFF AMLs (Fig. 6A), and 3rd recipients demonstrated an extensive proliferative infiltration of extra-medullary tissues including spleen, liver and kidney (Figs. 6B and 6C). As expected, it was observed that 3rd recipients had much higher levels of disease infiltration as compared with 2nd recipient mice (Fig. 6D) and a higher proliferative index in the infiltrates (Figs. 6E and 6F).
2-HG was strongly reduced in the mIDH2 OFF setting compared to respective mIDH2 ON 19 condition (Fig. IF), and IDH2R140Q expression was appropriately repressed in the mIDH2 OFF setting for 2nd and 3rd recipient mice (Fig. 1G), with stable expression of both Hoxa9 (Fig. 1H) and Meisla (Fig. II) in these leukemias.
To further evaluate if the independence from mIDH2 in vivo represents a cell autonomous process, in vitro culture systems were established to assay sternness and the proliferative potential of these AMLs (Figs. 6G and 6H). In these conditions, AMLs from both 2nd and 3rd recipient mice demonstrated a similar capacity to generate colonies in methylcellulose (Fig. 1J, vehicle treated). Targeted inhibition of mIDH2 activity in vitro decreased the colony forming capacity of AMLs isolated from 2nd recipients, but not of those cells isolated from 3rd recipient (Figs. 1J and IK), though 2- HG levels were reduced (Fig. 11). All together these data demonstrate the independence from mIDH2 expression corresponds with resistance to mIDH2 inhibition and occur cell autonomously during time.
Example 2. De novo resistance is associated with a distinct metabolic switch to one- carbon metabolism and altered redox balance
Since the expression of mIDH2 directly impacts cellular metabolism, polar metabolites were extracted from sensitive and resistant AML cells from both 2nd and 3rd transplanted mice (Fig. 7A). Comparison of metabolite abundance established multiple metabolic processes altered between the mIDH2 leukemic states (Fig. 2A and 2B). Resistant cells were significantly enriched in glycerophospholipid, pyrimidine, purine, cysteine and methionine metabolism pathways (Fig. 2B). These pathways can be fueled by one-carbon metabolism, which consists of both the folate and the methionine cycles (Figs. 7B and 1C). Importantly, one-carbon metabolism is a main cellular engine contributing to nucleotide metabolism and global methylation, as well as cellular redox status. Similar to recent findings for purine metabolism in cancer, a general increase in purine precursors in 3rd compared to 2nd recipient AMLs was observed (Figs. 7D-F).
Finally, one-carbon metabolism also contributes to redox balance through the biosynthesis of glutathione (GSH). Glutathione metabolism was the most significant and highly enriched metabolic pathway in resistant AML cells (Fig. 2C). 3rd recipient AML cells demonstrated high levels of glutathione and cysteine, glutathione’s major precursor (Fig. 2D), suggesting that these cells may have an altered redox balance. Indeed, altered NADPH/NADP+ and NADH/NAD+ ratios confirm this oxidative stress (Fig. 2E), and excessive ROS levels were visualized using MitoSOX™ Red staining (Figs. 2F-G), especially relative to Hoxa9/Meisla driven leukemias lacking mIDH2 (Fig. 7G).
In this connection, it was observed that mouse early stage
HoxA9/Meisla/mIDH2 leukemia at early (sensitive) stage were marked by the same features of late (resistant) leukemia. See Figs. 2J(a-e) and 3K(a-e). This evidenced that the mutant IDH leukemia at early stage show the same characteristics/features of the late stage leukemia, when using ATO combined with ATRA, providing a rational for the utilization of ATO and ATRA not only in mutant IDH2 leukemia at late sage (when cells became resistant to the inhibitor), but also at early stage (when cells are sensitive to the inhibitor).
To evaluate genotoxic stress, staining for g-H2A.C was carried out on mouse bone marrow leukemia cells (Fig. 2H). Similarly, staining for g-H2A.C was carried out on infiltrated spleens from both 2nd and 3rd transplanted mice (Fig. 21). Evidence of increased DNA damage suggests that altered redox balance may represent a vulnerability within mIDH2 leukemias that could be targeted for therapy.
Example 3. Translocations of hematopoietic genes are associated with mIDH2 resistant leukemias
To determine if such genotoxic stress may contribute to AML evolution through targeted mutation whole exome sequencing (WES) of a 2nd recipient and three of its derived 3rd recipient‘daughter’ leukemias was performed (Fig. 8A). Non-synonymous base substitutions and both G>A:C>T and A>G:T>C transitions accounted for two- thirds of the single base substitutions (SBS) observed, as is frequently found in cancers without biased substitution (Fig. 8B). Additionally, principal component analysis (PCA) established that these leukemias did not appear to cluster (Fig. 8C). Although a variety of mutations were observed in progression from 2nd to 3rd recipient leukemias sequenced the majority of these mutations identified were non-synonymous single nucleotide variants (SNV), and included a number of indel mutations to a variety of genes. Only Spl40 appeared to be commonly mutated across all samples (Fig. 8D). Each of these leukemias harbored a unique point mutation in Spl40 ( Spl40Y5D in 3rd_l 1 ; SpI4(FMG in 3rd_08; Spl40C203G in 3rd_09) (Fig. 8D). SpMO is a component of the PML nuclear body, however, no obvious or consistent alteration to SpMO or PML localization was observed for these mutant variants.
Global changes across these leukemia genomes identified a distinct pattern of both genomic amplification and deletion in each AMLs (Fig. 8E). Several leukemia- associated genes were found to be affected, including amplification of the Flt3 proto oncogene (3rd_08) and deletion of the tumor suppressors Dokl and Trp53 (3rd_09) and Dok3 and Dok4 (3rd_l 1) (Fig. 8E). Interestingly, a number of translocations shared amongst 3rd recipient leukemias may be particularly relevant in the context of this disease. These translocations involve known hematopoietic genes including Rael ( Rael;Pappa t(4;2)), Meisl ( EeahMeis P, t(l 1 ; 10)), and both Ppplrl3b (Asppl) and Cadps2 (Ppplrl 3b:Cadps2 t(6;12)) (Fig. 8E). The translocation involving Ppplrl3b and Cadps2 was of particular interest since loss of function for both of these genes has been implicated in hematopoietic stem cell maintenance. The Ppplrl 3b gene is also implicated in leukemia development, coordinating tumor suppression with the TP53. While the Ppprl3b:Cadps2 translocation was only identified in two out of three of the 3rd recipient AMFs (3rd_08 and 3rd_ll), the third leukemia showed genomic loss of Trp53, suggesting that targeting of Trp53 may contribute to progression.
Example 4. Aberrant ATRA signaling characterizes resistance to mIDH2 withdrawal
RNAseq analysis was performed to create a global picture of leukemia progression from a state of mIDH2 dependence to independence (Fig. 9A). Primary leukemias derived from Hoxa9;Meisl overexpression without mIDH2 was used for comparison. PCA analysis identified distinct clusters of 2nd and 3rd recipient leukemias (Fig. 9B). Differential gene expression patterns highlighted clear differences between sensitive and resistant leukemias (Fig. 3A), suggestive of common pathways leading to independence from mIDH2. A gene-centric PCA identified genes associated with the Jun/Fos AP-1 transcription factor family (Jim, Fos, Fosb), granulopoiesis and myeloid differentiation ( My a, Lyz2, Ngp ), and inflammation ( Zfp36 ) as differential (Fig. 9C). Altered expression status of myeloid granule components also suggested that 2nd and 3rd recipient leukemias may represent different stages of myeloid development (Fig. 9C).
Furthermore, significant enrichment of cancer associated signaling pathways including MAPK, Erk, PI3K and Akt was observed in resistant leukemias, as well as an enrichment in inflammation and tumor microenvironment (IL-1, IL-6, ILK, MIF, TNFR2, etc.) (Fig. 3B). Gene set enrichment analysis (GSEA) identified similar pathways altered in resistant AMLs, including enrichment of Kras, MAPK, TNF signaling and response to Tretinoin (aka. all-trans retinoic acid; ATRA) (Fig. 3C), while an interactive network of all differentially regulated genes highlighted the central role of Erk/MAPK signaling in defining the signatures associated with resistant disease (Fig. 8C) consistent with previously published data, suggesting that the present model recapitulates mechanisms relevant to human AML. Indeed, cancer signaling pathway activation was confirmed by flow cytometry analysis (Fig. 8E).
Intriguingly, ATRA-responsive genes were highlighted by GSEA
(Tretinoin_Response_DOWN gene cluster), suggesting a more undifferentiated state as mIDH2 AML evolves to resistance (Fig. 3D). Indeed, further analysis highlighted a shared set of ATRA responsive genes previously reported to be regulated by inhibition of the demethylase LSD1 and associated with ATRA sensitivity (Fig. 3E). This prompted us to hypothesize mIDH2 leukemia might harbor sensitivity to ATRA.
Indeed, both pharmacological and sub-pharmacological doses of ATRA demonstrated profound differentiation effects on mIDH2 expressing AMLs (Fig. 3F). To determine if this is also the case in human hematopoietic cells expressing mIDH2, TF1 cell lines overexpressing the mIDH2 allele and increased 2-HG levels were generated (Fig. 3G). Treatment of mIDH2 overexpressing TF1 with ATRA (10 6 M) resulted in increased differentiation as compared to controls (Fig. 3H), with a concomitant decrease in cell growth (Figs. 31 and 3Jj). In this connection, it was observed that continued inhibition of LSD1 impacted the intracellular levels of oxidative stress in TF1 cells (Fig. 4M).
Furthermore, these data were replicated in U937 cells overexpressing mIDH2 treated with ATRA in the presence of vitamin D (Figs. 8G-J).
Example 5. PIN1 upregulation is a common hallmark of the resistant state
The mechanism by which mIDH2 cells conferred sensitivity to the
differentiation effects of ATRA was evaluated. ATRA has been recently established as a specific inhibitor of the PIN 1 proto-oncogene. PIN 1 has been reported to be upregulated by C/EBPa-p30, and can promote activation of MAPK. Similarly, it promotes PI3K activity and regulates AKT’s stability and phosphorylation. While ATRA is a specific inhibitor of PIN1, it is also important to note that PIN1 itself can be a negative regulator of ATRA, and there is an expanding role for PIN 1 as a negative regulator of hematopoietic differentiation.
It was therefore hypothesized that PIN 1 may contribute to proliferative signaling (MAPK and PI3K dependent), increased survival to ROS-mediated apoptosis, and the ATRA mediated differentiation block observed. Indeed, a marked upregulation of Pin 1 protein in both Dox ON and OFF mIDH2 leukemias at late stages of progression (Fig. 4A, Lanes 5-8). This suggested that 3rd recipient leukemias may be sensitized to ATRA and that targeting PIN 1 may relieve both the oncogenic signaling and the differentiation block in these cells.
Next, the status of RAR genes in differentiation was examined and strong downregulation of both Rara and Rxra in 3rd recipient AML was observed (Fig. 4A, Lanes 5-8 compared with Lanes 1 and 2), in line with Pinl degradation of Rara.
Additionally downregulation of the tumor suppressive p42 form of C/EBRa, and decreased expression of C/ERBe were observed, which may also contribute to a primitive differentiation state of these cells (Fig. 4A).
Surprisingly, ATRA-sensitive retinoic acid receptors were upregulated in mIDH2 2nd recipient AML, as well as increased C/EBRa and C/EBRe (Fig. 4A, Lanes 3 and 4). However, PIN1 itself, the negative regulator of the pathway, was also concomitantly induced (Fig. 4A, Lanes 3 and 4). However, validated Rara/Rxra responsive genes were not transcriptionally activated, suggesting that RARs are transcriptionally inactive.
mIDH2 overexpressing TF- 1 and U937 cell lines were used to understand if the same was true for human leukemia. Indeed, both TF- 1 (Fig. 4B) and U937 (Fig. 4C) lines demonstrated upregulation of PIN1 in the presence of mIDH2, along with retinoic acid receptors and C/EBRa. Inhibition of PIN1 by using a specific inhibitor (Juglone) clearly demonstrated PIN 1 to be required for blocking differentiation driven by erythropoietin (EPO) (Fig. 4D) and reduced their clonogenic ability (Figs. 4E, 10A, and 10B). In addition, knockdown of PIN1 resulted in up-regulation of the differentiation associated HGB, KLF1, and GATA2 genes (Fig. 4F-H). Similarly, PIN1 overexpression promoted expression of stem markers CD34 and CD117 in mIDH2 expressing cells (Figs. 41, 4J, and IOC).
Furthermore, this was also observed to be the case for TF-1 cells overexpressing mutant IDH1. Importantly, comparison of a cohort of primary AML patients with or without mIDH2 mutation identified increased levels in PIN 1 mRNA levels in these patients. Although the Cancer Genome Atlas (TCGA) AML dataset represents a cohort of primary AML patients at early diagnosis, concomitant analysis demonstrated variable PIN1 expression, and patients harbouring mIDH mutations had a trend towards higher PIN1 expression. Indeed, a similar trend was observed in PIN1 protein levels assessed by intracellular flow cytometry from primary AML patients.
Example 6. ATRA and ATO combination for treatment of mIDH2 AML
Given ATRA sensitivity and extensive ROS in mIDH2 AML, it was hypothesized that the combination of the pro-oxidant ATO together with ATRA may be utilized to treat mIDH2 AML. While Hoxa9/Meisla leukemias alone showed some sensitivity to only the combination, 2nd recipient leukemias demonstrated sensitivity to both single agents and a synergistic response to the combination (Fig. 11 A). Late stage disease (e.g., 3rd recipient, mIDH2-independent leukemias in both the presence and absence of mIDH2) demonstrated a similar level of response to both single agent and combination treatments disease both in the presence and absence of the mIDH2 oncogene (Fig. 1 IB), indicating efficacy in both mIDH2 sensitive and resistant disease. To confirm these findings in vivo a mIDH2 independent (e.g, resistant) mouse AML was transplanted into BL6 (Fig. 11C) and placed mice on a treatment regime as outlined in Fig. 4K. Both single agent and combination treatments demonstrated efficacy as measured by increase in mean survival of mice treated (Fig. 11D). Strikingly, a number of mice treated with the ATO/ ATRA combination demonstrated a strong differentiation response in the leukemic blasts associated with an excessive infiltration of mature myeloid cells in the lung (Fig. 11E-G). Thus, steroid dexamethasone was also administered. As outlined in Figs. 4K-L, dexamethasone treatment successfully overcame the differentiation syndrome, and enabled extensive survival benefits upon treatment with the ATO/ ATRA combination.
Example 7. Differentiation therapy for the treatment of human mIDH2 AML
An in vivo pre-clinical study was performed using the U937 cell line in immunocompromised NSG host mice (Fig. 12A). 21 days after initiating treatment all control mice had succumbed to disease, while only mIDH2 overexpressing U937 treated with the ATO/ ATRA combination remained alive (Fig 12B). Bone marrow (BM) analysis demonstrated a significant decrease in the percentage of GFP+ leukemic blasts, and increased differentiation, in both the ATRA and ATO/ ATRA treated cohorts of mice transplanted with mIDH2 overexpressing cells (Figs. 12C-E). Importantly, only mIDH2 expressing U937 cells treated with the combination therapy demonstrated the mature myeloid CDllb marker amongst all the cohorts analyzed (Figs. 12F and 12G). Additionally, reduced spleen weights were observed in mIDH2 expressing U937 cells treated with ATO/ATRA, demonstrating the power of this treatment combination to impact the severity of disease (Fig. 12H).
Next, a panel of human primary AMLs was treated with ATO/ATRA to evaluate their potential for clinical efficacy, as measured by colony formation in methylcellulose. Importantly, only AML harboring mIDH2 showed a significantly reduced number of colonies upon treatment, and strong synergy was observed in combination treatments (Fig. 5A). NSG mice transplanted with human primary mIDH2 positive AML (Fig. 5B) were subjected to the treatment protocol as outlined in Fig. 5C to evaluate in vivo efficacy. To minimize onset of DS a metronomic dosing schedule was utilized.
Importantly, a notable survival advantage for both ATO and ATRA treated mice was observed, while combination treated mice appeared to demonstrate a durable remission in most cases (Fig. 5D). Interestingly, the single agent ATO and ATRA treated cohorts demonstrated a significant increase in differentiating blasts in the bone marrow as evaluated by morphology (Figs. 5E and 5F).
Example 8. Therapeutic vulnerabilities driven by mIDH
Based on the above results, it was hypothesized that PIN1, ATRA sensitivity and high ROS levels represented therapeutic vulnerabilities for intervention in mIDH leukemia. Importantly, ATRA can inhibit the enzymatic activity of its negative regulator PIN1 through direct binding, as reported in Wei et ak, Nat. Med. 2015, 21:457-466. To test this, the ability of ATRA was evaluated to promote differentiation of leukemic blasts in a murine model of AML. Indeed, both pharmacological and sub- pharmacological doses of ATRA demonstrated striking differentiation effects on murine mIDH2 expressing AMLs, both in the mIDH2 dependent and independent phases of disease evolution (Fig. 13a).
To further determine whether the sensitivity to ATRA is indeed mIDH2- dependent and whether this would also be the case in human hematopoietic cells expressing mIDH2, studies were conducted with TF1 cell lines overexpressing the mIDH2 allele. Treatment of mIDH2 overexpressing TF1 with a pharmacological ATRA dose (106 M) resulted in a dramatic difference in cellular differentiation as compared to controls (Figs. 13b and 13c), with a concomitant decrease in cell growth (Fig. 13d). Furthermore, as pointed out above, a study was performed to generate U937 cells overexpressing the mutant isoform R140Q of IDH2. This cell line has been extensively utilized to study how the fusion genes of APL (e.g. PML-RARa) cause a block in cellular differentiation. Once again, treatment of mIDH2 -overexpressing U937 with pharmacological doses of ATRA (10 6 M) in the presence of vitamin D, resulted in a dramatic difference in cellular differentiation as compared to controls and a concomitant decrease in proliferation (Fig. 13e), while treatment of TF1 cell line overexpressing mIDHI also demonstrated a similar decreased proliferative response. To determine if this sensitivity was a dependency on PIN 1 activity, a study was conducted to assess whether PIN 1 could act as a critical mediator of the block of differentiation observed in mIDH2 leukaemia through both pharmacological and genetic targeting. Inhibition of PIN1 by using a specific inhibitor (Juglone) clearly demonstrated Pinl to be differentially required in mouse AML harbouring mIDH2 which showed a significantly decreased colony forming capacity upon Pinl targeting (Fig. 13f), while mIDH2 TF1 cells also demonstrated a similar sensitivity as demonstrated by reduced clonogenic capacity upon specific targeting of PIN1 by Juglone (Fig. 13g). Similarly, dependence on Pinl in mIDH2 independent AML cells was demonstrated by genetic silencing, which significantly attenuated their colony forming capacity. Congruent with this behaviour, mIDH2- overexpression in TF1 cells inhibited the induction of the differentiation marker CD71 upon differentiation driven by erythropoietin (EPO), while specific targeting of PIN 1 with Juglone restored the upregulation of this marker. Also similarly, these findings were mimicked by genetic targeting of PIN 1 in mIDH2- overexpressing TF1 cells, with up-regulation of the CD71 and CD44 markers detected by flow cytometry and the differentiation associated HGB and KLF1 genes
demonstrating the increased sensitivity to differentiation upon loss of PINL Critically, the overexpression of PIN1 favoured the maintenance of the distinctive undifferentiated state of mIDH2 cells, even upon treatment with the specific mutant IDH2 inhibitor AG- 221, rendering them resistant, highlighting the dependence on Pinl and underscoring the relationship between mIDH2 and PINL
In the same fashion, the therapeutic opportunity afforded by ROS induction was evaluated in this model through the use of arsenic trioxide, hypothesizing that the pro oxidant activity of ATO could cause genotoxic stress and cell death. Indeed, the murine AML model demonstrated increased apoptosis in both a sensitive mIDH2 dependent and resistant mIDH2 independent setting (Fig. 13h), while the expression of mIDH2 in TF1 cells conferred sensitivity to induction of apoptosis upon treatment with ATO that was not observed in control infected cells (Fig. 13i). Interestingly, we also demonstrated the ability of mIDH2 and PIN 1 overexpression to facilitate the induction of ROS in TF1 cells, while TF1 cells overexpressing mIDHI were also found to respond to treatment with ATO.
Thus, it was hypothesized that these agents may function as targeted therapies towards mIDH AML, especially as both ATRA and ATO have also been shown to be able to directly and indirectly target PIN 1 at multiple levels consistent with our data. Combining these agents in vitro against AML cells isolated from Hoxa9/Meisla and Hoxa9/Meisla/mIDH2 murine leukaemias, only mIDH2-expressing AML cells demonstrated enhanced sensitivity to the combination as measured by reduced colony forming capacity. Indeed, 2nd recipient leukaemias demonstrated sensitivity to both single agents and a synergistic response to combination (Fig. 13j). Late stage disease (i.e. 3rd recipient, mIDH2-independent leukaemias in both the presence and absence of mIDH2) demonstrated a similar pattern of responses, showing sensitivity to single agents and synergistic effect of combination treatments, indicating efficacy in both mIDH2 dependent and independent disease and consistent with the hypothesis based on the AML RNAseq data (Fig. 4c-f). Finally, to ensure that the efficacy conferred by treatment of mIDH2 AML with the ATRA/ ATO combination was not due simply to oncogenic interaction with HOXA9 and Meisla, we evaluated the ability of ATRA and ATO to effectively target mIDH AMLs derived from a number of distinct genetic contexts. In particular we analysed the clonogenic capacity of murine leukaemia cells derived from AML with mIDH2 in combination with FLT3-ITD, and mIDHI in combination with NPMc+ or with FLT3-ITD/NPMc+ (Fig. 13k). Each of the AMLs harbouring mIDH demonstrated exquisite sensitivity to the ATRA/ ATO combination as compared to AML derived from MLL-AF9 overexpression with wild type IDH alleles, as negative controls. Murine AML arising from the combination of NPMc+/FLT3-ITD alone were used as positive control as this genotype was previously shown to confer sensitivity to ATRA/ ATO. However, mIDH conferred superior sensitivity even when compared with this genetic make-up (Fig. 13k).
Example 9. ATRA and ATO combination for treatment of mIDH AML To evaluate the efficacy of this treatment in a human setting, an in vivo pre- clinical study was carried out using our U937 cell line in immunocompromised NSG host mice (Fig. 14a). 21 days after initiating treatment mice engrafted with mIDH2- overexpressing U937 treated with the ATO/ATRA combination remained alive, while all control mice had succumbed to disease (Fig. 14b). Bone marrow (BM) analysis demonstrated a significant decrease in the percentage of human leukemic blasts, and increased differentiation, in both the ATRA and ATO/ATRA treated cohorts of mice transplanted with mIDH2-overexpressing cells (Fig. 14c-14e). Importantly, only mIDH2 expressing U937 cells treated with the combination therapy demonstrated the mature myeloid CDllb marker amongst all the cohorts analysed (Fig. 14f and 14g). Reduced spleen weights were observed in mice transplanted with mIDH2-expressing U937 cells treated with ATO/ATRA, demonstrating the power of this treatment combination to impact the severity of disease (Fig. 14h).
We next treated a panel of human primary AMLs, including eleven harbouring an IDH2 mutation, 3 harbouring an IDH1 mutation, and seven AMLs, with wild type IDH, with ATO/ATRA to evaluate their potential for clinical efficacy, as measured by colony formation in methylcellulose. Importantly, only AML harbouring mIDH2 showed significantly reduced number of colonies upon treatment (Fig. 15a), and strong synergy was observed in combination treatments (Fig. 15a). Interestingly, in the case of patient #AML_2, colonies arising from single agent ATRA or ATO treatment gave primarily blast- like morphology, while the combination treatment resulted in almost complete loss of this morphology. Moreover, we treated one mIDH2 AML displaying de-novo resistance to mIDH2 inhibitor (AG- 221). Once again, this sample displayed PIN1 elevation and remarkable sensitivity to these agents.
Given the promising efficacy associated with this treatment in vitro, we next determined the impact of treatment in vivo, using GEMM and human AML PDX models. Using 3rd transplanted mIDH2 independent murine leukaemia cells, we established a pre-clinical study to evaluate the efficacy of the ATRA/ ATO combination in vivo. For each of the single treatments we observed a significant enhancement in survival of these mice, associated with reduction in bone marrow associated blast-like phenotype. Importantly, while the combination treatment also demonstrated an increased survival capacity over vehicle-treated mice, several of the mice treated with ATRA/ ATO died not as a result of frank AML, but rather succumbed to differentiation syndrome (DS) characterized by infiltration of lungs with mature myeloid cells demonstrating strong myeloperoxidase (MPO) expression, a feature also associated with APL patients treated with ATRA. To further evaluate the efficacy of this treatment combination in AML harbouring mIDH2, we carried out two human PDX trials with two independent human primary AMLs (Figs. 15b and 15d). NSG mice transplanted with human primary mIDH2 positive AML were subjected to the treatment protocol, and to minimize onset of differentiation syndrome (DS), we utilized a metronomic dosing schedule, as for APL patients’ treatment protocols. Importantly, for one PDX trial we observed a notable survival advantage for both ATO and ATRA treated mice, while combination treated mice appeared to demonstrate a durable remission (Fig. 15b), and single agent ATO and ATRA treated cohorts demonstrated a significant increase in differentiating blasts in the bone marrow as evaluated by morphology (Fig. 15c). Our second PDX trial, also demonstrated efficacy of ATO and the combination of ATRA and ATO with extensive differentiation of human blasts observed in the bone marrow at the time of euthanasia (Fig. 15e). Importantly, for both PDX trials, and in particular the second case, aggressive DS was observed (Figs. 15f and 15g), highlighting the sensitivity of mIDH AML to combination of ATRA and ATO and a potential need for caution when treating human patients.
Thus, these data indicate that mIDHI- or mIDH2 -driven leukaemias are highly responsive to the classic APL treatment protocol, and differentiation therapy may represent a unique and complementary therapeutic approach for combination with mIDH targeting agents.
Clearly, the above studies identified vulnerabilities associated with the expression of mIDH2 and the leukemia evolution of a mIDH2 independent state (Fig. 16). Further, we extended our analysis and generalized our conclusions taking advantage of a number of mIDHl/2 mouse models of various genotypes, human mIDH 1/2 cell lines, as well as primary mIDH 1/2 AMLs.
Common outputs identified in the progression of mIDH2 AML include altered redox balance with ROS accumulation, genotoxic stress, genetic mutation and translocation, MAPK/PI3K hyper-activation, and an aberrant ATRA transcriptional program (Fig. 16). Indeed, the relevance of MAPK dependence and relevance of differentiation in therapy has recently been highlighted for patients treated with Enasidenib, thereby validating the molecular underpinnings of the pre-clinical model used in the above studies. See, e.g., Amatangelo et al., Blood, 2017, 130:732-741.
It has been shown that mIDH2-dependent molecular and metabolic rewiring can drive ROS accumulation, and a dependence on PIN 1 with the prolyl isomerase acting as a critical node in mediating a differentiation block in spite of the increase ATRA sensitization triggered by mIDH. While PIN 1 is proto-oncogenic in its action triggering the activation of MAPK/PI3K signaling, it is also known to trigger ROS production through mitochondrial activation. As leukemic blasts are known to be particularly sensitive to ROS levels, this in turn creates an inherent vulnerability, which negatively impacts stem cell maintenance and facilitates exhaustion. Indeed, the above data illustrate how natural selection towards a mIDH2-independent state further exacerbates a PIN1-ATRA block and the altered cellular balance towards extreme levels of oxidation.
On this basis, we identify the classical targeted combination therapy of APL, ATRA and ATO, as a therapeutic strategy for the treatment of AML harboring mutation in mIDHl/2, independent of multiple and diverse additional genetic events. This is highlighted on the one hand by the exquisite sensitivity to this combination therapy of our multiple leukaemic models harbouring mIDH along with other established driver mutations (e.g., NPMc-i- and FLT3-ITD), and on the other hand by the fact that ATRA/ ATO are an effective combination also against mIDH AML that has drifted to independence and has accumulated additional genetic mutation and translocation events. Such an approach is of utmost relevance in view of multiple resistance mechanisms driven by a diverse mutational landscape might be at play to restore the block in differentiation, highlighting the need for additional therapeutic approaches to overcome such resistance.
In APL, the ATRA/ ATO combination selectively targets the PINl-PML-RARa oncogenic node, while in mIDH-leukemia, the ATRA/ ATO combination treatment selectively targets the oncogenic mIDH-PINl-RARa node. In addition, using a cohort of primary human AML cells that harbor either mIDHI or mIDH2, we have been able to clearly demonstrate the potential efficacy of the ATRA/ ATO combination to treat this subset of AML. Our analysis points to the ability of these oncogenes to sensitize to the effects of ATRA plus ATO. Thus, the combination of these agents with specific mIDH targeting agents may in turn potentiate and extend the efficacy of these inhibitors. Indeed, the fact that mIDH blocks myeloid differentiation and the ATRA response similarly to PML-RARa, also suggests that rare atypical APL cases lacking the usual PML/RARa translocations may actually harbor mutation in IDH enzymes. Intriguingly, in keeping with this notion, out of two atypical APL we analyzed, one displayed mutations in IDH2 enzyme. Furthermore, mutations in IDH 1/2 have been described for AMLs displaying an acute promyelocytic leukemia-like (APL-like) immunophenotype by flow cytometry, reinforcing the idea that APL and AMLs harboring mIDH2 harbor common pathways of evolution and vulnerabilities despite distinct genetic drivers.
Taken together, the above studies provide critical understanding of the mechanisms underlying mTDH-driven AML pathogenesis, and underscore the value and insights that can be gained from modeling cancer dependencies and vulnerabilities in appropriate model systems. Critically, our data point towards the development of a rationale-based therapeutic strategy for the targeted and effective treatment of leukemia. Other Embodiments
While the invention has been described in connection with specific
embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims. Other embodiments are within the claims.

Claims

CLAIMS What is claimed is:
1. A method of treating cancer in a subject having a pathogenic IDH2 allele or having elevated 2-hydroxyglutarate (2-HG) levels, said method comprising contacting the cells of said cancer with an effective amount of a pharmaceutical compound, said pharmaceutical compound being Darinaparsin, a retinoic acid compound, or a combination thereof,
wherein contacting said cells of said cancer with said pharmaceutical compound treats said cancer in said subject.
2. The method of claim 1, wherein said cancer is a leukemia.
3. The method of claim 1, wherein said cancer is a solid tumor.
4. The method of claim 3, wherein said pathogenic IDH2 allele is IDH2R140Q.
5. A method of treating cancer in a subject having a pathogenic IDH1 allele or having elevated 2-hydroxyglutarate (2-HG) levels, said method comprising contacting the cells of said cancer with an effective amount of a pharmaceutical compound, said pharmaceutical compound being Darinaparsin, a retinoic acid compound, or a combination thereof,
wherein contacting said cells of said cancer with said pharmaceutical compound treats said cancer in said subject.
6. The method of claim 5, wherein said cancer is a leukemia.
7. The method of claim 5, wherein said cancer is a solid tumor.
8. The method of claim 7, wherein said pathogenic IDH1 allele is IDH1R132C.
9. The method of claim 1 or 5, said method comprising contacting the cells of said leukemia with an effective amount of Darinaparsin.
10. The method of claim 1 or 5, said method comprising contacting the cells of said leukemia with an effective amount of a retinoic acid compound.
11. The method of claim 1 or 5, said method comprising contacting the cells of said leukemia with an effective amount of Darinaparsin and an effective amount of a retinoic acid compound.
12. The method of claim 11, wherein contacting said cells of said leukemia with said Darinaparsin and said retinoic acid compound cures said leukemia in said subject.
13. The method of claim 11, wherein said Darinaparsin and said retinoic acid compound operate synergistically to treat said leukemia.
14. The method of claim 11, wherein contacting said cells of said leukemia with said Darinaparsin and said retinoic acid compound is more effective for treating said leukemia than administering the same quantities of either said Darinaparsin or said retinoic acid compound alone.
15. The method of claim 11, wherein contacting said cells of said leukemia with said Darinaparsin and said retinoic acid compound increases the production of reactive oxygen species in one or more cells of said leukemia.
16. The method of claim 11, wherein contacting said cells of said leukemia with said Darinaparsin and said retinoic acid compound promotes differentiation of one or more cells of said leukemia.
17. The method of claim 11, wherein contacting said cells of said leukemia with said Darinaparsin and said retinoic acid decreases Pinl activity in one or more cells of said leukemia.
18. The method of claim 11, wherein said Darinaparsin and said retinoic acid compound are administered to said subject, and wherein said administration of said Darinaparsin and said retinoic acid compound occurs concurrently.
19. The method of claim 11, wherein said Darinaparsin and said retinoic acid compound are administered to said subject, and wherein said administration of said Darinaparsin and said retinoic acid compound occurs separately.
20. The method of claim 19, wherein said Darinaparsin and said retinoic acid compound are administered to said subject, and wherein said Darinaparsin is administered prior to said retinoic acid compound.
21. The method of claim 19, wherein said Darinaparsin and said retinoic acid compound are administered to said subject, and wherein said Darinaparsin is administered after said retinoic acid compound.
22. The method of claim 11, wherein said effective amount of Darinaparsin is a low dose of Darinaparsin.
23. The method of claim 22, wherein said low dose of Darinaparsin is a nontoxic dose of Darinaparsin.
24. The method of claim 22, wherein said low dose of said Darinaparsin comprises a dose of about 2.5 mg/kg body weight or less.
25. The method of claim 24, wherein said low dose of said Darinaparsin comprises a dose of between about 0.05 mg/kg body weight and about 2.5 mg/kg body weight.
26. The method of claim 24, wherein said low dose of said Darinaparsin comprises a dose of about 0.05 mg/kg body weight or less.
27. The method of claim 11, wherein said effective amount of said retinoic acid compound is a low dose of said retinoic acid compound.
28. The method of claim 27, wherein said low dose of said retinoic acid compound is a nontoxic does of said retinoic acid compound.
29. The method of claim 27, wherein said low dose of said retinoic acid compound comprises a dose of about 30 mg/m2 body surface area or less.
30. The method of claim 29, wherein said low dose of said retinoic acid compound comprises a dose of about 10 mg/m2 body surface area or less.
31. The method of claim 11, wherein said retinoic acid compound is selected from the group consisting of all-trans retinoic acid (ATRA), 13-cis-retinoic acid, retinol, retinyl acetate, retinal, and AC-55640.
32. The method of claim 31, wherein said retinoic acid compound is ATRA.
33. The method of claim 9, wherein contacting said cells of said leukemia with said Darinaparsin increases the production of reactive oxygen species in one or more cells of said leukemia.
34. The method of claim 10, wherein contacting said cells of said leukemia with said retinoic acid compound promotes differentiation of one or more cells of said leukemia.
35. The method of claim 1 or 5, wherein said subject has elevated levels of Pinl activity.
36. The method of claim 35, wherein said elevated levels of Pinl activity were previously determined by measuring the levels of a Pinl marker, wherein elevated levels of said Pinl marker is indicative of elevated Pinl activity.
37. The method of claim 36, wherein said Pinl marker is Pinl mRNA expression level, PIN1 protein expression level, or expression of a downstream effector of Pinl.
38. The method of claim 1 or 5, wherein said method further comprises contacting said cells of said leukemia with an inhibitor of Pinl.
39. The method of claim 38, wherein said subject has decreased levels of LSD1 activity.
40. The method of claim 1 or 5, wherein said method further comprises contacting said cells of said leukemia with an inhibitor of LSD1.
41. The method of claim 1 or 5, wherein said method further comprises contacting said cells of said leukemia with dexamethasone.
42. The method of claim 1 or 5, wherein said leukemia is acute myeloid leukemia.
43. The method of claim 42, wherein said acute myeloid leukemia is relapsed or refractory acute myeloid leukemia.
44. The method of claim 42, wherein said acute myeloid leukemia is resistant to treatment with an IDH1 or IDH2 inhibitor.
45. The method of claim 11, wherein one or more cells of said leukemia comprise a pathogenic IDH1 or IDH2 allele and have elevated 2-HG levels.
46. The method of claim 11, wherein one or more cells of said leukemia comprise a pathogenic IDH1 or IDH2 allele in combination with NPMc+, FLT3-ITD, or both.
47. The method of claim 46, wherein one or more cells of said leukemia comprise a pathogenic IDH1 allele in combination with NPMc+, FLT3-ITD, or both.
48. The method of claim 47, wherein said pathogenic IDH1 allele is IDH1R132C.
49. The method of claim 46, wherein one or more cells of said leukemia comprise a pathogenic IDH2 allele in combination with NPMc+, FLT3-ITD, or both.
50. The method of claim 49, wherein said pathogenic IDH2 allele is IDH2R140Q.
51. The method of claim 11, wherein said effective amount of Darinaparsin is a low dose of about 2.5 mg/kg body weight or less, said effective amount of said retinoic acid compound is a low dose of about 30 mg/m2 body surface area or less, and said retinoic acid compound is selected from the group consisting of all-trans retinoic acid (ATRA), 13-cis-retinoic acid, retinol, retinyl acetate, retinal, and AC-55640.
52. The method of claim 51, wherein said effective amount of Darinaparsin is a low dose of between about 0.05 mg/kg body weight and about 2.5 mg/kg body weight, said effective amount of said retinoic acid compound is a low dose of about 10 mg/m2 body surface area or less, and said retinoic acid compound is ATRA.
53. The method of claim 52, wherein one or more cells of said leukemia comprise a pathogenic IDH1 or IDH2 allele in combination with NPMc+, FLT3-ITD, or both, in which said pathogenic IDH1 allele is IDH1R132C and said pathogenic IDH2 allele is IDH2R14°Q.
54. A kit for treating leukemia in a subject, said kit comprising:
(a) an effective amount of Darinaparsin,
(b) an effective amount of a retinoic acid compound, and
(c) instructions for the use of said Darinaparsin in combination with said retinoic acid compound for treating said leukemia in said subject,
wherein one or more cells of said leukemia comprise a pathogenic IDH1 or IDH2 allele or have elevated 2-HG levels.
55. The kit of claim 54, wherein said kit further comprises an effective amount of a compound that inhibits Pinl activity and instructions for the use of said compound that inhibits Pinl activity in combination with said Darinaparsin and said retinoic acid compound.
56. The kit of claim 54, wherein said kit further comprises an effective amount of a compound that inhibits LSD1 activity and instructions for the use of said compound that inhibits LSD1 activity in combination with said Darinaparsin and said retinoic acid compound.
57. The kit of claim 54, wherein said kit further comprises an effective amount of a compound that inhibits Pinl activity, an effective amount of a compound that inhibits LSD1 activity, and instructions for the use of said compound that inhibits Pinl activity and said compound that inhibits LSD1 activity in combination with said Darinaparsin and said retinoic acid compound.
58. The kit of claim 54, wherein said effective amount of Darinaparsin is a low dose of Darinaparsin.
59. The kit of claim 58, wherein said low dose of Darinaparsin is a nontoxic dose of Darinaparsin.
60. The kit of claim 58, wherein said low dose of said Darinaparsin comprises a dose of about 2.5 mg/kg body weight or less.
61. The kit of claim 60, wherein said low dose of said Darinaparsin comprises a dose of between about 0.05 mg/kg body weight and about 2.5 mg/kg body weight.
62. The kit of claim 60, wherein said low dose of said Darinaparsin comprises a dose of about 0.05 mg/kg body weight or less.
63. The kit of claim 54, wherein said effective amount of said retinoic acid compound comprises a low dose of said retinoic acid compound.
64. The kit of claim 63, wherein said low dose of said retinoic acid compound is a nontoxic does of said retinoic acid compound.
65. The kit of claim 63, wherein said low dose of said retinoic acid compound comprises a dose of about 30 mg/m2 body surface area or less.
66. The kit of claim 65, wherein said low dose of said retinoic acid compound comprises a dose of about 10 mg/m2 body surface area or less.
67. The kit of claim 54, wherein said retinoic acid compound is selected from the group consisting of all-trans retinoic acid (ATRA), 13-cis-retinoic acid, retinol, retinyl acetate, retinal, and AC-55640.
68. The kit of claim 67, wherein said retinoic acid compound is ATRA.
69. The kit of any one of claims 54-68, wherein said leukemia is acute myeloid leukemia.
70. The kit of claim 69, wherein said acute myeloid leukemia is relapsed or refractory acute myeloid leukemia.
71. The kit of claim 69, wherein said acute myeloid leukemia is resistant to treatment with an IDH1 or IDH2 inhibitor.
72. The kit of claim 54, wherein one or more cells of said leukemia comprise a pathogenic IDH1 or IDH2 allele and have elevated 2-HG levels.
73. The kit of claim 54, wherein one or more cells of said leukemia comprise a pathogenic IDH1 or IDH2 allele in combination with NPMc+, FLT3-ITD, or both.
74. The kit of claim 73, wherein one or more cells of said leukemia comprise a pathogenic IDH1 allele in combination with NPMc+, FLT3-ITD, or both.
75. The kit of claim 74, wherein said pathogenic IDH1 allele is IDH1R132C.
76. The kit of claim 73, wherein one or more cells of said leukemia comprise a pathogenic IDH2 allele in combination with NPMc+, FLT3-ITD, or both.
77. The kit of claim 76, wherein said pathogenic IDH2 allele is IDH2R140Q.
78. The kit of claim 54, wherein said effective amount of Darinaparsin is a low dose of about 2.5 mg/kg body weight or less, said effective amount of said retinoic acid compound is a low dose of about 30 mg/m2 body surface area or less, and said retinoic acid compound is selected from the group consisting of all-trans retinoic acid (ATRA), 13-cis-retinoic acid, retinol, retinyl acetate, retinal, and AC-55640.
79. The kit of claim 78, wherein said effective amount of Darinaparsin is a low dose of between about 0.05 mg/kg body weight and about 2.5 mg/kg body weight, said effective amount of said retinoic acid compound is a low dose of about 10 mg/m2 body surface area or less, and said retinoic acid compound is ATRA.
80. The kit of claim 79, wherein one or more cells of said leukemia comprise a pathogenic IDH1 or IDH2 allele in combination with NPMc+, FLT3-ITD, or both, in which said pathogenic IDH1 allele is IDH1R132C and said pathogenic IDH2 allele is IDH2R14°Q.
PCT/US2019/064326 2018-12-03 2019-12-03 Darinaparsin and retinoic acid compounds for treatment of idh-associated disorders Ceased WO2020117867A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862774709P 2018-12-03 2018-12-03
US62/774,709 2018-12-03

Publications (1)

Publication Number Publication Date
WO2020117867A1 true WO2020117867A1 (en) 2020-06-11

Family

ID=70975518

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/064326 Ceased WO2020117867A1 (en) 2018-12-03 2019-12-03 Darinaparsin and retinoic acid compounds for treatment of idh-associated disorders

Country Status (1)

Country Link
WO (1) WO2020117867A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040146575A1 (en) * 1997-11-10 2004-07-29 Memorial Sloan-Kettering Cancer Center Process for producing arsenic trioxide formulations and methods for treating cancer using arsenic trioxide or melarsoprol
WO2017146794A1 (en) * 2016-02-26 2017-08-31 Celgene Corporation Idh2 inhibitors for the treatment of haematological maligancies and solid tumours

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040146575A1 (en) * 1997-11-10 2004-07-29 Memorial Sloan-Kettering Cancer Center Process for producing arsenic trioxide formulations and methods for treating cancer using arsenic trioxide or melarsoprol
WO2017146794A1 (en) * 2016-02-26 2017-08-31 Celgene Corporation Idh2 inhibitors for the treatment of haematological maligancies and solid tumours

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
KOZONO ET AL.: "Arsenic targets Pin1 and cooperates with retinoic acid to inhibit cancer-driving ' pathways and tumor-initiating cells", NAT COMMUN, vol. 9, no. 1, 9 August 2018 (2018-08-09), pages 1 - 17, XP055716637 *
MATULIS ET AL.: "Darinaparsin induces a unique cellular response and is active in an arsenic - trioxide-resistant myeloma cell line", MOL CANCER THER, vol. 8, no. 5, 1 May 2009 (2009-05-01), pages 1197 - 1206, XP055716640 *
MUGONI ET AL.: "Vulnerabilities in mlDH2 AML confer sensitivity to APL-like targeted combination therapy", CELL RES, vol. 29, no. 6, 25 April 2019 (2019-04-25), pages 446 - 459, XP036847134, DOI: 10.1038/s41422-019-0162-7 *
OGAWARA ET AL.: "IDH2 and NPM1 Mutations Cooperate to Activate Hoxa9/Meis1 and Hypoxia Pathways in Acute Myeloid Leukemia", CANCER RES, vol. 75, no. 10, 15 May 2015 (2015-05-15), pages 2005 - 2016, XP055716639 *
SCHENK ET AL.: "Inhibition of the LSD1 (KDM1A) demethylase reactivates the all-trans-retinoic . acid differentiation pathway in acute myeloid leukemia", NAT MED, vol. 18, no. 4, 11 March 2012 (2012-03-11), pages 605 - 611, XP055372818, DOI: 10.1038/nm.2661 *
WANG ET AL.: "NADPH oxidase-derived reactive oxygen species are responsible for the high susceptibility to arsenic cytotoxicity in acute promyelocytic leukemia cells", LEUK RES, vol. 32, no. 3, 4 September 2007 (2007-09-04), pages 429 - 436, XP022498997, DOI: 10.1016/j.leukres.2007.06.006 *
WARD ET AL.: "The common feature of leukemia-associated IDH1 and IDH2 mutations is a . neomorphic enzyme activity converting alpha-ketoglutarate to 2-hydroxyglutarate", CANCER CEL L, vol. 17, no. 3, 18 February 2010 (2010-02-18), pages 225 - 234, XP055007472, DOI: 10.1016/j.ccr.2010.01.020 *

Similar Documents

Publication Publication Date Title
Kim et al. Transferrin receptor‐mediated iron uptake promotes colon tumorigenesis
Hosseini et al. Metformin reduces the competitive advantage of Dnmt3a R878H HSPCs
Cong et al. Cuproptosis: molecular mechanisms, cancer prognosis, and therapeutic applications
US20250041299A1 (en) Therapeutic targeting of gastrointestinal stromal tumor (gist) by disrupting the menin-mll epigenetic complex
Lucena-Cacace et al. NAMPT as a dedifferentiation-inducer gene: NAD+ as core axis for glioma cancer stem-like cells maintenance
Patra et al. Mechanisms governing metabolic heterogeneity in breast cancer and other tumors
Wang et al. Riboflavin attenuates myocardial injury via LSD1-mediated crosstalk between phospholipid metabolism and histone methylation in mice with experimental myocardial infarction
Tabnak et al. Forkhead box transcription factors (FOXOs and FOXM1) in glioma: from molecular mechanisms to therapeutics
Wang et al. Aryl hydrocarbon receptor regulates histone deacetylase 8 expression to repress tumor suppressive activity in hepatocellular carcinoma
Zwifelhofer et al. GATA factor-regulated solute carrier ensemble reveals a nucleoside transporter-dependent differentiation mechanism
Gu et al. IL-6 derived from therapy-induced senescence facilitates the glycolytic phenotype in glioblastoma cells
Zhao et al. Poly (rC)-binding proteins as pleiotropic regulators in hematopoiesis and hematological malignancy
Buck et al. Treatment of a methylmalonyl-CoA mutase stopcodon mutation
US20220125814A1 (en) Cancer combination therapies utilizing a nicotinamide phosphoribosyltransferase inhibitor in combination with a nicotinamide adenine dinucleotide salvage pathway precursor
Pace et al. Role of prostaglandin E2 in the invasiveness, growth and protection of cancer cells in malignant pleuritis
US20180312844A1 (en) Treatment for cancer metastasis
WO2020069187A1 (en) Combination therapy for acute myeloid leukemia
Wang et al. Plumbagin Triggers Cuproptosis in Hepatocellular Carcinoma (HCC) via the DNA‐Methyltransferase 1 (DNMT1)/microRNA‐302a‐3p (miR‐302a‐3p)/ATPase Copper Transporting Beta (ATP7B) Axis
WO2020117867A1 (en) Darinaparsin and retinoic acid compounds for treatment of idh-associated disorders
WO2020117868A1 (en) Arsenic compounds and retinoic acid compounds for treatment of idh-associated disorders
Wang et al. MCPPIR promotes cardiomyocyte proliferation and cardiac repair via o8G oxidation of POC1B mRNA
WO2019109095A1 (en) Arsenic trioxide and retinoic acid compounds for treatment of idh2-associated disorders
Cheng et al. Targeting PIKfyve-driven lipid homeostasis as a metabolic vulnerability in pancreatic cancer
Jan et al. Balancing senescence and apoptosis: therapeutic insights into aging and cancer
Alshuwayer Elucidation of the role of methylarginine metabolism in regulation of nitric oxide production and inflammation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19892034

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19892034

Country of ref document: EP

Kind code of ref document: A1