WO2020116688A1 - Nc886 및/또는 pkr 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법 - Google Patents

Nc886 및/또는 pkr 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법 Download PDF

Info

Publication number
WO2020116688A1
WO2020116688A1 PCT/KR2018/015450 KR2018015450W WO2020116688A1 WO 2020116688 A1 WO2020116688 A1 WO 2020116688A1 KR 2018015450 W KR2018015450 W KR 2018015450W WO 2020116688 A1 WO2020116688 A1 WO 2020116688A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
pkr
gene
treatment
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/015450
Other languages
English (en)
French (fr)
Inventor
이용선
김인후
이연수
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Cancer Center Japan
National Cancer Center Korea
Original Assignee
National Cancer Center Japan
National Cancer Center Korea
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Cancer Center Japan, National Cancer Center Korea filed Critical National Cancer Center Japan
Priority to PCT/KR2018/015450 priority Critical patent/WO2020116688A1/ko
Publication of WO2020116688A1 publication Critical patent/WO2020116688A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/429Thiazoles condensed with heterocyclic ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52Purines, e.g. adenine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer

Definitions

  • the present invention relates to an anti-cancer adjuvant comprising nc886 and/or a PKR inhibitor, and a method for providing information on drugs for the treatment of cancer.
  • Korean Patent Publication No. 10-2014-0090500 discloses a 2-(phenylethynyl)thieno[3,4-b]pyrazine derivative and a pharmaceutical composition for preventing or treating cancer comprising the same
  • Korean Patent Publication No. 10-2017-0143457 discloses a novel imidazopyridine derivative, a method for manufacturing the same, and a pharmaceutical composition for preventing or treating cancer containing the same as an active ingredient.
  • Doxorubicin an anthracycline antibiotic-based compound
  • doxorubicin induces apoptosis as a result of genetic toxic effects such as DNA adduct formation, DNA intercalation, interference with topoisomerase II action and formation of free radicals. It was thought to be.
  • doxorubicin has been used extensively and clinically for a long time, the exact mechanism of its cytotoxicity remains controversial. Doxorubicin has different therapeutic effects depending on the treatment dose, duration of treatment, and tumor type.
  • PKR Protein Kinase R
  • PKR Protein Kinase R
  • dsRNA double-stranded RNA
  • Phosphorylated PKR is an active kinase that phosphorylates elF2 ⁇ , the most well-known substrate, thereby stopping precursor synthesis and consequently apoptosis. The above action is a PKR-mediated antiviral response to block virus-infected cells.
  • PKR is controlled by cellular and external factors that play an important role in various signal transduction pathways such as NF- ⁇ B, p53, STAT1, and protein. Since these cell pathways are important in determining cell death and cell proliferation, PKR is an important gene in cancer pathology. When there is a problem in controlling cell death due to abnormal PKR, it is not only important in tumor development itself, but also a decisive factor in the resistance of cancer cells to cancer treatment. There are many studies showing that PKR is activated during doxorubicin treatment and promotes cell death. Therefore, PKR plays an important role in cell death not only in viral infection but also in doxorubicin treatment. Given that doxorubicin induces genetic toxicity to the nucleus, the mechanism by which doxorubicin activates PKR is unknown.
  • nc886 is transcribed by RNA polymerase III (Pol III) and expressed in normal human tissue. The expression level of nc886 is generally increased in cancer cells, but in some malignant tumors, it is completely silenced by CpG DNA and methylation. The present inventors completed the present invention, confirming that nc886 is an important signal molecule that links PKR and doxorubicin in therapeutic cell suicide.
  • doxorubicin induces apoptosis by targeting only cancer cells that DNA divides by damaging DNA.
  • the present inventors studied the action of nc886 and PKR when treating doxorubicin on cells. As a result, treatment with doxorubicin inhibited Pol III transcription and thereby decreased expression of nc886, resulting in increased phosphorylation of PKR, resulting in cell death. It was confirmed that such apoptosis is another aspect of the therapeutic cell death activity of doxorubicin. Since normal cells express nc886 and PKR, they may die due to the above-described activity of doxorubicin, and therefore, the PKR inhibitor should be treated with doxorubicin to prevent the death of the normal cells.
  • doxorubicin to target nc886/PKR, cancer cells can be killed. Since nc886 is generally increased in cancer cells, it is estimated that nc886 reduction and apoptosis due to PKR activity are more likely to occur than normal cells. In this case, doxorubicin treatment at a high concentration/short-term treatment minimizes DNA damage and reduces nc886/PKR. Induced apoptosis. The advantage of this method is that it can minimize damage to normal cells (hair cells or blood cells) that divide. The above facts were confirmed and the present invention was completed.
  • Another object of the present invention is to provide a cancer treatment adjuvant of a DNA-damaging agent comprising nc886 and/or a PKR inhibitor.
  • the present invention provides the expression level of the gene of nc886 comprising the following steps; And it provides a method for providing information on drugs for cancer treatment according to the expression level of the gene of PKR or the activity level of the protein thereof.
  • Another object of the present invention is the expression level of the gene of nc886; And it provides a kit for providing information of a drug or its administration for the treatment of cancer, comprising an agent capable of measuring the expression level of the gene of PKR or the protein's activity level.
  • the present invention is a composition for alleviating or reducing side effects of a cancer therapeutic agent comprising nc886 and/or PKR inhibitors; And it can provide a method for providing information on drugs for the treatment of cancer.
  • the PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.
  • the cancer treatment agent may be a DNA-damaging agent (damaging agnet).
  • the DNA-damaged agent is an anthracycline-based drug, a platinum-based anti-cancer drug, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, streptozosin, and laying Plate or thiotepine.
  • the anthracycline-based drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.
  • the cancer is lung cancer, colorectal cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myelogenous leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, stomach cancer, liver cancer, kidney cancer, gallbladder cancer, biliary cancer, esophageal cancer, ovarian cancer or neuroblastoma.
  • the present invention can also provide a cancer treatment adjuvant of a DNA-damaging agent comprising a PKR inhibitor.
  • the PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.
  • the DNA-damaging agent is an anthracycline-based drug, a platinum-based anti-cancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, It can be streptozosin, busulfan or thiotepine.
  • the present invention provides the expression level of the gene of nc886 comprising the following steps; And it provides a method for providing information on drugs for cancer treatment according to the expression level of the gene of PKR or the activity level of the protein thereof.
  • the PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire nc886 gene consisting of the nucleotide sequence of SEQ ID NO: 1, or a partial gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.
  • the DNA-damaging agent is an anthracycline-based drug, a platinum-based anti-cancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea , Streptozosin, busulfan or thiotefil.
  • the PKR inhibitor may alleviate or reduce side effects caused by DNA-damaging agents.
  • the agent measuring the expression of the gene may be an antisense oligonucleotide, primer pair or probe.
  • the agent measuring the activity of the protein may be an antibody that specifically binds to the phosphorylation of PKR.
  • nc886 and/or PKR inhibitors when treating cancer using a DNA-inhibiting agent-based anticancer agent such as doxorubicin, nc886 and/or PKR inhibitors are administered in combination to reduce the cytotoxicity of the anticancer agent in normal cells.
  • nc886 and/or PKR by measuring the expression and/or activity of nc886 and/or PKR to provide information on drugs for cancer treatment, there is an effect that can more effectively treat cancer.
  • nc886 is a result of confirming the expression of nc886 when treating doxorubicin
  • A is H 2 O 2 (0.5 mM)
  • doxorubicin Doxo; 6 ⁇ M
  • desperioxamine Dferferoxamine
  • actinomycin D actinomycin D
  • ActD actinomycin D
  • B to E are the results of staining Northern Blot and EtBr of nc886, and the administration conditions are shown in FIG.
  • A is the result of Western blot of the protein after doxorubicin administration
  • B is the MTT result for measuring cell survival
  • C and D are Western blot result and MTT result after administration of doxorubicin after transfection with siRNA.
  • Figure 3 is a result showing the activation of PKR after doxorubicin treatment
  • A is the result of the phosphorylation activity analysis of PKR in vitro
  • B is the result of Western blot of the indicated protein
  • C is the luciferase analysis result of measuring NF- ⁇ B activity (24 hours after transfection of the luciferase-expressing plasmid, cells were pre-treated with 2-AP (2 mM) for 1 hour, and then replaced with a medium containing doxorubicin (6 ⁇ M) for 8 hours)
  • D Is the result of the luciferase assay described in panel C, except for the treatment of 2-AP.
  • Figure 4 is a result showing the role of nc886 for PKR-mediated cytotoxicity in the treatment with doxorubicin
  • A is the result of various assay methods that appear when transfected with anti-oligos (control and nc886-targeting) for 24 hours
  • B and C are Western results after experiments combining doxorubicin treatment and transfection of nc886 RNA (in vitro transcript) (12 hours (HCT116) or 6 hours (Nthy-ori 3-1 for Western blot) ), the transfection and administration were performed simultaneously before the cells were harvested),
  • D is the same experimental result as panel BC, except that the mutant nc886 was used
  • E to F are Western blots from HCT116 wt and p53 null cells and It is the result of Northern Blot.
  • Figure 5 shows the results of nc886/PKR-mediated apoptosis independent of vtRNAs or Vault complex
  • A is the result of Northern and Western blot of the same portion of each fraction after cell fractionation
  • B is the same standard Northern blot of vtRNA
  • D is Western blot after transfection of yeast tRNA ("-") and results of in vitro transcripts of vtRNA1-1 and nc886
  • E and F are the results of performing MTT analysis (Panel F) for 24 hours by transfection of siRNA for MVP for 48 hours, followed by Western blot (Panel E) or doxorubicin treatment.
  • FIG. 6 is a result showing the removal of Pol III and inhibition by doxorubicin
  • a and B are the results of Northern blot of the indicated Pol III gene
  • C is qRT-PCR of the indicated Pol III gene
  • D is aclarubicin (Acla, 6 ⁇ M), Etoposide (Etopo; 30 ⁇ M) and doxorubicin (Doxo; 6 ⁇ M) after treatment 8 hours after Northern and Western blot results
  • E is circular plasmid DNA or linear DNA expressing nc886 Is the result of confirming the expression of nc886 24 hours after transfection with Northern blot
  • F is the qPCR result of the indicated genomic region bound to POLR3A after treatment with 6 ⁇ M doxorubicin for 2 hours.
  • A is a schematic diagram of a pulse treatment experiment
  • B and C are performed as a schematic diagram on A Afterwards are Northern Blot and Western Blot results
  • D is a brief summary and schematic showing how to create a three-dimensional culture system
  • E and F are Northern and Western Blot results described in Panel C
  • G is a 791 cell line.
  • IC 50 values are shown as rank distribution in ascending order
  • H is a dot plot result of IC 50 values of parent cells (left circle) and doxorubicin endocrine (right triangle) from which 6 species were collected.
  • the present inventors studied the effect of doxorubicin, a DNA-damaging agent-based anticancer agent, on cancer cells/normal cells and the relationship between nc886/PKR.
  • doxorubicin a DNA-damaging agent-based anticancer agent
  • the expression of nc886 decreased and the activity of PKR increased to kill the cells, and the cause of this cell death was that pkr was activated through inhibition of nc886, not p53 induction (FIG. 1). To 4).
  • nc886 is classified as a paralog of vault RNA (vtRNA), one of its nicknames is vtRNA2-1, and canonical vtRNA (vtRNA1-1, 1-2 and 1-3) are giant ribos called volt complexes that are associated with drug resistance in cancer cells. It is one of the components of the nucleic acid protein complex.
  • vtRNA paralog of vault RNA
  • vtRNA1-1, 1-2 and 1-3 canonical vtRNA
  • vtRNA1-1, 1-2 and 1-3 giant ribos called volt complexes that are associated with drug resistance in cancer cells. It is one of the components of the nucleic acid protein complex.
  • the vault complex did not play a role in doxorubicin under the dosing conditions despite the inhibition of standard vtRNA by doxorubicin ( Fig. 5).
  • nc886 is transcribed by Pol III, and using this to investigate the mechanism for inhibition of nc886 by doxorubicin, it was confirmed that doxorubicin inhibits Pol III transcription (FIG. 6 ). Even when the above experiment was performed in 3D cell culture, doxorubicin inhibited nc886 and induced apoptosis, and thus it is estimated that the nc886/PKR pathway will also act on tumor cells in vivo (FIG. 7 ). As a result, as shown in FIG. 8, it was confirmed that doxorubicin inhibits Pol III transcription, thereby suppressing the expression of nc886, and increasing the activity of PKR, resulting in apoptosis (FIG. 8 ).
  • the present invention can alleviate or reduce side effects of cancer therapeutics by administering inhibitors of nc886 and/or PKR.
  • the PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.
  • the imidazolo-oxindole compound may be represented by Formula 1 below.
  • the 2-aminopurine (2-AP) may be represented by Formula 2.
  • the base sequence of nc886 consisting of the base sequence of SEQ ID NO: 1 may be 5'-AGCGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUU-3".
  • the nc896 used in the present invention is a functional equivalent of a nucleic acid molecule constituting it, for example, some nucleotide sequences of the nc886 nucleic acid molecule have been modified by deletion, substitution, or insertion, but nc886 nucleic acid It is a concept that includes variants that can function functionally the same as a molecule.
  • nucleotide sequence of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2 may be “5'-CAUGCCGGACUUUCUAUCUGUCCAUCUCUGUG-3".
  • ncRNA of the present invention may exist in single-stranded or partially double-stranded form.
  • nucleic acid molecule of the present invention may be composed of RNA, DNA, peptide nucleic acids (PNA) or locked nucleic acid (LNA).
  • the nucleic acid molecule of the present invention may be separated or prepared using standard molecular biology techniques, for example, chemical synthesis methods or recombinant methods, or commercially available ones.
  • the composition of the present invention may include not only the ncRNA nucleic acid molecule itself, but also other substances capable of increasing the expression rate of the ncRNA of the present invention in cells, for example, compounds, natural products, new proteins, and the like.
  • the cancer treatment may be a DNA-damaging agent (damaging agnet), the DNA-damaging agent (damaging agent) anthracycline-based drugs, platinum-based anti-cancer drugs, nitrogen mustard (nitrogen mustard), cyclophosphamide, melphalan (melphalan), chlorambucil, bis-chloroethylnitrosourea, streptozocin, busulfan or thiotepine.
  • a DNA-damaging agent damaging agnet
  • the DNA-damaging agent anthracycline-based drugs
  • platinum-based anti-cancer drugs platinum-based anti-cancer drugs
  • nitrogen mustard nitrogen mustard
  • cyclophosphamide melphalan
  • chlorambucil bis-chloroethylnitrosourea
  • streptozocin busulfan or thiotepine
  • the anthracycline-based drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.
  • the cancer is lung cancer, colorectal cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myelogenous leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, stomach cancer, liver cancer, kidney cancer, gallbladder cancer, biliary cancer, esophageal cancer, ovarian cancer or neuroblastoma.
  • the expression level of the nc886 gene is lower than that of the normal control sample, and the expression of the gene of PKR or the activity of its protein may be increased than that of the normal control sample.
  • the present invention can provide a cancer treatment adjuvant of a DNA-damaging agent comprising a PKR inhibitor.
  • the PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), nc886 whole gene consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.
  • the cancer treatment may be a DNA-damaging agent (damaging agnet), the DNA-damaging agent (damaging agent) anthracycline-based drugs, platinum-based anti-cancer drugs, nitrogen mustard (nitrogen mustard), cyclophosphamide, melphalan (melphalan), chlorambucil, bis-chloroethylnitrosourea, streptozocin, busulfan or thiotepine.
  • a DNA-damaging agent damaging agnet
  • the DNA-damaging agent anthracycline-based drugs
  • platinum-based anti-cancer drugs platinum-based anti-cancer drugs
  • nitrogen mustard nitrogen mustard
  • cyclophosphamide melphalan
  • chlorambucil bis-chloroethylnitrosourea
  • streptozocin busulfan or thiotepine
  • the anthracycline-based drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.
  • the present invention also includes the following steps, the expression level of the gene of nc886; And it can provide a method for providing information on drugs for the treatment of cancer according to the expression level of the gene of PKR or the activity level of its protein:
  • the pathologically determined to be cancer may be cancer classified from stage 1 to stage 4 according to a tumor or node metasis (TNM) system.
  • TNM tumor or node metasis
  • the biological sample includes, but is not limited to, a sample such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.
  • the PKR inhibitor may be an imidazolo-oxindole compound, 2-aminopurine (2-AP), the entire gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 1, or some gene of nc886 consisting of the nucleotide sequence of SEQ ID NO: 2.
  • the DNA-damaging agent is an anthracycline-based drug, a platinum-based anticancer drug, a nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, It can be streptozosin, busulfan or thiotepine.
  • the anthracycline-based drug may be daunorubicin, doxorubicin, epirubicin, idarubicin, or mitoxantrone.
  • the continuous administration may be to continuously administer the DNA-damaging agent at a concentration of 1 to 50 micromolar, preferably at a concentration of 1 to 25 micromolar, and more preferably at a concentration of 6 micromolar.
  • RNA of the gene in cancer tissue cells refers to a process of confirming the presence and expression level of RNA of the gene in cancer tissue cells to confirm the type of cancer, and is made by measuring the amount of mRNA.
  • RT-PCR reverse transcriptase reaction
  • Competitive RT-PCR competitive reverse transcriptase reaction
  • Realtime RT-PCR real-time reverse transcriptase reaction
  • RNase protection assay RNase protection assay
  • Northern blotting DNA chip, etc.
  • the agent for measuring the level of a gene in the present invention is preferably an antisense oligonucleotide, primer pair or probe.
  • antisense is an oligomer consisting of nucleotides in which an antisense oligomer is hybridized with a target sequence in RNA by Watson-Crick base pairing, allowing formation of mRNA and RNA:oligomeric heterodimers within the target sequence, typically.
  • Oligomers can have accurate sequence complementarity or approximate complementarity to the target sequence. This antisense oligomer can block or inhibit the translation of mRNA and alter the processing of mRNA to produce splice variants of mRNA.
  • measurement of protein expression level and activity thereof is a process of confirming the presence and expression level of a protein expressed from the gene of the present invention in a cancer tissue cell to confirm the progression of liver cancer. It is made by measuring. For this, Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis , Tissue immunostaining, immunoprecipitation assay, complement fixation assay, flow cytometry (FACS), protein chip, etc., but are not limited thereto.
  • the agent for measuring the protein expression level is preferably an antibody.
  • the PKR inhibitor may alleviate or reduce side effects caused by DNA-damaging agents in normal cells.
  • Doxorubicin is originally a DNA-damaging agent, and thus it is known to kill only dividing cancer cells, but according to the present invention, it is possible to explain why undesired side effects occur in which normal cells die by the nc886/PKR pathway. .
  • the present invention provides the expression level of the gene of nc886 comprising the following steps; And it can provide a method for providing information of drugs for cancer treatment according to the expression level of the gene of PKR or the activity level of its protein.
  • the short period may be, for example, 1 minute to 24 hours, preferably 10 minutes to 12 hours, more preferably 10 minutes to 2 hours, particularly preferably 20 minutes to 40 minutes, and most preferably It can be 30 minutes.
  • the cancer is lung cancer, colorectal cancer, colon cancer, rectal cancer, breast cancer, prostate cancer, bladder cancer, blood cancer, leukemia, myelogenous leukemia, lymphoma, cervical carcinoma, osteosarcoma, glioblastoma, melanoma ( melanoma), pancreatic cancer, stomach cancer, liver cancer, kidney cancer, gallbladder cancer, biliary cancer, esophageal cancer, ovarian cancer or neuroblastoma.
  • doxorubicin When targeting nc886/PKR, treatment with high concentrations of doxorubicin in a short period of time can minimize DNA damage, thus minimizing the genotoxic effects of proliferating normal cells such as hematopoietic cells, hair follicle cells and intestinal epithelial cells. It may be sufficient to induce cell death.
  • the DNA-damaging agent is a platinum-based anti-cancer drug, nitrogen mustard, cyclophosphamide, melphalan, chlorambucil, bis-chloroethylnitrosourea, streptozosin, busulfan , Doxorubicin or thiotepine.
  • the present invention also provides the expression level of the gene of nc886; And an agent capable of measuring the expression level of the gene of PKR or the activity level of the protein thereof.
  • the drug information is information on a method of administering a DNA damage agent and a PKR inhibitor in combination.
  • the information on the administration of the drug refers to the frequency of administration, the concentration of administration, etc., where the expression of the nc886 gene is lower than the normal control sample, and the expression of the gene of PKR or the activity of its protein is increased than the normal control sample, in general It is lower than the dose concentration of doxorubicin, and it is said to increase the frequency and duration of administration.
  • the agent measuring the expression of the gene may be an antisense oligonucleotide, primer pair or probe.
  • the agent measuring the activity of the protein may be an agent that specifically binds to the phosphorylation of PKR.
  • Example 1 Cell lines, antibodies and other reagents
  • nc886 was a PCR amplified 649nt PCR fragment containing 101 nt nc886 transcript and flanking sequences [271nt and 277nt on the 5'and 3'sides, respectively]. This fragment was inserted into the pCR4-TOPO vector (Invitrogen, Carlsbad, CA). The resulting plasmid and PCR fragments were used in the transfection experiment of Figure 6E. In NF- ⁇ B luciferase analysis using pNF- ⁇ B-Luc (Stratagene, La Jolla, CA), pRL-SV40 was infected together for standardization.
  • siRNA for PKR and MVP Stealth RNAiTMsiRNA (Invitrogen), target sequences of nt 343-367, 1054-1078 and 1228-1252 of PKR and nt 1067-1091 and 1908-1932 of MVP were used. These siRNAs targeting different regions of the gene were equally mixed and transfected at a concentration of 40 nM.
  • Anti-oligos against nc886 and standard vtRNA (vtRNA1-1, 1-2, 1-3) used DNA-RNA mixmers with modified sugars (2') and phosphorothioate backbones , Target sequences thereof are 5'-aucucugugcugggguucga-3' (nt 56-75 corresponding to nc886) and 5'-ggcuggcuuuagcucagcgg-3' (corresponding nt 2-21 vtRNA). These anti-oligos were transfected with 200 nM.
  • Subcelluar fractionation was performed as described in Kickhoefer VA et al., J Biol Chem 273: 8971-8974 (1998) and Lee K et al., RNA 17: 1076-1089 (2011).
  • the harvested cells ( ⁇ 5*10 7 ) were added to 1.2 ml of buffer A (50 mM Tris-Cl (pH 7.4), 1.5 mM MgCl 2 , 75 mM NaCl, 0.5% Nonidet P-40) containing 1 mM PMSF (phenylmethylsulfonyl fluoride).
  • buffer A 50 mM Tris-Cl (pH 7.4), 1.5 mM MgCl 2 , 75 mM NaCl, 0.5% Nonidet P-40
  • PMSF phenylmethylsulfonyl fluoride
  • the supernatant was bulk cytoplasmic and fractionated by centrifugation at 100,000 ⁇ for 1 hour to separate the resulting supernatant (labeled “S100”) from the pellet (labeled “P100”).
  • the P10 and P100 fractions were resuspended with RIzol buffer for subsequent RNA preparation or Western blotting with Trizol reagent. The same amount of isopropanol was added to concentrate the S100 fraction, followed by centrifugation (at a rate of 12 krpm for 10 minutes). RNA was extracted from the obtained pellet with Trizol reagent. An aliquot of the S100 fraction was loaded directly for Western blotting.
  • ChIP analysis was performed as described previously [Park K et al., J Leukoc Biol 91: 245-257 (2012)]. Briefly, cells were crosslinked with 1% formaldehyde and expansion buffer [5 mM PIPES (pH 8.0), 85 mM KCl, 0.5% Nonidet P-40] and buffer A [10 mM Tris-HCl, 2 mM EDTA, 0.2 % Sonic dodecyl sulfate was used for sonication using Bioruptor.
  • Chromatin samples were diluted with Buffer B [10 mM Tris-HCl (pH 8.0), 2% Triton X-100, 280 mM NaCl, 0.2% deoxycholate] and immunoprecipitated with antibodies against POLR3A. Chromatin-antibody complex was removed with ProteinA/G Dynabeads. After treating with proteinase K and reversing crosslinking, the amount of immunoprecipitated DNA was measured by real-time PCR. Chip primers are shown in Table 2 below.
  • the BiO AssayTM kit from n3D Biosciences was treated according to the manufacturer's instructions. Briefly, monolayer cultured 3.3 x 10 6 cells were treated with NanoShuttleTM-PL for 200 hours for 16 hours, followed by trypsin treatment, followed by magnetic injury in 6-well for 24 hours. Suspended cells were suspended in 2 ml of culture (per 6-well), resuspended by pipetting, bioprinted in 96-wells (2.0 x 10 5 cells per 96-well), and ring-driven for 30 minutes. Then, doxorubicin was treated. A schematic diagram of the 3-D cell culture is disclosed in FIG. 7D.
  • HBE135-E6E7 partially modified lung epithelial cell line
  • HCT116 colon cancer cell line
  • H 2 O 2 oxidative stress inducer
  • desperioxamine hypooxia-like compound
  • doxorubicin doxorubicin
  • doxorubicin was required at a high concentration (at least 3 ⁇ M or more) to reduce nc886 (FIG. 1B ). It should be noted that this concentration is similar to the clinically relevant concentration.
  • the maximum plasma concentration ranged from 5 to 25 ⁇ M after bolus injection of doxorubicin into the patient.
  • nc886 was noticeably reduced after 2 hours treatment and barely observed after 4-8 hours (FIG. 1C ). After the expression of nc886 disappeared at 8 hours, it was observed that even after replacing the medium containing doxorubicin with fresh medium, nc886 expression did not recover after 36 hours (FIG. 1C ).
  • the time-lapse data show that doxorubicin blocks nc886 transcription almost immediately after treatment, given that the half-life of nc886 is 1-2 hours.
  • Example 8 PKR contributes to doxorubicin-induced cell death.
  • PKR pathway has been found to induce the PKR pathway and ultimately apoptosis.
  • the experimental evidence for the contribution of PKR to the apoptosis pathway was based mainly on experiments inducing knockdown (KD) using small interfering (or hairpin) RNA (siRNA or shRNA).
  • KD knockdown
  • shRNA small interfering RNA
  • This role of PKR was supported by experiments on PKR KO cells generated from original Nthy-ori 3-1 cells (PKR wt) by CRISPR-Cas technology (Western blot of PKR in FIG. 2A).
  • Doxorubicin treatment induces proteins related to cell suicide such as caspase-3 and cleaved poly (ADP-ribose) polymerase (PARP) in PKR wt cells, Expression of this protein was significantly attenuated in PKR KO cells (FIG. 2A ). Similar induction of p53 and Chk2 (represented in its phosphate form in FIG. 2A) in PKR wt and KO cells, doxorubicin was equally effective in these two cell lines. The cell death data showed that it may not be due to the difference in the damage response of the DNA. In addition, when the amount of doxorubicin was treated with an appropriate amount, MTT assays were performed to measure cell survival (FIG. 2B ).
  • PARP cleaved poly (ADP-ribose) polymerase
  • PKR automatic phosphorylation characteristic of PKR activation, was measured by in vitro kinase analysis.
  • PKR immunoprecipitation (IP) active PKR molecules were radiolabeled and digested on SDS-polyacrylamide gels ( Figure 3A).
  • the asterisk band is PKR because it moves to the correct position and is not detected in PKR KO Nthy-ori 3-1 cells (two lanes on the right in FIG. 3A).
  • PKR was phosphorylated in HCT116 and Nthy-ori 3-1 (PKR wt) cells compared to doxorubicin treatment.
  • PKR activation was confirmed by phosphorylation of eIF2 ⁇ ( Figure 3B) and activation of the NF- ⁇ B pathway (( Figure 3C-D)) as assessed in the Lucifer raise reporter assay using the NF- ⁇ B reactive promoter.
  • EIF2 ⁇ phosphorylation and activation of the NF- ⁇ B pathway are the downstream pathways of PKR Induction of NF- ⁇ B by doxorubicin treatment was nullified by the PKR inhibitor 2-aminopurine (2-AP) (Fig. 3C) PKR KO It was thought to be due to PKR activation because it was hardly seen in Nthy-ori 3-1 cells (FIG. 3D) Doxorubicin activates PKR and its downstream pathway as shown in the above data.
  • Example 10 Doxorubicin activates PKR through nc886 inhibition rather than through p53 induction
  • nc886 expression was inhibited upon doxorubicin treatment. Since nc886 is a PKR inhibitor, it was assumed that nc886 inhibition is the basic mechanism of doxorubicin-mediated PKR activation.
  • nc886 KD experiment was performed using modified antisense oligonucleotides (anti-oligo) to confirm that the deficiency of nc886 induces the same cellular response as doxorubicin treatment.
  • nc886 targeting anti-oligo inhibits nc886 compared to anti-control (Northern blot; top panel in FIG.
  • nc886 KD was sufficient to induce cell death in PKR wt cells and inhibit cell proliferation (bottom panel in FIG. 4A). This phenotype of nc886 KD occurred through PKR activation because it did not occur in PKR KO cells (compare lanes 2 and 4 in the left panel of Figure 4A). Similar results were confirmed in HCT116 (right panel in Figure 4A). nc886 KD showed the same effect as doxorubicin treatment in PKR activation and thus induction of cell death. Doxorubicin elicits a multifaceted expression effect.
  • nc886 The contribution of nc886 was fractionated and it was investigated whether doxorubicin-mediated cytotoxicity was mitigated by ectopic expression of nc886.
  • nc886 expression was induced by the gene promoter element, so expression from exogenous DNA was also inhibited by doxorubicin (FIG. 6E ). Therefore, the strategy for nc886 expression in the presence of doxorubicin was to deliver it in a form of in vitro transcript.
  • nc886 transcript was transfected with HCT116 and Nthy-ori 3-1 (PKR wt) cells, but not in Nthy-ori 3-1 (PKR KO) cells ( Figure 4B-C).
  • PSR wt HCT116 and Nthy-ori 3-1
  • PRR KO Nthy-ori 3-1
  • p53 wt and null HCT116 cells (p53 +/+ and p53 ⁇ / ⁇ in the same cell line pair disclosed in a previous report [Yoon CH et al., Proc Natl Acad Sci USA 106: 7852-7857 (2009)] of FIG. p53 western blot).
  • These two cell lines showed expression levels similar to nc886, which were inhibited by doxorubicin in the almost same time course (Fig. 4F).
  • PKR was activated as indicated by eIF2 ⁇ phosphorylation, leading to cell suicide ( Figure 4E). This event occurred to a similar extent in both cell lines.
  • Example 11 The vault complex does not play a role in doxorubicin sensitivity.
  • nc886 is classified as a paralog of vault RNA (vtRNA) and one of its nicknames is vtRNA2-1.
  • Canonical vtRNA vtRNA1-1, 1-2 and 1-3
  • the vault complex is a component of the giant ribonucleic acid protein complex called the vault complex, which is associated with drug resistance in cancer cells. Therefore, the role of the vault complex in the possible relationship between doxorubicin sensitivity and the nc886/PKR pathway was investigated.
  • Subcellular fractionation separated the nuclear fraction (“P10” in FIG. 5A) and soluble cytoplasmic fraction (“S100”) from insoluble cytoplasmic pellets (“P100”) containing large complexes such as ribosomes and vault particles.
  • vtRNA1-1 The major component of the Bolt Vault Protein (MVP) was only in the P100 ( Figure 5A).
  • vtRNA1-1 not nc886, was found in P100.
  • nc886 was exclusively present in S100 of HBE135-E6E7 cells, and in the case of HeLa cells, little was detected due to RNA degradation during fractionation (see EtBr staining in FIG. 5A).
  • vtRNA1-1 was detected in P100. Probably because it was stably assembled in the Vault Complex and protected from RNA degradation. According to the above data, nc886 was consistent with the previous report, and was not physically related to the bolt complex.
  • nc886 is transcribed by Pol III.
  • Previous studies have concluded that when doxorubicin inhibits the transcription of Pol III when introduced into an in vitro transcription assay. However, this observation has not been pursued in any further studies so far, and thus its biological significance has not been revealed. So, doxorubicin was treated, and Pol nc transcribed ncRNA (labeled "Pol III gene") was measured in addition to nc886. Steady state 5S rRNA and tRNA were not affected by doxorubicin (FIG. 6A ), probably because they are very rich and stable RNA.
  • Precursor-tRNAs are considered the most sensitive indicators of assessing Pol III transcription rates. This is because the intermediates are processed and the half-life is very short. The expression levels of the two pre-tRNAs decreased almost completely within 1 hour (purple line in FIG. 6C). All of these data strongly suggested that the worldwide Pol III warriors were discontinued immediately after doxorubicin treatment.
  • PolII transcribed ncRNA of essential cellular function did not decrease within hours of doxorubicin treatment, and therefore could not account for the acute cytotoxic effects observed in the study. Then, I was wondering how doxorubicin inhibits Pol III gene expression extensively.
  • Doxorubicin imposes stress on the DNA/chromatin in several ways. It intercalates to DNA to create topological tension.
  • Another well-known effect of doxorubicin is topoisomerase II (topo II) poisoning. Captures topo II in double stranded cleavage and prevents linkage. The cellular results of this effect are DNA stand breakage, histone removal from chromatin, DNA damage response and cell death.
  • Aclarubicin is a DNA intercalator.
  • doxorubicin it is not a topo II toxic substance. Therefore, when DNA breakage occurs, it cannot be attributed to the topo II poisoning mechanism.
  • Controversy has been raised as to whether Aclarubicin causes DNA destruction because contradictory data have been obtained in several studies.
  • the non-anthracycline compound, etoposide does not intercalate with DNA and acts as topo II toxicity. The properties of these three drugs are summarized in Figure 6D.
  • tracycline drugs including doxorubicin and aclarubicin
  • Pol III e.g. renal polymerization
  • circular plasmid DNA and linear DNA for nc886 expression were compared. When topological tension is the cause, circular DNA is more affected than linear DNA. Transcription of nc886 from two DNA templates was similarly inhibited by doxorubicin ( Figure 6E), suggesting that topological interference is an unlikely mechanism.
  • Another result of intercalation of an anthracycline drug to DNA is the dissociation of the DNA binding protein.
  • doxorubicin and aclarubicin are known to expel histones from DNA, and etoposide is not. Therefore, it was speculated that these two drugs would remove Pol III as in the case of histones.
  • ChoIP chromatin immunoprecipitation
  • Pol III did not bind to the position of the GAPDH gene, which is the Pol II gene, but was bound to the positions of nc886 and vtRNA1-1, which are the Pol III genes. And this binding was reduced by doxorubicin ( Figure 6F).
  • Example 13 Optimization of doxorubicin treatment for the nc886/PKR pathway and application in a three-dimensional (3-D) cell culture system
  • the DNA damage response measured by phospho-Chk2 was not so significantly induced until 30 min, but slightly induced at 60 min in PKR wt cells (lanes 1 to 3 for lane 7 and lane 4 for FIG. 7C).
  • PKR KO cells phospho-Chk2 was observed and cell suicide was induced at night at 30 and 60 minutes (lanes 7-8 in FIG. 7C). It was not known why the DNA damage response was more proficient in PKR KO than PKR wt cells. Nevertheless, in the presence of PKR, the nc886/PKR pathway was dominant in inducing cell death, but the effect of the DNA damage response was minimal in 30 min pulse treatment.
  • Doxorubicin inhibits nc886 in continuous and pulsed treatment of 3D cultures (lanes 1 and 3-4, respectively, in Figures 7E-F) and induces cell death, indicating that the nc886/PKR pathway works in 3-D cultured cells. Suggests, and may also be possible in tumor cells in vivo.
  • Example 14 Treatment with doxorubicin at a concentration of ⁇ M is widely applicable to a subset of cells, particularly tumor cells except silent nc886.
  • doxorubicin 6 ⁇ M doxorubicin is expected to be effective in most cancer cells based on available data.
  • Doxorubicin was searched in the cancer drug database (http://www.cancerrxgene.org/) and IC 50 values of the 931 cell line were downloaded.
  • CpG methylation data was obtained from the 957 cell line in a published study. The comparison of the two data sets showed IC 50 values and methylation values in 791 cell lines.
  • IC 50 values were sorted in ascending order (FIG. 7G )
  • Even slightly lowering the IC 50 cutoff (1.5 ⁇ M) only 83 cells (10.5%) met the criteria.
  • nc886/PKR The doxorubicin concentration effective for apoptosis by nc886/PKR was around 6 ⁇ M, and a small number of doxorubicin resistant cell lines with IC 50 values higher than this concentration (eg, 83 cell lines in FIG. 7G) exist.
  • nc886 and PKR are mostly expressed in normal human tissue, previous studies have shown that the nc886/PKR pathway does not work in all tumors.
  • the characteristic of nc886 is the silence by CpG DNA and methylation in some malignant cells. This feature is interesting and unique among Pol III genes. Theoretically and based on the above data, this silence would have caused cell death as PKR was activated.
  • nc886-silenced in vitro and nc886-silenced tumor cells have been developed.
  • this cell death would have occurred to ensure elimination of precancerous cells that would have contributed to a reduction in cancer incidence.
  • certain cells acquire a genetic/epigenetic modification, for example, overexpression of eIF2B, which neutralizes the apoptotic effect of phospho-eIF2 ⁇ , may bypass the PKR cell death pathway. Only those cells were able to survive nc886 silencing and developed into clinically detectable and in vitro detachable malignant cells.
  • nc886 has a CpG island (-189 to +82, the 5'end of the nc886 copy is a +1 reference point), and 10CpG sites in or near this island were analyzed. The average of 10 sites was calculated and >90% was considered hypermethylation. In this analysis (pie chart in FIG.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Wood Science & Technology (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 nc886 및/또는 PKR 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법에 관한 것이다.

Description

NC886 및/또는 PKR 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법
본 발명은 nc886 및/또는 PKR 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법에 관한 것이다.
암은 혈액 암과 고형 암으로 크게 분류되며, 폐암, 위암, 유방암, 구강암, 간암, 자궁암, 식도암, 피부암 등 신체의 거의 모든 부위에서 발생하며, 이들의 치료방법으로 최근 글리벡 또는 허셉틴과 같은 소수의 표적치료제가 특정 암의 치료에 이용되고 있으나 현재까지는 수술이나 방사선 요법 및 세포증식을 억제하는 화학 요법제를 이용한 항암제 치료가 주된 방법이다. 예를 들어 한국공개특허번호 10-2014-0090500호에는 2-(페닐에티닐)티에노[3,4-b]피라진 유도체 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물이 개시되어 있고, 한국공개특허번호 10-2017-0143457호에는 신규한 이미다조피리딘 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물이 개시되어 있다.
세포 독성 약물을 사용하는 화학 요법은 전통적으로 암 환자에게 중요한 치료 방법으로 사용해 왔다. 안트라시클린 항생제 계열의 화합물인 독소루비신은 가장 효과적인 항암제 중 하나이며, 거의 반세기 동안 다양한 종류의 악성 종양을 치료하기 위해 첫 번째로 선택되었다. 일반적으로 독소루비신은 DNA 부가물 형성 (DNA adduct formation), DNA 인터카레이션 (DNA intercalation), 토포아이소머라아제 II 작용에 대한 간섭 및 자유 라디칼의 형성과 같은 유전 독성 효과의 결과로 세포사멸을 유도하는 것으로 생각 되었다. 독소루비신은 광범위하고 오랫동안 임상적으로 사용되었음에도 불구하고 그 세포 독성을 나타내는 정확한 기전은 여전히 논란의 여지가 있다. 독소루비신은 치료용량, 치료 기간 및 종양 유형에 따라 치료효과가 달라진다.
PKR (Protein Kinase R)은 인터페론-유도성 세린/트레오닌 키나아제이다. PKR은 대부분의 포유류 세포에 잠복 상태로 존재하며 바이러스 게놈 자체이거나 바이러스 복제 및 전사 중에 생성되는 이중가닥 RNA (dsRNA)에 의해 활성화 된다. PKR이 dsRNA에 결합하면, PKR은 이합체화 및 인산화 된다. 인산화된 PKR은 가장 잘 알려진 기질인 elF2α를 인산화시키는 활성 키나아제이며, 이로 인해 전구체 합성이 중단되고 결과적으로 세포사멸이 일어난다. 상기의 작용은 바이러스 감염세포를 막기 위한 PKR 매개 항바이러스 반응이다. 그러나 PKR 경로는 위의 설명보다 훨씬 복잡하다. PKR은 dsRNA외에도 NF-κB, p53, STAT1, 단백질 등 다양한 신호 전달 경로에서 중요한 역할을 하는 세포 및 외부 요인에 의해 제어된다. 이러한 세포 경로는 세포의 사멸 및 세포의 증식을 결정하는데 중요하기 때문에, 암 병리학에서 PKR은 중요한 유전자이다. 비정상적인 PKR에 의해 세포 사멸의 조절에 문제가 있는 경우는 종양 발달 자체에서 중요할 뿐 아니라 암 치료제에 대한 암세포의 내성에도 결정적인 요소이다. PKR이 독소루비신 치료 시 활성화 되고 세포 사멸을 촉진한다는 많은 연구가 있다. 따라서 PKR은 바이러스 감염뿐만 아니라 독소루비신 처리에서도 세포사멸에 중요한 역할을 한다. 독소루비신이 핵에 유전 독성력을 유도한다는 점을 감안할 때, 독소루비신이 PKR을 어떻게 활성화 시키는지에 대한 메커니즘은 밝혀져 있지 않다.
본 발명자들은 PKR에 결합하여 PKR의 활성을 억제하는 non-coding RNA를 확인하였다. nc886은 RNA 중합효소 III (Pol III)에 의해 전사되고 정상적인 인간 조직에서 발현된다. nc886의 발현 수준은 일반적으로 암세포에서 증가하지만 일부 악성 종양에서는 CpG DNA과 메틸화에 의해 완전히 침묵하기도 한다. 본 발명자들은 치료적 세포 자살에 있어서 nc886이 PKR 및 독소루비신을 연결하는 중요한 신호 분자라는 사실을 확인하면서, 본 발명을 완성하였다.
기본적으로 독소루비신은 DNA에 손상을 입힘으로써, DNA가 분열하는 암세포만을 표적하여 세포사멸을 유도한다고 알려져 있었다. 본 발명자들은 독소루비신을 세포에 처리할 경우, nc886 및 PKR의 작용을 연구한 결과, 독소루비신을 처리하면 Pol III 전사를 억제하고 이로 인해 nc886의 발현이 감소하게 되어, PKR의 인산화가 증가하여 세포가 사멸하며 이러한 세포사멸이 독소루비신의 치료적 세포 사멸 활성의 또 다른 측면임을 확인하였다. 정상세포의 경우 nc886과 PKR을 발현하므로, 독소루비신의 위와 같은 활성으로 인하여 사멸할 수 있으므로, 상기 정상 세포의 사멸을 예방하기 위해 PKR 저해제를 독소루비신과 같이 처리해야한다.
혹은 독소루비신이 nc886/PKR을 표적함을 응용하여, 암세포를 사멸시킬수도 있다. 일반적으로 암세포에서는 nc886이 증가되어 있으므로, nc886감소 및 PKR 활성에 따른 세포사멸이 정상세포보다는 더 잘 일어나리라 추정되며, 이 경우에는 독소루비신을 고농도/단기간 처리하면 DNA 손상을 최소화 하면서, nc886/PKR에 의한 세포사멸을 유도할 수 있다. 이 방법의 장점은 분열하는 정상세포 (모발세포나 혈액세포)에 대한 손상을 최소화 할 수 있다는 것에 있다. 위와 같은 사실을 확인하고 본 발명을 완성하였다.
본 발명의 목적은 nc886 및/또는 PKR 저해제를 포함하는 암 치료제의 부작용의 완화 또는 감소용 조성물을 제공하는 것이다.
본 발명은 다른 목적은 nc886 및/또는 PKR 저해제를 포함하는 DNA-손상 제제(damaging agent)의 암 치료 보조제를 제공하는 것이다.
본 발명은 하기의 단계를 포함하는 nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준에 따른 암 치료를 위한 약물의 정보 제공 방법을 제공하는 것이다.
(a) 병리학적으로 암으로 판단된 암 환자로부터 분리된 생물학적 시료로부터 nc886의 유전자 또는 이의 단백질 발현 수준; 및 PKR의 유전자 발현 수준 또는 이의 단백질의 활성 수준을 측정하는 단계; 및
(b) 상기 측정된 nc886 유전자의 발현 수준이 정상 대조군 시료보다 낮으며, PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준이 정상 대조군 시료보다 높은 경우 상기 암 환자에게 DNA-손상 제제(damaging agent) 및 PKR 저해제를 투여하도록 하는, 약물 선택 정보를 제공하는 단계.
본 발명의 다른 목적은 nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준을 측정할 수 있는 제제를 포함하는 암 치료를 위한 약물 또는 이의 투여의 정보를 제공하기 위한 키트를 제공하는 것이다.
본 발명은 nc886 및/또는 PKR 저해제를 포함하는 암 치료제의 부작용을 완화 또는 감소용 조성물; 및 암 치료를 위한 약물의 정보 제공 방법을 제공 할 수 있다.
상기 PKR 저해제는 imidazolo-oxindole compound, 2-aminopurine (2-AP), 서열번호 1의 염기서열로 이루어진 nc886 전체 유전자 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자일 수 있다.
상기 암 치료제는 DNA-손상 제제(damaging agnet)일 수 있다.
상기 DNA-손상 제제는 안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파인일 수 있다.
상기 안트라사이클린계 약물은 다우노루비신, 독소루비신, 에피루비신, 이다루비신 또는 미톡산트론일 수 있다.
상기 암은 폐암, 대장암, 결장암, 직장암, 유방암, 전립선암, 방광암, 혈액암, 백혈병, 골수성 백혈병, 림프종, 자궁경부암(cervical carcinoma), 골육종(osteosarcoma), 교아종(glioblastoma), 흑색종(melanoma), 췌장암, 위암, 간암, 신장암, 담낭암, 담도암, 식도암, 난소암 또는 신경아세포종(neuroblastoma)일 수 있다.
본 발명은 또한 PKR 저해제를 포함하는 DNA-손상 제제(damaging agent)의 암 치료 보조제를 제공할 수 있다.
상기 PKR 저해제는 imidazolo-oxindole compound, 2-aminopurine (2-AP), 서열번호 1의 염기서열로 이루어진 nc886의 전체 유전자 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자 일 수 있다.
상기 DNA-손상 제제(damaging agent)는 안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파인일 수 있다.
본 발명은 하기의 단계를 포함하는 nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준에 따른 암 치료를 위한 약물의 정보 제공 방법을 제공하는 것이다.
(a) 병리학적으로 암으로 판단된 암 환자로부터 분리된 생물학적 시료로부터 nc886의 유전자 또는 이의 단백질 발현 수준; 및 PKR의 유전자 발현 수준 또는 이의 단백질의 활성 수준을 측정하는 단계; 및
(b) 상기 측정된 nc886 유전자의 발현 수준이 정상 대조군 시료보다 낮으며, PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준이 정상 대조군 시료보다 높은 경우 상기 암 환자에게 DNA-손상 제제(damaging agent) 및 PKR 저해제를 투여하도록 하는, 약물 선택 정보를 제공하는 단계.
상기 PKR 저해제는 imidazolo-oxindole compound, 2-aminopurine (2-AP), 서열번호 1의 염기서열로 이루어진 nc886 유전자 전체 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자일 수 있다.
상기 상기 DNA-손상 제제(damaging agent)는 안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파일 수 있다.
상기 PKR 저해제는 DNA-손상 제제(damaging agent)에 의한 부작용을 완화 또는 감소시킬 수 있다.
nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준을 측정할 수 있는 제제를 포함하는 암 치료를 위한 약물 또는 이의 투여 정보 제공용 키트를 제공할 수 있다.
상기 유전자의 발현을 측정하는 제제는 안티센스 올리고뉴클레오티드, 프라이머 쌍 또는 프로브일 수 있다.
상기 단백질의 활성을 측정하는 제제는 PKR의 인산화에 특이적으로 결합하는 항체일 수 있다.
본 발명은, 독소루비신 등 DNA-저해제 계열의 항암제를 이용한 암 치료 시, nc886 및/또는 PKR의 저해제를 병용 투여하여 일반세포에서 항암제의 세포독성을 완화할 수 있는 효과가 있다. 또한, nc886 및/또는 PKR의 발현 및/또는 활성을 측정하여 암 치료를 위한 약물의 정보를 제공하여, 보다 효과적으로 암을 치료할 수 있는 효과가 있다.
도 1은 독소루비신 치료시 nc886의 발현을 확인한 결과로서, A는 H2O2 (0.5 mM), 독소루비신 (Doxo; 6 μM), 데스페리옥사민 (desferrioxamine) (DFX; 100 μM) 및 악티노마이신D (actinomycin D) (ActD; 2 μg / ml)를 세포 주에 8시간 처리한 후의 노던 블랏 (Northern blot) 방법으로 nc886의 발현을 확인한 결과이고 (레인 1과 6은 처리하지 않은 군 ("_" 으로 표시), B 내지 E는 nc886의 노던 블랏 및 EtBr 염색한 결과로서, 투여 조건은 도에 표시되어 있다.
도 2는 PKR의 존재 또는 부재 하에 독소루비신의 세포 독성 효과를 나타낸 결과로서, A는 독소루비신 투여 후 나타난 단백질의 웨스턴 블랏의 결과이고, B는 세포의 생존을 측정하기 위한 MTT 결과이며, C 및 D는 siRNA로 형질 감염시킨 후의 독소루비신을 투여한 후의 웨스턴 블랏 결과 및 MTT 결과이다.
도 3은 독소루비신 처리 후 PKR의 활성화를 나타낸 결과로서, A는 시험관 내 PKR의 인산화 활성 분석 결과이고, B는 표시된 단백질의 웨스턴 블랏 결과이며, C는 NF-κB 활성을 측정하는 루시퍼라제 분석 결과이며 (루시퍼라이제-발현 플라스미드를 형질감염 시킨 후 24시간 후에 세포를 2-AP (2 mM)로 1 시간 동안 전 처리한 후 독소루비신 (6 μM)이 함유 된 배지로 8 시간 동안 교체함), D는 2-AP의 치료를 제외하고 패널 C에 기술 된 루시퍼라제 분석 결과이다.
도 4는 독소루시비신 처리 시 PKR 매개 세포 독성에 대한 nc886의 역할을 보여주는 결과로서, A는 anti-oligos (대조군과 nc886- 표적화)를 24 시간 동안 형질 감염 시켰을 때 나타나는 여러 가지 검정하는 방법의 결과이고, B 및 C는 독소루비신 처리와 nc886 RNA (시험 관내 전사 물)의 형질 감염을 조합하여 실험한 뒤의 웨스턴 결과이고 (Western blot을 위해 12 시간 (HCT116) 또는 6 시간 (Nthy-ori 3-1)에서 세포를 채취하기 전에 형질감염 및 투여를 동시에 수행하였음), D는 돌연변이 nc886을 사용한 것을 제외하고는 패널 B-C와 동일한 실험한 결과이고, E 내지 F는 HCT116 wt 및 p53 null 세포에서 웨스턴 블랏 및 노던 블랏의 결과이다.
도 5은 vtRNAs 또는 Vault complex에 독립된 nc886/PKR 매개 세포사멸을 보여주는 결과로서, A는 세포분획을 한 후, 각 분획의 동일한 부분을 노던 및 웨스턴 블롯을 한 결과이고, B는 동일하게 수행되는 표준 vtRNA의 노던 블랏이며, 표시된 안티올리고의 형질 전환 24시간 후 노던 및 웨스턴 블랏 결과이고, D는 효모 tRNA ("-")를 형질 감염시킨 후 웨스턴 블랏이고 vtRNA1-1 및 nc886의 시험 관내 전사물의 결과이며, E 및 F는 MVP에 대한 siRNA를 48 시간 동안 형질 감염시킨 다음, 웨스턴 블랏 (패널 E) 또는 독소루비신 (doxorubicin) 처리로 24 시간 동안 MTT 분석 (패널 F)을 수행한 결과이다.
도 6은 Pol III의 축출 및 독소루비신에 의한 억제를 나타내는 결과이로서, A 및 B는 표시된 Pol III 유전자의 노던 블랏의 결과이고, C는 표시된 Pol III 유전자의 qRT-PCR이며, D는 아클라루비신 (Acla, 6 μM), 에토포사이드 (Etopo; 30 μM) 및 독소루비신 (Doxo; 6 μM)을 처리한 후 8시간 후의 노던 및 웨스턴 블랏의 결과이고, E는 원형 플라스미드 DNA 또는 nc886을 발현하는 선형 DNA를 형질 감염한 24 시간 후의 nc886의 발현을 노던 블랏으로 확인한 결과이며, F는 6 μM 독소루비신을 2 시간 처리 한 후, POLR3A에 결합된 표시된 게놈 영역의 qPCR결과이다.
도 7은 μM 농도의 독소루비신의 짧은 펄스 처리: 3 차원 배양 시스템에서의 응용 및 다양한 암세포에서의 조사를 한 결과로써, A는 펄스 처리 실험의 모시도이고, B 및 C는 A에 모식도와 같이 수행한 후 노던 브랏 및 웨스턴 블랏 결과이며, D는 3 차원 배양 시스템을 생성하는 방법을 설명하는 간략한 요약 및 모식도이고, E 및 F는 패널 C에 기술된 노던 및 웨스턴 블랏 결과이고, G는 791 세포주의 IC50 값을 오름차순으로 랭크 분포도로 표시이며, H는 6 종이 수집 된 부모 세포 (왼쪽 원)와 독소루비신 내분 제 (오른쪽 삼각형)의 IC50 값의 도트 플롯 결과이다.
도 8은 독소루비신 처리시 nc886/PKR 경로를 요약한 결과이다.
이하에서 본 발명을 자세히 설명한다.
본 발명자들은 DNA-damaging agent 계열 항암제인 독소루비신이 암세포/정상세포에 미치는 영향과 nc886/PKR의 연관성을 연구하였다. 독소루비신을 세포에 처리했을 때, nc886의 발현은 감소하고 PKR의 활성은 증가하여 세포가 사멸하며, 이 세포 사멸의 원인은 p53 유도가 아니라 nc886의 억제를 통해 PKR이 활성화됨이라는 것을 밝혔다 (도 1 내지 4). nc886은 vault RNA (vtRNA)의 paralog로 분류되며 별칭 중 하나는 vtRNA2-1이고, Canonical vtRNA (vtRNA1-1, 1-2 및 1-3)는 암세포의 약물 내성과 관련되어있는 볼트 복합체라는 거대한 리보 핵산 단백질 복합체의 구성 성분 중에 하나이다. 이에 독소루비신 민감도와 nc886/PKR 경로와의 가능한 관계에서 볼트 복합체 (vault complex)에 대한 역할을 조사한 결과, vault complex가 독소루비신에 의한 표준 vtRNA의 억제에도 불구하고, 투여 조건에서 독소루비신에서 역할을 하지 않았다 (도 5). nc886은 Pol III에 의해 전사되고, 이를 이용하여 독소루비신에 의한 nc886 억제에 대한 메커니즘을 조사한 결과 독소루비신이 Pol III 전사를 억제한다는 것을 확인하였다 (도 6). 상기의 실험을 3D 세포 배양에서 한 경우에도, 독소루비신이 nc886을 억제하고 세포 사멸을 유도하였으며, 따라서 nc886/PKR 경로가 실제 생체 내 종양세포에서도 작동하리라고 추정된다 (도 7). 그 결과 도 8과 같이 독소루비신은 Pol III 전사를 억제하고 이로 인하여 nc886의 발현이 억제되고, PKR의 활성이 증가되어 세포사멸이 일어난다는 것을 확인하였다 (도 8).
이와 같이, 본 발명은 nc886 및/또는 PKR의 저해제를 투여하여 암 치료제의 부작용을 완화 또는 감소시킬 수 있다.
상기 PKR 저해제는 imidazolo-oxindole compound, 2-aminopurine (2-AP), 서열번호 1의 염기서열로 이루어진 nc886 전체 유전자 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자일 수 있다.
상기 imidazolo-oxindole compound는 하기 화학식 1로 표시될 수 있다.
[화학식 1]
Figure PCTKR2018015450-appb-I000001
상기 2-aminopurine (2-AP)는 화학식 2로 표시될 수 있다.
[화학식 2]
Figure PCTKR2018015450-appb-I000002
상기 서열번호 1의 염기서열로 이루어진 nc886의 염기서열은 5'-AGCGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUUU-3”일 수 있다. 본 발명에서 사용되는 nc896은 이를 구성하는 핵산 분자의 작용성 등가물, 예를 들어, nc886 핵산 분자의 일부 염기서열이 결실(deletion), 치환(substitution) 또는 삽입(insertion)에 의해 변형되었지만, nc886 핵산분자와 기능적으로 동일한 작용을 할 수 있는 변이체를 포함하는 개념이다.
서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자의 염기서열은 “5’-CAUGCCGGACUUUCUAUCUGUCCAUCUCUGUG-3”일 수 있다.
본 발명의 ncRNA은 단일 가닥 또는 부분적인 이중 가닥 형태로 존재할 수 있다. 또한, 본 발명의 핵산 분자는 RNA, DNA, PNA(peptide nucleic acids) 또는 LNA(locked nucleic acid) 같은 형태로 구성될 수 있다.
본 발명의 상기 핵산분자는 표준 분자 생물학 기술, 예를 들어 화학적 합성 방법 또는 재조합 방법을 이용하여 분리 또는 제조하거나, 시판되는 것을 사용할 수 있다. 또한, 본 발명의 조성물은 ncRNA 핵산 분자 자체뿐만 아니라, 세포 내에서 본 발명의 ncRNA의 발현율을 증가시킬 수 있는 기타의 물질, 예를 들어 화합물, 천연물, 신규 단백질 등을 포함할 수 있다.
상기 암 치료제는 DNA-손상 제제(damaging agnet)일 수 있고, 상기 DNA-손상 제제(damaging agent)는 안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파인일 수 있다.
상기 안트라사이클린계 약물은 다우노루비신, 독소루비신, 에피루비신, 이다루비신 또는 미톡산트론일 수 있다.
상기 암은 폐암, 대장암, 결장암, 직장암, 유방암, 전립선암, 방광암, 혈액암, 백혈병, 골수성 백혈병, 림프종, 자궁경부암(cervical carcinoma), 골육종(osteosarcoma), 교아종(glioblastoma), 흑색종(melanoma), 췌장암, 위암, 간암, 신장암, 담낭암, 담도암, 식도암, 난소암 또는 신경아세포종(neuroblastoma)일 수 있다.
상기 암은 nc886 유전자의 발현 수준이 정상 대조군 시료보다 낮으며, PKR의 유전자의 발현 또는 이의 단백질의 활성이 정상 대조군 시료보다 증가될 수 있다.
본 발명은 PKR 저해제를 포함하는 DNA-손상 제제(damaging agent)의 암 치료 보조제를 제공할 수 있다.
상기 PKR 저해제는 imidazolo-oxindole compound, 2-aminopurine (2-AP), 서열번호 1의 염기서열로 이루어지 nc886 전체 유전자 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자일 수 있다.
상기 암 치료제는 DNA-손상 제제(damaging agnet)일 수 있고, 상기 DNA-손상 제제(damaging agent)는 안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파인일 수 있다.
상기 안트라사이클린계 약물은 다우노루비신, 독소루비신, 에피루비신, 이다루비신 또는 미톡산트론일 수 있다.
본 발명은 또한 하기의 단계를 포함하는 nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준에 따른 암 치료를 위한 약물의 정보 제공 방법을 제공할 수 있다:
(a) 병리학적으로 암으로 판단된 암 환자로부터 분리된 생물학적 시료로부터 nc886의 유전자 또는 이의 단백질 발현 수준; 및 PKR의 유전자 발현 수준 또는 이의 단백질의 활성 수준을 측정하는 단계; 및
(b) 상기 측정된 nc886 유전자의 발현 수준이 정상 대조군 시료보다 낮으며, PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준이 정상 대조군 시료보다 높은 경우 상기 암 환자에게 DNA-손상 제제(damaging agent) 및 PKR 저해제를 계속 투여하도록 하는, 약물 선택 정보를 제공하는 단계.
상기 병리학적으로 암으로 판단된다는 것은 암전이 분류 (tumor or node metasis: TNM) 시스템에 따라 1기부터 4기 까지 분류되는 암일 수 있다.
상기 생물학적 시료는 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨와 같은 시료 등을 포함하나, 이에 제한되지 않는다.
상기 PKR 저해제는 imidazolo-oxindole compound, 2-aminopurine (2-AP), 서열번호 1의 염기서열로 이루어진 nc886 전체 유전자 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자일 수 있다.
상기 DNA-손상 제제(damaging agent)는 안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파인일 수 있다.
상기 안트라사이클린계 약물은 다우노루비신, 독소루비신, 에피루비신, 이다루비신 또는 미톡산트론일 수 있다.
상기 계속 투여는 DNA-손상 제제(damaging agent)를 1 내지 50micromolar 농도로, 바람직하게는 1 내지 25 micromolar 농도로, 더 바람직하게는 6 micromolar 농도로 지속적으로 투여하는 것 일 수 있다.
본 발명에서 "발현량 측정"이란 암의 종류를 확인하기 위해 암 조직 세포에서 상기 유전자의 RNA 존재 여부와 발현 정도를 확인하는 과정으로, mRNA의 양을 측정하여 이루어진다. 이를 위한 분석 방법으로 는 예를 들어, 역전사 중합효소반응 (RT-PCR), 경쟁적 역전사 중합효소반응 (Competitive RT-PCR), 실시간 역전 사 중합효소반응 (Realtime RT-PCR), RNase 보호 분석법 (RPA; RNase protection assay), 노던 블랏팅 (Northern blotting), DNA 칩 등이 있으나, 이에 제한되는 것은 아니다.
본 발명에서 유전자의 수준을 측정하는 제제는 바람직하게는 안티센스 올리고뉴클레오티드, 프라이머 쌍 또는 프로브이다. 본 발명에서 "안티센스"는 안티센스 올리고머가 왓슨-크릭 염기쌍 형성에 의해 RNA 내의 표적 서열 과 혼성화되어, 표적서열 내에서, 전형적으로 mRNA와 RNA:올리고머 헤테로이중체의 형성을 허용하는, 뉴클레오티드로 이루어진 올리고머를 지칭한다. 올리고머는 표적 서열에 대한 정확한 서열 상보성 또는 근사 상보성을 가질 수 있다. 이 안티센스 올리고머는 mRNA의 번역을 차단 또는 저해하고 mRNA의 스플라이스 변이체를 생산하는 mRNA의 프로세싱 과정을 변화시킬 수 있다.
본 발명에서 "단백질 발현량 및 이의 활성의 측정"이란 간암의 진행 여부를 확인하기 위하여 암 조직 세포에서 본 발명의 유전자로부터 발현된 단백질의 존재 여부와 발현 정도를 확인하는 과정으로, 단백질의 양을 측정하여 이루어진다. 이를 위한 분석 방법으로는 웨스턴 블랏, ELISA (enzyme linked immunosorbent assay), 방사선면역분석 (RIA:Radioimmunoassay), 방사 면역 확산법 (radioimmunodiffusion), 오우크테로니 (Ouchterlony) 면역확산법, 로케트 (rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법 (Immunoprecipitation Assay), 보체 고정 분석법 (Complement Fixation Assay), 유세포분석 (Fluorescence Activated Cell Sorter, FACS), 단백질 칩 (protein chip) 등이 있으나 이로 제한되는 것은 아니다. 본 발명에서 단백질 발현 수준을 측정하는 제제는 바람직하게는 항체이다.
상기 PKR 저해제는 DNA-손상 제제(damaging agent)가 정상세포에 일으키는 부작용을 완화 또는 감소시킬 수 있다. 독소루비신은 원래 DNA-손상 제제(damaging agent)이며, 따라서 분열하는 암세포만 죽인다고 알려져 있으나, 본 발명에 따르면 일반세포도 nc886/PKR경로에 의해 죽게 되는, 원치 않는 부작용이 일어나는 이유를 설명할 수 있게 되었다.
본 발명은 하기의 단계를 포함하는 nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준에 따른 암 치료를 위한 약물의 정보 제공 방법을 제공 할 수 있다.
(a) 병리학적으로 암으로 판단된 암 환자로부터 분리된 생물학적 시료로부터 nc886의 유전자 발현 수준; 및 PKR의 유전자 발현 수준 또는 이의 단백질의 활성 수준을 측정하는 단계; 및
(b) 상기 nc886의 유전자의 발현 수준이 정상 대조군 시료보다 높으며, PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준이 정상 대조군 시료보다 낮은 경우 상기 환자에게 DNA-손상 제제(damaging agent)을 단기간 투여하도록 약물 선택 정보를 제공하는 단계.
상기 단기간은 예컨대, 1분 내지 24시간 일 수 있으며, 바람직하게는 10분 내지 12시간, 보다 바람직하게는 10분 내지 2시간, 특히 바람직하게는 20분 내지 40분 일 수 있고, 가장 바람직하게는 30분일 수 있다.
상기 암은 폐암, 대장암, 결장암, 직장암, 유방암, 전립선암, 방광암, 혈액암, 백혈병, 골수성 백혈병, 림프종, 자궁경부암(cervical carcinoma), 골육종(osteosarcoma), 교아종(glioblastoma), 흑색종(melanoma), 췌장암, 위암, 간암, 신장암, 담낭암, 담도암, 식도암, 난소암 또는 신경아세포종(neuroblastoma)일 수 있다. nc886/PKR을 타깃으로 할 때, 고농도의 독소루비신을 짧은 시간으로 처리하면 DNA 손상을 최소화 할 수 있으며, 따라서 조혈 계통의 세포, 모낭 세포 및 장의 상피 세포와 같은 증식하는 정상 세포의 최소한의 유전 독성 효과를 가지면서 세포 사멸을 유도하는데 충분할 수 있다.
상기 DNA-손상 제제(damaging agent)는 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판, 독소루비신 또는 티오테파인일 수 있다.
본 발명은 또한 nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준을 측정할 수 있는 제제를 포함하는 암 치료를 위한 약물 또는 이의 투여의 정보 제공용 키트를 제공할 수 있다.
상기 약물 정보는 DNA 손상 제제 및 PKR 저해제를 병용으로 투여하는 방법에 대한 정보이다.
상기 약물의 투여의 정보는 투여 횟수, 투여 농도 등을 이야기 하는 것으로, nc886 유전자의 발현이 정상 대조군 시료보다 낮으며, PKR의 유전자의 발현 또는 이의 단백질의 활성이 정상 대조군 시료보다 증가된 경우, 일반적인 독소루비신 투여 농도보다 낮으며, 투여 횟수 및 투여 기간을 늘리는 것을 이야기 한다.
상기 유전자의 발현을 측정하는 제제는 안티센스 올리고뉴클레오티드, 프라이머 쌍 또는 프로브일 수 있다.
상기 단백질의 활성을 측정하는 제제는 PKR의 인산화에 특이적으로 결합하는 항제일 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1. 세포주, 항체 및 기타 시약
모든 세포주, 항체 및 기타 시약은 달리 명시하지 않는 한 문헌[Jeon SH et al., FEBS Lett 586: 3477-348 (2012b)] 및 [Lee K et al., RNA 17: 1076-1089 (2011)에 기술되어 있다. 독소루비신 (doxorubicin), 에토포사이드 (etoposide) 및 아클라루비신 (aclarubicin)은 EMD Millipore, Sigma-Aldrich 및 Santa Cruz Biotechnology에서 각각 구입하였다. H2O2와 메실산데페록사민 (deferoxamine mesylate)는 Fisher Chemical과 Sigma-Aldrich에서 각각 구입하였다. total p53 및 Chk2에 대한 항체는 Santa Cruz Biotechnology로부터 구입하였고, 이들 항체에 대한 인산화 항체는 Cell Signaling Technology에서 구입하였다.
실시예 2. 프라이머, 플라스미드 DNA, RNA 및 형질 감염
PCR 프라이머 및 노던 프로브에 대한 서열은 하기 표 1에 요약되어 있다. nc886을 발현하는 DNA는 101 nt nc886 전사체와 인접 서열 (flanking sequence) [각각 5 '및 3'측에서 271nt 및 277nt]을 포함하는 PCR 증폭된 649nt PCR 단편이었다. 이 단편을 pCR4-TOPO 벡터 (Invitrogen, Carlsbad, CA)에 삽입 하였다. 생성된 플라스미드 및 PCR 단편을 도 6E의 형질 감염 실험에 사용 하였다. pNF-κB-Luc (Stratagene, La Jolla, CA)를 사용하여 NF-κB 루시퍼라제 분석함에 있어서, 표준화를 위해 pRL-SV40를 함께 감염 시켰다. PKR 및 MVP에 대한 siRNA는 PKR의 nt 343-367, 1054-1078 및 1228-1252 및 MVP의 nt 1067-1091 및 1908-1932의 표적 서열인 Stealth RNAi™siRNA (Invitrogen)를 사용하였다. 유전자의 다른 영역을 표적으로 하는 이들 siRNA를 동일하게 혼합하고 40 nM 농도로 형질 감염시켰다. nc886 및 표준 vtRNA (vtRNA1-1, 1-2, 1-3)에 대항하는 안티 올리고는 변형된 당 (2′) 및 포스포로티오에이트 백본(phosphorothioate backbone)을 갖는 DNA-RNA 믹스머를 사용하였고, 이의 표적 서열은 5'-aucucugugcugggguucga-3 '(nc886에 상응하는 nt 56-75) 및 5'-ggcuggcuuuagcucagcgg-3 '(상응하는 nt 2-21의 vtRNA) 이다. 이들 안티 올리고는 200 nM으로 형질 감염시켰다. 구조 실험을 위해 (도 4B-D 및 6C), 시험 관내 전사 된 nc886 및 vtRNA를 (비특허문헌 015)에 기술된 바와 같이 제조하고 효모 tRNA를 Applied Biosystems / Ambion (Carlsbad, CA)에서 구입 하였다. 짧은 RNA (siRNAs, antioligos 및 in vitro transcripts)를 Lipofectamine™ RNAiMAX 시약 (Invitrogen)으로 형질감염하고, DNA를 Lipofectamine ™2000 시약 (Invitrogen)으로 형질 감염시켰다.
PCR 프라이머 및 노던 프로브에 대한 서열목록
Primer 서열
nc886 for PCR Forward CGGGTCGGAGTTAGCTCAAGCGG
Backward AAGGGTCAGTAAGCACCCGCG
nc886 for northern blot probe AAGGGTCAGTAAGCACCCGCG
실시예 3. 루시퍼라제 분석, 세포증식 분석 및 시험관내 키나아제 분석
이러한 모든 분석은 문헌[Kunkeaw N et al., Oncogene 32: 3722-3731 (2013)] 및 [Lee K et al., RNA 17: 1076-1089 (2011)] 에 기재되어 있는 대로 수행하였다. 모든 정량 분석법 (MTT 분석법, 루시퍼라제 분석법, qRT-PCR 및 ChIP-PCR)을 평균, 표준 편차 및 p-값 (양측 t-test)을 계산하기 위해 3번 반복 수행하였다.
실시예 4. 세포내 분획화
Subcelluar fractionation은 문헌[Kickhoefer VA et al., J Biol Chem 273: 8971-8974 (1998) 및 [Lee K et al., RNA 17: 1076-1089 (2011)]에 개시되어 있는 대로 수행하였다. 수확된 세포 (~5*107)를 1mM PMSF (phenylmethylsulfonyl fluoride)를 함유하는 buffer A (50mM Tris-Cl (pH 7.4), 1.5mM MgCl2, 75mM NaCl, 0.5 % Nonidet P-40) 1.2㎖에 재현탁하고, 10 mM 리보뉴클레오시드-바나딜 복합체 (ribonucleoside-vanadyl complex; New England Biolabs, Ipswich, MA) 및 인간 태반으로 부터의 200 unit/ml RNase 억제제 (New England Biolabs) 0.1 ml를 첨가하였다. 모든 후속 단계는 4℃에서 수행 하였다. 재현탁한 세포를 10분 동안 용해시키고 Optima TLX 초 원심 분리기를 사용하여 TLA-55 로터에서 6,000 xg에서 10 분간 원심 분리 하였다. 펠렛은 핵 분획 (도 6A에서 "P10"으로 표시됨)이었다. 상층액은 벌크 세포질이었고, 100,000×에서 1시간 동안 원심 분리하여 분획화하여, 생성된 상층액 ("S100"로 명명 됨)을 펠렛 ("P100"으로 표시)으로부터 분리 하였다. P10 및 P100 분획을 Trizol 시약으로 후속 RNA 조제 또는 웨스턴 블랏팅을 위한 RIPA 완충액으로 재현탁 하였다. 동량의 이소프로판올을 가하여 S100 분획을 농축시킨 다음 원심 분리(10 분간 12 krpm 속도로)를 수행하였다. 얻어진 펠릿을 Trizol 시약으로 RNA를 추출 하였다. S100 분획의 분액을 웨스턴 블랏팅을 위해 직접 적재 하였다.
실시예 5. CHIP assays
ChIP 분석은 이전에 설명한 [Park K et al., J Leukoc Biol 91: 245-257 (2012)]에 기재된 대로 수행하였다. 간단히 말하면, 세포를 1% 포름알데히드로 가교 결합시키고 팽창 완충액 [5 mM PIPES (pH 8.0), 85 mM KCl, 0.5 % Nonidet P-40] 및 buffer A [10 mM Tris―HCl, 2 mM EDTA, 0.2% 나트륨 도데실 설페이트 (sodium dodecyl sulfate)에서 Bioruptor를 사용하여 초음파 처리 하였다. 염색질 샘플을 Buffer B [10 mM Tris-HCl (pH 8.0), 2 % Triton X-100, 280 mM NaCl, 0.2 % 데옥시콜레이트 (deoxycholate)]로 희석시키고, POLR3A에 대한 항체로 면역 침전시켰다. Chromatin-항체 복합체는 ProteinA/G Dynabeads로 제거하였다. 프로테이나제 K (proteinase K)로 처리하고 가교 결합을 역전시킨 후, 면역 침전된 DNA의 양을 실시간 PCR로 측정 하였다. 칩 프라이머는 하기 표 2와 같다.
칩 프라이머에 대한 서열목록
gene 염기 서열
nc886 Left CCAGCACAGAGATGGACAGA nc886 PCR primer for POLR3A ChIP
Right GTCCCTCTCCACATCGTCAC nc886 PCR primer for POLR3A ChIP
Vtrna1 Left AGTCTGGAAGCGAAGGAGGT vtRNA1-1 PCR primer for POLR3A ChIP
Right ATGACTCAGCGACCAGGACT vtRNA1-1 PCR primer for POLR3A ChIP
GAPDH Left CGGCTACTAGCGGTTTTACG GAPDH PCR primer for POLR3A ChIP
Right GCTGCGGGCTCAATTTATAG GAPDH PCR primer for POLR3A ChIP
실시예 6. 3-D 세포 배양
3-D 세포 배양은 n3D Biosciences의 BiO AssayTM kit를 제조자의 지시에 따라 처리하였다. 간단히 말해서, 단층 배양된 3.3 ×106 세포를 200 시간 동안 NanoShuttleTM-PL로 16 시간 동안 처리하고, 트립신 처리한 후, 6-웰에서 24 시간 동안 자기 부상을 일으켰다. 부유 세포를 배양액 2 ml (6-well 당)에 현탁시키고, pipetting에 의해 재현 탁하고, 96-웰 (96-웰 당 2.0 x 105 세포)에 바이오 인쇄하여 30 분 동안 링 구동 시켰다. 그리고 독소루비신을 처리하였다. 상기 3-D 세포 배양의 모식도는 도 7D에 개시되어 있다.
실시예 7. nc886 발현은 독소루비신 처리 시 감소한다
nc886의 역할을 확인하는 첫 단계로 nc886 발현이 변경된 생물학적 상황을 조사하였다. 이를 위해 HBE135-E6E7 (부분적으로 변형된 폐 상피세포주)과 HCT116 (대장 암 세포주)을 H2O2 (산화 스트레스 유도제), 데스페리옥사민 (desferrioxamine; 저산소증 유사 화합물) 및 독소루비신을 처리하여, 여러 가지 스트레스 조건을 테스트 하였다. 비교를 위해 처리된 전사 억제제인 Actinomycin D는 예상대로 nc886 발현을 억제하였다 (도 1A). 독소루비신은 actinomycin D만큼 nc886 발현을 억제하는데 효과적이었지만, H2O2와 데스페리옥사민 (desferrioxamine)은 거의 효과가 없었다 (도 1A). 본 발명의 용량 적정 실험은 nc886을 감소시키기 위해 독소루비신을 고농도 (최소한 3 μM 이상)로 필요로 한다는 것을 보여 주었다 (도 1B). 이 농도는 임상적으로 관련된 농도와 비슷하다는 점에서 유의해야 한다. 환자에게 독소루비신을 볼루스 주사(bolus injection)한 후 최대 혈장 농도는 5 내지 25 μM 범위였다. nc886은 2 시간 처리 후에 눈에 띄게 감소되었으며 4-8 시간 후에 간신히 관찰되었다 (도 1C). 8시간 째 nc886의 발현이 사라진 후 독소루비신을 포함하는 배지를 신선한 배지로 교체하여도 nc886 발현이 36 시간 후에도 회복되지 않음을 관찰하였다 (도 1C). 상기 시간 경과 데이터는 nc886의 반감기가 1-2 시간이라는 점을 감안할 때, 독소루비신이 치료 즉시 거의 nc886 전사를 차단한다는 것을 보여준다.
실시예 8. PKR은 독소루비신 유발성 세포 사멸에 기여한다.
독소루비신은 PKR 경로와 궁극적으로 세포 자살 (apotosis)를 유발하는 것으로 확인되었다. 인간유래 세포의 경우, 상기 세포 자살 경로에 대한 PKR의 기여에 대해 실험적 증거는 주로 small interfering (또는 hairpin) RNA (siRNA 또는 shRNA)를 사용하여 knockdown (KD)을 유도한 실험을 기반으로 하였다. PKR의 이러한 역할은 CRISPR-Cas 기술에 의해 원래의 Nthy-ori 3-1 세포(PKR wt)로부터 생성된 PKR KO 세포에 대한 실험에 의해 뒷받침 되었다 (도 2A의 PKR의 Western blot). 독소루비신 처리는 PKR wt 세포에서 카스파제-3 (caspase-3) 및 절단된 폴리 (ADP-리보스) 중합 효소 (cleaved Poly (ADP-ribose) polymerase; PARP)과 같은 세포 자살과 관련된 단백질을 유도하고, 상기 단백질의 발현은 PKR KO 세포에서 유의하게 약화되었다 (도 2A). PKR wt 및 KO 세포에서 p53 및 Chk2 (도 2A에서 이의 인산 형태로 나타냄)의 유사한 유도는 독소루비신이 이들 2 개의 세포 주에서 동등하게 효과적이었다. 세포 사멸 데이터가 DNA의 손상 반응의 차이로 인한 것이 아닐 수 있음을 보여 주었다. 또한 독소루비신의 양을 적정량으로 처리했을 때, 세포 생존을 측정하기 위해 MTT assays를 수행하였다 (도 2B). PKR KO 세포는 PKR wt (각각 IC50 값 = 22.83 vs 6.49 μM)보다 독소루비신에 내성을 보였으나, 이 두 세포 주는 정상적인 성장 조건에서 유사하게 증식 하였다. PKR KO 세포가 clonally 선택되어 오랫동안 유지되었기 때문에, 이들 세포가 독소루비신 저항성을 우연히 일으킬 수 있는 유전적 또는 후성적 변이를 획득했을 가능성이 있다. 이 가능성을 배제하기 위해 우리는 HCT116 세포에서 siRNA에 의한 급성 PKR KD 후 독소루비신 감수성을 측정하였다. PKR에 대한 siRNA는 PKR 발현을 효과적으로 억제시켰다 (도 2C). 중요하게도, PKR KD는 PKR KO 데이터와 유사하게 IC50 값을 약 3.5 배 증가시켰다 (도 2D). 상기 데이터는 PKR이 독소루비신에 의해 유발된 세포 사멸에 중요한 역할을 한다는 것을 분명히 보여 주었다.
실시예 9. 독소루비신은 PKR을 활성화 시킨다.
시험 관내 키나아제 분석에 의해 PKR 활성화의 특징인 PKR 자동 인산화를 측정하였다. 상기 분석에서, PKR 면역침전 (IP) 활성 PKR 분자를 방사성 표지하고 SDS-폴리 아크릴아미드 겔상에서 분해시켰다 (도 3A). 별표가 있는 밴드는 올바른 위치로 이동하고 PKR KO Nthy-ori 3-1 세포에서 검출되지 않기 때문에 PKR 이다 (도 3A의 오른쪽 두 레인). PKR은 HCT116 및 Nthy-ori 3-1 (PKR wt) 세포에서 독소루비신으로 처리할 때보다 인산화되었다. PKR 활성화는 NF-κB 반응성 프로모터를 사용하는 루시퍼 레이즈 리포터 분석에서 평가 된 바와 같이 eIF2α의 인산화 (도 3B) 및 NF-κB경로의 활성화 ((도 3C-D)에 의해 확증되었다. 상기 두 개의 사건 (eIF2α의 인산화 및 NF-κB경로의 활성화)은 PKR의 하류 경로 (downstream pathways)이다. 독소루비신 처리에 의한 NF-κB의 유도는 PKR 억제제인 2-aminopurine (2-AP)에 의해 무효화되었고 (도 3C) PKR KO Nthy-ori 3-1 세포에서는 거의 보이지 않았기 때문에 PKR 활성화에 기인한 것이라고 생각하였다 (도 3D). 상기 데이터와 같이 독소루비신은 PKR과 이의 하류 경로를 활성화 시킨다.
실시예 10. 독소루비신은 p53 유도를 통해서가 아니라 nc886 억제를 통해 PKR을 활성화시킨다
상기 데이터는 독소루비신 처리시 nc886 발현이 억제됨을 보여 주었다. nc886이 PKR 억제제이기 때문에 nc886 억제가 독소루비신-매개 PKR 활성화의 기본 메커니즘이라고 가정하였다. 상기 가설을 증명하기 위해 여러 실험을 수행하였다. 먼저, nc886의 결핍이 독소루비신 처리와 동일한 세포 반응을 유도하는지 확인하기 위해 변형 된 안티센스 올리고 뉴클레오티드 (anti-oligo)를 사용하여 nc886 KD 실험을 수행하였다. anti-oligo (anti-nc886)를 표적으로 하는 nc886은 anti-control (Northern blot;도 4A의 상단 패널)에 비해 nc886을 억제하고 시험 관내 키나아제 분석 (도 4A의 중간 패널)에 의해 확인되는 바와 같이 PKR 활성화를 유도하였다. nc886 KD는 PKR wt 세포에서 세포 사멸을 유도하고 세포 증식을 억제하는데 충분하였다 (도 4A의 하단 패널). nc886 KD의 이러한 표현형은 PKR KO 세포에서 발생하지 않았기 때문에 PKR 활성화를 통해 일어났다 (도 4A의 왼쪽 패널에서 레인 2와 4 비교). 유사한 결과가 HCT116에서 확인되었다 (도 4A의 우측 패널). nc886 KD는 PKR 활성화 및 이에 따른 세포 사멸 유도에서 독소루비신 처리와 같은 효과를 나타내었다. 독소루비신은 다면 발현 효과를 이끌어낸다. nc886의 기여도를 분별하고 독소루비신 매개 세포 독성이 nc886의 이소성 발현에 의해 완화되었는지 여부를 조사하였다. Pol III 전사체로서 nc886 발현은 유전자 내부 프로모터 요소에 의해 유도되므로 외인성 DNA로부터의 발현도 독소루비신에 의해 억제되었다 (도 6E). 따라서 독소루비신의 존재 하에 nc886 발현을 위한 전략은 in vitro transcript의 한 형태로 그것을 전달하는 것 이었다. 독소루비신에 의해 유도된 세포 사멸은 nc886 전사체가 HCT116 및 Nthy-ori 3-1 (PKR wt) 세포로 형질 감염되었을 때 약화되었지만 Nthy-ori 3-1 (PKR KO) 세포에서는 그렇지 않았다 (도 4B-C). PKR 경로에서의 nc886의 역할은 nc886의 2 가지 버전을 시험으로써 확인되었다 (PKR이 nc886 ("mut_46-56")과 접촉 한 46-56에서 돌연변이를 갖는 wt 및 다른 돌연변이를 시험 함) (도 4D). 이 돌연변이체는 PKR 결합이 없었다. 독소루비신 유도 세포자살은 caspase-3 유도에 의해 나타났으며 wt nc886에 의해 완화되었지만 mut_46-56에서는 완화되지 않았다 (도 4D). 상기 모든 데이터는 nc886 억제에 의한 PKR 활성화가 독소루비신에 대한 세포 반응에 중요한 역할을 한다는 것을 분명히 보여준다. 이전 보고서[Yoon CH et al., Proc Natl Acad Sci U S A 106: 7852-7857 (2009)]에서 PKR의 발현과 활성은 독소루비신에 의해 p53 의존적으로 유도되었다. 그래서 이전 보고서[Yoon CH et al., Proc Natl Acad Sci U S A 106: 7852-7857 (2009)]에 개시되어 있는 동일한 세포주 쌍인 p53 wt 및 null HCT116 세포 (p53 +/+ 및 p53 -/- 도 4E의 p53 웨스턴 블랏 참조)에서 이 가능성을 조사하였다. 이 두 세포 주는 nc886과 비슷한 발현 수준을 보였으며, 이는 거의 동일한 시간 경과 과정에서 독소루비신에 의해 억제되었다 (도 4F). 결과적으로, PKR은 eIF2α 인산화에 의해 지시된 바와 같이 활성화되어, 세포 자살을 유도 하였다 (도 4E). 이러한 사건은 두 세포 주 모두에서 비슷한 정도로 발생하였다. 전체 PKR 수준이 모든 레인에서 동일하다는 것은 PKR은 p53의 전사 표적도 아니며 독소루비신에 의해 유도되지도 않았다는 것을 나타낸다. 상기 결과는 Yoon 논문 ([Yoon CH et al., Proc Natl Acad Sci U S A 106: 7852-7857 (2009)])과 모순되었지만, 동일한 HCT 116세포주에서 실험을 반복한 결과 Yoon 논문과 비교한 다른 논문 (문헌[Rahman M et al., Cell Cycle 8: 3606-3607 (2009)])과 일치하였다. 도 4의 결과를 종합하면, 독소루비신 처리시 nc886 억제가 p53 상태에 관계없이 PKR 활성화 및 이의 결과로 인한 세포 독성의 주요 원인임을 확인하였다. 그럼에도 불구하고 모든 연구에서 eIF2α의 인산화가 p53 -/- 세포에서 약간 약화 되었기 때문에 p53이 상기 경로에서 중요한 역할을 할 수 있는 가능성이 있다 (도 4E).
실시예 11. vault complex은 독소루비신 감수성에서 역할을 하지 않는다.
nc886은 vault RNA (vtRNA)의 paralog로 분류되며 별칭 중 하나는 vtRNA2-1이다. Canonical vtRNA (vtRNA1-1, 1-2 및 1-3)는 암세포의 약물 내성과 관련되어있는 볼트 복합체 (vault complex)라 불리는 거대한 리보 핵산 단백질 복합체의 구성 성분이다. 따라서 독소루비신 민감도와 nc886/PKR 경로와의 가능한 관계에서 볼트 복합체 (vault complex)에 대한 역할을 조사하였다. subcellular 분별은 리보좀 및 vault 입자와 같은 큰 복합체를 포함하는 불용성 세포질 펠릿 ("P100")에서 핵 분획 (도 5A의 "P10")과 가용성 세포질 분획 ("S100")을 분리하였다. 볼트 컴플렉스 (Major Vault Protein, MVP)의 주요 구성 요소는 P100에만 있었다 (도 5A). nc886이 아닌 vtRNA1-1이 P100에서 발견되었다. nc886은 HBE135-E6E7 세포의 S100에만 독점적으로 존재하였으며, HeLa 세포의 경우에는 분획 동안 RNA 분해로 인해 (도 5A의 EtBr 염색 참조) 거의 검출되지 않았다. 하지만 이 경우에 P100에서 vtRNA1-1을 검출 할 수 있었다. 아마도 이것이 Vault Complex에서 안정적으로 조립되어 RNA 분해로부터 보호되었기 때문이다. 상기 데이터에 따르면 nc886은 이전 보고서와 일치하여 볼트 컴플렉스와 물리적으로 관련이 없는 것으로 나타났다. nc886과 마찬가지로 독소루비신에 의해 억제되는 세 가지 표준 vtRNA가 발견되었다 (도 5B, 도 1A와 비교). nc886이 vault complex와 무관함을 밝히긴 했지만, 표준 vtRNA (및 볼트 컴플렉스)가 nc886과는 독립적으로 독소루비신 감수성에서 어떤 역할을 할 수 있을 가능성은 여전히 존재한다. 상기 가능성은 vDRNA1-1의 KD 및 이소성 발현에 의해 시험되었다 (도 5C-D). 안티 올리고에 의한 vtRNA1-1 KD는 PKR을 활성화시키지 않았고 (phospho-eIF2α가 없는 것으로 나타남) 유도된 세포 자살도 아니었다(도 5C). 시험 관내 전사된 vtRNA1-1의 도입은 독소루비신에 의해 유발된 세포 사멸을 완화시키지 못하였다 (도 5D). 동일한 실험에서 nc886과 상기 결과를 비교하여 nc886의 긍정적인 효과를 재현 가능하게 관찰함으로써 상기 두 실험에서 vtRNA1-1의 이러한 효과의 결핍이 사실임을 확인하였다. 또한 MVP의 siRNA 매개 KD는 Nthy-ori 3-1 세포에서 독소루비신의 IC50 값에 영향을 미치지 않았다 (도 5E-F). 총체적으로 우리는 vault complex가 독소루비신에 의한 표준 vtRNA의 억제에도 불구하고 우리의 투여 조건에서 독소루비신에서 역할을 하지 않는다고 결론지었다.
실시예 12. 독소루비신은 Pol III 전사를 억제한다
독소루비신에 의한 nc886 억제에 대한 메커니즘을 조사하였다. nc886은 Pol III에 의해 전사된다. 이전 연구에 의하면 독소루비신은 시험 관내 전사 분석에 도입 될 때, 독소루비신이 Pol III의 전사를 억제한다는 결론을 내렸다. 그러나 상기 관찰은 지금까지 어떤 더 많은 연구에서도 추구되지 않았고 따라서 생물학적 의미는 아직 밝혀지지 않았다. 그래서 독소루비신을 처리하고 nc886 이외에 Pol III 전사된 ncRNA("Pol III 유전자"로 표시)를 측정하였다. 정상 상태의 5S rRNA와 tRNA는 독소루비신(도 6A)에 의해 영향을 받지 않았고, 아마도 매우 풍부하고 안정적인 RNA이기 때문일 것이다. 그래서 다른 Pol III 유전자에 관심을 돌리고 nc886과 비슷한 반감기를 갖는 표준 vtRNA를 측정하기로 결정하였다. 독소루비신 처리시, 세 가지 vtRNA와 nc886은 거의 동일한 동역학으로 감소하였다 (도 6A-C). Precursor-tRNAs (Pre-RNAs)는 Pol III 전사율을 평가하는 가장 민감한 지표로 간주된다. 이는 중간체를 처리하고 반감기가 매우 짧기 때문이다. 2 개의 pre-tRNA의 발현 수준은 1 시간 이내에 거의 완전히 감소하였다 (도 6C의 보라색 라인). 이러한 모든 데이터는 전 세계적으로 진행된 Pol III 전사가 독소루비신 처리 즉시 중단되었음을 강력히 시사하였다. 필수적 세포 기능 (도 6A에서 5S rRNA 및 tRNA)의 PolII 전사된 ncRNA는 독소루비신 처리 수 시간 이내에 감소하지 않았으며, 따라서 상기 연구에서 관찰한 급성 세포 독성 효과를 설명할 수 없다. 그렇다면 독소루비신은 어떻게 광범위하게 Pol III 유전자의 발현을 억제할까라는 의문이 들었다. 독소루비신은 DNA/염색질에 스트레스를 여러 가지 방식으로 부과한다. 그것은 토폴로지 긴장 (topological tension)을 생성하기 위해 DNA에 인터칼레이션 한다. 독소루비신의 다른 잘 알려진 효과는 topoisomerase II (topo II) 중독이다. 이중 가닥 분열 형태에서 topo II를 포획하고 연결을 방지한다. 상기 효과의 세포 결과는 DNA 스탠드 파손, 염색질로부터의 히스톤 제거, DNA 손상 반응 및 세포 사멸이다. 상기 원인 중에 어떤 것이 Pol III 전사의 억제의 원인인지를 식별하기 위해, 3개의 상이한 화합물을 비교하였다. 평면 방향족 부분으로 구성된 안트라 사이클린 계 약물 중 하나인 아클라루비신(Aclarubicin)은 DNA 인터칼레이터 (DNA intercalator)이다. 그러나 독소루비신과 달리 topo II 독성 물질은 아니다. 따라서 DNA 파손이 발생하면 topo II 중독 메카니즘에 기인 할 수 없다. 아클라루비신(Aclarubicin)이 DNA 파괴를 일으키는 지에 대한 논란이 제기되었는데, 그 이유는 여러 연구에서 모순 된 자료가 확보되었기 때문이다. 비-안트라 사이클린 화합물인 에토포사이드 (etoposide)는 DNA에 인터칼레이션하지 않고 topo II 독성으로 작용한다. 이 세 가지 약물의 특성은 도 6D에 요약되어있다. 처리 용량 [6 μM 아클라루비신, 30 μM 에토포시드 및 6 μM 독소루비신]으로 상기 약물을 처리 했을 때, 독소루비신과 아클라루비신은 nc886 발현을 억제하는 반면, 에토포시드는 억제하지 않았다 (도 6D에서 왼쪽 패널). 세 가지 약물 모두에서 p53과 Chk2의 인산화가 관찰되었으며 (도 6D의 오른쪽 패널), 모든 처리법이 효과적이었으며 nc886 억제가 DNA 손상 반응의 여파로 인한 것이 아님을 나타낸다. 에토포시드 데이터는 Pol III 전사 억제가 topo II 중독 또는 DNA 파손에 의한 것이 아니라는 것을 증명하였다. 트라사이클린 약물 (독소루비신 및 아클라루비신 포함)을 DNA에 인터칼레이션 (intercalation)하면 Pol III의 작용을 방해 할 수 있는 DNA 비틀림이 발생한다 (예: 신장 중합진행 단계). 상기 가능성을 테스트하기 위해 원형 플라스미드 DNA와 nc886 발현을 위한 선형 DNA를 비교하였다. 토폴로지 긴장이 원인인 경우, 원형 DNA가 선형 DNA보다 영향을 많이 받는다. 2 개의 DNA 주형으로부터의 nc886의 전사는 독소루비신에 의해 유사하게 억제되었으며 (도 6E), 위상학적 간섭은 있을 법하지 않은 메커니즘임을 시사했다. 안트라사이클린 (anthracycline) 약물을 DNA에 인터칼레이션 (intercalation)하는 또 다른 결과는 DNA 결합 단백질의 해리입니다. 사실, 독소루비신과 아클라루비신은 히스톤을 DNA로부터 축출한다고 알려져 있으며, 에토포시드는 그렇지 못하다고 알려져 있다. 따라서 이 두 약물이 히스톤의 경우와 마찬가지로 Pol III를 제거 할 것이라고 추측했다. Pol III 서브 유니트 (POLR3A)를 이용한 염색질 면역침전 (ChIP) 결과에 따르면 Pol III가 Pol II 유전자인 GAPDH 유전자 위치에는 결합하지 않았으며, Pol III 유전자인 nc886 및 vtRNA1-1 위치에 결합하였다. 그리고 이러한 결합은 독소루비신에 의해 감소되었다 (도 6F).
실시예 13. nc886 / PKR 경로에 대한 독소루비신 처리의 최적화 및 3 차원 (3-D) 세포 배양 시스템에서의 적용
상기의 데이터(도 6)에서 총체적으로, nc886의 전사는 독소루비신 처리 즉시 중단되었다. 즉, 짧은 펄스 처리로 nc886 / PKR 경로와 세포 사멸을 활성화 시키는데 충분하다. 세포를 독소루비신으로 처리하고 15, 30, 60 분에 독소루비신이 없는 배지로 교체함으로써 이 가능성을 시험하였다 (실험 계획은 도 7A 참조). 30분은 독소루비신이 nc886을 억제하고 PKR-의존적 방식으로 세포 사멸을 유도하기에 충분한 시간 이었다 (도 7B-C). phospho-Chk2에 의해 측정 된 DNA 손상 반응은 30 분까지는 그렇게 유의하게 유도되지 않았으나 PKR wt 세포에서는 60 분에 약간 유도되었다 (레인 7은 레인 1 ~ 3, 도 7C에서는 레인 4). 비교를 위해 PKR KO 세포에서, phospho-Chk2가 관찰되었고 30분과 60분에 세포 자살이 야간 유도되었다 (도 7C의 7-8 레인). 왜 DNA 손상 반응이 PKR wt 세포보다 PKR KO에서 더 능숙했는지 알지 못하였다. 그럼에도 불구하고, PKR이 존재할 때, nc886/PKR 경로는 세포 사멸을 유도하는데 있어 지배적 이었으나 DNA 손상 반응의 효과는 30 분 펄스 처리에서 최소였다.
지금까지 실험은 약물 감수성을 포함한 여러 측면에서 생체 내 종양 환경과 크게 다른 2 차원 단층 세포 배양에서 수행되었다. 3 차원에서 배양된 세포는 생체내 생리학에 더 가깝다. 그래서 3차원 배양에서 nc886/PKR 경로를 조사하려고 시도하였다. 다른 방법보다 편리하고 우수한 최근에 개발 된 프로토콜을 사용하였다. 이 기법에서 세포는 자성 나노 입자로 코팅되고 자기장을 가함으로써 부상하게 된다. 공중 부양 된 세포는 세포 외 기질과 함께 3-D 구조를 형성하고 플레이트 위에 생체에 인쇄된다 (도식 및 실제 이미지의 경우 도 7D 참조). 독소루비신은 3차원 배양물에 대한 연속 및 펄스 처리 (각각 도 7E-F의 레인 1 및 3-4)에서 nc886을 억제하고 세포 사멸을 유도하여 nc886/PKR 경로가 3-D 배양 세포에서 작동한다는 것을 시사하며, 또한 생체 내 종양 세포에서도 가능할 수 있다.
실시예 14. μM 농도의 독소루비신 처리는 세포의 부분 집합, 특히 침묵된 nc886을 제외한 종양 세포에 광범위하게 적용 할 수 있다.
6 μM 독소루비신은 이용 가능한 데이터에 근거하여 대부분의 암세포에서 효과적일 것으로 예상된다. 암 약물 데이터베이스 (http://www.cancerrxgene.org/)에서 독소루비신을 검색하고 931 세포주의 IC50 값을 다운로드 하였다. 또한 출판된 연구에서 957 세포주에서 CpG 메틸화 데이터를 얻었다. 두 데이터 세트의 비교는 791 개의 세포주에서 IC50 값과 메틸화 값을 보였다. 오름차순으로 IC50 값을 분류하였을 때 (도 7G), IC50> 6 μM인 세포주는 27개 였다. IC50 컷오프를 조금 낮추어도 (1.5 μM) 83 개의 세포 (10.5 %)만이 상기 기준을 충족시켰다. 화학 요법의 주요 문제점은 약물 내성 세포의 출현이며, 결과적으로 악성 종양의 재발이다. 여러 가지 보고서에서 이러한 내성 세포는 화학 요법 후 점차적으로 약물 농도가 증가하거나 환자의 반복 종양으로부터 분리되어 개발되었다. 문헌 조사를 통해 원래 세포와 독소루비신 내성 유도 세포주로부터 IC50 값을 수집하여 도트 플롯에 표시하였다 (도 7H 및 표 3). 독소루비신 내성 그룹의 모든 부모 세포 (38 개 중 38개)와 대부분의 세포 (71 개 중 60 개는 84.5 %)는 IC50이 6 μM 미만으로 처리 조건 (6 μM에서 30분)은 재발성 종양에서도 크게 효과적이다. nc886/PKR에 의한 세포사멸에 효과적인 독소루비신 농도는 6 μM 정도였으며, IC50 값이 이 농도보다 높은 독소루비신 내성 세포주들이 (예를 들어, 도 7G의 83 개 세포주) 소수이지만 존재한다. nc886과 PKR이 정상 인간 조직에서 대부분 발현되어 있지만, 이전 연구에 따르면 nc886/PKR 경로는 모든 종양에서 작동하지 않는다. nc886의 특징은 일부 악성 세포에서 CpG DNA과 메틸화에 의한 침묵 현상이다. 이 특징은 Pol III 유전자들 사이에서 흥미롭고 독특하다. 이론적으로 그리고 상기 데이터에 근거하여, 이 침묵은 PKR이 활성화되었으므로 세포 사멸을 야기했을 것이다. 그러나 nc886-silenced in vitro 및 nc886-silenced된 종양세포가 존재한다. 이전 연구는 종양 감시 모델에 의해 이것을 설명했다. 이 모델에서 이러한 세포 사멸은 암 발병률의 감소에 기여했을 전암 세포의 제거를 확실히 하기 위해 발생했을 것이다. 그러나 특정 세포는 유전적/후성 변형을 획득하는데, 예를 들어 phospho-eIF2α의 세포 사멸 효과를 중화하는 eIF2B의 과발현이 PKR 세포 사멸 경로를 우회 할 수 있다. 그 세포들만이 nc886 silencing시 살아남을 수 있었고 임상적으로 검출 가능하고 in vitro에서 분리 가능한 악성 세포로 발전하였다. 이 세포들이 세포 사멸을 위한 PKR 경로를 잃어 버렸고 그러므로 독소루비신, 특히 μM 농도,에 내성인 경향이 있다고 가정하였다. nc886은 마이크로 RNA 나 mRNA가 아니므로 공공 배열이나 시퀀싱 데이터에서 발현 수준을 추정하는 것은 어렵다. 따라서 nc886 silencing의 프록시 지시자로서 CpG 메틸화 값을 조사하였다. nc886에는 CpG 섬 (-189 ~ +82, nc886 사본의 5 '끝이 +1 참조 지점임)이 있으며 이 섬내 또는 근처의 10CpG 사이트를 분석하였다. 10개 사이트의 평균을 계산하고> 90 %가 과 메틸화라고 간주하였다. 이 분석에서 (도 7G의 원형 차트), 632 개의 독소루비신 감수성 (IC50 <0.6) 세포주 중 nc886-과 메틸화 (12.0 %)만이 86개 였다. 독소루비신 내성 (IC50> 1.5) 세포 주에서 동일한 분석을 실시한 결과, 과 메틸화 세포의 농축이 통계적으로 유의한 수준 (p = 0.041)으로 83회 중 20회 (19.4 %) 관찰되었다. 이러한 데이터는 PKR 세포 죽음 경로가 독소루비신에 대한 저항성에 기여하는 요인이 될 nc886-silenced 세포에서 결함이 있음을 지지하였다.

Claims (16)

  1. nc886 및/또는 PKR 저해제를 포함하는, 암 치료제의 부작용의 완화 또는 감소용 조성물.
  2. 제 1항에 있어서, 상기 PKR 저해제는 이미다졸로-옥신돌(imidazolo-oxindole) 화합물, 2-아미노퓨린(2-AP), 서열번호 1의 염기서열로 이루어진 nc886 전체 유전자, 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자인, 암 치료제의 부작용을 완화 또는 감소용 조성물.
  3. 제 1항에 있어서, 상기 암 치료제는 DNA-손상 제제(DNA damaging agnet)인, 암 치료제의 부작용을 완화 또는 감소용 조성물.
  4. 제 3항에 있어서, 상기 DNA-손상 제제는 안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파인, 암 치료제의 부작용을 완화 또는 감소용 조성물.
  5. 제 4항에 있어서, 상기 안트라사이클린계 약물은 다우노루비신, 독소루비신, 에피루비신, 이다루비신 또는 미톡산트론인, 암 치료제의 부작용을 완화 또는 감소용 조성물.
  6. 제 1항에 있어서, 상기 암은 폐암, 대장암, 결장암, 직장암, 유방암, 전립선암, 방광암, 혈액암, 백혈병, 골수성 백혈병, 림프종, 자궁경부암(cervical carcinoma), 골육종(osteosarcoma), 교아종(glioblastoma), 흑색종(melanoma), 췌장암, 위암, 간암, 신장암, 담낭암, 담도암, 식도암, 난소암 또는 신경아세포종(neuroblastoma)인, 암 치료제의 부작용을 완화 또는 감소용 조성물.
  7. nc886 및/또는 PKR 저해제를 포함하는, DNA-손상 제제(DNA damaging agent)의 암 치료 보조제.
  8. 제 7항에 있어서, 상기 PKR 저해제는 이미다졸로-옥신돌 (imidazolo-oxindole) 화합물, 2-아미노퓨린(2-AP), 서열번호 1의 염기서열로 이루어진 nc886 전체 유전자, 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자인, DNA-손상 제제(damaging agent)의 암 치료 보조제.
  9. 제 7항에 있어서, 상기 DNA-손상 제제(damaging agent)는 안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파인, DNA-손상 제제(damaging agent)의 암 치료 보조제.
  10. (a) 병리학적으로 암으로 판단된 암 환자로부터 분리된 생물학적 시료로부터 nc886의 유전자 또는 이의 단백질 발현 수준; 및 PKR의 유전자 발현 수준 또는 이의 단백질의 활성 수준을 측정하는 단계; 및
    (b) 상기 측정된 nc886 유전자의 발현 수준이 정상 대조군 시료보다 낮으며, PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준이 정상 대조군 시료보다 높은 경우, 상기 암 환자에게 DNA-손상 제제(damaging agent) 및 PKR 저해제를 투여하도록 하는, 약물 선택 정보를 제공하는 단계;
    를 포함하는, nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준에 따른 암 치료를 위한 약물의 정보 제공 방법.
  11. 제 10항에 있어서, 상기 PKR 저해제는 imidazolo-oxindole compound, 2-aminopurine (2-AP), 서열번호 1의 염기서열로 이루어진 nc886 전체 유전자 또는 서열번호 2의 염기서열로 이루어진 nc886의 일부 유전자인, nnc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준에 따른 암 치료를 위한 약물의 정보 제공 방법.
  12. 제 10항에 있어서, 상기 DNA-손상 제제(damaging agent)는 백안트라사이클린계 약물, 백금계 항암 약물, 질소 머스타드(nitrogen mustard), 사이클로포스파미드, 멜파란(melphalan), 클로람부실, 비스-클로로에틸니트로소우레아, 스트렙토조신, 부설판 또는 티오테파인, nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준에 따른 암 치료를 위한 약물의 정보 제공 방법.
  13. 제 10항에 있어서, 상기 PKR 저해제는 DNA-손상 제제(damaging agent)에 의한 부작용을 완화 또는 감소시키는, nc886의 유전자의 발현 수준; 및 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준에 따른 암 치료를 위한 약물의 정보 제공 방법.
  14. nc886의 유전자의 발현 수준; 및/또는 PKR의 유전자의 발현 수준 또는 이의 단백질의 활성 수준을 측정할 수 있는 제제를 포함하는, 암 치료를 위한 약물 또는 이의 투여의 정보를 제공하기 위한 키트.
  15. 제 14항에 있어서, 상기 유전자의 발현을 측정하는 제제는 안티센스 올리고뉴클레오티드, 프라이머 쌍 또는 프로브인, 암 치료를 위한 약물의 정보를 제공하기 위한 키트.
  16. 제 14항에 있어서, 상기 단백질의 활성을 측정하는 제제는 PKR의 인산화에 특이적으로 결합하는 항체인, 암 치료를 위한 약물의 정보를 제공하기 위한 키트.
PCT/KR2018/015450 2018-12-06 2018-12-06 Nc886 및/또는 pkr 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법 Ceased WO2020116688A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2018/015450 WO2020116688A1 (ko) 2018-12-06 2018-12-06 Nc886 및/또는 pkr 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2018/015450 WO2020116688A1 (ko) 2018-12-06 2018-12-06 Nc886 및/또는 pkr 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법

Publications (1)

Publication Number Publication Date
WO2020116688A1 true WO2020116688A1 (ko) 2020-06-11

Family

ID=70974333

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/015450 Ceased WO2020116688A1 (ko) 2018-12-06 2018-12-06 Nc886 및/또는 pkr 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법

Country Status (1)

Country Link
WO (1) WO2020116688A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118240776A (zh) * 2024-05-29 2024-06-25 上海凌医生物科技有限公司 一种提高aav病毒产量的方法

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
AHN, J.-H.: "nc886 is induced by TGF-13 and suppresses the microRNA pathway in ovarian cancer", NATURE COMMUNICATIONS, 21 March 2018 (2018-03-21), pages 1 - 14, XP055620928 *
BENNETT RICHARD L., CARRUTHERS AUBREY L., HUI TENG, KERNEY KRYSTAL R., LIU XIANGFEI, MAY W. STRATFORD: "Increased expression of the dsRNA-activated protein kinase PKR in breast cancer promotes sensitivity to doxorubicin", PLOS ONE, 2012, pages 1 - 12, XP055717296 *
JEON, S. H.: "A tumor surveillance model: a non-coding RNA senses neoplastic cells and its protein partner signals cell death", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, 2012, pages 13134 - 13139, XP055717290 *
KUNKEAW N, JEON S H, LEE K, JOHNSON B H, TANASANVIMON S, JAVLE M, PAIROJKUL C, CHAMGRAMOL Y, WONGFIENG W, GONG B, LEELAYUWAT C, LE: "Cell death/proliferation roles for nc886, a non-coding RNA, in the protein kinase R pathway in cholangiocarcinoma", ONCOGENE, 2013, pages 3722 - 3731, XP055717300 *
LEE J. H., PARK J.-E., CHO J., YI H., KIM V. N.: "PKR is activated by cellular dsRNAs during mitosis and acts as a mitotic regulator", GENES & DEVELOPMENT, 2014, pages 1310 - 1322, XP055717291 *
LEE, E. K.: "nc886, a non-coding RNA and suppressor of PKR , exerts an oncogenic function in thyroid cancer", ONCOTARGET, 2016, pages 75000 - 75012, XP055461434 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118240776A (zh) * 2024-05-29 2024-06-25 上海凌医生物科技有限公司 一种提高aav病毒产量的方法

Similar Documents

Publication Publication Date Title
US10358644B2 (en) Polycomb-associated non-coding RNAs
US20220119817A1 (en) Polycomb-associated Non-Coding RNAs
US20230348908A1 (en) RNA Interactome of Polycomb Repressive Complex 1 (PRC1)
US11001841B2 (en) CCCTC-binding factor (CTCF) RNA interactome
EP2655621B1 (en) Polycomb-associated non-coding rnas
EP3302522B1 (en) Means and methods for treating facioscapulohumeral muscular dystrophy (fshd).
WO2020116688A1 (ko) Nc886 및/또는 pkr 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법
KR102143701B1 (ko) nc886 및/또는 PKR 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법
US20200157537A1 (en) Modulating RNA Interactions with Polycomb Repressive Complex 1 (PRC1)
WO2017188707A1 (en) Dicer substrate rna nanostructures with enhanced gene silencing effect and preparation method thereof
WO2023163497A1 (ko) Ednra 억제제를 유효성분으로 포함하는 대장암의 예방 또는 치료용 약학적 조성물
WO2011087343A2 (ko) Hpv 감염과 관련된 암의 치료용 조성물
Serafim et al. CDK12/13 inhibition disrupts nucleolar morphology and promotes aberrant expression of IGS transcripts
WO2017061828A1 (ko) Plrg1 (pleiotropic regulator 1) 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학 조성물
Guittet et al. Upregulation of the p53R2 ribonucleotide reductase subunit by nitric oxide
AU2011349464A9 (en) Polycomb-associated non-coding RNAS
US9045752B2 (en) NKX3-1 saRNA and KLF4 saRNA and uses thereof
US20200199588A1 (en) Polycomb-Associated Non-Coding RNAs
WO2018038558A1 (ko) 마이크로 rna를 포함하는 이중나선 올리고 rna 구조체
이재은 Study on the initiation mechanism of Alternative Lengthening of Telomeres upon BRCA2 abrogation
WO2025178391A1 (ko) Odc1 억제제를 유효성분으로 함유하는, 항암제 내성 억제, 항암제 반응성 회복 또는 항암제 민감성 증진용 약학적 조성물
Ozturk Identification of Novel Transcriptional Modulators of Oncogenesis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18942336

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18942336

Country of ref document: EP

Kind code of ref document: A1