WO2020102644A2

WO2020102644A2 - Methods and monitoring of treatment with vegf/dll4 binding agent

Info

Publication number: WO2020102644A2
Application number: PCT/US2019/061651
Authority: WO
Inventors: Alayne Lisette BRUNNER; Suqin Cai
Original assignee: Oncomed Pharmaceuticals, Inc.
Priority date: 2018-11-15
Filing date: 2019-11-15
Publication date: 2020-05-22
Also published as: AU2019380595A1; CA3119458A1; EP3880697A2; WO2020102644A3

Abstract

The present invention relates to VEGF/DLL4 binding agents, including methods of treatment (e.g., treatment of cancer or tumor) with a VEGF/DLL4 binding agent and methods of monitoring treatment with a VEGF/DLL4 binding agent.

Description

METHODS AND MONITORING OF TREATMENT WITH VEGF/DLL4 BINDING

AGENT

CROSS-REFERENCE TO RELATED APPLICATONS

[0001] This application claims the priority benefit of U.S. Provisional Application No.

62/767,923, filed November 15, 2018, which is hereby incorporated by reference herein in its entirety.

REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY VIA EFS-WEB

[0002] The content of the electronically submitted Sequence Listing (Name: OMP-175- PCT_SeqListing.txt; Size: 185 kilobytes; and Date of Creation: November 14, 2019) is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0003] The present invention relates to the field of treating a subject with a VEGF/DLL4 binding agent. More particularly, the present invention includes methods of treatment with a VEGF/DLL4 binding agent and methods of monitoring treatment with the same.

BACKGROUND OF THE INVENTION

[0004] Cancer is one of the leading causes of death in the developed world, with over 1 million people diagnosed with cancer and 500,000 deaths per year in the United States alone. It is estimated that more than 1 in 3 people will develop some form of cancer during their lifetime. There are more than 200 different types of cancer, four of which— breast, lung, colorectal, and prostate— account for almost half of all new cases (Siegel et al., 2011, CA: A Cancer J. Clin. 61 :212-236).

[0005] The focus of cancer drug research is shifting toward targeted therapies aimed at genes, proteins and pathways involved in human cancer. There is a need for new agents targeting signaling pathways and new combinations of agents that target multiple pathways that could provide therapeutic benefit for cancer patients. Thus, biomolecules (e.g., bispecific antibodies) that disrupt multiple signaling pathways are a potential source of new therapeutic agents for cancer. Signaling pathways implicated in human oncogenesis include, but are not limited to, the vascular endothelial growth factor (VEGF) pathway and the Notch pathway.

[0006] The VEGF pathway is involved in multiple aspects of vascular development and involves a family of proteins acting as angiogenic activators, including VEGF-A, VEGF-B, VEGF-C, VEGF-E and their respective receptors (VEGFR-1, VEGFR-2 and VEGFR-3). VEGF-A, also referred to as VEGF or vascular permeability factor (VPF), exists in five isoforms that arise from alternative splicing of mRNA of a single VEGF gene: VEGFm, VEGF 145, VEGFies, VEGF₁₈₉ and VEGF₂₀₆. VEGF₁₆₅ appears to be the most abundant and potent isoform with regard to biologic angiogenic function, followed by VEGFm and VEGF₁₈₉.

[0007] Anti- VEGF antibodies have been shown to suppress the growth of tumor cells in vitro and in vivo. A humanized anti- VEGF monoclonal antibody, bevacizumab (AVASTIN) has been developed and approved in the United States as a cancer therapeutic. Furthermore, it has been reported that VEGF may be a prognostic factor for some cancers that could identify patients with poor survival and higher risk of death that could benefit from therapy with bevacizumab therapy (Bandiera et al., 2012, ISRN Obstetrics and Gynecology, 2012: 1-11 ; Int'l Pub. No. 2013/083499; Int'l Pub. No. 2016/077227).

[0008] Placental growth factor (P1GF or PFGF) is a member of the VEGF family and a ligand of vascular endothelial growth factor receptor 1 (VEGFR-1) (Chang et al., 2012, Brain Tumors, 3^rd Ed. pp. 102-113; Williams et al., 2010, Basic Science in Obstetrics and Gynaecology, 4^th Ed. pp. 173-230). P1GF is a 149-amino-acid mature protein with a 21-amino-acid signal sequence and a centrally located platelet derived growth factor (PDGF)-like domain. It shares a 42% sequence homology with VEGF, and the two are structurally similar. Four human forms of P1GF have been described, PlGF-1 through P1GF-4. P1GF has angiogenic properties, enhancing survival, growth and migration of endothelial cells in vitro, and promotes vessel formation in certain in vivo models. It is thus regarded as a central component in regulating vascular function. Moreover, increased P1GF expression has been found to correlate with disease progression and decreased patient survival in colorectal cancer.

[0009] The Notch pathway is also involved in multiple aspects of vascular development (Iso et al., 2003, Arterioscler. Thromb. Vase. Biol., 23:543). The Notch receptor ligand DLL4 (delta-like ligand 4) is an important component of the Notch pathway and plays a role in angiogenesis. Heterozygous loss of DLL4 results in severe defects in arterial development and yolk sac vascularization, leading to embryonic lethality (Duarte et al., 2004, Genes Dev., 18:2474-78; Gale et al., 2004, PNAS, 101 : 15949-54; Krebs et al., 2004, Genes Dev., 18:2469-73). Furthermore, tumor cells and tumor vasculature often over-express DEE4, suggesting that DEE4 expression is an important player in tumor angiogenesis (Patel et al., 2005, Cancer Res., 65:8690-97; Yan et al., 2001, Blood, 98:3793-99). Thus, blocking DEE4 signaling has emerged as a promising path for the development of new anti-cancer therapies.

[0010] Blocking DEE4 signaling, such as with an anti-DEE4 antibody, has been shown to reduce tumor growth by multiple different mechanisms (Ridgway et al., 2006, Nature, 444: 1083-87; Noguera-Troise et al., Nature, 444: 1032-37; Hoey et al., 2009, Cell Stem Cell, 5: 168-77). For example, DFF4-blocking antibodies have been reported to result in endothelial cell proliferation and the development of blood vessels, however, these blood vessels lack a functional lumen. This dysangiogenic effect has been reported to block tumor growth by promoting the development of only non-functional blood vessels (Ridgway et al., 2006, Nature, 444: 1083-87; Noguera-Troise et al., Nature, 444:1032-37; Scehnet et al., 2007, Blood, 109:4753-60). Additionally, DLL4 blocking antibodies have been shown to inhibit tumor growth by reducing the proliferation of tumor cells and reducing cancer stem cell frequency. Although the mechanism behind the reduction of cancer stem cells or CSCs is unknown, it is hypothesized that DLL4 is required for the self-renewal of CSCs and maintains these cells in an undifferentiated state (Hoey et al., 2009, Cell Stem Cell, 5: 168- 77).

[0011] Despite these advances, there is still great potential for further improvements. It is one of the objectives of the present invention to provide improved treatment and monitoring methods for VEGF/DLL4 binding agents.

SUMMARY OF THE INVENTION

[0012] The present invention provides methods related to the treatment of a subject (e.g., treatment of cancer or tumor) with an agent that binds VEGF and/or DLL4 (e.g., a VEGF/DLL4 binding agent).

[0013] In a first aspect, the invention provides a method of selecting a subject for treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of VEGF and/or P1GF in a sample from the subject; and (b) selecting the subject for treatment with the VEGF/DLL4 binding agent if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF.

[0014] In another aspect, the invention provides a method of selecting a subject for treatment with a VEGF/DLL4 binding agent, comprising (a) obtaining a sample from the subject; (b) determining the level of VEGF and/or P1GF in the sample; and (c) selecting the subject for treatment with the VEGF/DLL4 binding agent if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF.

[0015] In another aspect, the invention provides a method of identifying a subject as eligible for treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of VEGF and/or P1GF in a sample from the subject; and (b) identifying the subject as eligible for treatment with the VEGF/DLL4 binding agent if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF.

[0016] In another aspect, the invention provides a method of identifying a subject as eligible for treatment with a VEGF/DLL4 binding agent, comprising (a) obtaining a sample from the subject; (b) determining the level of VEGF and/or P1GF in the sample; and (c) identifying the subject as eligible for treatment with the VEGF/DLL4 binding agent if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF. [0017] In certain embodiments of such methods, the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less. In certain embodiments, the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml. In certain embodiments, the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 mg/pg.

[0018] In certain embodiments of such methods, the predetermined level of P1GF is about 50 pg/ml or less, about 75 pg/ml or less, about 100 pg/ml or less, about 120 pg/ml or less, about 150 pg/ml or less, or about 200 pg/ml or less. In certain embodiments, the predetermined level of P1GF is from about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 150 pg/ml, about 50 pg/ml to about 120 pg/ml, about 50 pg/ml to about 100 pg/ml, about 50 pg/ml to about 75 pg/ml, about 75 pg/ml to about 200 pg/ml, about 75 pg/ml to about 150 pg/ml, about 75 pg/ml to about 120 pg/ml, about 75 pg/ml to about 100 pg/ml, about 100 pg/ml to about 200 pg/ml, about 100 pg/ml to about 150 pg/ml, about 100 pg/ml to about 120 pg/ml, about 120 pg/ml to about 200 pg/ml, about 120 pg/ml to about 150 pg/ml, or about 150 pg/ml to about 200 pg/ml. In certain embodiments, the predetermined level of P1GF is about 50 pg/ml, about 75 pg/ml, about 100 pg/ml, about 120 pg/ml, about 150 pg/ml, or about 200 pg/ml.

[0019] In certain embodiments of such methods, the predetermined level of VEGF and/or P1GF is a normal reference level of VEGF and/or P1GF. In certain embodiments of such methods, the predetermined level of VEGF and/or P1GF is the level of VEGF and/or P1GF in a sample obtained at an earlier date. In certain embodiments of such methods, the predetermined level of VEGF and/or P1GF is the level of VEGF and/or P1GF in a sample obtained prior to treatment with the VEGF/DLL4 binding agent.

[0020] In certain embodiments of such methods, the subject has not previously received treatment with the VEGF/DLL4 binding agent. In certain embodiments of such methods, the obtaining, determining and/or identifying occur prior to administration of the VEGF/DLL4 binding agent.

[0021] In certain embodiments of such methods, the method further comprises administering the VEGF/DLL4 binding agent to the subject if the subject is eligible for treatment with the VEGF/DLL4 binding agent. In certain embodiments, the VEGF/DLL4 binding agent is administered to the subject in an amount in excess of VEGF level of the subject. In certain embodiments, the VEGF level is a plasma VEGF level. [0022] In certain embodiments of such methods, the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg. In certain embodiments, the VEGF/DLL4 binding agent is administered weekly, every two weeks, every three weeks, or every four weeks. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg every two weeks.

[0023] In another aspect, the invention provides a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of VEGF in a sample from the subject; and (b) selecting the subject for termination of treatment if the level of VEGF decreases after treatment with the VEGF/DLL4 binding agent.

[0024] In another aspect, the invention provides a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) obtaining a sample from the subject; (b) determining the level of VEGF in the sample; and (c) selecting the subject for termination of treatment if the level of VEGF decreases after treatment with the VEGF/DLL4 binding agent.

[0025] In another aspect, the invention provides a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of VEGF in a sample from the subject; and (b) selecting the subject for risk of cancer or tumor progression if the level of VEGF decreases after treatment with the VEGF/DLL4 binding agent.

[0026] In another aspect, the invention provides a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) obtaining a sample from the subject; (b) determining the level of VEGF in the sample; and (c) selecting the subject for risk of cancer or tumor progression if the level of VEGF decreases after treatment with the VEGF/DLL4 binding agent.

[0027] In another aspect, the invention provides a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) determining a first level of VEGF in a first sample from the subject prior to administration of the VEGF/DLL4 binding agent; (b) administering the VEGF/DLL4 binding agent; and (c) determining a second level of VEGF in a second sample from the subject; (d) comparing the first and second VEGF levels; and (e) terminating treatment with the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administered if the second VEGF level is lower than the first VEGF level.

[0028] In certain embodiments of such methods, the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less. In certain embodiments, the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml. In certain embodiments, the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 mg/pg.

[0029] In certain embodiments of such methods, the decrease in VEGF levels is about 100 pg/ml or more, about 200 pg/ml or more, about 400 pg/ml or more, about 600 pg/ml or more, about 800 pg/ml or more, or about 1000 pg/ml or more. In certain embodiments, the decrease in VEGF levels is from about 100 pg/ml to about 1000 pg/ml, about 100 pg/ml to about 800 pg/ml, about 100 pg/ml to about 600 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 1000 pg/ml, about 200 pg/ml to about 800 pg/ml, about 200 pg/ml to about 600 pg/ml, about 200 pg/ml to about 400 pg/ml, about 400 pg/ml to about 1000 pg/ml, about 400 pg/ml to about 800 pg/ml, about 400 pg/ml to about 600 pg/ml, about 600 pg/ml to about 1000 pg/ml, about 600 pg/ml to about 800 pg/ml, or about 800 pg/ml to about 1000 pg/ml. In certain embodiments, the decrease in VEGF levels is about 100 pg/ml, about 200 pg/ml, about 400 pg/ml, about 600 pg/ml, about 800 pg/ml, or about 1000 pg/ml.

[0030] In certain embodiments of such methods, the decrease in VEGF levels occurs over at least about 1 week, at least about 2 weeks, at least about 3 weeks or at least about 4 weeks. In certain embodiments, the decrease in VEGF levels occurs over from about 1 week to about 4 weeks, about 1 week to about 3 weeks, about 1 week to about 2 weeks, about 2 weeks to about 4 weeks, about 2 weeks to about 3 weeks, or about 3 weeks to about 4 weeks. In certain embodiments, the decrease in VEGF levels occurs over about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.

[0031] In certain embodiments of such methods, the predetermined level of VEGF is a normal reference level of VEGF. In certain embodiments of such methods, the predetermined level of VEGF is the level of VEGF in a sample obtained at an earlier date.

[0032] In certain embodiments of such methods, the subject has received treatment with the VEGF/DLL4 binding agent. In certain embodiments of such methods, the obtaining, determining and/or identifying occur after administration of the VEGF/DLL4 binding agent.

[0033] In certain embodiments of such methods, the method further comprises terminating administration of the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administered if the level of VEGF decreases during treatment with the VEGF/DLL4 binding agent.

[0034] In certain embodiments of such methods, the VEGF/DLL4 binding agent is administered to the subject in an amount in excess of VEGF level of the subject. In certain embodiments, the VEGF level is a plasma VEGF level. [0035] In certain embodiments of such methods, the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg. In certain embodiments, the VEGF/DLL4 binding agent is administered weekly, every two weeks, every three weeks, or every four weeks. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg every two weeks.

[0036] In certain embodiments of such methods, a sample is obtained about every week, about every 2 weeks, about every 3 weeks, or about every 4 weeks.

[0037] In another aspect, the invention provides a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) determining a first level of VEGF and/or P1GF in a first sample from the subject obtained prior to treatment with the VEGF/DLL4 binding agent; (b) administering the VEGF/DLL4 binding agent to the subject; (c) determining a second level of VEGF in a second sample from the subject obtained after administration of the VEGF/DLL4 binding agent; and (d) terminating administration of the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administered if (i) the first level of VEGF and/or P1GF in the first sample is at or above a predetermined level of VEGF and/or P1GF, and (ii) the second level of VEGF in the second sample decreases during treatment with the VEGF/DLL4 binding agent.

[0038] In another aspect, the invention provides a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) determining a first level of VEGF and/or P1GF in a first sample from the subject obtained prior to treatment with the VEGF/DLL4 binding agent; (b) administering the VEGF/DLL4 binding agent to the subject; (c) determining a second level of VEGF in a second sample from the subject obtained after administration of the VEGF/DLL4 binding agent; and (d) continuing administration of the VEGF/DLL4 binding agent if (i) the first level of VEGF and/or P1GF in the first sample is below a predetermined level of VEGF and/or P1GF, and (ii) the second level of VEGF in the second sample is above a predetermined level of VEGF and/or if the level of VEGF does not decrease during treatment with the VEGF/DLL4 binding agent.

[0039] In certain embodiments of such methods, the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less. In certain embodiments, the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml. In certain embodiments, the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 mg/pg.

[0040] In certain embodiments of such methods, the predetermined level of P1GF is about 50 pg/ml or less, about 75 pg/ml or less, about 100 pg/ml or less, about 120 pg/ml or less, about 150 pg/ml or less, or about 200 pg/ml or less. In certain embodiments, the predetermined level of P1GF is from about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 150 pg/ml, about 50 pg/ml to about 120 pg/ml, about 50 pg/ml to about 100 pg/ml, about 50 pg/ml to about 75 pg/ml, about 75 pg/ml to about 200 pg/ml, about 75 pg/ml to about 150 pg/ml, about 75 pg/ml to about 120 pg/ml, about 75 pg/ml to about 100 pg/ml, about 100 pg/ml to about 200 pg/ml, about 100 pg/ml to about 150 pg/ml, about 100 pg/ml to about 120 pg/ml, about 120 pg/ml to about 200 pg/ml, about 120 pg/ml to about 150 pg/ml, or about 150 pg/ml to about 200 pg/ml. In certain embodiments, the predetermined level of P1GF is about 50 pg/ml, about 75 pg/ml, about 100 pg/ml, about 120 pg/ml, about 150 pg/ml, or about 200 pg/ml.

[0041] In certain embodiments of such methods, the VEGF/DFF4 binding agent is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg. In certain embodiments, the VEGF/DEE4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg. In certain embodiments, the VEGF/DEE4 binding agent is administered weekly, every two weeks, every three weeks, or every four weeks. In certain embodiments, the VEGF/DEE4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks. In certain embodiments, the VEGF/DEE4 binding agent is administered at a dose of about 3 mg/kg every two weeks.

[0042] In another aspect, the invention provides a method of selectively treating a subject with a VEGF/DEE4 binding agent, comprising selectively administering a VEGF/DEE4 binding agent on the basis of the subject (a) having a level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to administration of the VEGF/DLL4 binding agent; and/or (b) having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent.

[0043] In another aspect, the invention provides a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising (a) selecting the subject for treatment with VEGF/DLL4 binding agent on the basis of the subject having a baseline level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to a first administration of the VEGF/DLL4 binding agent; and (b) administering the VEGF/DLL4 binding agent to the patient. [0044] In another aspect, the invention provides a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising (a) administering the VEGF/DLL4 binding agent to the patient; and (b) selecting the subject for continued administration of the VEGF/DLL4 binding agent on the basis of the subject having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent; (c) continuing administration of the VEGF/DLL4 binding agent.

[0045] In another aspect, the invention provides a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising (a) selecting the subject for a first treatment with VEGF/DLL4 binding agent on the basis of the subject having a baseline level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to administration of the VEGF/DLL4 binding agent; (b) administering a first dose of the VEGF/DLL4 binding agent to the patient; (c) selecting the subject for continued treatment with the VEGF/DLL4 binding agent on the basis of the subject having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent; and (d) continuing administration of the VEGF/DLL4 binding agent to the patient.

[0046] In another aspect, the invention provides a method of treating a subject with a VEGF/DLL4 binding agent, comprising determining whether the subject is eligible for treatment with a VEGF/DLL4 binding agent by (i) obtaining or having obtained a sample from the subject; and (ii) performing or having performed an assay on the sample to determine if the subject is eligible for treatment with a VEGF/DLL4 binding agent; and administering the VEGF/DLL4 binding agent to the subject if the subject is eligible for treatment with the VEGF/DLL4 binding agent.

[0047] In another aspect, the invention provides a method of treating a subject with a VEGF/DLL4 binding agent, comprising (a) determining a first level of VEGF and/or P1GF in a first sample from the subject obtained before treatment with the VEGF/DLL4 binding agent; (b) administering the VEGF/DLL4 binding agent to the subject if the first level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF; (c) determining a second level of VEGF in a second sample from the subject obtained after administration of the VEGF/DLL4 binding agent; and (d) continuing treatment with the VEGF/DLL4 binding agent if the second level of VEGF is above a predetermined level of VEGF and/or if the level of VEGF does not decrease during treatment with the VEGF/DLL4 binding agent.

[0048] Furthermore, the invention provides a VEGF/DEE4 binding agent or a composition comprising a VEGF/DEE4 binding agent for use in the methods of selectively treating a subject described in this application. The invention additionally provides a use of a VEGF/DEE4 binding agent or a composition comprising a VEGF/DEE4 binding agent for the manufacture of a medicament for the methods of selectively treating a subject as described in this application. [0049] In certain embodiments of such methods, the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less. In certain embodiments, the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml. In certain embodiments, the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 mg/pg.

[0050] In certain embodiments of such methods, the predetermined level of P1GF is about 50 pg/ml or less, about 75 pg/ml or less, about 100 pg/ml or less, about 120 pg/ml or less, about 150 pg/ml or less, or about 200 pg/ml or less. In certain embodiments, the predetermined level of P1GF is from about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 150 pg/ml, about 50 pg/ml to about 120 pg/ml, about 50 pg/ml to about 100 pg/ml, about 50 pg/ml to about 75 pg/ml, about 75 pg/ml to about 200 pg/ml, about 75 pg/ml to about 150 pg/ml, about 75 pg/ml to about 120 pg/ml, about 75 pg/ml to about 100 pg/ml, about 100 pg/ml to about 200 pg/ml, about 100 pg/ml to about 150 pg/ml, about 100 pg/ml to about 120 pg/ml, about 120 pg/ml to about 200 pg/ml, about 120 pg/ml to about 150 pg/ml, or about 150 pg/ml to about 200 pg/ml. In certain embodiments, the predetermined level of P1GF is about 50 pg/ml, about 75 pg/ml, about 100 pg/ml, about 120 pg/ml, about 150 pg/ml, or about 200 pg/ml.

[0051] In certain embodiments of such methods, the predetermined level of VEGF and/or P1GF is a normal reference level of VEGF and/or P1GF. In certain embodiments of such methods, the predetermined level of VEGF and/or P1GF is the level of VEGF and/or P1GF in a sample obtained at an earlier date.

[0052] In certain embodiments of such methods, the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg. In certain embodiments, the VEGF/DLL4 binding agent is administered weekly, every two weeks, every three weeks, or every four weeks. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks. In certain embodiments, the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg every two weeks.

[0053] In certain embodiments of the methods of the invention, the subject is human. In certain embodiments, the subject has cancer or a tumor. In certain embodiments, the cancer or tumor has a mutation in CTNNB1. [0054] In certain embodiments of the methods of the invention, the cancer is lung cancer, breast cancer, colon cancer, colorectal cancer, melanoma, pancreatic cancer, gastrointestinal cancer, renal cancer, ovarian cancer, liver cancer, endometrial cancer, kidney cancer, prostate cancer, thyroid cancer, neuroblastoma, glioma, glioblastoma, melanoma, cervical cancer, stomach cancer, bladder cancer, gallbladder cancer, nasopharygeal cancer, myoepithelial cancer, fallopian tube cancer, uterine cancer, neuroendocrine cancer, sarcoma, adrenal cancer, hepatoma, lymphoma, leukemia, or head and neck cancer.

[0055] In certain embodiments of the methods of the invention, the tumor is a colorectal tumor, colon tumor, ovarian tumor, pancreatic tumor, lung tumor, liver tumor, breast tumor, kidney tumor, prostate tumor, gastrointestinal tumor, melanoma, cervical tumor, bladder tumor, or glioblastoma.

[0056] In preferred embodiments of the methods of the invention, the subject has failed to respond to another anti-cancer treatment. For example, the subject may have failed to respond to at least one, two, three, or four prior therapies (e.g., failure of more than two, such as three or four, prior therapies) and/or the subject has failed to respond to an anti-VEGF agent (e.g., an anti-VEGF antibody such as bevacizumab).

[0057] In certain embodiments of the methods of the invention, the cancer is platinum-resistant ovarian cancer, platinum-resistant primary peritoneal cancer, or platinum-resistant fallopian cancer, or the tumor is a platinum-resistant ovarian tumor, platinum-resistant primary peritoneal tumor, or platinum-resistant fallopian tumor. In preferred embodiments, the cancer is platinum-resistant ovarian cancer, primary peritoneal or fallopian tube cancer. In other embodiments, the cancer is platinum-resistant gastric or colorectal cancer.

[0058] In preferred embodiments, the cancer is high grade ovarian, primary peritoneal or fallopian tube cancer, wherein the subject has failed to respond to at least 3 prior therapies and/or the prior administration of bevacizumab. For example, the invention provides a VEGF/DLL4 binding agent or a composition comprising a VEGF/DLL4 binding agent for use in a method of selectively treating a subject with high grade ovarian, primary peritoneal or fallopian tube cancer, wherein the subject has failed to respond to at least 3 prior therapies and/or the prior administration of bevacizumab.

[0059] In further preferred emodiments, the VEGF/DLL4 binding agent is used in combination with paclitaxel. For example, the VEGF/DLL4 binding agent is used in combination with paclitaxel for use in a method of of selectively treating a subject, whererin the cancer is high grade ovarian, primary peritoneal or fallopian tube cancer and wherein the subject has failed to respond to at least 3 prior therapies and/or the prior administration of bevacizumab.

[0060] In certain embodiments of the methods of the invention, the VEGF/DLL4 binding agent is a VEGF/DLL4 antagonist. In certain embodiments, the VEGF/DLL4 antagonist is an antibody. In certain embodiments, the antibody comprises a VEGF binding site of bevacizumab; a heavy chain variable domain of bevacizumab; a light chain variable domain of bevacizumab; or a heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2 and light chain CDR3 of bevacizumab. In certain embodiments, the antibody is a monoclonal antibody, a recombinant antibody, a chimeric antibody, a humanized antibody, a human antibody, an antibody fragment comprising an antigen-binding site, a modified immunoglobulin molecule comprising an antigen-binding site, a dual variable domain antibody, a bispecific antibody, an IgGl antibody, an IgG2 antibody, an IgG4 antibody, a monovalent bispecific antibody, a bivalent bispecific antibody, or a dual variable domain antibody.

[0061] In certain embodiments, the antibody is a bispecific antibody comprising (a) a first heavy chain variable region having at least 90% sequence identity to SEQ ID NO: l l ; (b) a second heavy chain variable region having at least 90% sequence identity to SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 58, or SEQ ID NO: 64; and (c) a first and a second light chain variable region having at least 90% sequence identity to SEQ ID NO: 12.

[0062] In certain embodiments, the antibody comprises a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4, wherein (a) the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19); the second antigen binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISN YNR ATN YN QKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22); or (b) the first antigen-binding site comprises a heavy chain variable region that has at least 95% sequence identity to SEQ ID NO: 11 and comprises a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19) and one or more of (i) a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17) and (ii) a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18); the second antigen-binding site comprises a heavy chain variable region that has at least 95% sequence identity to SEQ ID NO:64 and comprises a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16) and one or more of (i) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) and (ii) a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65); and both the first and second antigen-binding sites comprise an identical light chain variable region that has at least 95% sequence identity to SEQ ID NO: 12.

[0063] In certain embodiments, the antibody specifically binds human DLL4, wherein the antibody comprises (a) a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 104, SEQ ID NO: 15 or SEQ ID NO: 105), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22), or (b) a heavy chain variable region comprising amino acid sequence SEQ ID NO: 106, SEQ ID NO:9 or SEQ ID NO: 107, or a light chain variable region comprising SEQ ID NO: 12.

[0064] In certain embodiments, the antibody comprises a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 104, SEQ ID NO: 15 or SEQ ID NO: 105), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22).

[0065] In certain embodiments, the antibody comprises a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 15), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22).

[0066] In certain embodiments, the antibody comprises a heavy chain variable region comprising amino acid sequence SEQ ID NO: 106, SEQ ID NO:9 or SEQ ID NO: 107.

[0067] In certain embodiments, the antibody comprises a heavy chain variable region comprising SEQ ID NO:9 or a light chain variable region comprising SEQ ID NO: 12.

[0068] In certain embodiments of the methods of the invention, the cancer is colorectal cancer or the tumor is colorectal tumor, the antibody comprises (a) a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO:104, SEQ ID NO: 15 or SEQ ID NO:105), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO: 22), or (b) a heavy chain variable region comprising amino acid sequence SEQ ID NO: 106, SEQ ID NO:9 or SEQ ID NO: 107, or a light chain variable region comprising SEQ ID NO: 12; and the VEGF/DLL4 binding agent is administered in combination with irinotecan.

[0069] In certain embodiments of the methods of the invention, the antibody comprises (a) a first antigen-binding site that specifically binds human VEGF; and (b) a second antigen-binding site that specifically binds human DLL4; wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising

DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising

HYDDKYYPLMDY (SEQ ID NO: 19); wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YI AN YNRATN YN QKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YIAGYKDATNYNQKFKG (SEQ ID NO:59), or YISN YNRATN YN QKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In certain embodiments, the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13). In certain embodiments, the second antigen-binding site comprises a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65). In certain embodiments, the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) and a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65). In certain embodiments, the first antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO: 11. In certain embodiments, the second antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO:64. In certain embodiments, both the first and second antigen-binding sites comprise a light chain variable region comprising SEQ ID NO: 12. In certain embodiments, the first antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO: 11 and a light chain variable region comprising SEQ ID NO: 12, and the second antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO:64 and a light chain variable region comprising SEQ ID NO: 12.

[0070] In certain embodiments of the methods of the invention, the cancer is colorectal cancer or the tumor is colorectal tumor, the antibody comprises (a) a first antigen-binding site that specifically binds human VEGF; and (b) a second antigen-binding site that specifically binds human DLL4; wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19); wherein the second antigen binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YI AN YNRATN YN QKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YI AGYKD ATN YN QKFKG (SEQ ID NO:59), or YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22); and the antibody is administered in combination with irinotecan.

[0071] In certain embodiments of the methods of the invention, the VEGF/DLL4 binding agent comprises a first and second polypeptide chains, each independently comprising VDl-(Xl)n-VD2- C-(X2)n, wherein VD1 is a first variable domain; VD2 is a second variable domain; C is a constant domain; XI is a linker; X2 is an Fc region; n is 0 or 1, wherein the VD1 domains on the first and second polypeptide chains form a first functional target binding site and the VD2 domains on the first and second polypeptide chains form a second functional target binding site, and wherein the binding protein is capable of binding DLL4 and VEGF, wherein the first polypeptide chain of the binding protein comprises SEQ ID NO: 81 and the second polypeptide chain of the binding protein comprises SEQ ID NO: 82. In certain embodiments, the binding protein comprises the constant region sequences from SEQ ID NO: 83 and/or SEQ ID NO: 84. In certain embodiments, the first and second polypeptide chains of the binding protein comprise SEQ ID NOs:83 and 84.

[0072] In certain embodiments of the methods of the invention, the VEGF/DLL4 binding agent comprises a protein specifically binding to DLL4, which recognizes a conformational epitope of DLL4 comprising amino acid residues 58th to 65th amino acid sequences and 110th to 115th amino acid sequences in amino acid sequences of DLL4 protein represented by SEQ ID NO:85, and an antibody specifically binding to VEGF. In certain embodiments, the protein specifically binding to DLL4 comprises a heavy chain variable region comprising heavy chain CDR1 having an amino acid sequence represented by SEQ ID NO: 86, heavy chain CDR2 having an amino acid sequence represented by SEQ ID NO: 87, and heavy chain CDR3 having an amino acid sequence represented by SEQ ID NO:88, and a light chain variable region comprising light chain CDR1 having an amino acid sequence represented by SEQ ID NO: 89, light chain CDR2 having an amino acid sequence represented by SEQ ID NO:90, and light chain CDR3 having an amino acid sequence represented by SEQ ID NO:91. In certain embodiments, the protein binding specifically to DLL4 comprises a heavy chain amino acid sequence represented by SEQ ID NO:92 and a light chain amino acid sequence represented by SEQ ID NO:93. In certain embodiments, the antibody specifically binding to VEGF comprises a heavy chain variable region comprising heavy chain CDR1 having an amino acid sequence represented by SEQ ID NO:94, heavy chain CDR2 having an amino acid sequence represented by SEQ ID NO:95, and heavy chain CDR3 having an amino acid sequence represented by SEQ ID NO:96, and a light chain variable region comprising light chain CDR1 having an amino acid sequence represented by SEQ ID NO:97, light chain CDR2 having an amino acid sequence represented by SEQ ID NO:98, and light chain CDR3 having an amino acid sequence represented by SEQ ID NO:99. In certain embodiments, the antibody specifically binding to VEGF comprises a heavy chain variable region having an amino acid sequence represented by SEQ ID NO: 100 and a light chain variable region having an amino acid sequence represented by SEQ ID NO: 101. In certain embodiments, the antibody binding specifically to VEGF is Bevacizumab. In certain embodiment, the antibody specifically binding to VEGF comprises a heavy chain variable region having an amino acid sequence represented by SEQ ID NO: 102 and a light chain variable region having an amino acid sequence represented by SEQ ID NO: 103.

[0073] In certain embodiments of the methods of the present invention, the VEGF/DLL4 binding agent is an antibody that is 219R45-MB-21M18, 219R45-MB-21R79, 219R45-MB-21R75, or 219R45-MB-21R83.

[0074] In certain embodiments of the methods of the present invention, the level of VEGF that is determined is the level of VEGF165, VEGF121, or a combination thereof.

[0075] In another aspect, the invention provides a method of selecting a subject for treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1 , CYP1B1, BMP7, MMP19, LEF1, and ECM1 ; and (b) selecting the subject for treatment with the VEGF/DLL4 binding agent if the level of the one or more genes is above a predetermined level.

[0076] In another aspect, the invention provides a method of identifying a subject as eligible for treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B 1, BMP7, MMP19, LEF1, and ECM1 ; and (b) selecting the subject for treatment with the VEGF/DLL4 antagonist if the level of the one or more genes is above a predetermined level.

[0077] In another aspect, the invention provides a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising selectively administering a VEGF/DLL4 binding agent on the basis of the subject having a level of one or more genes in a sample from the subject above a predetermined level, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1 , CYP1B1, BMP7, MMP19, LEF1, and ECM1.

[0078] In another aspect, the invention provides a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising (a) selecting the subject for treatment with VEGF/DLL4 binding agent on the basis of the subject having a level of one or more genes in a sample from the subject above a predetermined level, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B 1, BMP7, MMP19, LEF1, and ECM1 ; and (b) administering the VEGF/DLL4 binding agent to the patient.

[0079] In another aspect, the invention provides a method of treating a subject with a VEGF/DLL4 binding agent, comprising determining whether the subject is eligible for treatment with a VEGF/DLL4 binding agent by (i) obtaining or having obtained a sample from the subject; and (ii) performing or having performed an assay on the sample to determine if the subject is eligible for treatment with a VEGF/DLL4 binding agent; wherein if the subject is eligible for treatment with the VEGF/DLL4 binding agent, then administering the VEGF/DLL4 binding agent to the subject; and wherein the subject is eligible for treatment with the VEGF/DLL4 binding agent if the level of one or more genes selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, LEF1, and ECM1 is above a predetermined level.

[0080] In another aspect, the invention provides a method of identifying a subject as ineligible for treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: PGF, VAV2, APOLD1, EIF2S2, DTX3L, KRIT1, LFNG, STAT1, PTK2, HPSE, DDAH1, FGF9, and EDNRA; and (b) excluding the subject from treatment with the VEGF/DLL4 binding agent if the level of the one or more genes is above a predetermined level.

[0081] In another aspect, the invention provides a method of excluding a subject from treatment with a VEGF/DLL4 binding agent, comprising determining whether the subject is ineligible for treatment with a VEGF/DLL4 binding agent by (i) obtaining or having obtained a sample from the subject; and (ii) performing or having performed an assay on the sample to determine if the subject is ineligible for treatment with a VEGF/DLL4 binding agent; wherein if the subject is ineligible for treatment with the VEGF/DLL4 binding agent, then the subject is excluded from treatment with the VEGF/DLL4 binding agent; and wherein the subject is ineligible for treatment with the VEGF/DLL4 binding agent if the level of one or more genes selected from the group consisting of: PGF, VAV2, APOLD1, EIF2S2, DTX3L, KRIT1, LFNG, STAT1, PTK2, HPSE, DDAH1, FGF9, and EDNRA is above a predetermined level.

BRIEF DESCRIPTIONS OF THE DRAWINGS

[0082] Figure 1A shows that some patients treated with the anti-DLL4/anti-VEGF bispecific antibody, navicixizumab, exhibit high baseline VEGF protein levels and/or decreased VEGF protein levels after treatment. Figure 1 A shows boxplots of VEGF plasma protein levels (pg/mL) from patients before treatment (Day 0) and after treatment (Day 28) overlaid with matched sample pairs.

[0083] Figure IB shows that some patients treated with navicixizumab exhibited high baseline P1GF protein levels. Figure IB shows boxplots of P1GF plasma protein levels (pg/mL) from patients before treatment (Day 0) and about four weeks after treatment (Day 28) overlaid with matched sample pairs.

[0084] Figure 2 shows that patients with high baseline VEGF and/or P1GF levels or decreased VEGF levels after navicixizumab treatment show poor treatment response. Figure 2 shows a waterfall plot of tumor assessment data grouped by patient best overall response (NE = not evaluable; PD = progressive disease; SD = stable disease; PR = partial response; CR = complete response). The percent change in size of the primary tumor lesion is indicated on the Y-axis for the tumor types and treatment regimens indicated on the X-axis. Mutations in CTNNB1 were observed in tumors from 3 patients (A) having a clinical benefit with treatment (PR or SD).

[0085] Figure 3A shows a gene signature of 26 angiogenesis-related and Notch-related genes expressed in baseline tumor samples identified for association with clinical benefit of treatment with navicixizumab. Figure 3A shows individual gene area under the curve (AUC) values for the top 13 positively correlated genes (left side) and top 13 negatively correlated genes (right side).

[0086] Figure 3B shows the gene signature score for each of the 39 tumors assessed in Figure 3A, grouped by the clinical benefit of treatment with navicixizumab. "Score" was defined as mean (positively correlated 13 genes) - mean (negatively correlated 13 genes). Two-sided Wilcoxon test was used to obtain the p-value for the difference in distribution of signature expression score in patients with PR or SD (clinical benefit =1) and PD (clinical benefit =0).

DETAILED DESCRIPTION OF THE INVENTION

[0087] The present invention provides methods related to the treatment of a subject (e.g., treatment of cancer or tumor) with an agent that binds VEGF and/or DLL4 (e.g., a VEGF/DLL4 binding agent). For example, the present invention provides methods of selecting a subject for treatment with a VEGF/DLL4 binding agent that include determining the level of VEGF and/or P1GF in a sample from the subject before treatment with the VEGF/DLL4 binding agent. The present invention also provides methods of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent that include determining the level of VEGF in a sample from the subject after treatment with the VEGF/DLL4 binding agent. The methods of the present invention can include, for example, (i) administration of the VEGF/DLL4 binding agent to the subject if the level of VEGF and/or P1GF before treatment is below a predetermined level of VEGF and/or P1GF, (ii) terminating administration of the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administered if the level of VEGF decreases after treatment, and/or (iii) continuing administration of the VEGF/DLL4 binding agent if the level of VEGF does not decrease and/or is above a predetermined level of VEGF after treatment. In some embodiments, the level of VEGF is the level of VEGFies, VEGFm, or a combination thereof.

[0088] The VEGF/DLL4 binding agent can be, for example, an antibody that binds VEGF and/or DLL4 (e.g., a bispecific antibody). The methods of the present invention can also include administration of an additional therapeutic with the VEGF/DLL4 binding agent (e.g., an immunotherapeutic agent or anti-cancer agent, e.g., for the treatment of cancer or tumor).

I. Definitions

[0089] To facilitate an understanding of the present invention, a number of terms and phrases are defined below.

[0090] The term "antibody" means an immunoglobulin molecule that recognizes and specifically binds a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing through at least one antigen recognition site or antigen-binding site within the variable region(s) of the immunoglobulin molecule. As used herein, the term "antibody" encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, and Fv fragments), single chain Fv (scFv) mutants, multispecific antibodies such as bispecific antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen-binding site of an antibody, and any other modified immunoglobulin molecule comprising an antigen-binding site as long as the antibodies exhibit the desired biological activity. An antibody can be any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2), based on the identity of their heavy chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively. The different classes of immunoglobulins have different and well known subunit structures and three-dimensional configurations. Antibodies can be naked or conjugated to other molecules including, but not limited to, toxins and radioisotopes. As used herein, the term "antibody" includes, for example, a monoclonal antibody, a recombinant antibody, a chimeric antibody, a humanized antibody, a human antibody, an antibody fragment comprising an antigen binding site, a modified immunoglobulin molecule comprising an antigen-binding site, a dual variable domain antibody, a bispecific antibody, an IgGl antibody, an IgG2 antibody, an IgG4 antibody, a monovalent bispecific antibody, a bivalent bispecific antibody, or a dual variable domain antibody. In some embodiments, the antibody is an anti-VEGF/DLL4 antibody. In some embodiments, the antibody comprises a VEGF binding site of bevacizumab. In some embodiments, the antibody is navicixizumab or ABT-165.

[0091] As used herein, the term "bispecific antibody" encompasses monovalent and multivalent (e.g., bivalent and tetravalent) antibodies of any structural format, including, but not limited to, dual variable domain antibodies (Ig-DVD or DVD-Ig).

[0092] The term "antibody fragment" refers to a portion of an intact antibody and as used herein refers to the antigenic determining variable regions or the antigen-binding site of an intact antibody. "Antibody fragment" as used herein comprises an antigen-binding site or epitope-binding site. Examples of antibody fragments include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, single chain antibodies, and multispecific antibodies formed from antibody fragments.

[0093] The term "variable region" of an antibody refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, either alone or in combination. The variable regions of the heavy chain and light chain generally consist of four framework regions connected by three complementarity determining regions (CDRs) (also known as hypervariable regions). The CDRs in each chain are held together in close proximity by the framework regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of the antibody. There are at least two techniques for determining CDRs: (1) an approach based on cross-species sequence variability (i.e., Rabat et al., 1991, Sequences of Proteins of Immunological Interest, 5th Edition, National Institutes of Health, Bethesda MD); and (2) an approach based on crystallographic studies of antigen-antibody complexes (Al-Fazikani et al., 1997, J. Mol. Biol. 273:927-948). In addition, combinations of these two approaches are sometimes used in the art to determine CDRs. [0094] The term "monoclonal antibody" refers to a homogeneous antibody population involved in the highly specific recognition and binding of a single antigenic determinant or epitope. This is in contrast to polyclonal antibodies that typically include a mixture of different antibodies directed against a variety of different antigenic determinants. The term "monoclonal antibody" encompasses both intact and full-length monoclonal antibodies as well as antibody fragments (such as Fab, Fab', F(ab')2, Fv fragments), single chain Fv (scFv) mutants, fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen-binding site. Furthermore, "monoclonal antibody" refers to such antibodies made by any number of techniques, including but not limited to, hybridoma production, phage selection, recombinant expression, and transgenic animals.

[0095] The term "humanized antibody" refers to forms of non-human (e.g., murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences.

[0096] The term "human antibody" means an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human made using any technique known in the art. This definition of a human antibody includes intact or full-length antibodies, and fragments thereof.

[0097] The term "chimeric antibody" refers to an antibody wherein the amino acid sequence of the immunoglobulin molecule is derived from two or more species. Typically, the variable region of both light and heavy chains corresponds to the variable region of antibodies derived from one species of mammal (e.g., mouse, rat, rabbit, etc.) with the desired specificity, affinity, and/or capability while the constant regions are homologous to the sequences in antibodies derived from another species (usually human) to avoid eliciting an immune response in that species.

[0098] The terms "epitope" and "antigenic determinant" are used interchangeably herein and refer to that portion of an antigen capable of being recognized and specifically bound by a particular antibody. When the antigen is a polypeptide, epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids (also referred to as linear epitopes) are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding (also referred to as conformational epitopes) are typically lost upon protein denaturing. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.

[0099] The terms "heteromultimeric molecule" or "heteromul timer" or "heteromultimeric complex" or "heteromultimeric polypeptide" are used interchangeably herein to refer to a molecule comprising at least a first polypeptide and a second polypeptide, wherein the second polypeptide differs in amino acid sequence from the first polypeptide by at least one amino acid residue. The heteromultimeric molecule can comprise a "heterodimer" formed by the first and second polypeptide or can form higher order tertiary structures where additional polypeptides are present. [00100] The terms "antagonist" and "antagonistic" as used herein refer to any molecule that partially or fully blocks, inhibits, reduces, or neutralizes a biological activity of a target and/or signaling pathway (e.g., the Notch pathway). The term "antagonist" is used herein to include any molecule that partially or fully blocks, inhibits, reduces, or neutralizes the activity of a protein. Suitable antagonist molecules specifically include, but are not limited to, antagonist antibodies or antibody fragments.

[00101] The terms "modulation" and "modulate" as used herein refer to a change or an alteration in a biological activity. Modulation includes, but is not limited to, stimulating or inhibiting an activity. Modulation may be an increase or a decrease in activity (e.g., a decrease in angiogenesis or an increase in angiogenesis), a change in binding characteristics, or any other change in the biological, functional, or immunological properties associated with the activity of a protein, pathway, or other biological point of interest.

[00102] The terms "selectively binds" or "specifically binds" mean that a binding agent or an antibody reacts or associates more frequently, more rapidly, with greater duration, with greater affinity, or with some combination of the above to the epitope, protein, or target molecule than with alternative substances, including unrelated proteins. In some embodiments "specifically binds" means, for instance, that an antibody binds a protein with a K_D of about 0.1 mM or less, but more usually less than about 1 mM. In some embodiments, "specifically binds" means that an antibody binds a target at times with a K_D of at least about 0.1 mM or less, at other times at least about 0.01 pM or less, and at other times at least about 1 nM or less. Because of the sequence identity between homologous proteins in different species, specific binding can include an antibody that recognizes a protein in more than one species (e.g., human VEGF and mouse VEGF). Likewise, because of homology within some regions of polypeptide sequences of different proteins, specific binding can include an antibody (or other polypeptide or binding agent) that recognizes more than one protein (e.g., human VEGF-A and human VEGF-B). It is understood that, in some embodiments, an antibody or binding moiety that specifically binds a first target may or may not specifically bind a second target. As such, "specific binding" does not necessarily require (although it can include) exclusive binding, i.e. binding to a single target. Thus, an antibody may, in some embodiments, specifically bind more than one target. In some embodiments, multiple targets may be bound by the same antigen-binding site on the antibody. For example, an antibody may, in some instances, comprise two identical antigen-binding sites, each of which specifically binds the same epitope on two or more proteins. In some alternative embodiments, an antibody may be multispecific and comprise at least two antigen-binding sites with differing specificities. By way of non-limiting example, a bispecific antibody may comprise one antigen-binding site that recognizes an epitope on one protein (e.g., human VEGF) and further comprise a second, different antigen-binding site that recognizes a different epitope on a second protein (e.g., human DLL4). Generally, but not necessarily, reference to binding means specific binding. [00103] The terms "polypeptide" and "peptide" and "protein" are used interchangeably herein and refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids), as well as other modifications known in the art. It is understood that, because the polypeptides of this invention may be based upon antibodies, in some embodiments, the polypeptides can occur as single chains or associated chains.

[00104] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to polymers of nucleotides of any length, and include DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase.

[00105] "Conditions of high stringency" can be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 15 mM sodium chloride/1.5 mM sodium citrate/0.1% sodium dodecyl sulfate at 50 °C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) form amide with 0.1% bovine serum alhumin/0.1 % FicoII/0.1% poIyvinyIpyrroIidone/50mM sodium phosphate buffer at pH 6.5 in 5x SSC (0.75M NaCl, 75mM sodium citrate) at 42°C; or (3) employ during hybridization 50% formamide in 5x SSC, 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50pg/ml), 0.1% SDS, and 10% dextran sulfate at 42 °C, with washes at 42 °C in 0.2x SSC and 50% formamide, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55 °C.

[00106] The terms "identical" or percent "identity" in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that may be used to obtain alignments of amino acid or nucleotide sequences are well- known in the art. These include, but are not limited to, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variations thereof. In some embodiments, two nucleic acids or polypeptides of the invention are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In some embodiments, identity exists over a region of the sequences that is at least about 10, at least about 20, at least about 40-60 residues, at least about 60-80 residues in length or any integral value therebetween. In some embodiments, identity exists over a longer region than 60-80 residues, such as at least about 80-100 residues, and in some embodiments the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a nucleotide sequence.

[00107] A "conservative amino acid substitution" is one in which one amino acid residue is replaced with another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, substitution of a phenylalanine for a tyrosine is a conservative substitution. Preferably, conservative substitutions in the sequences of the polypeptides and antibodies of the invention do not abrogate the binding of the polypeptide or antibody containing the amino acid sequence, to the antigen to which the polypeptide or antibody binds. Methods of identifying nucleotide and amino acid conservative substitutions which do not eliminate antigen binding are well-known in the art.

[00108] The term "vector" as used herein means a construct, which is capable of delivering, and usually expressing, one or more gene(s) or sequence(s) of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid, or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, and DNA or RNA expression vectors encapsulated in liposomes.

[00109] A polypeptide, antibody, polynucleotide, vector, cell, or composition which is "isolated" is a polypeptide, antibody, polynucleotide, vector, cell, or composition which is in a form not found in nature. Isolated polypeptides, antibodies, polynucleotides, vectors, cells, or compositions include those which have been purified to a degree that they are no longer in a form in which they are found in nature. In some embodiments, a polypeptide, antibody, polynucleotide, vector, cell, or composition which is isolated is substantially pure.

[00110] The term "substantially pure" as used herein refers to material which is at least 50% pure (i.e., free from contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.

[00111] The terms "cancer" and "cancerous" as used herein refer to or describe the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth. [00112] The terms "tumor" and "neoplasm" as used herein refer to any mass of tissue that results from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions.

[00113] The term "metastasis" as used herein refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion at a new location. A "metastatic" or "metastasizing" cell is one that loses adhesive contacts with neighboring cells and migrates via the bloodstream or lymph from the primary site of disease to invade neighboring body structures.

[00114] The terms "cancer stem cell" and "CSC" and "tumor stem cell" and "tumor initiating cell" are used interchangeably herein and refer to cells from a cancer or tumor that: (1) have extensive proliferative capacity; 2) are capable of asymmetric cell division to generate one or more types of differentiated cell progeny wherein the differentiated cells have reduced proliferative or developmental potential; and (3) are capable of symmetric cell divisions for self-renewal or self maintenance. These properties confer on the cancer stem cells the ability to form or establish a tumor or cancer upon serial transplantation into an immunocompromised host (e.g., a mouse) compared to the majority of tumor cells that fail to form tumors. Cancer stem cells undergo self renewal versus differentiation in a chaotic manner to form tumors with abnormal cell types that can change over time as mutations occur.

[00115] The terms "cancer cell" and "tumor cell" refer to the total population of cells derived from a cancer or tumor or pre-cancerous lesion, including both non-tumorigenic cells, which comprise the bulk of the cancer cell population, and tumorigenic stem cells (cancer stem cells). As used herein, the terms "cancer cell" or "tumor cell" will be modified by the term "non-tumorigenic" when referring solely to those cells lacking the capacity to renew and differentiate to distinguish those tumor cells from cancer stem cells.

[00116] The term "tumorigenic" as used herein refers to the functional features of a cancer stem cell including the properties of self-renewal (giving rise to additional tumorigenic cancer stem cells) and proliferation to generate all other tumor cells (giving rise to differentiated and thus non- tumorigenic tumor cells).

[00117] The term "tumorigenicity" as used herein refers to the ability of a random sample of cells from the tumor to form palpable tumors upon serial transplantation into immunocompromised hosts (e.g., mice). This definition also includes enriched and/or isolated populations of cancer stem cells that form palpable tumors upon serial transplantation into immunocompromised hosts (e.g., mice).

[00118] The term "platinum-resistant" in the context of ovarian cancer, refers to a patient with recurrent disease having no response to platinum-based chemotherapy (i.e., disease progression or stable disease as the best response) or, if the cancer did initially respond to platinum-based chemotherapy, but recurred within 6 months of primary treatment. Most patients with recurrent ovarian cancer eventually develop platinum resistance. [00119] The term "subject" refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, canines, felines, rodents, and the like, which is to be the recipient of a particular treatment. Typically, the terms "subject" and "patient" are used interchangeably herein in reference to a human subject.

[00120] The term "pharmaceutically acceptable" refers to a product or compound approved (or approvable) by a regulatory agency of the Federal government or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, including humans.

[00121] The terms "pharmaceutically acceptable excipient, carrier or adjuvant" or "acceptable pharmaceutical carrier" refer to an excipient, carrier or adjuvant that can be administered to a subject, together with at least one binding agent (e.g., an antibody) of the present disclosure, and which does not destroy the activity of the binding agent. The excipient, carrier or adjuvant should be nontoxic when administered with a binding agent in doses sufficient to deliver a therapeutic effect.

[00122] The terms "effective amount" or "therapeutically effective amount" or "therapeutic effect" refer to an amount of a binding agent, an antibody, polypeptide, polynucleotide, small organic molecule, or other drug effective to "treat" a disease or disorder in a subject or mammal. In the case of cancer, the therapeutically effective amount of a drug (e.g., an antibody) has a therapeutic effect and as such can reduce the number of cancer cells; decrease tumorigenicity, tumorigenic frequency or tumorigenic capacity; reduce the number or frequency of cancer stem cells; reduce the tumor size; reduce the cancer cell population; inhibit and/or stop cancer cell infiltration into peripheral organs including, for example, the spread of cancer into soft tissue and bone; inhibit and/or stop tumor or cancer cell metastasis; inhibit and/or stop tumor or cancer cell growth; relieve to some extent one or more of the symptoms associated with the cancer; reduce morbidity and mortality; improve quality of life; or a combination of such effects. To the extent the agent, for example an antibody, prevents growth and/or kills existing cancer cells, it can be referred to as cytostatic and/or cytotoxic.

[00123] The terms "treating" or "treatment" or "to treat" or "alleviating" or "to alleviate" refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent or slow the development of a targeted pathologic condition or disorder. Thus those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented. In some embodiments, a subject is successfully "treated" according to the methods of the present invention if the patient shows one or more of the following: a reduction in the number of or complete absence of cancer cells; a reduction in the tumor size; inhibition of or an absence of cancer cell infiltration into peripheral organs including the spread of cancer cells into soft tissue and bone; inhibition of or an absence of tumor or cancer cell metastasis; inhibition or an absence of cancer growth; relief of one or more symptoms associated with the specific cancer; reduced morbidity and mortality; improvement in quality of life; reduction in tumorigenicity; reduction in the number or frequency of cancer stem cells; or some combination of effects.

[00124] As used herein, the terms "selectively treating" or "selectively administering" refer to treating a subject with a VEGF/DLL4 binding agent, administering a VEGF/DLL4 binding agent to a subject, or continuing administration of a VEGF/DLL4 binding agent to a subject using a method of the present invention. Such methods include, for example, determining the level of VEGF and/or P1GF in a sample from the subject before treatment with the VEGF/DLL4 binding agent and administering the VEGF/DLL4 binding agent to the subject if the level of VEGF and/or P1GF before treatment is below a predetermined level of VEGF and/or P1GF. Such methods also include, for example, determining the level of VEGF in a sample from the subject after treatment with the VEGF/DLL4 binding agent and continuing administration of the VEGF/DLL4 binding agent if the level of VEGF after treatment does not decrease.

[00125] As used herein, "having obtained a sample" refers to the action of directing or ordering that a sample be taken from a subject. In some embodiments, the action of having obtained a sample is done by the same person or entity administering the VEGF/DLL4 binding agent, or by an agent of that person or entity. In some embodiments, the action of having obtained a sample and the administering of a VEGF/DLL4 binding agent are done by a physician or his/her agent.

[00126] As used herein, "having performed an assay" refers to the action of directing or ordering an assay to be performed on a sample. In some embodiments, the action of having performed an assay is done by the same person or entity administering the VEGF/DLL4 binding agent, or by an agent of that person or entity. In some embodiments, the action of having performed an assay and the administering of a VEGF/DLL4 binding agent are done by a physician or his/her agent.

[00127] By "FOLFIRI" is meant the combination of leucovorin (LV), 5-fluorouraciI (FU), and irinotecan where the l-LV 200 mg/m² or dl- LV 400 mg/m² is given as a 2-hour infusion, and the irinotecan at 180 mg/m² is given as a 90-minute infusion in 500 mL dextrose 5% at the same time (e.g., by a Y connector), followed by bolus FU 400 mg/m² and a 46-hour infusion FU at 2,400 mg/m²-3,000 mg/m² given every 2 weeks.

[00128] By "pancreatic cancer" or "pancreatic tumor" is meant any cancer or tumor that originally develops in the pancreas. The most common type of pancreatic cancer is pancreatic adenocarcinoma. Other types of pancreatic cancer include islet cell carcinoma, pancreaticoblastoma, and ampullary cancer.

[00129] By "colorectal cancer" or "colorectal tumor" is meant any cancer that develops in large intestine, i.e., the colon or rectum. The most colorectal cancers are adenocarcinomas. Other types of colorectal cancer include carcinoid tumors, gastrointestinal stromal tumors, and sarcomas. [00130] By "ovarian cancer" is meant any cancer that develops in the ovaries, fallopian tubes, or primary peritoneum and spreads to the ovaries. The most common ovarian cancer is ovarian epithelial cancer. Other ovarian cancers include germ cell cancers.

[00131] By "endometrial cancer" is meant any cancer that develops in the uterine lining. Endometrial cancers include endometrial carcinomas, for example, adenocarcinomas, carcinosarcomas, squamous cell carcinomas, undifferentiated carcinomas, small cell carcinomas, and transitional carcinomas, the most common of which are adenocarcinomas.

[00132] As used herein, the term "VEGF" refers to vascular endothelial growth factor. The VEGF pathway is involved in multiple aspects of vascular development and involves a family of proteins acting as angiogenic activators, including VEGF-A, VEGF-B, VEGF-C, VEGF-E and their respective receptors (VEGFR-1, VEGFR-2 and VEGFR-3). VEGF-A, also referred to as VEGF or vascular permeability factor (VPF), exists in five isoforms that arise from alternative splicing of mRNA of a single VEGF gene: VEGFm, VEGF, 45 , VEGFies, VEGF189 and VEGF206. VEGF , ,,5 appears to be the most abundant and potent isoform with regard to biologic angiogenic function, followed by VEGFm and VEGF189. The sequence of human VEGFies is provided as SEQ ID NO: 108. The sequence of human VEGFm is provided as SEQ ID NO: 110.

[00133] As used herein, the term "P1GF" refers to placental growth factor. P1GF is also known as PGF. P1GF is a member of the VEGF family and is a key molecule in angiogenesis and vasculogenesis, particularly in embryogenesis and trophoblast growth and differentiation. The sequence of human P1GF is provided as SEQ ID NO: 109.

[00134] As used herein, "CTNNB1" refers to catenin beta 1, a gene which encodes the beta-catenin protein. Beta-catenin plays a role in cell adhesion, cell communication and cell signaling as part of the Wnt signaling pathway. The sequence of human CTNNB1 is described, for example, in NCBI Gene ID No. 1499.

[00135] As used in the present disclosure and claims, the singular forms "a", "an", and "the" include plural forms unless the context clearly dictates otherwise.

[00136] It is understood that wherever embodiments are described herein with the language "comprising" otherwise analogous embodiments described in terms of "consisting of" and/or "consisting essentially of" are also provided. It is also understood that wherever embodiments are described herein with the language "consisting essentially of" otherwise analogous embodiments described in terms of "consisting of" are also provided.

[00137] The term "and/or" as used in a phrase such as "A and/or B" herein is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). II. Methods of selecting, identifying, monitoring or treating

[00138] The present disclosure is based, at least in part, on the surprising observation that certain cancer patients having elevated vascular endothelial growth factor (VEGF) and/or placental growth factor (P1GF) baseline levels prior to treatment with a VEGF/DFF4 binding agent or having decreased VEGF levels during a treatment period with a VEGF/DLL4 binding agent, showed an elevated risk of disease progression.

[00139] In some embodiments, the present invention provides methods related to the treatment of a subject with polypeptides, such as antibodies, that bind vascular endothelial growth factor (VEGF) and/or delta-like ligand 4 (DLL4) (e.g., a VEGF/DLL4 binding agent, described further herein). More particularly, the methods relate to measuring or determining the level of VEGF and/or placental growth factor (P1GF) in a sample from the subject, prior to treatment, concurrently with treatment, or after treatment with a VEGF/DLL4 binding agent.

[00140] In some embodiments, the methods of the present invention pertain to a subject who is treatment naive with respect to a VEGF/DLL4 binding agent. In such embodiments, a subject can be selected for treatment with a VEGF/DLL4 binding agent if the VEGF and/or P1GF baseline levels in a sample from the subject are below a predetermined level, as described further herein. In other embodiments, a subject can be excluded from treatment with a VEGF/DLL4 binding agent if the VEGF and/or P1GF baseline levels in a sample from the subject are above a predetermined level, as described further herein.

[00141] In other embodiments, the methods of the present invention pertain to a subject already receiving treatment with a VEGF/DLL4 binding agent. In such embodiments, a subject whose VEGF levels do not decrease (i.e., stay constant or increase) during a period of treatment with a VEGF/DLL4 binding agent should continue the treatment. However, a subject whose VEGF levels decrease during a period of treatment with a VEGF/DLL4 binding agent should discontinue the treatment because such levels indicate that the subject is experiencing disease progression.

[00142] Methods for measuring and determining the level of VEGF and P1GF in a sample include, but are not limited to, bioassays such as immunoassays, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), polymerase chain reaction (PCR), real-time quantitative polymerase chain reaction (RT-PCR), microarrays (e.g., protein microarrays), Biacore analysis, FACS analysis, immunofluorescence, immunocytochemistry, Western blot analysis, "sandwich" immunoassay, immunoprecipitation assay, precipitation reaction, gel diffusion precipitin reaction, immunodiffusion assay, agglutination assay, complement-fixation assay, immunoradiometric assay, fluorescent immunoassay, homogeneous time -resolved fluorescence assay (HTRF), and protein A immunoassay. Such assays are routine and well-known in the art (see, e.g., Ausubel et al., Editors, 1994-present, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, NY). [00143] In some embodiments of the methods of the present invention, the level of VEGF that is measured or determined is the level of VEGFies, VEGFm, or a combination thereof.

[00144] Likewise, methods of obtaining a sample from a subject are also routine and well-known in the art. A sample useful in any of the methods of the present invention can be, for example, blood, serum, plasma, or a combination thereof. In some embodiments of the invention, a sample is obtained from a subject at least about every week, at least about every 2 weeks, at least about every 3 weeks, or at least about every 4 weeks.

[00145] In some embodiments, a sample is obtained from a subject prior to treatment with a VEGF/DLL4 binding agent. In some embodiments, a sample is collected prior to treatment on the same day of treatment. In some embodiments, a sample is collected 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more days prior to treatment. In some embodiments, a sample is collected 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more weeks prior to treatment. In some embodiments, a sample is collected 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more months prior to treatment.

[00146] In some embodiments, a sample is obtained from a subject after treatment with a VEGF/DLL4 binding agent. In some embodiments, a sample is collected after treatment on the same day of treatment. In some embodiments, a sample is collected 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more days after treatment. In some embodiments, a sample is collected 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more weeks after treatment. In some embodiments, a sample is collected 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more months after treatment.

[00147] In other embodiments of the invention, the subject is a mammal (e.g., human).

[00148] The methods of the present invention also include selecting a subject for treatment with a VEGF/DLL4 binding agent, or administering a VEGF/DLL4 binding agent to the subject, if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF prior to treatment with the VEGF/DLL4 binding agent. In addition, the methods of the present invention include selecting a subject for continued treatment with a VEGF/DLL4 binding agent, or continuing administration of a VEGF/DLL4 binding agent to the subject, if the level of VEGF is above a predetermined level of VEGF and/or does not decrease or significantly decrease during treatment with the VEGF/DLL4 binding agent. The methods of the present invention also include selecting a subject for termination of treatment with a VEGF/DLL4 binding agent, or increasing the dose of administration of a VEGF/DLL4 binding agent to the subject, if the level of VEGF is below a predetermined level of VEGF and/or decreases or significantly decreases during treatment with the VEGF/DLL4 binding agent. Moreover, the methods of the present invention include combinations of the same (e.g., determining the level of VEGF and/or P1GF prior to treatment and determining the level of VEGF after treatment). Compositions and methods for administering a VEGF/DLL4 binding agent are well-known and described further herein. In addition, a predetermined level of VEGF and PIGF for use in the present invention are well-known and described further herein.

[00149] In more specific embodiments, the present invention is directed to a method of selecting a subject for treatment with a VEGF/DFF4 binding agent, comprising (a) determining the level of VEGF and/or PIGF in a sample from the subject; and (b) selecting the subject for treatment with the VEGF/DFF4 binding agent if the level of VEGF and/or PIGF is below a predetermined level of VEGF and/or PIGF. In some embodiments, the method comprises (a) obtaining a sample from the subject; (b) determining the level of VEGF and/or PIGF in the sample; (c) selecting the subject for treatment with the VEGF/DFF4 binding agent if the level of VEGF and/or PIGF is below a predetermined level of VEGF and/or PIGF; and (d) optionally administering the VEGF/DFF4 binding agent to the subject.

[00150] In more specific embodiments, the present invention is directed to a method of identifying a subject as eligible for treatment with a VEGF/DFF4 binding agent, comprising (a) determining the level of VEGF and/or PIGF in a sample from the subject; and (b) identifying the subject as eligible for treatment with the VEGF/DFF4 binding agent if the level of VEGF and/or PIGF is below a predetermined level of VEGF and/or PIGF. In some embodiments, the method comprises (a) obtaining a sample from the subject; (b) determining the level of VEGF and/or PIGF in the sample; (c) identifying the subject as eligible for treatment with the VEGF/DFF4 binding agent if the level of VEGF and/or PIGF is below a predetermined level of VEGF and/or PIGF; and (d) optionally administering the VEGF/DFF4 binding agent to the subject.

[00151] In more specific embodiments, the present invention is directed to a method of monitoring a subject receiving treatment with a VEGF/DFF4 binding agent comprising (a) determining the level of VEGF in a sample from the subject; and (b) selecting the subject for termination of treatment if the level of VEGF decreases during treatment with the VEGF/DFF4 binding agent. In some embodiments, the method comprises (a) obtaining a sample from the subject; (b) determining the level of VEGF in the sample; and (c) selecting the subject for termination of treatment the level of VEGF decreases during treatment with the VEGF/DFF4 binding agent. In some embodiments, the method comprises (a) determining the level of VEGF in a sample from the subject; and (b) selecting the subject for risk of cancer or tumor progression if the level of VEGF decreases during treatment with the VEGF/DFF4 binding agent. In some embodiments, the method comprises (a) obtaining a sample from the subject; (b) determining the level of VEGF in the sample; and (c) selecting the subject for risk of cancer or tumor progression if the level of VEGF decreases during treatment with the VEGF/DFF4 binding agent. In some embodiments, the method comprises (a) determining a first level of VEGF in a first sample from the subject prior to treatment; (b) administering the VEGF/DFF4 binding agent; (c) determining a second level of VEGF in a second sample from the subject after treatment; (d) comparing the first and second VEGF levels; and (e) terminating treatment with the VEGF/DLL4 binding agent if the second VEGF level is lower than the first VEGF level.

[00152] In some embodiments of the methods of the present invention, the method further comprises administering the VEGF/DLL4 binding agent to the subject if the subject is eligible for treatment with the VEGF/DLL4 binding agent. In some embodiments, the method further comprises administering the VEGF/DLL4 binding agent to the subject if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF.

[00153] In some embodiments of the methods of the present invention, the method further comprises terminating administration of the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administeredif the level of VEGF decreases during or after treatment with the VEGF/DLL4 binding agent. In some embodiments, the method further comprises continuing administration of the VEGF/DLL4 binding agent if the level of VEGF does not decrease during or after treatment with the VEGF/DLL4 binding agent.

[00154] In more specific embodiments, the present invention is directed to a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) determining a first level of VEGF and/or P1GF in a first sample from the subject obtained prior to treatment with the VEGF/DLL4 binding agent; (b) administering the VEGF/DLL4 binding agent to the subject; (c) determining a second level of VEGF in a second sample from the subject obtained after administration of the VEGF/DLL4 binding agent; and (d) terminating administration of the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administered if (i) the first level of VEGF and/or P1GF in the first sample is above a predetermined level of VEGF and/or P1GF, and/or (ii) the second level of VEGF decreases during treatment with the VEGF/DLL4 binding agent.

[00155] In more specific embodiments, the present invention is directed to a method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising (a) determining a first level of VEGF and/or P1GF in a first sample from the subject obtained prior to treatment with the VEGF/DLL4 binding agent; (b) administering the VEGF/DLL4 binding agent to the subject; (c) determining a second level of VEGF in a second sample from the subject obtained after administration of the VEGF/DLL4 binding agent; and (d) continuing administration of the VEGF/DLL4 binding agent if (i) the first level of VEGF and/or P1GF in the first sample is below a predetermined level of VEGF and/or P1GF, and/or (ii) the second level of VEGF in the second sample is above a predetermined level of VEGF and/or if the level of VEGF does not decrease during treatment with the VEGF/DLL4 binding agent.

[00156] In more specific embodiments, the present invention is directed to a method of treating a subject with a VEGF/DLL4 binding agent. In some embodiments, the present invention is directed to a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising selectively administering a VEGF/DLL4 binding agent on the basis of the subject (a) having a level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to administration of the VEGF/DEE4 binding agent; and/or (b) having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent.

[00157] In more specific embodiments, the present invention is directed to a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising (a) selecting the subject for treatment with VEGF/DLL4 binding agent on the basis of the subject having a level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to administration of the VEGF/DLL4 binding agent; and (b) administering the VEGF/DLL4 binding agent to the patient.

[00158] In more specific embodiments, the present invention is directed to a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising (a) administering the VEGF/DLL4 binding agent to the patient; (b) selecting the subject for continued administration of the VEGF/DLL4 binding agent on the basis of the subject having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent; and (c) continuing administration of the VEGF/DLL4 binding agent.

[00159] In more specific embodiments, the present invention is directed to a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising (a) selecting the subject for treatment with VEGF/DLL4 binding agent on the basis of the subject having a level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to administration of the VEGF/DLL4 binding agent; (b) administering the VEGF/DLL4 binding agent to the patient; (c) selecting the subject for continued treatment with the VEGF/DLL4 binding agent on the basis of the subject having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent; and (d) administering the VEGF/DLL4 binding agent to the patient.

[00160] In more specific embodiments, the present invention is directed to a method of treating a subject with a VEGF/DLL4 binding agent, comprising (a) determining whether the subject is eligible for treatment with a VEGF/DLL4 binding agent by (i) obtaining or having obtained a sample from the subject; and (ii) performing or having performed an assay on the sample to determine if the subject is eligible for treatment with a VEGF/DLL4 binding agent; and (b) administering the VEGF/DLL4 binding agent to the subject if the subject is eligible for treatment with the VEGF/DLL4 binding agent.

[00161] In more specific embodiments, the present invention is directed to a method of treating a subject with a VEGF/DLL4 binding agent, comprising (a) determining a first level of VEGF and/or P1GF in a first sample from the subject obtained before treatment with the VEGF/DLL4 binding agent; (b) administering the VEGF/DLL4 binding agent to the subject if the first level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF; (c) determining a second level of VEGF in a second sample from the subject obtained after administration of the VEGF/DLL4 binding agent; and (d) continuing treatment with the VEGF/DLL4 binding agent if the second level of VEGF is above a predetermined level of VEGF and/or if the level of VEGF does not decrease during treatment with the VEGF/DLL4 binding agent.

[00162] Other embodiments of the methods of the present invention relate to the treatment of a subject with a VEGF/DLL4 binding agent. In some embodiments, the treatment with the VEGF/DLL4 binding agent is a first-line therapy. In some embodiments, the methods of the present invention methods of treating cancer or tumor. In some embodiments, the subject of the methods of the present invention has cancer or tumor. In some embodiments, the cancer or tumor has a mutation in CTNNB1.

[00163] In some embodiments, the cancer is lung cancer, breast cancer, colon cancer, colorectal cancer, melanoma, pancreatic cancer, gastrointestinal cancer, renal cancer, ovarian cancer, liver cancer, endometrial cancer, kidney cancer, prostate cancer, thyroid cancer, neuroblastoma, glioma, glioblastoma, melanoma, cervical cancer, stomach cancer, bladder cancer, gallbladder cancer, nasopharygeal cancer, myoepithelial cancer, fallopian tube cancer, uterine cancer, neuroendocrine cancer, sarcoma, adrenal cancer, hepatoma, lymphoma, leukemia, or head and neck cancer.

[00164] In some embodiments, the tumor is a colorectal tumor, colon tumor, ovarian tumor, pancreatic tumor, lung tumor, liver tumor, breast tumor, kidney tumor, prostate tumor, gastrointestinal tumor, melanoma, cervical tumor, bladder tumor, or glioblastoma. In some embodiments, the cancer is platinum-resistant ovarian cancer, platinum-resistant primary peritoneal cancer, or platinum-resistant fallopian cancer.

[00165] In some embodiments, the cancer or tumor is resistant or refractory to one or more different cancer therapies, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different cancer therapies. If a cancer or tumor is resistant or refractory to one or more different cancer therapies, then the subject has failed to respond to the one or more different cancer therapies. In some embodiments, the different cancer therapies are selected from any of the anti-cancer or immunotherapeutic agents described herein. For example, in some embodiments, the cancer or tumor is refractory or resistant to a taxane. In some embodiments, the cancer or tumor is resistant or refractory to palladium. In some embodiments, the cancer or tumor is refractory or resistant to FOFFIRI. In some embodiments, the cancer or tumor is refractory or resistant to bevacizumab. In some embodiments, the cancer or tumor is refractory or resistant to bevacizumab and a taxane. In some embodiments, the cancer is refractory or resistant to bevacizumab and FOFFIRI. In some embodiments, the cancer or tumor is refractory or resistant to bevacizumab, a taxane, and palladium. In preferred emboldiments, the cancer is refractory or resistant to at least 3 prior therapies and/or prior bevacizumab. [00166] In some embodiments, the cancer or tumor is responsive to one or more different cancer therapies, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different cancer therapies. In some embodiments, the different cancer therapies are selected from any of the anti-cancer or immunotherapeutic agents described herein. For example, in some embodiments, the cancer or tumor is responsive to a taxane. In some embodiments, the cancer or tumor is responsive to palladium. In some embodiments, the cancer or tumor is responsive to FOLFIRI. In some embodiments, the cancer or tumor is responsive to bevacizumab. In some embodiments, the cancer or tumor is responsive to bevacizumab and a taxane. In some embodiments, the cancer is responsive to bevacizumab and FOLFIRI. In some embodiments, the cancer or tumor is responsive to bevacizumab, a taxane, and palladium.

[00167] In other embodiments of the present invention, the methods described herein pertain to one or more genes selected from the group consisting of NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B 1, BMP7, MMP19, LEF1, and ECM1. In some embodiments of the present invention, the methods described herein pertain to one or more genes selected from the group consisting of PGF, VAV2, APOLD1, EIF2S2, DTX3L, KRIT1, LFNG, STAT1, PTK2, HPSE, DDAH1, FGF9, and EDNRA. One or more of these genes can be used in any of the methods described herein for VEGF and/or P1GF.

[00168] For example, some embodiments of the present invention relate to a method of selecting a subject for treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, LEF1, and ECM1 ; and (b) selecting the subject for treatment with the VEGF/DLL4 binding agent if the level of the one or more genes is above a predetermined level. In some embodiments, the present invention relates to a method of identifying a subject as eligible for treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B 1, BMP7, MMP19, LEF1, and ECM1 ; and (b) selecting the subject for treatment with the VEGF/DLL4 antagonist if the level of the one or more genes is above a predetermined level.

[00169] In another example, the present invention relates to a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising selectively administering a VEGF/DLL4 binding agent on the basis of the subject having a level of one or more genes in a sample from the subject above a predetermined level, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B 1, BMP7, MMP19, LEF1, and ECM1. In some embodiments, the present invention relates to a method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising (a) selecting the subject for treatment with VEGF/DLL4 binding agent on the basis of the subject having a level of one or more genes in a sample from the subject above a predetermined level, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, LEF1, and ECM1 ; and (b) administering the VEGF/DLL4 binding agent to the patient. In some embodiments, the present invention relates to a method of treating a subject with a VEGF/DLL4 binding agent, comprising determining whether the subject is eligible for treatment with a VEGF/DLL4 binding agent by (i) obtaining or having obtained a sample from the subject; and (ii) performing or having performed an assay on the sample to determine if the subject is eligible for treatment with a VEGF/DLL4 binding agent; wherein if the subject is eligible for treatment with the VEGF/DLL4 binding agent, then administering the VEGF/DLL4 binding agent to the subject; and wherein the subject is eligible for treatment with the VEGF/DLL4 binding agent if the level of one or more genes selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, LEF1, and ECM1 is above a predetermined level.

[00170] In another example, the present invention relates to a method of identifying a subject as ineligible for treatment with a VEGF/DLL4 binding agent, comprising (a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: PGF, VAV2, APOLD1, EIF2S2, DTX3L, KRIT1, LFNG, STAT1, PTK2, HPSE, DDAH1, FGF9, and EDNRA; and (b) excluding the subject from treatment with the VEGF/DLL4 binding agent if the level of the one or more genes is above a predetermined level.

[00171] In another example, the present invention relates to a method of excluding a subject from treatment with a VEGF/DLL4 binding agent, comprising determining whether the subject is ineligible for treatment with a VEGF/DLL4 binding agent by (i) obtaining or having obtained a sample from the subject; and (ii) performing or having performed an assay on the sample to determine if the subject is ineligible for treatment with a VEGF/DLL4 binding agent; wherein if the subject is ineligible for treatment with the VEGF/DLL4 binding agent, then the subject is excluded from treatment with the VEGF/DLL4 binding agent; and wherein the subject is ineligible for treatment with the VEGF/DLL4 binding agent if the level of one or more genes selected from the group consisting of: PGF, VAV2, APOLD1, EIF2S2, DTX3L, KRIT1, LFNG, STAT1, PTK2, HPSE, DDAH1, FGF9, and EDNRA is above a predetermined level.

[00172] In some embodiments of the methods of the present invention, the subject has not previously received treatment with the VEGF/DLL4 binding agent. In some embodiments, the subject has received treatment with the VEGF/DLL4 binding agent.

[00173] In some embodiments of the methods of the present invention, one or more steps of the method (e.g., obtaining, determining and/or identifying) occur prior to administration of the VEGF/DLL4 binding agent. In some embodiments of the methods of the present invention, one or more steps of the method (e.g., obtaining, determining and/or identifying) occur after administration of the VEGF/DLL4 binding agent. [00174] Also, as used herein, the steps of the methods of the present invention (e.g., "obtaining", "determining", "identifying", "performing" or "administering") include the actions of having obtained, having determined, having identified, having performed or having administered, in addition to directly obtaining, determining, identifying, performing or administering.

III. Predetermined level of VEGF and/or P1GF and decrease in VEGF

[00175] The methods of the present invention include comparison of a determined or measured level of vascular endothelial growth factor (VEGF) and/or placental growth factor (P1GF) to a "predetermined level" of VEGF and/or P1GF. Methods of measuring and determining the level of VEGF and P1GF include, but are not limited to, bioassays such as immunoassays, enzyme-linked immunosorbent assay (EFISA), radioimmunoassay (RIA), polymerase chain reaction (PCR), real time quantitative polymerase chain reaction (RT-PCR), microarrays (e.g., protein microarrays), Biacore analysis, FACS analysis, immunofluorescence, immunocytochemistry, Western blot analysis, "sandwich" immunoassay, immunoprecipitation assay, precipitation reaction, gel diffusion precipitin reaction, immunodiffusion assay, agglutination assay, complement-fixation assay, immunoradiometric assay, fluorescent immunoassay, homogeneous time-resolved fluorescence assay (HTRF), and protein A immunoassay. Such assays are routine and well-known in the art (see, e.g., Ausubel et al., Editors, 1994-present, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, NY).

[00176] In some embodiments, the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less. In some embodiments, the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml. In some embodiments, the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 pg/ml.

[00177] In some embodiments of the present invention, the method includes a predetermined level of P1GF. In some embodiments, the predetermined level of P1GF is about 50 pg/ml or less, about 75 pg/ml or less, about 100 pg/ml or less, about 120 pg/ml or less, about 150 pg/ml or less, or about 200 pg/ml or less. In some embodiments, the predetermined level of P1GF is from about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 150 pg/ml, about 50 pg/ml to about 120 pg/ml, about 50 pg/ml to about 100 pg/ml, about 50 pg/ml to about 75 pg/ml, about 75 pg/ml to about 200 pg/ml, about 75 pg/ml to about 150 pg/ml, about 75 pg/ml to about 120 pg/ml, about 75 pg/ml to about 100 pg/ml, about 100 pg/ml to about 200 pg/ml, about 100 pg/ml to about 150 pg/ml, about 100 pg/ml to about 120 pg/ml, about 120 pg/ml to about 200 pg/ml, about 120 pg/ml to about 150 pg/ml, or about 150 pg/ml to about 200 pg/ml. In some embodiments, the predetermined level of P1GF is about 50 pg/ml, about 75 pg/ml, about 100 pg/ml, about 120 pg/ml, about 150 pg/ml, or about 200 Pg/ml.

[00178] In some embodiments, the predetermined level of VEGF and/or P1GF is a normal reference level of VEGF and/or P1GF. In some embodiments, the predetermined level of VEGF and/or P1GF is the level of VEGF and/or P1GF in a sample obtained at an earlier date. In some embodiments, the predetermined level of VEGF and/or P1GF is the level of VEGF and/or P1GF in a sample obtained prior to treatment with the VEGF/DLL4 binding agent.

[00179] In some embodiments of the present invention, the method includes a decrease in VEGF levels during a period of treatment with the VEGF/DLL4 binding agent. In some embodiments, the decrease in VEGF levels is about 100 pg/ml or more, about 200 pg/ml or more, about 400 pg/ml or more, about 600 pg/ml or more, about 800 pg/ml or more, or about 1000 pg/ml or more. In some embodiments, the decrease in VEGF levels is about 100 pg/ml or less, about 200 pg/ml or less, about 400 pg/ml or less, about 600 pg/ml or less, about 800 pg/ml or less, or about 1000 pg/ml or less. In some embodiments, the decrease in VEGF levels is from about 100 pg/ml to about 1000 pg/ml, about 100 pg/ml to about 800 pg/ml, about 100 pg/ml to about 600 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 1000 pg/ml, about 200 pg/ml to about 800 pg/ml, about 200 pg/ml to about 600 pg/ml, about 200 pg/ml to about 400 pg/ml, about 400 pg/ml to about 1000 pg/ml, about 400 pg/ml to about 800 pg/ml, about 400 pg/ml to about 600 pg/ml, about 600 pg/ml to about 1000 pg/ml, about 600 pg/ml to about 800 pg/ml, or about 800 pg/ml to about 1000 pg/ml. In some embodiments, the decrease in VEGF levels is about 100 pg/ml, about 200 pg/ml, about 400 pg/ml, about 600 pg/ml, about 800 pg/ml, or about 1000 pg/ml. In some embodiments, the decrease in VEGF levels is about 5% or more, about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 100% or more.

[00180] In some embodiments, the decrease in VEGF levels during a period of treatment with the VEGF/DLL4 binding agent occurs over at least about 1 week, at least about 2 weeks, at least about 3 weeks, or at least about 4 weeks. In some embodiments, the decrease in VEGF levels occurs over from about 1 week to about 4 weeks, about 1 week to about 3 weeks, about 1 week to about 2 weeks, about 2 weeks to about 4 weeks, about 2 weeks to about 3 weeks, or about 3 weeks to about 4 weeks. In some embodiments, the decrease in VEGF levels occurs over about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.

[00181] In some embodiments, the decrease in VEGF levels is based on comparison of a baseline or predetermined level of VEGF to a level of VEGF from a sample from a subject. In some embodiments, the decrease in VEGF levels is based on comparison of a first level of VEGF from a first sample from a subject to a second level of VEGF from a second sample from a subject.

[00182] In some embodiments, the decrease in VEGF levels occurs during or after treatment with the VEGF/DLL4 binding agent. In some embodiments, the decrease in VEGF levels occurs about 1 day after treatment with the VEGF/DLL4 binding agent, about 1 week after treatment with the VEGF/DLL4 binding agent, about 2 weeks after treatment with the VEGF/DLL4 binding agent, about 3 weeks after treatment with the VEGF/DLL4 binding agent, or about 4 weeks after treatment with the VEGF/DLL4 binding agent.

IV. VEGF/DLL4 binding agents, compositions and administration

[00183] In some embodiments of the present invention, the methods include administration of a VEGF/DLL4 binding agent. In some embodiments, the VEGF/DLL4 binding agent is a VEGF/DLL4 antagonist. In some embodiments, the VEGF/DLL4 binding agent is an antagonist of VEGF (e.g., human VEGF). In some embodiments, the VEGF/DLL4 binding agent is an antagonist of DLL4 (e.g., human DLL4). In some embodiments, the VEGF/DLL4 binding agent is an antagonist of both VEGF and DLL4 (e.g., human VEGF and human DLL4). In some embodiments, the VEGF/DLL4 binding agent is a polypeptide. In some embodiments, the VEGF/DLL4 binding agent specifically binds VEGF (e.g., human VEGF). In some embodiments, the VEGF/DLL4 binding agent specifically binds DLL4 (e.g., human DLL4). The full-length amino acid sequences for human VEGF (VEGF- A) and human DLL4 are known in the art and are provided herein as SEQ ID NO:27 (VEGF) and SEQ ID NO:23 (DLL4).

[00184] In some embodiments, the VEGF/DLL4 antagonist is an antibody. In some embodiments, the VEGF/DLL4 antagonist is a modified immunoglobulin. In some embodiments, the antibody is a monoclonal antibody, a recombinant antibody, a chimeric antibody, a humanized antibody, a human antibody, an antibody fragment comprising an antigen-binding site, a modified immunoglobulin molecule comprising an antigen-binding site, a dual variable domain antibody, a bispecific antibody, an IgGl antibody, an IgG2 antibody, an IgG4 antibody, a monovalent bispecific antibody, a bivalent bispecific antibody, or a dual variable domain antibody.

[00185] In some embodiments, the antibody is a recombinant antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a chimeric antibody. In some embodiments, the antibody is a humanized antibody. In some embodiments, the antibody is a human antibody. In some embodiments, the antibody is an IgA, IgD, IgE, IgG, or IgM antibody. In some embodiments, the antibody is an IgGl antibody. In some embodiments, the antibody is an IgG2 antibody. In some embodiments, the antibody is an antibody fragment comprising an antigen binding site. In some embodiments, the antibody is monovalent, monospecific, bivalent, or multispecific. In some embodiments, the antibody is conjugated to a cytotoxic moiety. In some embodiments, the antibody is isolated. In some embodiments, the antibody is substantially pure. [00186] Exemplary VEGF/DLL4 binding agents are described, for example, in Int'l Pub. No. WO 2008/042236, Int’l Pub. No. WO 2011/047383, Int’l Pub. No. WO 2011/068840, Int’l Pub. No. WO 2012/068098, Int’l Pub. No. WO 2013/044215, Int’l Pub. No. WO 2014/062659, Int’l Pub. No. WO 2014/071018, Int’l Pub. No. WO 2017/053705, U.S. Patent No. 9,045,551, and U.S. Pub. No. 2016/0159929, which are incorporated by reference herein in their entireties.

[00187] In other embodiments, the VEGF/DLL4 binding agent is an antibody that comprises (a) a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 104, SEQ ID NO: 15 or SEQ ID NO: 105), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22), or (b) a heavy chain variable region comprising amino acid sequence SEQ ID NO: 106, SEQ ID NO:9 or SEQ ID NO: 107, or a light chain variable region comprising SEQ ID NO: 12. In some embodiments, the antibody comprises a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 104, SEQ ID NO: 15 or SEQ ID NO: 105), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent is an antibody that comprises a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 15), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent is an antibody that comprises a heavy chain variable region comprising amino acid sequence SEQ ID NO: 106, SEQ ID NO: 9 or SEQ ID NO: 107. In some embodiments, the VEGF/DLL4 binding agent is an antibody that comprises a heavy chain variable region comprising SEQ ID NO:9. In some embodiments, the VEGF/DLL4 binding agent is an antibody that comprises a light chain variable region comprising SEQ ID NO: 12.

[00188] In some embodiments, the VEGF/DLL4 binding agent is an antibody comprising a binding site for VEGF from bevacizumab, a complementarity determining region (e.g., heavy chain or light chain CDR1, CDR2, or CDR3) from bevacizumab, a heavy chain variable domain or light chain variable domain of bevacizumab, or a combination thereof.

[00189] In some embodiments, the cancer or tumor is colorectal tumor and the VEGF/DLL4 binding agent is a modified immunoglobulin molecule that specifically binds human DLL4. In some embodiments, the VEGF/DLL4 binding agent is administered in combination with irinotecan. In some embodiments, the modified immunoglobulin molecule and irinotecan are administered sequentially to the subject. In other embodiments, the modified immunoglobulin molecule and irinotecan are administered concurrently to the subject.

[00190] In some embodiments, the VEGF/DLL4 binding agent is an antibody that comprises (a) a first antigen-binding site that specifically binds human VEGF; and (b) a second antigen-binding site that specifically binds human DLL4; wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19); wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YI AN YNRATN YN QKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YIAGYKDATNYNQKFKG (SEQ ID NO:59), or YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13). In some embodiments, the second antigen-binding site comprises a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65). In some embodiments, the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) and a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65). In some embodiments, the first antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO: 11. In some embodiments, the second antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO:64. In some embodiments, the first and second antigen binding sites comprise a light chain variable region comprising SEQ ID NO: 12. In some embodiments, the first antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO: 11 and a light chain variable region comprising SEQ ID NO: 12, and the second antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO:64 and a light chain variable region comprising SEQ ID NO: 12.

[00191] In preferred embodiments, the antibody comprises (a) a first antigen-binding site that specifically binds human VEGF; and (b) a second antigen-binding site that specifically binds human DLL4; wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19); wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); wherein both the first and second antigen binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). Preferably, the antibody can comprise (a) a first heavy chain variable region comprising SEQ ID NO: l l ; (b) a second heavy chain variable region comprising SEQ ID NO:64; and (c) a first and a second light chain variable region comprising SEQ ID NO: 12. In a further preferably embodiment the antibody can also comprise (a) a heavy chain of SEQ ID NO:7; (b) a heavy chain of SEQ ID NO: 62; and (c) two light chains of SEQ ID NO: 111.

[00192] In some embodiemnts, the VEGF/DLL4 binding agent is a modified immunoglobulin. The modified immunoglobulin can comprise (a) first antigen-binding site that specifically binds human VEGF; and (b) a second antigen-binding site that specifically binds human DLL4; wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19); wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YI AN YNRATN YN QKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YI AGYKD ATN YN QKFKG (SEQ ID NO:59), or YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising

RDYDYDVGMDY (SEQ ID NO: 16); wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising

QQSKEVPWTFGG (SEQ ID NO:22). Preferably, the modified immunoglobulin comprises (a) first antigen-binding site that specifically binds human VEGF; and (b) a second antigen-binding site that specifically binds human DLL4; wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising

DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising

HYDDKYYPLMDY (SEQ ID NO: 19); wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising

QQSKEVPWTFGG (SEQ ID NO:22).

[00193] The modified immunoglobulin can comprise (a) a first heavy chain variable region comprising SEQ ID NO: l l ; (b) a second heavy chain variable region comprising SEQ ID NO: 64; and (c) a first and a second light chain variable region comprising SEQ ID NO: 12. The modified immunoglobulin can also comprise (a) a heavy chain of SEQ ID NO:7; (b) a heavy chain of SEQ ID NO:62; and (c) two light chains of SEQ ID NO: 111.

[00194] In some embodiments, the VEGF/DLL4 binding agent comprises a first and second polypeptide chains, each independently comprising VDl-(Xl)n-VD2-C-(X2)n, wherein VD1 is a first variable domain; VD2 is a second variable domain; C is a constant domain; XI is a linker; X2 is an Fc region; n is 0 or 1, wherein the VD1 domains on the first and second polypeptide chains form a first functional target binding site and the VD2 domains on the first and second polypeptide chains form a second functional target binding site, and wherein the binding protein is capable of binding DLL4 and VEGF, wherein the first polypeptide chain of the binding protein comprises SEQ ID NO: 81 and the second polypeptide chain of the binding protein comprises SEQ ID NO: 82. In some embodiments, the binding protein comprises the constant region sequences from SEQ ID NO: 83 and/or SEQ ID NO: 84. In some embodiments, the first and second polypeptide chains of the binding protein comprise SEQ ID NOs:83 and 84.

[00195] In some embodiments, the VEGF/DLL4 binding agent comprises a protein specifically binding to DLL4, which recognizes a conformational epitope of DLL4 comprising amino acid residues 58th to 65th amino acid sequences and 110th to 115th amino acid sequences in amino acid sequences of DLL4 protein represented by SEQ ID NO: 85, and an antibody specifically binding to VEGF. In some embodiments, the protein specifically binding to DLL4 comprises a heavy chain variable region comprising heavy chain CDR1 having an amino acid sequence represented by SEQ ID NO:86, heavy chain CDR2 having an amino acid sequence represented by SEQ ID NO:87, and heavy chain CDR3 having an amino acid sequence represented by SEQ ID NO:88, and a light chain variable region comprising light chain CDR1 having an amino acid sequence represented by SEQ ID NO:89, light chain CDR2 having an amino acid sequence represented by SEQ ID NO:90, and light chain CDR3 having an amino acid sequence represented by SEQ ID NO:91. In some embodiments, the protein binding specifically to DLL4 comprises a heavy chain amino acid sequence represented by SEQ ID NO:92 and a light chain amino acid sequence represented by SEQ ID NO:93. In some embodiments, the antibody specifically binding to VEGF comprises a heavy chain variable region comprising heavy chain CDR1 having an amino acid sequence represented by SEQ ID NO:94, heavy chain CDR2 having an amino acid sequence represented by SEQ ID NO:95, and heavy chain CDR3 having an amino acid sequence represented by SEQ ID NO:96, and a light chain variable region comprising light chain CDR1 having an amino acid sequence represented by SEQ ID NO: 97, light chain CDR2 having an amino acid sequence represented by SEQ ID NO:98, and light chain CDR3 having an amino acid sequence represented by SEQ ID NO:99. In some embodiments, the antibody specifically binding to VEGF comprises a heavy chain variable region having an amino acid sequence represented by SEQ ID NO: 100 and a light chain variable region having an amino acid sequence represented by SEQ ID NO: 101. In some embodiments, the antibody binding specifically to VEGF is bevacizumab. In some embodiments, the antibody specifically binding to VEGF comprises a heavy chain variable region having an amino acid sequence represented by SEQ ID NO: 102 and a light chain variable region having an amino acid sequence represented by SEQ ID NO: 103.

[00196] In some embodiments, the VEGF/DLL4 binding agent comprises one, two, three, four, five, and/or six of the CDRs of antibody 219R45 (see Table 1). In some embodiments, the VEGF/DLL4 binding agent comprises one or more of the CDRs of 219R45, two or more of the CDRs of 219R45, three or more of the CDRs of 219R45, four or more of the CDRs of 219R45, five or more of the CDRs of 219R45, or ah six of the CDRs of 219R45. In some embodiments, the VEGF/DLL4 binding agent binds human VEGF and mouse VEGF.

Table 1

[00197] In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising

DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising

HYDDKYYPLMDY (SEQ ID NO: 19). In some embodiments, the VEGF/DLL4 binding agent further comprises a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent comprises (a) a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19), and (b) a light chain CDR1 comprising

RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22).

[00198] In some embodiments, the VEGF/DLL4 binding agent comprises: (a) a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (b) a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (c) a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (d) a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (e) a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; and (f) a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative substitutions.

[00199] In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 80% sequence identity to SEQ ID NO: 11, and a light chain variable region having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 11. In some embodiments, the VEGF/DLL4 binding agent comprises a light chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 95% sequence identity to SEQ ID NO: 11, and a light chain variable region having at least about 95% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region comprising SEQ ID NO: 11, and a light chain variable region comprising SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region consisting essentially of SEQ ID NO: 11, and a light chain variable region consisting essentially of SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain comprising SEQ ID NO:49, and a light chain comprising SEQ ID NO:8. In some embodiments, the VEGF/DLL4 binding antibody or other agent comprises a heavy chain comprising SEQ IDNO:7, and a light chain comprising SEQ ID NO:8. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain comprising SEQ ID NO:49, and a light chain comprising SEQ ID NO: 111. In some embodiments, the VEGF/DLL4 binding antibody or other agent comprises a heavy chain comprising SEQ ID NO:7, and a light chain comprising SEQ ID NO: 111.

[00200] In some embodiments, the VEGF/DLL4 binding agent comprises the heavy chain variable region and light chain variable region of the 219R45 antibody. In some embodiments, the VEGF/DLL4 binding agent comprises the heavy chain and light chain of the 219R45 antibody (with or without the leader sequence). In some embodiments, a VEGF/DLL4 binding agent is the 219R45 antibody. In some embodiments, the VEGF/DLL4 binding agent comprises the same heavy chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA- 13236. The plasmid PTA- 13236 was deposited with the American Type Culture Collection (ATCC), at 10801 University Boulevard, Manassas, VA, 20110, under the conditions of the Budapest Treaty on September 21, 2012. In some embodiments, the VEGF/DLL4 binding agent comprises the same light chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13235. The plasmid PTA-13235 was deposited with the ATCC, at 10801 University Boulevard, Manassas, VA, 20110, under the conditions of the Budapest Treaty on September 21, 2012. In some embodiments, the VEGF/DLL4 binding agent comprises the same heavy chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA- 13236 and the same light chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13235.

[00201] In some embodiments, a VEGF/DLL4 binding agent comprises, consists essentially of, or consists of, the antibody 219R45.

[00202] In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) binds the same epitope, or essentially the same epitope, on VEGF as antibody 219R45. In another embodiment, the VEGF/DLL4 binding agent is an antibody that binds an epitope on VEGF that overlaps with the epitope on VEGF bound by antibody 219R45.

[00203] In some embodiments, the VEGF/DLL4 binding agent inhibits binding of VEGF to at least one VEGF receptor. In some embodiments, the VEGF/DLL4 binding agent inhibits binding of human VEGF to VEGFR-1 or VEGFR-2. In some embodiments, the VEGF/DLL4 binding agent specifically binds VEGF and modulates angiogenesis. In some embodiments, the VEGF/DLL4 binding agent specifically binds VEGF and inhibits angiogenesis. In some embodiments, the VEGF/DLL4 binding agent specifically binds VEGF and inhibits tumor growth.

[00204] In some embodiments, the invention provides a VEGF/DLL4 binding agent (e.g., an antibody) that specifically binds human DLL4, wherein the VEGF/DLL4 binding agent (e.g., an antibody) comprises one, two, three, four, five, and/or six of the CDRs of antibody 21R79 (see Table 2). In some embodiments, the VEGF/DLL4 binding agent comprises one or more of the CDRs of 21R79, two or more of the CDRs of 21R79, three or more of the CDRs of 21R79, four or more of the CDRs of 21R79, five or more of the CDRs of 21R79, or all six of the CDRs of 21R79. In some embodiments, the VEGF/DLL4 binding agent (e.g., an antibody) comprises one, two, three, four, five, and/or six of the CDRs of antibody 21R75 (see Table 2). In some embodiments, the VEGF/DLL4 binding agent comprises one or more of the CDRs of 21R75, two or more of the CDRs of 21R75, three or more of the CDRs of 21R75, four or more of the CDRs of 21R75, five or more of the CDRs of 21R75, or all six of the CDRs of 21R75. In some embodiments, the VEGF/DLL4 binding agent (e.g., an antibody) comprises one, two, three, four, five, and/or six of the CDRs of antibody 21R83 (see Table 2). In some embodiments, the VEGF/DLL4 binding agent comprises one or more of the CDRs of 21R83, two or more of the CDRs of 21R83, three or more of the CDRs of 21R83, four or more of the CDRs of 21R83, five or more of the CDRs of 21 R83, or all six of the CDRs of 21R83. In some embodiments, the VEGF/DLL4 binding agent binds human DLL4 and mouse DLL4. Table 2

[00205] In some embodiments, the heavy chain CDR1 of the VEGF/DLL4 binding agent is a minimal HC CDR1 comprising AYYIH (SEQ ID NO:79).

[00206] In some embodiments, the VEGF/DLL4 binding agent is an antibody that binds human DLL4 and comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YIX iX₂ YX3X4ATN YN QKFKG (SEQ ID NO: 80), wherein Xi is serine or alanine, X2 is serine, asparagine, or glycine, X3 is asparagine or lysine, and X4 is glycine, arginine, or aspartic acid, and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22).

[00207] In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YI AN YNR ATN YN QKFKG (SEQ ID NO: 14), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16). In some embodiments, the VEGF/DLL4 binding agent further comprises a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent comprises: (a) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YIANYNRATNYNQKFKG (SEQ ID NO: 14), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16), and (b) a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). [00208] In some embodiments, the VEGF/DLL4 binding agent comprises: (a) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (b) a heavy chain CDR2 comprising YIANYNRATNYNQKFKG (SEQ ID NO: 14), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (c) a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (d) a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (e) a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; and (f) a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative substitutions.

[00209] In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 80% sequence identity to SEQ ID NO: 10, and a light chain variable region having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 10. In some embodiments, the VEGF/DLL4 binding agent comprises a light chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 95% sequence identity to SEQ ID NO: 10, and a light chain variable region having at least about 95% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region comprising SEQ ID NO: 10, and a light chain variable region comprising SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region consisting essentially of SEQ ID NO: 10, and a light chain variable region consisting essentially of SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain comprising SEQ ID NO:48, and a light chain comprising SEQ ID NO:8. In some embodiments, the VEGF/DLL4 binding antibody or other agent comprises a heavy chain comprising SEQ ID NO:6, and a light chain comprising SEQ ID NO:8. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain comprising SEQ ID NO:48, and a light chain comprising SEQ ID NO: 111. In some embodiments, the VEGF/DLL4 binding antibody or other agent comprises a heavy chain comprising SEQ ID NO:6, and a light chain comprising SEQ ID NO: 111. In some embodiments, the antibody is a bispecific antibody.

[00210] In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YIAGYKDATNYNQKFKG (SEQ ID NO:59), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16). In some embodiments, the VEGF/DLL4 binding agent further comprises a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent comprises: (a) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YIAGYKDATNYNQKFKG (SEQ ID NO:59), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16), and (b) a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22).

[00211] In some embodiments, the VEGF/DLL4 binding agent comprises: (a) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (b) a heavy chain CDR2 comprising YIAGYKDATNYNQKFKG (SEQ ID NO:59), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (c) a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (d) a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (e) a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; and (f) a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative substitutions.

[00212] In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 80% sequence identity to SEQ ID NO:58, and a light chain variable region having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO:58. In some embodiments, the VEGF/DLL4 binding agent comprises a light chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 95% sequence identity to SEQ ID NO:58, and a light chain variable region having at least about 95% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region comprising SEQ ID NO:58, and a light chain variable region comprising SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region consisting essentially of SEQ ID NO:58, and a light chain variable region consisting essentially of SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain comprising SEQ ID NO:56, and a light chain comprising SEQ ID NO:8. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain comprising SEQ ID NO:56, and a light chain comprising SEQ ID NO: 111. [00213] In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising

YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising

RDYDYDVGMDY (SEQ ID NO: 16). In some embodiments, the VEGF/DLL4 binding agent further comprises a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent comprises: (a) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16), and (b) a light chain CDR1 comprising

[00214] In some embodiments, the VEGF/DLL4 binding agent comprises: (a) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (b) a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (c) a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (d) a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; (e) a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions; and (f) a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22), or a variant thereof comprising 1, 2, 3, or 4 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative substitutions.

[00215] In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 80% sequence identity to SEQ ID NO:64, and a light chain variable region having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO:64. In some embodiments, the VEGF/DLL4 binding agent comprises a light chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region having at least about 95% sequence identity to SEQ ID NO:64, and a light chain variable region having at least about 95% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region comprising SEQ ID NO:64, and a light chain variable region comprising SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain variable region consisting essentially of SEQ ID NO:64, and a light chain variable region consisting essentially of SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain comprising SEQ ID NO:62, and a light chain comprising SEQ ID NO: 8. In some embodiments, the VEGF/DLL4 binding agent comprises a heavy chain comprising SEQ ID NO:62, and a light chain comprising SEQ ID NO: 111. In some embodiments, the agent is a bispecific antibody.

[00216] In some embodiments, the VEGF/DLL4 binding agent is an antibody that comprises a heavy chain comprising SEQ ID NO: 5, and a light chain comprising SEQ ID NO: 8. In some embodiments, the VEGF/DLL4 binding agent is an antibody that comprises a heavy chain comprising SEQ ID NO:5, and a light chain comprising SEQ ID NO: 111. In some embodiments, the antibody is a bispecific antibody.

[00217] In some embodiments, the VEGF/DLL4 binding agent binds DLL4 with a K_D of 25nM or less. In some embodiments, the VEGF/DLL4 binding agent binds DLL4 with a K_D of lOnM or less. In some embodiments, the VEGF/DLL4 binding agent binds DLL4 with a K_D of about InM or less. In some embodiments, the VEGF/DLL4 binding agent binds DLL4 with a K_D of about O.lnM or less. In some embodiments, the VEGF/DLL4 binding agent binds DLL4 with a K_D of about O.OlnM or less. In some embodiments, at least one amino acid residue in at least one CDR of the VEGF/DLL4 binding agent is substituted with a different amino acid so that the affinity of the VEGF/DLL4 binding agent for DLL4 is altered. In some embodiments, the affinity of the VEGF/DLL4 binding agent is increased. In some embodiments, the affinity of the VEGF/DLL4 binding agent is decreased.

[00218] In some embodiments, the VEGF/DLL4 binding agent comprises the heavy chain variable region and the light chain variable region of the 21R79 antibody. In some embodiments, the VEGF/DLL4 binding agent comprises the heavy chain and light chain of the 21R79 antibody (with or without the leader sequence). In some embodiments, the VEGF/DLL4 binding agent is the 21R79 antibody. In some embodiments, the VEGF/DLL4 binding agent comprises the same heavy chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13236. The plasmid PTA-13232 was deposited with the ATCC, at 10801 University Boulevard, Manassas, VA, 20110, under the conditions of the Budapest Treaty on September 21, 2012. In some embodiments, the VEGF/DLL4 binding agent comprises the same light chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13235. In some embodiments, the VEGF/DLL4 binding agent comprises the same heavy chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13232 and the same light chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13235.

[00219] In some embodiments, a VEGF/DLL4 binding agent comprises, consists essentially of, or consists of, the antibody 21R79. [00220] In some embodiments, the VEGF/DLL4 binding agent comprises the heavy chain variable region and the light chain variable region of the 21R75 antibody. In some embodiments, the VEGF/DLL4 binding agent comprises the heavy chain and light chain of the 21R75 antibody (with or without the leader sequence). In some embodiments, the VEGF/DLL4 binding agent is the 21R75 antibody. In some embodiments, the VEGF/DLL4 binding agent comprises the same heavy chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13234. The plasmid PTA-13234 was deposited with the ATCC, at 10801 University Boulevard, Manassas, VA, 20110, under the conditions of the Budapest Treaty on September 21, 2012. In some embodiments, the VEGF/DLL4 binding agent comprises the same light chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13235. In some embodiments, the VEGF/DLL4 binding agent comprises the same heavy chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA- 13232 and the same light chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13235.

[00221] In some embodiments, a VEGF/DLL4 binding agent comprises, consists essentially of, or consists of, the antibody 21R75.

[00222] In some embodiments, the VEGF/DLL4 binding agent comprises the heavy chain variable region and the light chain variable region of the 21R83 antibody. In some embodiments, the VEGF/DLL4 binding agent comprises the heavy chain and light chain of the 21R83 antibody (with or without the leader sequence). In some embodiments, the VEGF/DLL4 binding agent is the 21R83 antibody. In some embodiments, the VEGF/DLL4 binding agent comprises the same heavy chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13278. The plasmid PTA-13278 was deposited with the ATCC, at 10801 University Boulevard, Manassas, VA, 20110, under the conditions of the Budapest Treaty on October 24, 2012. In some embodiments, the VEGF/DLL4 binding agent comprises the same light chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13235. In some embodiments, the VEGF/DLL4 binding agent comprises the same heavy chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13278 and the same light chain variable region as a polypeptide encoded by the plasmid on deposit as ATCC Patent Deposit Designation PTA-13235.

[00223] In some embodiments, a VEGF/DLL4 binding agent comprises, consists essentially of, or consists of, the antibody 21R83.

[00224] In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) binds the same epitope, or essentially the same epitope, on DLL4 as antibody 21R79. In another embodiment, the VEGF/DLL4 binding agent is an antibody that binds an epitope on DLL4 that overlaps with the epitope on DLL4 bound by antibody 21R79. In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) binds the same epitope, or essentially the same epitope, on DLL4 as antibody 21R75. In another embodiment, the VEGF/DLL4 binding agent is an antibody that binds an epitope on DLL4 that overlaps with the epitope on DLL4 bound by antibody 21R75. In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) binds the same epitope, or essentially the same epitope, on DLL4 as antibody 21R83. In another embodiment, the VEGF/DLL4 binding agent is an antibody that binds an epitope on DLL4 that overlaps with the epitope on DLL4 bound by antibody 21R83.

[00225] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising a first antigen binding site that specifically binds human VEGF. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising a first antigen-binding site that specifically binds human VEGF and a second antigen-binding site that binds a tumor-associated target. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising: a first antigen binding site that specifically binds human VEGF, wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19). In some embodiments, the bispecific antibody further comprises: a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising: a first antigen-binding site that specifically binds human VEGF, wherein the first antigen-binding site comprises (a) a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19), and (b) a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22).

[00226] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising a first heavy chain variable region having at least about 80% sequence identity to SEQ ID NO: 11. In some embodiments, the bispecific antibody further comprises a light chain variable region having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: l l, and a light chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 12.

[00227] In some embodiments, the invention provides a VEGF/DLL4 binding agent that is a bispecific antibody. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising a first antigen-binding site that specifically binds human DLL4. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising a first antigen-binding site that specifically binds human DLL4 and a second antigen-binding site that binds a tumor-associated target. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising: a first antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YIX iX₂ YX3X4 ATN YN QKFKG (SEQ ID NO:80), wherein Xi is serine or alanine, X2 is serine, asparagine, or glycine, X3 is asparagine or lysine, and X4 is glycine, arginine, or aspartic acid, and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising: a first antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YI AN YNR ATN YN QKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YI AGYKD ATN YN QKFKG (SEQ ID NO:59), or YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16). In some embodiments, the bispecific antibody comprises a first antigen-binding site comprising a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YIANYNRATNYNQKFKG (SEQ ID NO: 14), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16). In some embodiments, the bispecific antibody comprises a first antigen-binding site comprising a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISSYNGATNYNQKFKG (SEQ ID NO: 15), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16). In some embodiments, the bispecific antibody comprises a first antigen-binding site comprising a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YI AGYKD ATN YN QKFKG (SEQ ID NO:59), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16). In some embodiments, the bispecific antibody comprises a first antigen-binding site comprising a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16). In some embodiments, the bispecific antibody further comprises: a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising: a first antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site comprises (a) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YIANYNRATNYNQKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YI AGYKD ATN YN QKFKG (SEQ ID NO:59), or YISN YNR ATN YN QKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16), and (b) a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22).

[00228] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody comprising a first heavy chain variable region having at least about 80% sequence identity to SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:58, or SEQ ID NO:64. In some embodiments, the bispecific antibody further comprises a light chain variable region having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:58, or SEQ ID NO:64; and/or a light chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 12.

[00229] In some embodiments, the VEGF/DLL4 binding agent (e.g., a bispecific antibody) specifically binds human VEGF and human DLL4. In some embodiments, the bispecific antibody comprises: a) a first antigen-binding site that specifically binds human VEGF, and b) a second antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19); wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YIX1X2YX3X4ATNYNQKFKG (SEQ ID NO: 80), wherein Xi is serine or alanine, X2 is serine, asparagine, or glycine, X3 is asparagine or lysine, and X4 is glycine, arginine, or aspartic acid, and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, a bispecific antibody comprises a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19), and the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YI AN YNRATN YN QKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YI AGYKD ATN YN QKFKG (SEQ ID NO:59), or YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22).

[00230] In some embodiments, the bispecific antibody comprises a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19), and the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YIANYNRATNYNQKFKG (SEQ ID NO: 14), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the bispecific antibody is 219R45-MB-21R79.

[00231] In some embodiments, the bispecific antibody comprises a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19), and the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISSYNGATNYNQKFKG (SEQ ID NO: 15), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the bispecific antibody is 219R45-MB-21M18.

[00232] In some embodiments, the bispecific antibody comprises a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site which comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19), and the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YIAGYKDATNYNQKFKG (SEQ ID NO:59), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the bispecific antibody is 219R45-MB-21R75.

[00233] In some embodiments, the bispecific antibody comprises a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4, wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19), and the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22). In some embodiments, the bispecific antibody is 219R45-MB-21R83.

[00234] In some embodiments, the VEGF/DLL4 binding agent (e.g., a bispecific antibody) comprises a first heavy chain variable region having at least about 80% sequence identity to SEQ ID NO:l l, a second heavy chain variable region having at least about 80% sequence identity to SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:58, or SEQ ID NO:64, and a first and a second light chain variable region having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: l l ; a second heavy chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:58, or SEQ ID NO:64; and a first and a second light chain variable region having at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region having at least about 95% sequence identity to SEQ ID NO: 11 , a second heavy chain variable region having at least about 95% sequence identity to SEQ ID NO:9, and a first and a second light chain variable region having at least about 95% sequence identity to SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region having at least about 95% sequence identity to SEQ ID NO: 11 , a second heavy chain variable region having at least about 95% sequence identity to SEQ ID NO: 10, and a first and a second light chain variable region having at least about 95% sequence identity to SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region having at least about 95% sequence identity to SEQ ID NO: 11 , a second heavy chain variable region having at least about 95% sequence identity to SEQ ID NO:58, and a first and a second light chain variable region having at least about 95% sequence identity to SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region having at least about 95% sequence identity to SEQ ID NO: 11 , a second heavy chain variable region having at least about 95% sequence identity to SEQ ID NO:64, and a first and a second light chain variable region having at least about 95% sequence identity to SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region comprising SEQ ID NO: 11 , a second heavy chain variable region comprising SEQ ID NO:9, and a first and a second light chain variable region comprising SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region comprising SEQ ID NO: 11, a second heavy chain variable region comprising SEQ ID NO: 10, and a first and a second light chain variable region comprising SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region comprising SEQ ID NO: 11, a second heavy chain variable region comprising SEQ ID NO:58, and a first and a second light chain variable region comprising SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region comprising SEQ ID NO: 11, a second heavy chain variable region comprising SEQ ID NO:64, and a first and a second light chain variable region comprising SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region consisting essentially of SEQ ID NO: 11, a second heavy chain variable region consisting essentially of SEQ ID NO:9, and a first and a second light chain variable region consisting essentially of SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region consisting essentially of SEQ ID NO: 11, a second heavy chain variable region consisting essentially of SEQ ID NO: 10, and a first and a second light chain variable region consisting essentially of SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region consisting essentially of SEQ ID NO: 11 , a second heavy chain variable region consisting essentially of SEQ ID NO:58, and a first and a second light chain variable region consisting essentially of SEQ ID NO: 12. In some embodiments, the bispecific VEGF/DLL4 binding agent comprises a first heavy chain variable region consisting essentially of SEQ ID NO: 11, a second heavy chain variable region consisting essentially of SEQ ID NO:64, and a first and a second light chain variable region consisting essentially of SEQ ID NO: 12.

[00235] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti-VEGF antibody 219R45. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti-DLL4 antibody 21M18. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti-DLL4 antibody 21R79. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti-DLL4 antibody 21R75. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti-DLL4 antibody 21R83. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti-VEGF antibody 219R45, a heavy chain variable region from the anti-DLL4 antibody 21R79 and two identical light chain variable regions. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti-VEGF antibody 219R45, a heavy chain variable region from the anti-DLL4 antibody 21M18 and two identical light chain variable regions. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti-VEGF antibody 219R45, a heavy chain variable region from the anti-DLL4 antibody 21R75 and two identical light chain variable regions. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain variable region from the anti- VEGF antibody 219R45, a heavy chain variable region from the anti-DLL4 antibody 21R83 and two identical light chain variable regions.

[00236] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a first CH3 domain and a second CH3 domain, each of which is modified to promote formation of heteromultimers. In some embodiments, the first and second CH3 domains are modified using a knobs-into-holes technique. In some embodiments, the first and second CH3 domains comprise changes in amino acids that result in altered electrostatic interactions. In some embodiments, the first and second CH3 domains comprise changes in amino acids that result in altered hydrophobic/hydrophilic interactions.

[00237] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises heavy chain constant regions selected from the group consisting of: (a) a first human IgGl constant region, wherein the amino acids at positions corresponding to positions 253 and 292 of SEQ ID NO:41 are replaced with glutamate or aspartate, and a second human IgGl constant region, wherein the amino acids at positions corresponding to positions 240 and 282 of SEQ ID NO:41 are replaced with lysine; (b) a first human IgG2 constant region, wherein the amino acids at positions corresponding to positions 249 and 288 of SEQ I DN042 are replaced with glutamate or aspartate, and a second human IgG2 constant region wherein the amino acids at positions corresponding to positions 236 and 278 of SEQ ID NO:42 are replaced with lysine; (c) a first human IgG3 constant region, wherein the amino acids at positions corresponding to positions 300 and 339 of SEQ ID NO:43 are replaced with glutamate or aspartate, and a second human IgG3 constant region wherein the amino acids at positions corresponding to positions 287 and 329 of SEQ ID NO:43 are replaced with lysine; and (d) a first human IgG4 constant region, wherein the amino acids at positions corresponding to positions 250 and 289 of SEQ ID NO:44 are replaced with glutamate or aspartate, and a second IgG4 constant region wherein the amino acids at positions corresponding to positions 237 and 279 of SEQ ID NO:44 are replaced with lysine.

[00238] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a first human IgGl constant region with amino acid substitutions at positions corresponding to positions 253 and 292 of SEQ ID NO:41, wherein the amino acids are replaced with glutamate or aspartate, and a second human IgGl constant region with amino acid substitutions at positions corresponding to positions 240 and 282 of SEQ ID NO:41, wherein the amino acids are replaced with lysine. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a first human IgG2 constant region with amino acid substitutions at positions corresponding to positions 249 and 288 of SEQ ID NO:42, wherein the amino acids are replaced with glutamate or aspartate, and a second human IgG2 constant region with amino acid substitutions at positions corresponding to positions 236 and 278 of SEQ ID NO:42, wherein the amino acids are replaced with lysine. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a first human IgG3 constant region with amino acid substitutions at positions corresponding to positions 300 and 339 of SEQ ID NO:43, wherein the amino acids are replaced with glutamate or aspartate, and a second human IgG2 constant region with amino acid substitutions at positions corresponding to positions 287 and 329 of SEQ ID NO:43, wherein the amino acids are replaced with lysine. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a first human IgG4 constant region with amino acid substitutions at positions corresponding to positions 250 and 289 of SEQ ID NO:44, wherein the amino acids are replaced with glutamate or aspartate, and a second human IgG4 constant region with amino acid substitutions at positions corresponding to positions 237 and 279 of SEQ ID NO:44, wherein the amino acids are replaced with lysine.

[00239] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a first human IgG2 constant region with amino acid substitutions at positions corresponding to positions 249 and 288 of SEQ ID NO:42, wherein the amino acids are replaced with glutamate, and a second human IgG2 constant region with amino acid substitutions at positions corresponding to positions 236 and 278 of SEQ ID NO:42, wherein the amino acids are replaced lysine. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a first human IgG2 constant region with amino acid substitutions at positions corresponding to positions 249 and 288 of SEQ ID NO:42, wherein the amino acids are replaced with aspartate, and a second human IgG2 constant region with amino acid substitutions at positions corresponding to positions 236 and 278 of SEQ ID NO:42, wherein the amino acids are replaced with lysine.

[00240] In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:5. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO: 56. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:62. In some embodiments, the bispecific antibody further comprises a light chain of SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7, a heavy chain of SEQ ID NO:5, and two light chains of SEQ ID NO:8. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7, a heavy chain of SEQ ID NO:6, and two light chains of SEQ ID NO:8. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7, a heavy chain of SEQ ID NO: 56, and two light chains of SEQ ID NO: 8. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7, a heavy chain of SEQ ID NO:62, and two light chains of SEQ ID NO:8.

[00241] . In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7, a heavy chain of SEQ ID NO:5, and two light chains of SEQ ID NO: 111. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7, a heavy chain of SEQ ID NO:6, and two light chains of SEQ ID NO: 111. In some embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7, a heavy chain of SEQ ID NO:56, and two light chains of SEQ ID NO: 111. In preferred embodiments, the VEGF/DLL4 binding agent is a bispecific antibody which comprises a heavy chain of SEQ ID NO:7, a heavy chain of SEQ ID NO:62, and two light chains of SEQ ID NO: 111.

[00242] In some embodiments, a VEGF/DLL4 binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NOG, SEQ ID NO:4, SEQ ID NOG, SEQ ID NOG, SEQ ID NO: l l, SEQ ID NO: 12, SEQ ID NO:47, and SEQ ID NO:49.

[00243] In some embodiments, a VEGF/DLL4 binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NOG, SEQ ID NOG, SEQ ID NOG, SEQ ID NO: 111, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:47, SEQ ID NO:49.

[00244] In some embodiments, a VEGF/DLL4 binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: l, SEQ ID NOG, SEQ ID NOG, SEQ ID NOG, SEQ NO ID:6, SEQ ID NOG, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NOG6, SEQ ID NOG8, SEQ ID NOG6, SEQ ID NOG7, SEQ ID NOG8, SEQ ID NO:62, SEQ ID NO:63, and SEQ ID NO:64.

[00245] In some embodiments, a VEGF/DLL4 binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: l, SEQ ID NOG, SEQ ID NOG, SEQ ID NOG, SEQ NO ID:6, SEQ ID NO:l l l, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NOG6, SEQ ID NOG8, SEQ ID NOG6, SEQ ID NOG7, SEQ ID NOG8, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64.In some embodiments, a VEGF/DLL4 binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:62, SEQ ID NO:63, and SEQ ID NO:64.

[00246] In some embodiments, a VEGF/DLL4 binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO: 111, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64.

[00247] In some embodiments, a VEGF/DLL4 binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:62, SEQ ID NO:63, and SEQ ID NO:64. In some embodiments, the VEGF/DLL4 binding agent further comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NOG, SEQ ID NO:7, SEQ ID NO: 11, SEQ ID NO:47, and SEQ ID NO:49. In some embodiments, the VEGF/DLL4 binding agent further comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO:4, SEQ ID NO:8, and SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent further comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO:4, SEQ ID NO: 111, and SEQ ID NO: 12.

[00248] In some embodiments, a VEGF/DLL4 binding agent comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NOG, SEQ ID NOG, SEQ ID NO: 11, SEQ ID NO:47, and SEQ ID NO:49. In some embodiments, the VEGF/DLL4 binding agent further comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NO: 1 , SEQ ID NOG, SEQ ID NOG, SEQ ID NOG, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NOG6, SEQ ID NOG7, SEQ ID NOG8, SEQ ID NO:62, SEQ ID NO:63, and SEQ ID NO:64. In some embodiments, the VEGF/DLL4 binding agent further comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NOG, SEQ ID NOG, and SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 binding agent further comprises a polypeptide comprising a sequence selected from the group consisting of: SEQ ID NOG, SEQ ID NO: 111 , and SEQ ID NO: 12.

[00249] In some embodiments, a VEGF/DLL4 binding agent (e.g., antibody) competes for specific binding to VEGF with an antibody that comprises a heavy chain variable region comprising SEQ ID NO: 11 and a light chain variable region comprising SEQ ID NO: 12. In some embodiments, a VEGF/DLL4 binding agent competes with antibody 219R45 for specific binding to human VEGF. In some embodiments, a VEGF/DLL4 binding agent or antibody competes for specific binding to VEGF in an in vitro competitive binding assay. In some embodiments, the VEGF is human VEGF. In some embodiments, the VEGF is mouse VEGF.

[00250] In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to VEGF with the antibody 219R45 (e.g., in a competitive binding assay).

[00251] In some embodiments, a VEGF/DLL4 binding agent (e.g., antibody) competes for specific binding to DLL4 with an antibody that comprises a heavy chain variable region comprising SEQ ID NO:9 SEQ ID NO: 10, SEQ ID NO:58, or SEQ ID NO:64 and a light chain variable region comprising SEQ ID NO: 12. In some embodiments, a VEGF/DLL4 binding agent competes with antibody 21R79 for specific binding to human DLL4. In some embodiments, a VEGF/DLL4 binding agent competes with antibody 21R75 for specific binding to human DLL4. In some embodiments, a VEGF/DLL4 binding agent competes with antibody 21R83 for specific binding to human DLL4. In some embodiments, a VEGF/DLL4 binding agent or antibody competes for specific binding to DLL4 in an in vitro competitive binding assay. In some embodiments, the DLL4 is human DLL4. In some embodiments, the DLL4 is mouse DLL4.

[00252] In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) binds the same epitope, or essentially the same epitope, on DLL4 as an antibody of the invention. In another embodiment, a VEGF/DLL4 binding agent is an antibody that binds an epitope on DLL4 that overlaps with the epitope on DLL4 bound by an antibody of the invention. In some embodiments, a VEGF/DLL4 binding agent binds the same epitope, or essentially the same epitope, on DLL4 as antibody 21R79. In some embodiments, a VEGF/DLL4 binding agent binds the same epitope, or essentially the same epitope, on DLL4 as antibody 21R75. In some embodiments, a VEGF/DLL4 binding agent binds the same epitope, or essentially the same epitope, on DLL4 as antibody 21R83. In another embodiment, the VEGF/DLL4 binding agent is an antibody that binds an epitope on DLL4 that overlaps with the epitope on DLL4 bound by antibody 21R79. In another embodiment, the VEGF/DLL4 binding agent is an antibody that binds an epitope on DLL4 that overlaps with the epitope on DLL4 bound by antibody 21R75. In another embodiment, the VEGF/DLL4 binding agent is an antibody that binds an epitope on DLL4 that overlaps with the epitope on DLL4 bound by antibody 21R83.

[00253] In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to DLL4 with the antibody 21R79 (e.g., in a competitive binding assay). In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to DLL4 with the antibody 21R75 (e.g., in a competitive binding assay). In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to DLL4 with the antibody 21R83 (e.g., in a competitive binding assay). In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to DLL4 with the antibody 21M18 (e.g., in a competitive binding assay). [00254] In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to VEGF and/or DLL4 with the bispecific antibody 219R45-MB-21M18 (e.g., in a competitive binding assay). In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to VEGF and/or DLL4 with the bispecific antibody 219R45-MB- 21M79 (e.g., in a competitive binding assay). In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to VEGF and/or DLL4 with the bispecific antibody 219R45-MB-21M75 (e.g., in a competitive binding assay). In some embodiments, the VEGF/DLL4 binding agent is an agent that competes for specific binding to VEGF and/or DLL4 with the bispecific antibody 219R45-MB-21M83 (e.g., in a competitive binding assay).

[00255] In some embodiments, the VEGF/DLL4 binding agent (e.g., an antibody) described herein binds VEGF and modulates VEGF activity. In some embodiments, the VEGF/DLL4 binding agent is a VEGF antagonist and inhibits VEGF activity. In some embodiments, the VEGF/DLL4 binding agent is a VEGF antagonist and modulates angiogenesis. In some embodiments, the VEGF/DLL4 binding agent is a VEGF antagonist and inhibits angiogenesis. In some embodiments, the VEGF/DLL4 binding agent is a VEGF antagonist and inhibits tumor growth.

[00256] In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) described herein binds human DLL4 and modulates DLL4 activity. In some embodiments, a VEGF/DLL4 binding agent is a DLL4 antagonist and inhibits DLL4 activity. In some embodiments, a VEGF/DLL4 binding agent is a DLL4 antagonist and inhibits Notch activity. In some embodiments, a VEGF/DLL4 binding agent is a DLL4 antagonist and inhibits Notch signaling. In some embodiments, a VEGF/DLL4 binding agent is a DLL4 antagonist and modulates angiogenesis. In some embodiments, a VEGF/DLL4 binding agent is a DLL4 antagonist and promotes aberrant angiogenesis. In some embodiments, a VEGF/DLL4 binding agent is a DLL4 antagonist and inhibits tumor growth.

[00257] In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) described herein is a bispecific antibody that binds human VEGF and modulates VEGF activity. In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) described herein is a bispecific antibody that binds human DLL4 and modulates DLL4 activity. In some embodiments, a VEGF/DLL4 binding agent (e.g., an antibody) described herein is a bispecific antibody that binds human VEGF and human DLL4 and modulates both VEGF and DLL4 activity. In some embodiments, the bispecific antibody is a VEGF antagonist and a DLL4 antagonist and inhibits both VEGF activity and DLL4 activity. In some embodiments, the bispecific antibody is a VEGF antagonist and a DLL4 antagonist and inhibits VEGF activity and Notch activity. In some embodiments, the bispecific antibody is a VEGF antagonist and a DLL4 antagonist and inhibits VEGF activity and Notch signaling. In some embodiments, the bispecific antibody is a VEGF antagonist and a DLL4 antagonist and modulates angiogenesis. In some embodiments, the bispecific antibody is a VEGF antagonist and a DLL4 antagonist and promotes aberrant angiogenesis. In some embodiments, the bispecific antibody is a VEGF antagonist and a DLL4 antagonist and inhibits angiogenesis. In some embodiments, the bispecific antibody is a VEGF antagonist and a DLL4 antagonist and inhibits tumor growth.

[00258] In some embodiments, the VEGF/DLL4 binding agent (e.g., an antibody or a bispecific antibody) is an antagonist of VEGF. In some embodiments, the VEGF/DLL4 binding agent is an antagonist of VEGF and inhibits VEGF activity. In some embodiments, the VEGF/DLL4 binding agent inhibits VEGF activity by at least about 10%, at least about 20%, at least about 30%, at least about 50%, at least about 75%, at least about 90%, or about 100%. In some embodiments, a VEGF/DLL4 binding agent that inhibits human VEGF activity is antibody 219R45. In some embodiments, a VEGF/DLL4 binding agent that inhibits human VEGF activity is a bispecific antibody comprising the antigen-binding site of 219R45. In some embodiments, a VEGF/DLL4 binding agent that inhibits human VEGF activity is the bispecific antibody 219R45-MB-21M18. In some embodiments, a VEGF/DLL4 binding agent that inhibits human VEGF activity is the bispecific antibody 219R45-MB-21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits human VEGF activity is the bispecific antibody 219R45-MB-21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits human VEGF activity is the bispecific antibody 219R45-MB-21R83.

[00259] In some embodiments, the VEGF/DLL4 binding agent (e.g., an antibody) is an antagonist of DLL4. In some embodiments, the VEGF/DLL4 binding agent is an antagonist of DLL4 and inhibits DLL4 activity. In some embodiments, the VEGF/DLL4 binding agent inhibits DLL4 activity by at least about 10%, at least about 20%, at least about 30%, at least about 50%, at least about 75%, at least about 90%, or about 100%. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is antibody 21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is antibody 21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is antibody 21R83. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is a bispecific antibody comprising the antigen-binding site of 21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is a bispecific antibody comprising the antigen binding site of 21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is a bispecific antibody comprising the antigen-binding site of 21R83. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is the bispecific antibody 219R45-MB-21M18. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is the bispecific antibody 219R45-MB-21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is the bispecific antibody 219R45- MB-21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits human DLL4 activity is the bispecific antibody 219R45-MB-21R83. [00260] In some embodiments, the VEGF/DLL4 binding agent (e.g., antibody) is an antagonist of Notch signaling. In some embodiments, the VEGF/DLL4 binding agent inhibits Notch signaling by at least about 10%, at least about 20%, at least about 30%, at least about 50%, at least about 75%, at least about 90%, or about 100%. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is antibody 21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is antibody 21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is antibody 21R83. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is a bispecific antibody comprising the antigen-binding site of 21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is a bispecific antibody comprising the antigen-binding site of 21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is a bispecific antibody comprising the antigen-binding site of 21R83. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is the bispecific antibody 219R45-MB-21M18. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is the bispecific antibody 219R45-MB- 21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is the bispecific antibody 219R45-MB-21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits Notch signaling is the bispecific antibody 219R45-MB-21R83.

[00261] In some embodiments, the VEGF/DLL4 binding agent (e.g., antibody) inhibits binding of VEGF to at least one receptor. In some embodiments, the VEGF/DLL4 binding agent inhibits binding of VEGF to VEGFR-1 or VEGFR-2. In some embodiments, the VEGF/DLL4 binding agent inhibits binding of VEGF to at least one VEGF receptor by at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, or at least about 95%. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human VEGF to at least one VEGF receptor is antibody 219R45. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human VEGF to at least one VEGF receptor is a bispecific antibody comprising the antigen-binding site of 219R45. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human VEGF to at least one VEGF receptor is the bispecific antibody 219R45- MB-21M18. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human VEGF to at least one VEGF receptor is the bispecific antibody 219R45-MB-21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human VEGF to at least one VEGF receptor is the bispecific antibody 219R45-MB-21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human VEGF to at least one VEGF receptor is the bispecific antibody 219R45-MB-21R83.

[00262] In some embodiments, the VEGF/DLL4 binding agent (e.g., antibody) inhibits binding of DLL4 protein to at least one Notch receptor. In some embodiments, the VEGF/DLL4 binding agent inhibits binding of DLL4 to Notchl, Notch2, Notch3, and/or Notch4. In some embodiments, the VEGF/DLL4 binding agent inhibits binding of DLL4 to at least one Notch receptor by at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, or at least about 95%. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is antibody 21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is antibody 21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is antibody 21R83. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is a bispecific antibody comprising the antigen-binding site of 21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is a bispecific antibody comprising the antigen-binding site of 21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is a bispecific antibody comprising the antigen-binding site of 21R83. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is the bispecific antibody 219R45-MB- 21M18. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is the bispecific antibody 219R45-MB-21R79. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is the bispecific antibody 219R45-MB-21R75. In some embodiments, a VEGF/DLL4 binding agent that inhibits binding of human DLL4 to at least one Notch receptor is the bispecific antibody 219R45-MB-21R83.

[00263] In some embodiments of any of the methods described herein, the VEGF/DLL4 bispecific antibody comprises a first heavy chain variable region having at least about 80% sequence identity to SEQ ID NO: 11 , a second heavy chain variable region having at least about 80% sequence identity to SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:58, or SEQ ID NO:64, and a first and a second light chain variable region having at least 80% sequence identity to SEQ ID NO: 12. In some embodiments, the VEGF/DLL4 bispecific antibody comprises a first heavy chain variable region having at least about 80% sequence identity to SEQ ID NO: 11 , a second heavy chain variable region having at least about 80% sequence identity to SEQ ID NO:64, and a first and a second light chain variable region having at least 80% sequence identity to SEQ ID NO: 12.

[00264] In some embodiments, a VEGF/DLL4 binding agent is a monoclonal antibody. In some embodiments, the monoclonal antibody is a humanized antibody. Typically, humanized antibodies are human immunoglobulins in which residues from the CDRs are replaced by residues from a CDR of a non-human species (e.g., mouse, rat, rabbit, hamster, etc.) that have the desired specificity, affinity, and/or binding capability using methods known to one skilled in the art. In some embodiments, the Fv framework region residues of a human immunoglobulin are replaced with the corresponding residues in an antibody from a non-human species that has the desired specificity, affinity, and/or binding capability. In some embodiments, a humanized antibody can be further modified by the substitution of additional residues either in the Fv framework region and/or within the replaced non-human residues to refine and optimize antibody specificity, affinity, and/or capability. In general, a humanized antibody will comprise substantially all of at least one, and typically two or three, variable domain regions containing all, or substantially all, of the CDRs that correspond to the non-human immunoglobulin whereas all, or substantially all, of the framework regions are those of a human immunoglobulin consensus sequence. In some embodiments, a humanized antibody can also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. In some embodiments, such humanized antibodies are used therapeutically because they may reduce antigenicity and HAMA (human anti mouse antibody) responses when administered to a human subject.

[00265] In some embodiments, the VEGF/DLL4 binding agent is a human antibody. Human antibodies can be directly prepared using various techniques known in the art. In some embodiments, human antibodies may be generated from immortalized human B lymphocytes immunized in vitro or from lymphocytes isolated from an immunized individual. In either case, cells that produce an antibody directed against a target antigen can be generated and isolated by techniques known in the art. In some embodiments, a human antibody can be selected from a phage library, where that phage library expresses human antibodies. Alternatively, phage display technology can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable domain gene repertoires from unimmunized donors. Techniques for the generation and use of antibody phage libraries are well-known by those of skill in the art. Once antibodies are identified, affinity maturation strategies known in the art, including but not limited to, chain shuffling and site -directed mutagenesis, may be employed to generate high affinity human antibodies.

[00266] In some embodiments, human antibodies can be made in transgenic mice that contain human immunoglobulin loci. Upon immunization these mice are capable of producing the full repertoire of human antibodies in the absence of endogenous immunoglobulin production.

[00267] In some embodiments, the VEGF/DLL4 binding agent is an antibody fragment. Antibody fragments may have different functions or capabilities than intact antibodies; for example, antibody fragments can have increased tumor penetration. Various techniques are known for the production of antibody fragments including, but not limited to, proteolytic digestion of intact antibodies. In some embodiments, antibody fragments include a F(ab')₂ fragment produced by pepsin digestion of an antibody molecule. In some embodiments, antibody fragments include a Fab fragment generated by reducing the disulfide bridges of an F(ab')₂ fragment. In other embodiments, antibody fragments include a Fab fragment generated by the treatment of the antibody molecule with papain and a reducing agent. In some embodiments, antibody fragments are produced recombinantly. In some embodiments, antibody fragments include Fv or single chain Fv (scFv) fragments. Fab, Fv, and scFv antibody fragments can be expressed in and secreted from E. cob or other host cells, allowing for the production of large amounts of these fragments. In some embodiments, antibody fragments are isolated from antibody phage libraries as discussed herein. For example, methods can be used for the construction of Fab expression libraries (Fluse et al., 1989, Science, 246: 1275-1281) to allow rapid and effective identification of monoclonal Fab fragments with the desired specificity for VEGF and/or DLL4 or derivatives, fragments, analogs or homologs thereof. In some embodiments, antibody fragments are linear antibody fragments. In some embodiments, antibody fragments are monospecific or bispecific. In some embodiments, the VEGF/DLL4 binding agent is a scFv. Various techniques known to those of skill in the art can be used for the production of single-chain antibodies specific to VEGF or DLL4.

[00268] Methods known in the art for purifying antibodies and other proteins also include, for example, those described in U.S. Patent Publication Nos. 2008/0312425; 2008/0177048; and 2009/0187005.

[00269] In some embodiments, the VEGF/DLL4 binding agent is a polypeptide that is not an antibody. A variety of methods for identifying and producing non-antibody polypeptides that bind with high affinity to a protein target are known in the art. See, e.g., Skerra, 2007, Curr. Opin. Biotechnol., 18:295-304; Hosse et al., 2006, Protein Science, 15: 14-27; Gill et al., 2006, Curr. Opin. Biotechnol., 17:653-658; Nygren, 2008, FEBS J., 275:2668-76; and Skerra, 2008, FEBS J., 275:2677-83. In some embodiments, phage or mammalian cell display technology may be used to produce and/or identify a VEGF/DLL4 binding polypeptide that is not an antibody. In some embodiments, the polypeptide comprises a protein scaffold of a type selected from the group consisting of protein A, protein G, a lipocalin, a fibronectin domain, an ankyrin consensus repeat domain, and thioredoxin.

[00270] In some embodiments, the VEGF/DLL4 binding agents or antibodies can be used in any one of a number of conjugated (i.e., an immunoconjugate or radioconjugate) or non-conjugated forms. In some embodiments, the antibodies can be used in a non-conjugated form to harness the subject's natural defense mechanisms including complement-dependent cytotoxicity and antibody- dependent cellular toxicity to eliminate malignant or cancer cells.

[00271] In some embodiments, the VEGF/DLL4 binding agent (e.g., an antibody or polypeptide) is conjugated to a cytotoxic agent. In some embodiments, the cytotoxic agent is a chemotherapeutic agent including, but not limited to, methotrexate, adriamycin, doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents. In some embodiments, the cytotoxic agent is an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof, including, but not limited to, diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain, ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), Momordica charantia inhibitor, curcin, crotin, Sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes. In some embodiments, the cytotoxic agent is a radioisotope to produce a radioconjugate or a radioconjugated antibody. A variety of radionuclides are available for the production of radioconjugated antibodies including, but not limited to,

Conjugates of an antibody and one or more small molecule toxins, such as calicheamicins, maytansine (e.g., mertansine), maytansinoid, trichothecene, and CC1065, and the derivatives of these toxins that have toxin activity, can also be used. Conjugates of an antibody and cytotoxic agent can be made using a variety of bifunctional protein-coupling agents including, but not limited to, N-succinimidyl-3-(2-pyridyidithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HC1), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis(p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5- difluoro-2, 4-dinitrobenzene).

[00272] In some embodiments, the VEGF/DLL4 binding agents used in the present invention are encoded by one or more polynucleotides described herein. These polynucleotides can be polynucleotides that encode a polypeptide (or a fragment of a polypeptide) that specifically binds VEGF, DLL4, both VEGF and DLL4. The term "polynucleotides that encode a polypeptide" encompasses a polynucleotide which includes only coding sequences for the polypeptide, as well as a polynucleotide which includes additional coding and/or non-coding sequences. For example, in some embodiments, the polynucleotide comprises a polynucleotide sequence that encodes an antibody to human VEGF or encodes a fragment of such an antibody (e.g., a fragment comprising the antigen-binding site). In some embodiments, the polynucleotide comprises a polynucleotide sequence that encodes an antibody to human DFF4 or encodes a fragment of such an antibody (e.g., a fragment comprising the antigen-binding site). The polynucleotides can be in the form of RNA or in the form of DNA. DNA includes cDNA, genomic DNA, and synthetic DNA; and can be double-stranded or single-stranded, and if single-stranded can be the coding strand or non-coding (anti-sense) strand.

[00273] In some embodiments, the polynucleotide comprises a polynucleotide encoding a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NOG, SEQ ID NO:4, SEQ ID NOG, SEQ ID NOG, SEQ ID NO:7, SEQ ID NOG, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:62, SEQ ID NO:63, and SEQ ID NO:64. In some embodiments, the polynucleotide comprises a polynucleotide encoding a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO: l, SEQ ID NOG, SEQ ID NOG, SEQ ID NOG, SEQ ID NOG, SEQ ID NOG, SEQ ID NO:7, SEQ ID NO: 111, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NOG6, SEQ ID NOG7, SEQ ID NOG8, SEQ ID NOG2, SEQ ID NOG3, and SEQ ID NOG4. [00274] In some embodiments, the polynucleotide comprises a polynucleotide encoding a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:62, and SEQ ID NO: 64. In some embodiments, the polynucleotide comprises a polynucleotide encoding a polypeptide comprising a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO: 111, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:62, and SEQ ID NO: 64. In some embodiments, the polynucleotide comprises a polynucleotide sequence selected from the group consisting of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID

NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID

NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:66, SEQ ID

NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID

NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, and SEQ ID NO:78.

[00275] In some embodiments, the polynucleotide comprises a polynucleotide having a nucleotide sequence at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, and in some embodiments, at least about 96%, 97%, 98% or 99% identical to a polynucleotide comprising a sequence selected from the group consisting of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, and SEQ ID NO:78. In some embodiments, the polynucleotide comprises a polynucleotide having a nucleotide sequence at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, and in some embodiments, at least about 96%, 97%, 98% or 99% identical to a polynucleotide comprising a sequence selected from the group consisting of SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:54, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, and SEQ ID NO:78. Also provided is a polynucleotide that comprises a polynucleotide that hybridizes to SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, and SEQ ID NO:78. In some embodiments, the hybridization is under conditions of high stringency.

[00276] In some embodiments, the polynucleotides comprise the coding sequence for the mature polypeptide fused in the same reading frame to a polynucleotide which aids, for example, in expression and secretion of a polypeptide from a host cell (e.g., a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell). The polypeptide having a leader sequence is a preprotein and can have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides can also encode for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.

[00277] In some embodiments, the polynucleotides comprise the coding sequence for the mature polypeptide fused in the same reading frame to a marker sequence that allows, for example, for purification of the encoded polypeptide. For example, the marker sequence can be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or the marker sequence can be a hemagglutinin (HA) tag derived from the influenza hemagglutinin protein when a mammalian host (e.g., COS-7 cells) is used. In some embodiments, the marker sequence is a FLAG-tag, a peptide of sequence DYKDDDDK (SEQ ID NO:45) which can be used in conjunction with other affinity tags.

[00278] The present invention further relates to variants of the hereinabove described polynucleotides encoding, for example, fragments, analogs, and/or derivatives.

[00279] In some embodiments, the polynucleotides comprise polynucleotides having a nucleotide sequence at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, and in some embodiments, at least about 96%, 97%, 98% or 99% identical to a polynucleotide encoding a polypeptide comprising a VEGF/DLL4 binding agent (e.g., an antibody), or fragment thereof, described herein.

[00280] As used herein, the phrase a polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence is intended to mean that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence can include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence can be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence can be inserted into the reference sequence. These mutations of the reference sequence can occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

[00281] The polynucleotide variants can contain alterations in the coding regions, non-coding regions, or both. In some embodiments, a polynucleotide variant contains alterations which produce silent substitutions, additions, or deletions, but does not alter the properties or activities of the encoded polypeptide. In some embodiments, a polynucleotide variant comprises silent substitutions that results in no change to the amino acid sequence of the polypeptide (due to the degeneracy of the genetic code). Polynucleotide variants can be produced for a variety of reasons, for example, to optimize codon expression for a particular host (i.e., change codons in the human mRNA to those preferred by a bacterial host such as E. coli). In some embodiments, a polynucleotide variant comprises at least one silent mutation in a non-coding or a coding region of the sequence.

[00282] In some embodiments, a polynucleotide variant is produced to modulate or alter expression (or expression levels) of the encoded polypeptide. In some embodiments, a polynucleotide variant is produced to increase expression of the encoded polypeptide. In some embodiments, a polynucleotide variant is produced to decrease expression of the encoded polypeptide. In some embodiments, a polynucleotide variant has increased expression of the encoded polypeptide as compared to a parental polynucleotide sequence. In some embodiments, a polynucleotide variant has decreased expression of the encoded polypeptide as compared to a parental polynucleotide sequence.

[00283] In some embodiments, at least one polynucleotide variant is produced (without changing the amino acid sequence of the encoded polypeptide) to increase production of a heteromultimeric molecule. In some embodiments, at least one polynucleotide variant is produced (without changing the amino acid sequence of the encoded polypeptide) to increase production of a bispecific antibody.

[00284] In some embodiments, the polynucleotides are isolated. In some embodiments, the polynucleotides are substantially pure.

[00285] Vectors and cells comprising the polynucleotides described herein are also provided. In some embodiments, an expression vector comprises a polynucleotide molecule. In some embodiments, a host cell comprises an expression vector comprising the polynucleotide molecule. In some embodiments, a host cell comprises a polynucleotide molecule.

[00286] In some embodiments, the VEGF/DLL4 binding agent is administered at a dose of from about O.Olpg to about lOOmg/kg of body weight (mpk), from about O.lpg to about lOOmg/kg of body weight, from about lpg to about lOOmg/kg of body weight, from about lmg to about lOOmg/kg of body weight, about lmg to about 80mg/kg of body weight from about lOmg to about lOOmg/kg of body weight, from about lOmg to about 75mg/kg of body weight, or from about lOmg to about 50mg/kg of body weight. In some embodiments, the VEGF/DLL4 binding agent is administered at a dose of from about O. lmg to about 20mg/kg of body weight. In some embodiments, the VEGF/DLL4 binding agent is administered once or more daily, weekly, monthly, or yearly. In some embodiments, the VEGF/DLL4 binding agent is administered once every week, once every two weeks, once every three weeks, or once every month.

[00287] In some embodiments, the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mpk to about 12.5 mpk (e.g., about 0.5 mpk, about 1.0 mpk, about 2.5 mpk, about 3.5 mpk, about 5.0 mpk, about 7.5 mpk, about 10.0 mpk, about 12.5 mpk, or any values or range of values thereof). In some embodiments, the VEGF/DLL4 binding agent is administered every one, two, three or four weeks at a dose of from about 0.5 mpk to about 12.5 mpk (e.g., about 0.5 mpk, about 1.0 mpk, about 2.5 mpk, about 3.5 mpk, about 5.0 mpk, about 7.5 mpk, about 10.0 mpk, about 12.5 mpk, or any values or range of values thereof).

[00288] In some embodiments, the VEGF/DLL4 binding agent is administered to the subject in an amount in excess of the VEGF level of the subject. In some embodiments, the VEGF level is the plasma VEGF level.

[00289] In some embodiments, a VEGF/DLL4 binding agent is administered in combination with at least one additional therapeutic agent. In some embodiments, the at least one additional therapeutic agent comprises 1, 2, 3, or more additional therapeutic agents. In some embodiments, the additional therapeutic agent is an anti-cancer agent.

[00290] Useful classes of therapeutic agents include, for example, antitubulin agents, auristatins, DNA minor groove binders, DNA replication inhibitors, alkylating agents (e.g., platinum complexes such as cisplatin, mono(platinum), bis(platinum) and tri-nuclear platinum complexes and carboplatin), anthracyclines, antibiotics, antifolates, antimetabolites, chemotherapy sensitizers, duocarmycins, etoposides, fluorinated pyrimidines, ionophores, lexitropsins, nitrosoureas, platinols, purine antimetabolites, puromycins, radiation sensitizers, steroids, taxanes, topoisomerase inhibitors, vinca alkaloids, or the like. In some embodiments, the additional therapeutic agent is an alkylating agent, an antimetabolite, an antimitotic, a topoisomerase inhibitor, or an angiogenesis inhibitor.

[00291] Further therapeutic agents that can be administered with the VEGF/DFF4 binding agent include chemotherapeutic agents. Chemotherapeutic agents useful in the instant invention include, but are not limited to, alkylating agents such as thiotepa and cyclophosphamide (CYTOXAN); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphor amide, triethylenethiophosphaoramide and trimethylolomelamime; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics such as aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, calicheamicin, carabicin, caminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (adriamycin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytosine arabinoside, dideoxyuridine, doxifluridine, enocitabine, floxuridine, 5-FU; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenishers such as folinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; podophyllinic acid; 2-ethylhy dr azide; procarbazine; PSK; razoxane; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (Ara-C); taxoids, e.g. paclitaxel (TAXOL) and docetaxel (TAXOTERE); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; platinum analogs such as cisplatin, carboplatin, oxaliplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; novantrone; teniposide; daunomycin; aminopterin; ibandronate; CPT11 ; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoic acid; esperamicins; capecitabine (XELODA); and pharmaceutically acceptable salts, acids or derivatives of any of the above. Chemotherapeutic agents also include anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens including, for example, tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (FARESTON); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above. In some embodiments, an additional therapeutic agent is cisplatin. In some embodiments, an additional therapeutic agent is oxaliplatin. In some embodiments, an additional agent is doxorubicin (adriamycin). In some embodiments, an additional agent is epirubicin.

[00292] In some embodiments, the chemotherapeutic agent is a topoisomerase inhibitor. Topoisomerase inhibitors are chemotherapeutic agents that interfere with the action of a topoisomerase enzyme (e.g., topoisomerase I or II). Topoisomerase inhibitors include, but are not limited to, doxorubicin F1C1, daunorubicin citrate, mitoxantrone F1C1, actinomycin D, etoposide, topotecan F1C1, teniposide (VM-26), and irinotecan, as well as pharmaceutically acceptable salts, acids, or derivatives of any of these. In some embodiments, an additional therapeutic agent is irinotecan.

[00293] In some embodiments, the chemotherapeutic agent is an anti-metabolite. An anti metabolite is a chemical with a structure that is similar to a metabolite required for normal biochemical reactions, yet different enough to interfere with one or more normal functions of cells, such as cell division. Anti-metabolites include, but are not limited to, gemcitabine, fluorouracil, capecitabine, methotrexate sodium, ralitrexed, pemetrexed, tegafur, cytosine arabinoside, thioguanine, 5-azacytidine, 6-mercaptopurine, azathioprine, 6-thioguanine, pentostatin, fludarabine phosphate, and cladribine, as well as pharmaceutically acceptable salts, acids, or derivatives of any of these. In some embodiments, an additional therapeutic agent is 5-fluorouracil. In some embodiments, additional agents are 5-fluorouracil and irinotecan. In some embodiments, additional agents are 5-fluorouracil and oxaliplatin. In some embodiments, additional agents are 5- fluorouracil and cisplatin. In some embodiments, an additional agent is methotrexate.

[00294] In some embodiments, the chemotherapeutic agent is an antimitotic agent, including, but not limited to, agents that bind tubulin. In some embodiments, the agent is a taxane. In some embodiments, the agent is paclitaxel or docetaxel, or a pharmaceutically acceptable salt, acid, or derivative of paclitaxel or docetaxel. In some embodiments, the agent is paclitaxel (TAXOL), docetaxel (TAXOTERE), albumin-bound paclitaxel (ABRAXANE), DHA-paclitaxel, or PG- paclitaxel. In some embodiments, the antimitotic agent comprises a vinca alkaloid, such as vincristine, binblastine, vinorelbine, or vindesine, or pharmaceutically acceptable salts, acids, or derivatives thereof. In some embodiments, the antimitotic agent is an inhibitor of kinesin Eg5 or an inhibitor of a mitotic kinase such as Aurora A or Plkl. In some embodiments, an additional agent is docetaxel.

[00295] In some embodiments, an additional therapeutic agent comprises an agent such as a small molecule. For example, treatment can involve the combined administration of a VEGF/DLL4 binding agent (e.g. an antibody) or therapeutic combination of the present invention with a small molecule that acts as an inhibitor against additional tumor-associated proteins including, but not limited to, EGFR, ErbB2, HER2, and/or VEGF. In some embodiments, the additional therapeutic agent is a small molecule that inhibits a cancer stem cell pathway. In some embodiments, the additional therapeutic agent is a small molecule inhibitor of the Notch pathway. In some embodiments, the additional therapeutic agent is a small molecule inhibitor of the Wnt pathway. In some embodiments, the additional therapeutic agent is a small molecule inhibitor of the BMP pathway. In some embodiments, the additional therapeutic agent is a small molecule that inhibits b-catenin signaling.

[00296] In some embodiments, the further therapeutic agent comprises a biological molecule, such as an antibody. For example, treatment can involve the combined administration of a VEGF/DLL4 binding agent with further antibodies against additional tumor-associated proteins including, but not limited to, antibodies that bind EGFR, ErbB2, HER2, VEGF and/or VEGF receptors. In some embodiments, the additional therapeutic agent is anti-HER2 antibody trastuzumab. In some embodiments, the additional therapeutic agent is anti-VEGFR-2 antibody ramucirumab. In some embodiments, the additional therapeutic agent is an antibody that is an anti-cancer stem cell marker antibody. In some embodiments, the additional therapeutic agent is an antibody that binds a component of the Notch pathway. In some embodiments, the additional therapeutic agent is an antibody that binds a component of the Wnt pathway. In some embodiments, the additional therapeutic agent is an antibody that inhibits a cancer stem cell pathway. In some embodiments, the additional therapeutic agent is an antibody inhibitor of the Notch pathway. In some embodiments, the additional therapeutic agent is an antibody inhibitor of the Wnt pathway. In some embodiments, the additional therapeutic agent is an antibody inhibitor of the BMP pathway. In some embodiments, the additional therapeutic agent is an antibody that inhibits b-catenin signaling. In some embodiments, the additional therapeutic agent is an antibody that is an angiogenesis inhibitor or modulator (e.g., an anti- VEGF or VEGF receptor antibody). In some embodiments, the additional therapeutic agent is bevacizumab (AVASTIN), trastuzumab (HERCEPTIN), panitumumab (VECTIBIX), or cetuximab (ERBITUX).

[00297] In some embodiments, the further therapeutic agent is an immunotherapeutic agent. In some embodiments, the immunotherapeutic agent is an antagonist of the PD-1/PD-L1 pathway, an antagonist of PD-1 or PD-1 activity, an antagonist of PD-L1 or PD-L1 activity, an antagonist of the CTLA-4 pathway, an antagonist of CTLA-4 or CTLA-4 activity, an antagonist of Tim-3 or Tim-3 activity, an antagonist of LAG3 or LAG3 activity, an antagonist of TIGIT or TIGIT activity, an antagonist of KIR or KIR activity, an antagonist of CD96 or CD96 activity, or an antagonist of IDOl or IDOl activity. In some embodiments, the antagonist is an antibody, for example, an antibody that specifically binds PD-1, PD-L1, CTLA-1, Tim-3, LAG3, TIGIT, KIR, CD96 and/or IDOl. In some embodiments, the immunotherapeutic agent is an agonist of the CTLA-4/CD28 pathway, an agonist of CD28 or CD28 activity, an agonist of 4-1BB or 4-1BB activity, an agonist of 0X40 or 0X40 activity, an agonist of GITR or GITR activity, an agonist of CD40 or CD40 activity, an agonist of CD27 or CD27 activity, or an agonist of CD80 or CD80 activity. In some embodiments, the immunotherapeutic agent is a cytokine, lymphokine, or interferon. Other exemplary immunotherapeutic agents are described, for example, in Int'l Pub. No. WO 2016/070051, which is incorporated by reference herein in its entirety.

[00298] Furthermore, treatment with a VEGF/DLL4 binding agent can include further treatment with other biologic molecules, such as one or more cytokines (e.g., lymphokines, interleukins, tumor necrosis factors, and/or growth factors) or can be accompanied by surgical removal of tumors, cancer cells, or any other therapy deemed necessary by a treating physician.

[00299] It will be appreciated that the VEGF/DLL4 binding agent and an additional therapeutic agent can be administered in any order or concurrently. In some embodiments, treatment with the VEGF/DLL4 binding agent can occur prior to, concurrently with, or subsequent to administration of chemotherapies. Combined administration may include co-administration, either in a single pharmaceutical formulation or using separate formulations, or consecutive administration in either order but generally within a time period such that all active agents can exert their biological activities simultaneously. Preparation and dosing schedules for such chemotherapeutic agents can be used according to manufacturers' instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in The Chemotherapy Source Book, 4^th Edition, 2008, M. C. Perry, Editor, Lippincott, Williams & Wilkins, Philadelphia, PA.

[00300] In some embodiments, the VEGF/DLL4 binding agent is administered in combination with leucovorin, 5-fluorouracil, and irinotecan (e.g., for treatment of colorectal cancer), in combination with paclitaxel (e.g., for treatment of ovarian cancer such as platinum-resistant ovarian cancer), in combination with gemcitabine and nab-paclitaxel (e.g., for treatment of pancreatic cancer), and in combination with paclitaxel and/or carboplatin (e.g., for treatment of endometrial cancer). In preferred embodiments, the VEGF/DLL4 binding agent is administered in combination with paclitaxel.

[00301] In some embodiments, the VEGF/DLL4 binding agent is administered in combination with gemcitabine and ABRAXANE. This combination can be used, for example, to treat pancreatic cancer.

[00302] In some embodiments, the VEGF/DLL4 binding agent is administered in combination with paclitaxel and carboplatin. This combination can be used, for example, to treat endometrial cancer.

[00303] The subject's cancer/tumor, can, in some embodiments, be refractory to some treatment(s). In some embodiments, the subject's cancer (or tumor) may be chemorefractory. In those cases, the VEGF/DLL4 binding agent can be second-line or third-line therapy for the cancer/tumor.

[00304] In some embodiments, the cancer or tumor is colorectal tumor and the VEGF/DLL4 binding agent is a modified immunoglobulin molecule comprising a first antigen-binding site that specifically binds VEGF and a second antigen-binding site that specifically binds human DLL4. In some embodiments, the VEGF/DLL4 binding agent is administered in combination with irinotecan.

[00305] In some embodiments, the cancer is colorectal cancer or the tumor is colorectal tumor and the antibody comprises (a) a first antigen-binding site that specifically binds human VEGF; and (b) a second antigen-binding site that specifically binds human DLL4; wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19); wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YI AN YNRATN YN QKFKG (SEQ ID NO: 14), YIS S YNG ATN YN QKFKG (SEQ ID NO: 15), YIAGYKDATNYNQKFKG (SEQ ID NO:59), or YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNY GISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22); and the antibody is administered in combination with irinotecan.

[00306] In some embodiments, the VEGF/DLL4 binding agent is administered in a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises the VEGF/DLL4 binding agent in combination with an additional therapeutic agent (e.g., those described herein). In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable vehicle. Suitable pharmaceutically acceptable vehicles include, but are not limited to, non-toxic buffers such as phosphate, citrate, and other organic acids; salts such as sodium chloride; antioxidants including ascorbic acid and methionine; preservatives such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens, such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol; low molecular weight polypeptides (e.g., less than about 10 amino acid residues); proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; carbohydrates such as monosaccharides, disaccharides, glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes such as Zn-protein complexes; and non-ionic surfactants such as TWEEN or polyethylene glycol (PEG) (Remington: The Science and Practice of Pharmacy, 22st Edition, 2012, Pharmaceutical Press, London).

[00307] A pharmaceutical composition can be administered in any number of ways for either local or systemic treatment. Administration can be topical by epidermal or transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders; pulmonary by inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, and intranasal; oral; or parenteral including intravenous, intraarterial, intratumoral, subcutaneous, intraperitoneal, intramuscular (e.g., injection or infusion), or intracranial (e.g., intrathecal or intraventricular). A pharmaceutical composition can also be in unit dosage form. Such formulations include tablets, pills, capsules, powders, granules, solutions or suspensions in water or non-aqueous media, or suppositories.

[00308] In some embodiments, the VEGF/DLL4 binding agent is administered at a dose of from about O.Olpg to about lOOmg/kg of body weight (mpk), from about O.lpg to about lOOmg/kg of body weight, from about lpg to about lOOmg/kg of body weight, from about lmg to about lOOmg/kg of body weight, about lmg to about 80mg/kg of body weight from about lOmg to about lOOmg/kg of body weight, from about lOmg to about 75mg/kg of body weight, or from about lOmg to about 50mg/kg of body weight. In some embodiments, the VEGF/DLL4 binding agent is administered at a dose of from about O. lmg to about 20mg/kg of body weight. In some embodiments, the VEGF/DLL4 binding agent is administered once or more daily, weekly, monthly, or yearly. In some embodiments, the VEGF/DLL4 binding agent is administered once every week, once every two weeks, once every three weeks, or once every month.

[00309] In some embodiments, the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mpk to about 12.5 mpk (e.g., about 0.5 mpk, about 1.0 mpk, about 2.5 mpk, about 3.5 mpk, about 5.0 mpk, about 7.5 mpk, about 10.0 mpk, about 12.5 mpk, or any values or range of values thereof). In some embodiments, the VEGF/DLL4 binding agent is administered every one, two, three or four weeks at a dose of from about 0.5 mpk to about 12.5 mpk (e.g., about 0.5 mpk, about 1.0 mpk, about 2.5 mpk, about 3.5 mpk, about 5.0 mpk, about 7.5 mpk, about 10.0 mpk, about 12.5 mpk, or any values or range of values thereof).

[00310] In some embodiments, the cancer or tumor is platinum-resistant ovarian cancer or tumor, platinum-resistant primary peritoneal cancer or tumor, or platinum-resistant fallopian cancer or tumor and the VEGF/DLL4 binding agent is a modified immunoglobulin molecule comprising a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4. In some embodiments, the modified immunoglobulin molecule is administered following prior administration of an anti- VEGF agent. In some embodiments, the modified immunoglobulin molecule is administered in combination with a taxane. In some embodiments, the taxane is paclitaxel, docetaxel, albumin-bound paclitaxel, DHA- paclitaxel, or PG-paclitaxel. In some embodiments, the modified immunoglobulin molecule is administered following failure of more than two prior therapies. In some embodiments, the anti- VEGF agent is bevacizumab. In some embodiments, the modified immunoglobulin molecule is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg. In some embodiments, the modified immunoglobulin molecule is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg. In some embodiments, the modified immunoglobulin molecule is administered weekly, every other week, every three weeks, or every four weeks. In some embodiments, the modified immunoglobulin molecule is administered every two weeks or every three weeks. In some embodiments, the modified immunoglobulin molecule is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks. In some embodiments, the modified immunoglobulin molecule is administered at a dose of about 3 mg/kg every two weeks.

[00311] In some embodiments, the cancer or tumor is platinum-resistant primary peritoneal cancer or tumor or platinum-resistant fallopian cancer or tumor and the VEGF/DLL4 binding agent is a modified immunoglobulin molecule comprising a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4. In some embodiments, the cancer or tumor is platinum-resistant ovarian cancer or tumor, platinum-resistant primary peritoneal cancer or tumor, or platinum-resistant fallopian cancer or tumor and the VEGF/DLL4 binding agent is a modified immunoglobulin molecule comprising a first antigen binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4. In some embodiments, the modified immunoglobulin molecule is administered in combination with a taxane.

[00312] In some embodiments, the cancer or tumor is colorectal cancer and the VEGF/DLL4 binding agent is a modified immunoglobulin molecule comprising a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4. In some embodiments, the VEGF/DLL4 binding agent is administered in combination with leucovorin, 5-fluorouraciI, and irinotecan. In some embodiments, the administering occurs after the cancer or tumor has failed to respond to another anti-cancer treatment.

[00313] Embodiments of the present disclosure can be further defined by reference to the following non-limiting examples, which describe in detail preparation of some antibodies of the present disclosure and methods for using antibodies of the present disclosure. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the present disclosure.

EXAMPLES Example 1

Baseline VEGF and P1GF plasma levels and post-treatment changes

[00314] This Example illustrates some results from a navicixizumab (OMP-305B83) phase la study with a 3+3 dose escalation design (NCT02298387). Navicixizumab (OMP-305B83) is an IgG2 humanized bispecific monoclonal antibody directed against both human DLL4 and VEGF. It was observed that most patients included in the trial showed low baseline (pre-treatment) levels of VEGF and/or PIGF and increased post-treatment levels of VEGF. A subset of patients, however, was found to have relatively high baseline levels of VEGF and/or PIGF, which decreased following navicixizumab treatments.

[00315] The navicixizumab phase la trial design is generally described in in Jimeno et al., "A first- in-human phase la study of the bispecific anti-DLL4/anti-VEGF antibody navicixizumab (OMP- 305B83) in patients with previously treated solid tumors," Invest New Drugs. 2018 Sep 19. Blood plasma samples were collected before treatment with navicixizumab (Day 0) and after 28 days of navicixizumab treatment (Q3W). Samples were assayed using the Myriad RBM HumanMap v2.0 platform, and the results from panels HCANCER2 and HMPCORE2 included Placenta Growth Factor (PLGF or PIGF: pg/mL) and Vascular Endothelial Growth Factor (VEGF: pg/mL), respectively. For this assay, a monoclonal capture antibody was used that detects human VEGFies and human VEGFm. In ELISAs, this antibody has approximately 10% cross-reactivity with recombinant mouse (rm) VEGF and recombinant rat (rr) VEGF and no cross-reactivity with recombinant human (rh) VEGF-D is observed. The immunogen for this antibody is S. frugiperda insect ovarian cell line Sf 21-derived recombinant human VEGFies Ala27-Argl91, Accession # NP_001165097.1. In addition, a polyclonal detection antibody was used to detect human VEGF. In direct EFISAs, this antibody has approximately 100% cross-reactivity with recombinant canine VEGF, less than 20% cross-reactivity with recombinant mouse VEGFies and recombinant rat VEGFi64, and less than 5% cross-reactivity with recombinant zebrafish VEGF. The immunogen for this antibody is S. frugiperda insect ovarian cell line Sf 21-derived recombinant human VEGFies AIa27-Argl91, Accession # NP_001165097.1.

[00316] Figure 1A shows that some patients treated with navicixizumab, exhibited high baseline VEGF protein levels and/or decreased VEGF protein levels after treatment. Figure IB shows that some patients treated with navicixizumab exhibited high baseline PIGF protein levels. The normal subject reference range for VEGF plasma levels is approximately 87-321 pg/mF (Myriad RBM).

Example 2

Patients with high baseline VEGF and/or P1GF or decreased post-treatment levels of VEGF show poor response to navicixizumab

[00317] Patients were treated with navicixizumab and plasma proteins were collected and analyzed for VEGF and P1GF as described in Example 1. In addition, RNA from pre-treatment formalin- fixed paraffin-embedded (FFPE) tumor specimens was quantified using RNAseq with Illumina TruSeq at Almac Diagnostics. Clinical benefit was evaluated as: NE = not evaluable; PD = progressive disease; SD = stable disease; PR = partial response; CR = complete response. Mutation calls were also obtained using GATK on the RNASeq reads and validated (pts with CTNNB1 S33C and S37F) using GATK calls from whole exome sequencing (SureSelectXT HS) for FFPE and whole blood DNA.

[00318] Figure 2 shows patients with high baseline VEGF and/or PIGF levels and/or decreased post treatment VEGF levels showed poor response to navicixizumab. Of the 61 patients with tumor assessment measurements shown, 53 had blood plasma protein data and 41 had FFPE tumor RNAseq. Patients with the highest baseline VEGF and PIGF plasma levels were a subset of the patients with progressive disease (PD). (Not shown: an additional ovarian cancer patient and colon cancer patient with PD, but no reportable tumor assessment measurement, had high baseline VEGF and PIGF levels). 8 of the 9 patients shown on the plot with decreases in post-treatment plasma VEGF levels showed progressive disease (1 patient had stable disease). An additional patient with PD (not shown) also showed a decrease. 4 of the 5 patients with decreases in post-treatment plasma PIGF showed progressive disease (PD). Furthermore, CTNNB1 mutations were observed in tumors from 3 patients with clinical benefit (PR or SD). Example 3

A gene signature of 26 angiogenesis-related and Notch-related genes expressed in baseline tumor samples were identified for association with clinical benefit

[00319] RNA from baseline tumor samples were collected before the patients in Example 1 were treated with navicixizumab. Paired end reads (75bp x 2) were mapped to the human genome GRCh38 (HG38) primary assembly downloaded from Gencode (v25) using STAR (v2.5). The raw counts for each gene were obtained using the featurecounts function in the Rsubread R package (vl.20.6). Trimmed mean of m-values (TMM) normalization was used. Notch-related and angiogenesis-related genes were individually associated with clinical benefit (PR + SD) versus none (PD) using receiver operator characteristic calculations with area under the curve (AUC). Two- sided Wilcoxon test was used to test for the distribution of signature expression score in patients with PR or SD (clinical benefit =1) and PD (clinical benefit =0).

[00320] Figure 3 A shows a gene signature of 26 angiogenesis-related and Notch-related genes expressed in baseline tumor samples identified for association with clinical benefit of treatment with navicixizumab. Figure 3A shows individual gene area under the curve (AUC) values for the top 13 positively correlated genes (left side) and top 13 negatively correlated genes (right side).

[00321] Figure 3B shows the gene signature score for each of the 39 tumors assessed in Figure 3 A, grouped by the clinical benefit of treatment with navicixizumab. "Score" was defined as mean (positively correlated genes of 13 genes) - mean (negatively correlated 13 genes). Two-sided Wilcoxon test was used to obtain the p-value for the difference between signature expression score in patients with PR or SD (clinical benefit =1) and PD (clinical benefit =0).

[00322] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.

[00323] Where aspects or embodiments of the invention are described in terms of a Markush group or other grouping of alternatives, the present invention encompasses not only the entire group listed as a whole, but also each member of the group individually and all possible subgroups of the main group, and also the main group absent one or more of the group members. The present invention also envisages the explicit exclusion of one or more of any of the group members in the claimed invention.

[00324] All publications, patents, patent applications, internet sites, and accession numbers/database sequences including both polynucleotide and polypeptide sequences cited herein are hereby incorporated by reference herein in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, internet site, or accession number/database sequence was specifically and individually indicated to be so incorporated by reference.

[00325] Following are the sequences disclosed in the application:





21R75 Heavy chain nucleotide sequence with signal sequence (13B Version 1) (SEQ ID NO:60)

TGCAAGGCATCCGGTTACTCGTTCACCGCATACTATATCCACTGGGTTAAACAGGCACCA GGACAGGGACTTGAATGGATCGGATATATCGCTGGATATAAAGATGCTACAAACTATAAC CAAAAATTCAAAGGACGCGTGACTTTCACAACTGACACCTCAACCTCGACAGCATACATG GAATTACGGTCCCTACGGTCTGACGACACTGCCGTTTACTATTGCGCTAGAGATTATGAT TATGATGTTGGAATGGACTATTGGGGCCAGGGAACACTGGTGACAGTGTCTTCTGCATCC ACT AAGGGAC CATC CGTGTTCCCTTTGGCCCCTTGCTCTCGTTCGACCTCTGAATCGACT GCCGCTCTGGGATGCCTCGTGAAAGATTACTTCCCTGAGCCTGTGACCGTTTCCTGGAAC TCGGGCGCCCTAACCTCTGGCGTGCACACATTCCCTGCCGTGCTACAGTCTTCTGGCCTA TACTCTTTATCTTCGGTTGTTACCGTACCTTCTTCTAACTTCGGAACCCAAACTTACACC TGTAACGTAGACCACAAGCCTTCGAACACCAAGGTGGACAAGACTGTTGAGCGAAAGTGC TGCGTTGAGTGCCCTCCATGTCCTGCACCTCCTGTGGCTGGCCCTTCTGTGTTCCTGTTC CCTCCAAAACCTAAGGACACTCTAATGATCTCTCGGACTCCTGAGGTGACTTGCGTGGTT GTGGACGTGTCCCACGAGGACCCTGAGGTGCAGTTCAATTGGTACGTGGACGGAGTCGAG GTGCACAATGCAAAGACCAAGCCTCGGGAGGAACAGTTCAACTCCACCTTCCGGGTGGTT TCTGTGTTGACCGTTGTGCACCAAGACTGGCTGAACGGCAAAGAATACAAGTGCAAGGTG TCCAACAAGGGCCTGCCTGCCCCTATCGAAAAGACCATCAGCAAGACCAAGGGCCAGCCT CGCGAGCCTCAGGTGTACACCCTGCCTCCCAGCCGGGAAGAAATGACCAAGAACCAGGTG TCCCTGACCTGTCTGGTGGAGGGCTTCTACCCTTCCGACATCGCCGTTGAGTGGGAGTCT AACGGACAGCCGGAGAACAACTACAAGACTACGCCTCCAATGCTGGACTCCGACGGCTCC TTCTTCCTGTACTCCGAACTGACCGTGGACAAGTCCCGGTGGCAGCAGGGCAACGTGTTC TCATGCTCCGTAATGCACGAAGCCTTGCACAATCACTACACTCAAAAGTCCCTATCCTTA TCTCCTGGCAAG

21R75 Heavy chain variable region nucleotide sequence (13B Version 1) (SEQ ID NO:68)

CAGGTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAACCTGGCGCCTCCGTGAAGATC

TCCTGCAAGGCCTCCGGCTACTCCTTCACCGCCTACTACATCCACTGGGTCAAGCAGGCC

CCTGGACAGGGCCTGGAATGGATCGGCTATATCGCCGGCTACAAGGACGCCACCAACTAC

AACCAGAAATTCAAGGGCAGAGTGACCTTCACCACCGACACCTCCACCTCTACCGCCTAC

ATGGAACTGCGGTCCCTGCGGAGCGACGACACCGCCGTGTACTACTGCGCCAGAGACTAC

GACTACGACGTGGGCATGGACTACTGGGGCCAGGGCACACTCGTGACCGTGTCCTCT

21R75 Heavy chain variable region nucleotide sequence (13B Version 2) (SEQ ID NO:69)

CAGGTTCAGCTAGTTCAGTCTGGAGCGGAAGTTAAGAAACCTGGAGCATCCGTGAAAATA AGTTGCAAGGCATCCGGTTACTCGTTCACCGCATACTATATCCACTGGGTTAAACAGGCA C C AGG AC AGGGAC T T G AAT GGAT C GG AT AT AT C GC T GG AT AT AAAG AT GC T AC AAAC T AT AACCAAAAATTCAAAGGACGCGTGACTTTCACAACTGACACCTCAACCTCGACAGCATAC ATGGAATTACGGTCCCTACGGTCTGACGACACTGCCGTTTACTATTGCGCTAGAGATTAT GATTATGATGTTGGAATGGACTATTGGGGCCAGGGAACACTGGTGACAGTGTCTTCT

21R83 Heavy chain variable region nucleotide sequence (13B Version 1) (SEQ ID NO:70)

CAGGTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAACCTGGCGCCTCCGTGAAGATC

TCCTGCAAGGCCTCCGGCTACTCCTTCACCGCCTACTACATCCACTGGGTCAAGCAGGCC

CCTGGACAGGGCCTGGAATGGATCGGCTACATCTCCAACTACAACCGGGCCACCAATTAC

AACCAGAAATTCAAGGGCCGCGTGACCTTCACCACCGACACCTCTACCTCTACCGCCTAC

ATGGAACTGCGGTCCCTGCGGAGCGACGACACCGCCGTGTACTACTGCGCCAGAGACTAC

GACTACGACGTGGGCATGGACTACTGGGGCCAGGGCACACTCGTGACCGTGTCTAGC

21R75 Heavy chain variable region nucleotide sequence (13B Version 2) (SEQ ID NO:71)

CAGGTTCAGCTAGTTCAGTCTGGAGCGGAAGTTAAGAAACCTGGAGCATCCGTGAAAATA AGTTGCAAGGCATCCGGTTACTCGTTCACCGCATACTATATCCACTGGGTTAAACAGGCA C C AGGAC AGGGACT T GAATGGAT C GGAT AT AT CGCT GGAT AT AAAGAT GC T AC AAAC TAT AACCAAAAATTCAAAGGACGCGTGACTTTCACAACTGACACCTCAACCTCGACAGCATAC ATGGAATTACGGTCCCTACGGTCTGACGACACTGCCGTTTACTATTGCGCTAGAGATTAT GATTATGATGTTGGAATGGACTATTGGGGCCAGGGAACACTGGTGACAGTGTCTTCT

CGCGAGCCTCAGGTGTACACCCTGCCTCCCAGCCGGGAAGAAATGACCAAGAACCAGGTG

TCCCTGACCTGTCTGGTGGAGGGCTTCTACCCTTCCGACATCGCCGTTGAGTGGGAGTCT

AACGGACAGCCGGAGAACAACTACAAGACTACGCCTCCAATGCTGGACTCCGACGGCTCC

TTCTTCCTGTACTCCGAACTGACCGTGGACAAGTCCCGGTGGCAGCAGGGCAACGTGTTC

TCATGCTCCGTAATGCACGAAGCCTTGCACAATCACTACACTCAAAAGTCCCTATCCTTA

TCTCCTGGCAAGTAG

21M18 Heavy chain nucleotide sequence (version 2) (SEQ ID NO:75)

ATGAAGCACCTATGGTTCTTTCTATTATTAGTGGCCGCTCCCCGTTGGGTGTTATCGCAG GTTCAGCTAGTTCAGTCTGGAGCGGAAGTTAAGAAACCTGGAGCATCCGTGAAAATAAGT TGCAAGGCATCCGGTTACTCGTTCACCGCATACTATATCCACTGGGTTAAACAGGCACCA GGACAGGGACTTGAATGGATCGGATATATCTCCTCTTATAATGGAGCTACAAACTATAAC CAAAAATTCAAAGGACGCGTGACTTTCACAACTGACACCTCAACCTCGACAGCATACATG GAATTACGGTCCCTACGGTCTGACGACACTGCCGTTTACTATTGCGCTAGAGATTATGAT TATGATGTTGGAATGGACTATTGGGGCCAGGGAACACTGGTGACAGTGTCTTCTGCATCC ACT AAGGGAC CATC CGTGTTCCCTTTGGCCCCTTGCTCTCGTTCGACCTCTGAATCGACT GCCGCTCTGGGATGCCTCGTGAAAGATTACTTCCCTGAGCCTGTGACCGTTTCCTGGAAC TCGGGCGCCCTAACCTCTGGCGTGCACACATTCCCTGCCGTGCTACAGTCTTCTGGCCTA TACTCTTTATCTTCGGTTGTTACCGTACCTTCTTCTAACTTCGGAACCCAAACTTACACC TGTAACGTAGACCACAAGCCTTCGAACACCAAGGTGGACAAGACTGTTGAGCGAAAGTGC TGCGTTGAGTGCCCTCCATGTCCTGCACCTCCTGTGGCTGGCCCTTCTGTGTTCCTGTTC CCTCCAAAACCTAAGGACACTCTAATGATCTCTCGGACTCCTGAGGTGACTTGCGTGGTT GTGGACGTGTCCCACGAGGACCCTGAGGTGCAGTTCAATTGGTACGTGGACGGAGTCGAG GTGCACAATGCAAAGACCAAGCCTCGGGAGGAACAGTTCAACTCCACCTTCCGGGTGGTT TCTGTGTTGACCGTTGTGCACCAAGACTGGCTGAACGGCAAAGAATACAAGTGCAAGGTG TCCAACAAGGGCCTGCCTGCCCCTATCGAAAAGACCATCAGCAAGACCAAGGGCCAGCCT CGCGAGCCTCAGGTGTACACCCTGCCTCCCAGCCGGGAAGAAATGACCAAGAACCAGGTG TCCCTGACCTGTCTGGTGGAGGGCTTCTACCCTTCCGACATCGCCGTTGAGTGGGAGTCT AACGGACAGCCGGAGAACAACTACAAGACTACGCCTCCAATGCTGGACTCCGACGGCTCC TTCTTCCTGTACTCCGAACTGACCGTGGACAAGTCCCGGTGGCAGCAGGGCAACGTGTTC TCATGCTCCGTAATGCACGAAGCCTTGCACAATCACTACACTCAAAAGTCCCTATCCTTA TCTCCTGGCAAGTAG

21M18 Heavy chain variable region (version 2) (SEQ ID NO:76)

CAGCTAGTTCAGTCTGGAGCGGAAGTTAAGAAACCTGGAGCATCCGTGAAAATAAGTTGC

AAGGCATCCGGTTACTCGTTCACCGCATACTATATCCACTGGGTTAAACAGGCACCAGGA

CAGGGACTTGAATGGATCGGATATATCTCCTCTTATAATGGAGCTACAAACTATAACCAA

AAATTCAAAGGACGCGTGACTTTCACAACTGACACCTCAACCTCGACAGCATACATGGAA

TTACGGTCCCTACGGTCTGACGACACTGCCGTTTACTATTGCGCTAGAGATTATGATTAT

GATGTTGGAATGGACTATTGGGGCCAGGGAACACTGGTGACAGTGTCTTCT

21R75 Heavy chain nucleotide sequence with signal sequence (13B Version IT) (SEQ ID NO:77)

ATGAAGCACCTGTGGTTCTTTCTGCTGCTGGTGGCCGCTCCCAGATGGGTGCTGTCTCAG

GTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAACCTGGCGCCTCCGTGAAGATCTCC

TGCAAGGCCTCCGGCTACTCCTTCACCGCCTACTACATCCACTGGGTCAAGCAGGCCCCT

GGACAGGGCCTGGAATGGATCGGCTATATCGCCGGCTACAAGGACGCCACCAACTACAAC

CAGAAATTCAAGGGCAGAGTGACCTTCACCACCGACACCTCCACCTCTACCGCCTACATG

GAACTGCGGTCCCTGCGGAGCGACGACACCGCCGTGTACTACTGCGCCAGAGACTACGAC

TACGACGTGGGCATGGACTACTGGGGCCAGGGCACACTCGTGACCGTGTCCTCTGCTTCC

ACCAAGGGCCCCTCCGTGTTTCCTCTGGCCCCTTGCTCCAGATCCACCTCCGAGTCTACC

GCCGCTCTGGGCTGCCTCGTGAAGGACTACTTCCCCGAGCCCGTGACAGTGTCTTGGAAC

TCTGGCGCCCTGACCTCCGGCGTGCACACCTTTCCAGCTGTGCTGCAGTCCTCCGGCCTG

TACTCCCTGTCCTCCGTCGTGACTGTGCCCTCCTCCAACTTCGGCACCCAGACCTACACC

TGTAACGTGGACCACAAGCCCTCCAACACCAAGGTGGACAAGACCGTGGAACGGAAGTGC

TGCGTGGAATGCCCCCCTTGTCCTGCCCCTCCTGTGGCTGGCCCTAGCGTGTTCCTGTTC

Alternative 21R75, 21R79, 21R83, and 21M18 Heavy chain CDR1 (SEQ ID NO:79)

AYYIH

Anti-DLL4 heavy chain CDR2 consensus sequence (SEQ ID NO: 80)

where Xi is serine or alanine, X2 is serine, asparagine, or glycine, X3 is asparagine or lysine, and X4 is glycine, arginine, or aspartic acid

(SEQ ID NO:81)

Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Phe Pro Met Ala Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Thr He Ser Ser Ser Asp Gly Thr Thr Tyr Tyr Arg Asp Ser Val Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Tyr Tyr Asn Ser Pro Phe Ala Tyr Trp Gly Gin Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Glu Val Gin Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Gly Met Asn Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Gly Trp

Phe He Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gin Trp Lys Val Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin Glu Ser Val Thr Glu Gin Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

Claims

WHAT IS CLAIMED IS:

1. A method of selecting a subject for treatment with a VEGF/DLL4 binding agent, comprising:

(a) determining the level of VEGF and/or P1GF in a sample from the subject; and

(b) selecting the subject for treatment with the VEGF/DLL4 binding agent if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF.

2. A method of selecting a subject for treatment with a VEGF/DLL4 binding agent, comprising:

(a) obtaining a sample from the subject;

(b) determining the level of VEGF and/or P1GF in the sample; and

(c) selecting the subject for treatment with the VEGF/DLL4 binding agent if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF.

3. A method of identifying a subject as eligible for treatment with a VEGF/DLL4 binding agent, comprising:

(a) determining the level of VEGF and/or P1GF in a sample from the subject; and

(b) identifying the subject as eligible for treatment with the VEGF/DLL4 binding agent if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF.

4. A method of identifying a subject as eligible for treatment with a VEGF/DLL4 binding agent, comprising:

(a) obtaining a sample from the subject;

(b) determining the level of VEGF and/or P1GF in the sample; and

(c) identifying the subject as eligible for treatment with the VEGF/DLL4 binding agent if the level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF.

5. The method of any one of claims 1-4, wherein the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less.

6. The method of any one of claims 1-4, wherein the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml.

7. The method of any one of claims 1-6, wherein the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 mg/pg.

8. The method of any one of claims 1-6, wherein the predetermined level of P1GF is about 50 pg/ml or less, about 75 pg/ml or less, about 100 pg/ml or less, about 120 pg/ml or less, about 150 pg/ml or less, or about 200 pg/ml or less.

9. The method of any one of claims 1-6, wherein the predetermined level of P1GF is from about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 150 pg/ml, about 50 pg/ml to about 120 pg/ml, about 50 pg/ml to about 100 pg/ml, about 50 pg/ml to about 75 pg/ml, about 75 pg/ml to about 200 pg/ml, about 75 pg/ml to about 150 pg/ml, about 75 pg/ml to about 120 pg/ml, about 75 pg/ml to about 100 pg/ml, about 100 pg/ml to about 200 pg/ml, about 100 pg/ml to about 150 pg/ml, about 100 pg/ml to about 120 pg/ml, about 120 pg/ml to about 200 pg/ml, about 120 pg/ml to about 150 pg/ml, or about 150 pg/ml to about 200 pg/ml.

10. The method of any one of claims 1-6, wherein the predetermined level of P1GF is about 50 pg/ml, about 75 pg/ml, about 100 pg/ml, about 120 pg/ml, about 150 pg/ml, or about 200 pg/ml.

11. The method of any one of claims 1-4, wherein the predetermined level of VEGF and/or P1GF is a normal reference level of VEGF and/or P1GF.

12. The method of any one of claims 1-11, wherein the predetermined level of VEGF and/or P1GF is the level of VEGF and/or P1GF in a sample obtained at an earlier date.

13. The method of any one of claims 1-12, wherein the predetermined level of VEGF and/or P1GF is the level of VEGF and/or P1GF in a sample obtained prior to treatment with the VEGF/DLL4 binding agent.

14. The method of any one of claims 1-12, wherein the subject has not previously received treatment with the VEGF/DLL4 binding agent.

15. The method of any one of claims 1-12, wherein the obtaining, determining and/or identifying occur prior to administration of the VEGF/DLL4 binding agent.

16. The method of any one of claims 1-15, further comprising:

administering the VEGF/DLL4 binding agent to the subject if the subject is eligible for treatment with the VEGF/DLL4 binding agent.

17. The method of claim 16, wherein the VEGF/DLL4 binding agent is administered to the subject in an amount in excess of VEGF level of the subject.

18. The method of claim 17, wherein the VEGF level is a plasma VEGF level.

19. The method of any one of claims 1-18, wherein the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg.

20. The method of any one of claims 1-18, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg.

21. The method of any one of claims 1-18, wherein the VEGF/DLL4 binding agent is administered weekly, every two weeks, every three weeks, or every four weeks.

22. The method of any one of claims 1-18, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks.

23. The method of any one of claims 1-18, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg every two weeks.

24. A method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising:

(a) determining the level of VEGF in a sample from the subject; and

(b) selecting the subject for termination of treatment if the level of VEGF decreases after treatment with the VEGF/DLL4 binding agent.

25. A method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising:

(a) obtaining a sample from the subject;

(b) determining the level of VEGF in the sample; and

(c) selecting the subject for termination of treatment if the level of VEGF decreases after treatment with the VEGF/DLL4 binding agent.

26. A method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising:

(a) determining the level of VEGF in a sample from the subject; and

(b) selecting the subject for risk of cancer or tumor progression if the level of VEGF decreases after treatment with the VEGF/DLL4 binding agent.

27. A method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising:

(a) obtaining a sample from the subject;

(b) determining the level of VEGF in the sample; and

(c) selecting the subject for risk of cancer or tumor progression if the level of VEGF decreases after treatment with the VEGF/DLL4 binding agent.

28. A method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising:

(a) determining a first level of VEGF in a first sample from the subject prior to administration of the VEGF/DLL4 binding agent;

(b) administering the VEGF/DLL4 binding agent;

(c) determining a second level of VEGF in a second sample from the subject;

(d) comparing the first and second VEGF levels; and

(e) terminating treatment with the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administered if the second VEGF level is lower than the first VEGF level.

29. The method of any one of claims 24-28, wherein the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less.

30. The method of any one of claims 24-28, wherein the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml.

31. The method of any one of claims 24-28, wherein the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 mg/pg.

32. The method of any one of claims 24-28, wherein the decrease in VEGF levels is about 100 pg/ml or more, about 200 pg/ml or more, about 400 pg/ml or more, about 600 pg/ml or more, about 800 pg/ml or more, or about 1000 pg/ml or more.

33. The method of any one of claims 24-28, wherein the decrease in VEGF levels is from about 100 pg/ml to about 1000 pg/ml, about 100 pg/ml to about 800 pg/ml, about 100 pg/ml to about 600 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 1000 pg/ml, about 200 pg/ml to about 800 pg/ml, about 200 pg/ml to about 600 pg/ml, about 200 pg/ml to about 400 pg/ml, about 400 pg/ml to about 1000 pg/ml, about 400 pg/ml to about 800 pg/ml, about 400 pg/ml to about 600 pg/ml, about 600 pg/ml to about 1000 pg/ml, about 600 pg/ml to about 800 pg/ml, or about 800 pg/ml to about 1000 pg/ml.

34. The method of any one of claims 24-28, wherein the decrease in VEGF levels is about 100 pg/ml, about 200 pg/ml, about 400 pg/ml, about 600 pg/ml, about 800 pg/ml, or about 1000 pg/ml.

35. The method of any one of claims 24-28, wherein the decrease in VEGF levels occurs over at least about 1 week, at least about 2 weeks, at least about 3 weeks or at least about 4 weeks.

36. The method of any one of claims 24-28, wherein the decrease in VEGF levels occurs over from about 1 week to about 4 weeks, about 1 week to about 3 weeks, about 1 week to about 2 weeks, about 2 weeks to about 4 weeks, about 2 weeks to about 3 weeks, or about 3 weeks to about 4 weeks.

37. The method of any one of claims 24-28, wherein the decrease in VEGF levels occurs over about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.

38. The method of any one of claims 24-37, wherein the predetermined level of VEGF is a normal reference level of VEGF.

39. The method of any one of claims 24-38, wherein the predetermined level of VEGF is the level of VEGF in a sample obtained at an earlier date.

40. The method of any one of claims 24-39, wherein the subject has received treatment with the VEGF/DLL4 binding agent.

41. The method of any one of claim 24-39, wherein the obtaining, determining and/or identifying occur after administration of the VEGF/DLL4 binding agent.

42. The method of any one of claims 24-41, further comprising:

terminating administration of the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administered if the level of VEGF decreases during treatment with the VEGF/DLL4 binding agent.

43. The method of any one of claims 24-42, wherein the VEGF/DLL4 binding agent is administered to the subject in an amount in excess of VEGF level of the subject.

44. The method of claim 43, wherein the VEGF level is a plasma VEGF level.

45. The method of any one of claims 24-44, wherein the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg.

46. The method of any one of claims 24-44, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg.

47. The method of any one of claims 24-46, wherein the VEGF/DLL4 binding agent is administered weekly, every two weeks, every three weeks, or every four weeks.

48. The method of any one of claims 24-44, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks.

49. The method of any one of claims 24-44, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg every two weeks.

50. The method of any one of claims 24-49, wherein a sample is obtained about every week, about every 2 weeks, about every 3 weeks, or about every 4 weeks.

51. A method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising:

(a) determining a first level of VEGF and/or P1GF in a first sample from the subject obtained prior to treatment with the VEGF/DLL4 binding agent;

(b) administering the VEGF/DLL4 binding agent to the subject;

(c) determining a second level of VEGF in a second sample from the subject obtained after administration of the VEGF/DLL4 binding agent; and

(d) terminating administration of the VEGF/DLL4 binding agent or increasing the dose of the VEGF/DLL4 binding agent administered if (i) the first level of VEGF and/or P1GF in the first sample is at or above a predetermined level of VEGF and/or P1GF, and (ii) the second level of VEGF in the second sample decreases during treatment with the VEGF/DLL4 binding agent.

52. A method of monitoring a subject receiving treatment with a VEGF/DLL4 binding agent, comprising:

(b) administering the VEGF/DLL4 binding agent to the subject;

(d) continuing administration of the VEGF/DLL4 binding agent if (i) the first level of VEGF and/or P1GF in the first sample is below a predetermined level of VEGF and/or P1GF, and (ii) the second level of VEGF in the second sample is above a predetermined level of VEGF and/or if the level of VEGF does not decrease during treatment with the VEGF/DLL4 binding agent.

53. The method of claim 51 or 52, wherein the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less.

54. The method of claim 51 or 52, wherein the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml.

55. The method of claim 51 or 52, wherein the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 mg/pg.

56. The method of claim 51 or 52, wherein the predetermined level of P1GF is about 50 pg/ml or less, about 75 pg/ml or less, about 100 pg/ml or less, about 120 pg/ml or less, about 150 pg/ml or less, or about 200 pg/ml or less.

57. The method of claim 51 or 52, wherein the predetermined level of P1GF is from about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 150 pg/ml, about 50 pg/ml to about 120 pg/ml, about 50 pg/ml to about 100 pg/ml, about 50 pg/ml to about 75 pg/ml, about 75 pg/ml to about 200 pg/ml, about 75 pg/ml to about 150 pg/ml, about 75 pg/ml to about 120 pg/ml, about 75 pg/ml to about 100 pg/ml, about 100 pg/ml to about 200 pg/ml, about 100 pg/ml to about 150 pg/ml, about 100 pg/ml to about 120 pg/ml, about 120 pg/ml to about 200 pg/ml, about 120 pg/ml to about 150 pg/ml, or about 150 pg/ml to about 200 pg/ml.

58. The method of claim 51 or 52, wherein the predetermined level of P1GF is about 50 pg/ml, about 75 pg/ml, about 100 pg/ml, about 120 pg/ml, about 150 pg/ml, or about 200 pg/ml.

59. The method of any one of claims 51-58, wherein the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg.

60. The method of any one of claims 51-58, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg.

61. The method of any one of claims 51-60, wherein the VEGF/DLL4 binding agent is administered weekly, every two weeks, every three weeks, or every four weeks.

62. The method of any one of claims 51-61, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks.

63. The method of any one of claims 51-61, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg every two weeks.

64. A method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising selectively administering a VEGF/DLL4 binding agent on the basis of the subject:

(a) having a level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to administration of the VEGF/DLL4 binding agent; and/or

(b) having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent.

65. A method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising

(a) selecting the subject for treatment with VEGF/DLL4 binding agent on the basis of the subject having a baseline level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to a first administration of the VEGF/DLL4 binding agent; and

(b) administering the VEGF/DLL4 binding agent to the patient.

66. A method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising

(a) administering the VEGF/DLL4 binding agent to the patient; and

(b) selecting the subject for continued administration of the VEGF/DLL4 binding agent on the basis of the subject having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent;

(c) continuing administration of the VEGF/DLL4 binding agent.

67. A method of selectively treating a subject with a VEGF/DLL4 binding agent, comprising

(a) selecting the subject for a first treatment with VEGF/DLL4 binding agent on the basis of the subject having a baseline level of VEGF and/or P1GF in a sample from the subject below a predetermined level of VEGF and/or P1GF prior to administration of the VEGF/DLL4 binding agent; (b) administering a first dose of the VEGF/DLL4 binding agent to the patient;

(c) selecting the subject for continued treatment with the VEGF/DLL4 binding agent on the basis of the subject having a level of VEGF in a sample from the subject above a predetermined level of VEGF and/or a level of VEGF that does not decrease after administration of the VEGF/DLL4 binding agent; and

(d) continuing administration of the VEGF/DLL4 binding agent to the patient.

68. A method of treating a subject with a VEGF/DLL4 binding agent, comprising: determining whether the subject is eligible for treatment with a VEGF/DLL4 binding agent by:

(i) obtaining or having obtained a sample from the subject; and

(ii) performing or having performed an assay on the sample to determine if the subject is eligible for treatment with a VEGF/DLL4 binding agent; and

69. A method of treating a subject with a VEGF/DLL4 binding agent, comprising:

(a) determining a first level of VEGF and/or P1GF in a first sample from the subject obtained before treatment with the VEGF/DLL4 binding agent;

(b) administering the VEGF/DLL4 binding agent to the subject if the first level of VEGF and/or P1GF is below a predetermined level of VEGF and/or P1GF;

(d) continuing treatment with the VEGF/DLL4 binding agent if the second level of VEGF is above a predetermined level of VEGF and/or if the level of VEGF does not decrease during treatment with the VEGF/DLL4 binding agent.

70. The method of any one of claims 64-69, wherein the predetermined level of VEGF is about 50 pg/ml or less, about 100 pg/ml or less, about 200 pg/ml or less, about 300 pg/ml or less, about 400 pg/ml or less, or about 500 pg/ml or less.

71. The method of any one of claims 64-69, wherein the predetermined level of VEGF is from about 50 pg/ml to about 500 pg/ml, about 50 pg/ml to about 400 pg/ml, about 50 pg/ml to about 300 pg/ml, about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 100 pg/ml, about 100 pg/ml to about 500 pg/ml, about 100 pg/ml to about 400 pg/ml, about 100 pg/ml to about 300 pg/ml, about 100 pg/ml to about 200 pg/ml, about 200 pg/ml to about 500 pg/ml, about 200 pg/ml to about 400 pg/ml, about 200 pg/ml to about 300 pg/ml, about 300 pg/ml to about 500 pg/ml, about 300 pg/ml to about 400 pg/ml, or about 400 pg/ml to about 500 pg/ml.

72. The method of any one of claims 64-69, wherein the predetermined level of VEGF is about 50 pg/ml, about 100 pg/ml, about 200 pg/ml, about 300 pg/ml, about 400 pg/ml, or about 500 mg/pg.

73. The method of any one of claims 64-72, wherein the predetermined level of P1GF is about 50 pg/ml or less, about 75 pg/ml or less, about 100 pg/ml or less, about 120 pg/ml or less, about 150 pg/ml or less, or about 200 pg/ml or less.

74.The method of any one of claims 64-72, wherein the predetermined level of P1GF is from about 50 pg/ml to about 200 pg/ml, about 50 pg/ml to about 150 pg/ml, about 50 pg/ml to about 120 pg/ml, about 50 pg/ml to about 100 pg/ml, about 50 pg/ml to about 75 pg/ml, about 75 pg/ml to about 200 pg/ml, about 75 pg/ml to about 150 pg/ml, about 75 pg/ml to about 120 pg/ml, about 75 pg/ml to about 100 pg/ml, about 100 pg/ml to about 200 pg/ml, about 100 pg/ml to about 150 pg/ml, about 100 pg/ml to about 120 pg/ml, about 120 pg/ml to about 200 pg/ml, about 120 pg/ml to about 150 pg/ml, or about 150 pg/ml to about 200 pg/ml.

75. The method of any one of claims 64-72, wherein the predetermined level of P1GF is about 50 pg/ml, about 75 pg/ml, about 100 pg/ml, about 120 pg/ml, about 150 pg/ml, or about 200 pg/ml.

76. The method of any one of claims 64-69, wherein the predetermined level of VEGF and/or P1GF is a normal reference level of VEGF and/or P1GF.

77. The method of any one of claims 64-76, wherein the predetermined level of VEGF and/or P1GF is the level of VEGF and/or P1GF in a sample obtained at an earlier date.

78. The method of any one of claims 64-77, wherein the VEGF/DLL4 binding agent is administered at a dose of from about 0.5 mg/kg to about 10 mg/kg.

79. The method of any one of claims 64-77, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, or about 10 mg/kg.

80. The method of any one of claims 64-79, wherein the VEGF/DLL4 binding agent is administered weekly, every two weeks, every three weeks, or every four weeks.

81. The method of any one of claims 64-79, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg, about 4 mg/kg, or about 5 mg/kg every three weeks.

82. The method of any one of claims 64-79, wherein the VEGF/DLL4 binding agent is administered at a dose of about 3 mg/kg every two weeks.

83. The method of any one of claims 1-82, wherein the sample is blood, serum, or plasma.

84. The method of any one of claims 1-83, wherein the subject is human.

85. The method of any one of claims 1-84, wherein the subject has cancer or a tumor.

86. The method of claim 85, wherein the cancer or tumor has a mutation in CTNNB1.

87. The method of claim 85, wherein the cancer is lung cancer, breast cancer, colon cancer, colorectal cancer, melanoma, pancreatic cancer, gastrointestinal cancer, renal cancer, ovarian cancer, liver cancer, endometrial cancer, kidney cancer, prostate cancer, thyroid cancer, neuroblastoma, glioma, glioblastoma, melanoma, cervical cancer, stomach cancer, bladder cancer, gallbladder cancer, nasopharygeal cancer, myoepithelial cancer, fallopian tube cancer, uterine cancer, neuroendocrine cancer, sarcoma, adrenal cancer, hepatoma, lymphoma, leukemia, or head and neck cancer.

88. The method of claim 85, wherein the tumor is a colorectal tumor, colon tumor, ovarian tumor, pancreatic tumor, lung tumor, liver tumor, breast tumor, kidney tumor, prostate tumor, gastrointestinal tumor, melanoma, cervical tumor, bladder tumor, or glioblastoma.

89. The method of claim 85, wherein the cancer is platinum-resistant ovarian cancer, platinum-resistant primary peritoneal cancer, or platinum-resistant fallopian cancer.

90. The method of any one of claims 1-84, wherein the VEGF/DLL4 binding agent is a VEGF/DLL4 antagonist.

91. The method of claim 85, wherein the VEGF/DLL4 antagonist is an antibody.

92. The method of claim 91, wherein the antibody comprises a VEGF binding site of bevacizumab; a heavy chain variable domain of bevacizumab; a light chain variable domain of bevacizumab; or a heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2 and light chain CDR3 of bevacizumab.

93. The method of claim 91, wherein the antibody is a monoclonal antibody, a recombinant antibody, a chimeric antibody, a humanized antibody, a human antibody, an antibody fragment comprising an antigen-binding site, a modified immunoglobulin molecule comprising an antigen-binding site, a dual variable domain antibody, a bispecific antibody, an IgGl antibody, an IgG2 antibody, an IgG4 antibody, a monovalent bispecific antibody, a bivalent bispecific antibody, or a dual variable domain antibody.

94. The method of claim 91, wherein the antibody is a bispecific antibody comprising: (a) a first heavy chain variable region having at least 90% sequence identity to SEQ ID NO: 11 ; (b) a second heavy chain variable region having at least 90% sequence identity to SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:58, or SEQ ID NO:64; and (c) a first and a second light chain variable region having at least 90% sequence identity to SEQ ID NO: 12.

95. The method of claim 91, wherein the antibody comprises a first antigen-binding site that specifically binds human VEGF, and a second antigen-binding site that specifically binds human DLL4, wherein:

(a) the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19); the second antigen binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13), a heavy chain CDR2 comprising YISN YNR ATN YN QKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16); and both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22); or (b) the first antigen-binding site comprises a heavy chain variable region that has at least 95% sequence identity to SEQ ID NO: 11 and comprises a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19) and one or more of (i) a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17) and (ii) a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18); the second antigen-binding site comprises a heavy chain variable region that has at least 95% sequence identity to SEQ ID NO:64 and comprises a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16) and one or more of (i) a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) and (ii) a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65); and both the first and second antigen-binding sites comprise an identical light chain variable region that has at least 95% sequence identity to SEQ ID NO: 12.

96. The method of claim 91, wherein the antibody specifically binds human DLL4, wherein the antibody comprises:

(a) a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO: 13), CDR2 (SEQ ID NO: 104, SEQ ID NO: 15 or SEQ ID NO: 105), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22), or

(b) a heavy chain variable region comprising amino acid sequence SEQ ID NO: 106, SEQ ID NO:9 or SEQ ID NO: 107, or a light chain variable region comprising SEQ ID NO: 12.

97. The method of claim 91, wherein the antibody comprises a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:13), CDR2 (SEQ ID NO: 104, SEQ ID NO: 15 or SEQ ID NO: 105), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22).

98. The method of claim 91, wherein the antibody comprises a heavy chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:13), CDR2 (SEQ ID NO: 15), and CDR3 (SEQ ID NO: 16), and a light chain variable region comprising CDR amino acid sequences CDR1 (SEQ ID NO:20), CDR2 (SEQ ID NO:21), and CDR3 (SEQ ID NO:22).

99. The method of claim 91, wherein the antibody comprises a heavy chain variable region comprising amino acid sequence SEQ ID NO: 106, SEQ ID NO:9 or SEQ ID NO: 107.

100. The method of claim 91, wherein the antibody comprises a heavy chain variable region comprising SEQ ID NO: 9 or

a light chain variable region comprising SEQ ID NO: 12.

101. The method of any one of claims 1-100, wherein the cancer is colorectal cancer or the tumor is colorectal tumor, the antibody comprises:

(b) a heavy chain variable region comprising amino acid sequence SEQ ID NO: 106, SEQ ID NO:9 or SEQ ID NO: 107, or a light chain variable region comprising SEQ ID NO: 12; and the VEGF/DLL4 binding agent is administered in combination with irinotecan.

102. The method of claim 91, wherein the antibody comprises

(a) a first antigen-binding site that specifically binds human VEGF; and

(b) a second antigen-binding site that specifically binds human DLL4;

wherein the first antigen-binding site comprises a heavy chain CDR1 comprising NYWMH (SEQ ID NO: 17), a heavy chain CDR2 comprising DINPSNGRTSYKEKFKR (SEQ ID NO: 18), and a heavy chain CDR3 comprising HYDDKYYPLMDY (SEQ ID NO: 19);

wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YI AN YNRATN YN QKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YIAGYKDATNYNQKFKG (SEQ ID NO:59), or YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16);

wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22).

103. The method of claim 102, wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13).

104. The method of claim 102, wherein the second antigen-binding site comprises a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65).

105. The method of claim 102, wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) and a heavy chain CDR2 comprising YISNYNRATNYNQKFKG (SEQ ID NO:65).

106. The method of claim 102, wherein the first antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO: 11.

107. The method of claim 102, wherein the second antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO:64.

108. The method of claim 102, wherein both the first and second antigen-binding sites comprise a light chain variable region comprising SEQ ID NO: 12.

109. The method of claim 102, wherein the first antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO: 11 and a light chain variable region comprising SEQ ID NO: 12, and the second antigen-binding site comprises a heavy chain variable region comprising SEQ ID NO:64 and a light chain variable region comprising SEQ ID NO: 12.

110. The method of any one of claims 1-109, wherein the cancer is colorectal cancer or the tumor is colorectal tumor, the antibody comprises:

(a) a first antigen-binding site that specifically binds human VEGF; and

(b) a second antigen-binding site that specifically binds human DLL4;

wherein the second antigen-binding site comprises a heavy chain CDR1 comprising TAYYIH (SEQ ID NO: 13) or AYYIH (SEQ ID NO:79), a heavy chain CDR2 comprising YI AN YNR ATN YN QKFKG (SEQ ID NO: 14), YISSYNGATNYNQKFKG (SEQ ID NO: 15), YI AGYKD ATN YN QKFKG (SEQ ID NO:59), or YISNYNRATNYNQKFKG (SEQ ID NO:65), and a heavy chain CDR3 comprising RDYDYDVGMDY (SEQ ID NO: 16);

wherein both the first and second antigen-binding sites comprise a light chain CDR1 comprising RASES VDNYGISFMK (SEQ ID NO:20), a light chain CDR2 comprising AASNQGS (SEQ ID NO:21), and a light chain CDR3 comprising QQSKEVPWTFGG (SEQ ID NO:22); and the antibody is administered in combination with irinotecan.

111. The method of any one of claims 1-110, wherein the VEGF/DLL4 binding agent comprises a first and second polypeptide chains, each independently comprising VDl-(Xl)n-VD2- C-(X2)n, wherein VD1 is a first variable domain; VD2 is a second variable domain; C is a constant domain; XI is a linker; X2 is an Fc region; n is 0 or 1, wherein the VD1 domains on the first and second polypeptide chains form a first functional target binding site and the VD2 domains on the first and second polypeptide chains form a second functional target binding site, and wherein the binding protein is capable of binding DLL4 and VEGF, wherein the first polypeptide chain of the binding protein comprises SEQ ID NO: 81 and the second polypeptide chain of the binding protein comprises SEQ ID NO: 82.

112. The method of claim 111, wherein the binding protein comprises the constant region sequences from SEQ ID NO: 83 and/or SEQ ID NO: 84.

113. The method of claim 111, wherein the first and second polypeptide chains of the binding protein comprise SEQ ID NOs:83 and 84.

114. The method of any one of claims 1-110, wherein the VEGF/DLL4 binding agent comprises: a protein specifically binding to DLL4, which recognizes a conformational epitope of DLL4 comprising amino acid residues 58th to 65th amino acid sequences and 110th to 115th amino acid sequences in amino acid sequences of DLL4 protein represented by SEQ ID NO:85, and an antibody specifically binding to VEGF.

115. The method of claim 114, wherein the protein specifically binding to DLL4 comprises a heavy chain variable region comprising heavy chain CDR1 having an amino acid sequence represented by SEQ ID NO: 86, heavy chain CDR2 having an amino acid sequence represented by SEQ ID NO: 87, and heavy chain CDR3 having an amino acid sequence represented by SEQ ID NO:88, and a light chain variable region comprising light chain CDR1 having an amino acid sequence represented by SEQ ID NO: 89, light chain CDR2 having an amino acid sequence represented by SEQ ID NO:90, and light chain CDR3 having an amino acid sequence represented by SEQ ID NO:91.

116. The method of claim 114, wherein the protein binding specifically to DLL4 comprises a heavy chain amino acid sequence represented by SEQ ID NO: 92 and a light chain amino acid sequence represented by SEQ ID NO:93.

117. The method of claim 114, wherein the antibody specifically binding to VEGF comprises a heavy chain variable region comprising heavy chain CDR1 having an amino acid sequence represented by SEQ ID NO:94, heavy chain CDR2 having an amino acid sequence represented by SEQ ID NO:95, and heavy chain CDR3 having an amino acid sequence represented by SEQ ID NO:96, and a light chain variable region comprising light chain CDR1 having an amino acid sequence represented by SEQ ID NO:97, light chain CDR2 having an amino acid sequence represented by SEQ ID NO:98, and light chain CDR3 having an amino acid sequence represented by SEQ ID NO:99.

118. The method of claim 114, wherein the antibody specifically binding to VEGF comprises a heavy chain variable region having an amino acid sequence represented by SEQ ID NO: 100 and a light chain variable region having an amino acid sequence represented by SEQ ID NO: 101.

119. The method of claim 114, wherein the antibody binding specifically to VEGF is Bevacizumab.

120. The method of claim 114, wherein the antibody specifically binding to VEGF comprises a heavy chain variable region having an amino acid sequence represented by SEQ ID NO: 102 and a light chain variable region having an amino acid sequence represented by SEQ ID NO: 103.

121. The method of any one of claims 1-91, wherein the antibody is 219R45-MB- 21M18, 219R45-MB-21R79, 219R45-MB-21R75, or 219R45-MB-21R83.

122. The method of any one of claims 1-121, wherein the level of VEGF that is determined is the level of VEGFies, VEGFm, or a combination thereof.

123. A method of selecting a subject for treatment with a VEGF/DLL4 binding agent, comprising:

(a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, ELAVL1, SERPINF1, PLCD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, LEF1, and ECM1 ; and

(b) selecting the subject for treatment with the VEGF/DLL4 binding agent if the level of the one or more genes is above a predetermined level.

124. A method of identifying a subject as eligible for treatment with a VEGF/DLL4 binding agent, comprising:

(a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, EFAVF1, SERPINF1, PECD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, EEF1, and ECM1; and

(b) selecting the subject for treatment with the VEGF/DEE4 antagonist if the level of the one or more genes is above a predetermined level.

125. A method of selectively treating a subject with a VEGF/DEE4 binding agent, comprising selectively administering a VEGF/DEE4 binding agent on the basis of the subject having a level of one or more genes in a sample from the subject above a predetermined level, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, EEAVE1, SERPINF1, PECD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, EEF1, and ECM1.

126. A method of selectively treating a subject with a VEGF/DEE4 binding agent, comprising

(a) selecting the subject for treatment with VEGF/DEE4 binding agent on the basis of the subject having a level of one or more genes in a sample from the subject above a predetermined level, wherein the one or more genes is selected from the group consisting of: NRP2, FZD1, MAP2K1, EEAVE1, SERPINF1, PECD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, EEF1, and ECM1; and

(b) administering the VEGF/DEE4 binding agent to the patient.

127. A method of treating a subject with a VEGF/DEE4 binding agent, comprising determining whether the subject is eligible for treatment with a VEGF/DEE4 binding agent by:

(i) obtaining or having obtained a sample from the subject; and

(ii) performing or having performed an assay on the sample to determine if the subject is eligible for treatment with a VEGF/DEE4 binding agent;

wherein if the subject is eligible for treatment with the VEGF/DEE4 binding agent, then administering the VEGF/DEE4 binding agent to the subject; and

wherein the subject is eligible for treatment with the VEGF/DEE4 binding agent if the level of one or more genes selected from the group consisting of: NRP2, FZD1, MAP2K1, EEAVE1, SERPINF1, PECD1, TIMP2, ACVR1, CYP1B1, BMP7, MMP19, EEF1, and ECM1 is above a predetermined level.

128. A method of identifying a subject as ineligible for treatment with a VEGF/DEE4 binding agent, comprising:

(a) determining the level of one or more genes in a sample from the subject, wherein the one or more genes is selected from the group consisting of: PGF, VAV2, APOED1, EIF2S2, DTX3E, KRIT1, EFNG, STAT1, PTK2, HPSE, DDAH1, FGF9, and EDNRA; and (b) excluding the subject from treatment with the VEGF/DLL4 binding agent if the level of the one or more genes is above a predetermined level.

129. A method of excluding a subject from treatment with a VEGF/DLL4 binding agent, comprising determining whether the subject is ineligible for treatment with a VEGF/DLL4 binding agent by:

(i) obtaining or having obtained a sample from the subject; and

(ii) performing or having performed an assay on the sample to determine if the subject is ineligible for treatment with a VEGF/DLL4 binding agent;

wherein if the subject is ineligible for treatment with the VEGF/DLL4 binding agent, then the subject is excluded from treatment with the VEGF/DLL4 binding agent; and

wherein the subject is ineligible for treatment with the VEGF/DLL4 binding agent if the level of one or more genes selected from the group consisting of: PGF, VAV2, APOLD1, EIF2S2, DTX3L, KRIT1, LFNG, STAT1, PTK2, HPSE, DDAH1, FGF9, and EDNRA is above a predetermined level.