WO2020090974A1

WO2020090974A1 - Biosensor

Info

Publication number: WO2020090974A1
Application number: PCT/JP2019/042761
Authority: WO
Inventors: 上田　宏; 九龍蘇; 哲也北口; 有紀大室; フーンショーン; ベーサイラス
Original assignee: 国立大学法人東京工業大学; エージェンシーフォーサイエンス、テクノロジーアンドリサーチ
Priority date: 2018-11-02
Filing date: 2019-10-31
Publication date: 2020-05-07
Also published as: JP7169582B2; JP2020068746A

Abstract

To detect an antibody at a high sensitivity, provided is a biosensor for detecting an antibody binding to a peptide, said biosensor containing 1) a fused protein containing an enzyme mutant which is activated by multimer formation, a transmembrane domain and the aforesaid peptide and 2) a vesicle composed of a lipid membrane, characterized in that: A) the enzyme mutant is a mutant having a mutation introduced thereinto by which the binding affinity between monomers is lowered; B) the transmembrane domain penetrates through the lipid membrane of the vesicle; C) the enzyme mutant, which is activated by multimer formation, is exposed inside the vesicle; and D) the peptide is exposed outside the vesicle.

Description

Biosensor

The present invention relates to an antibody detection biosensor, a method for manufacturing the biosensor, and a method for detecting an antibody using the biosensor. The present invention also relates to an antigen detection biosensor and a method for detecting an antigen using the biosensor.

Currently, immunoassays are becoming an increasingly important measurement technique in clinical diagnosis. In adopting individual immunoassays, not only improvement in sensitivity and specificity, but also rapid and simple measurement are becoming major factors. In the currently mainstream immunoassays, the sandwich method is used as a measurement principle for detecting protein biomarkers, and the competitive method is used as a measurement principle for detecting small molecules. However, both of them are often enzyme immunoassays that mainly measure the enzyme activity used for the label after several times of reaction and washing, and there is a problem that the measurement takes time and takes several hours. On the other hand, the homogeneous immunoassay method in which a sample and a measurement reagent are mixed and allowed to react with each other and detected is simple and rapid, and thus has attracted attention in recent years.

Regarding the homogeneous immunoassay, a method utilizing a mutant of β-glucuronidase (GUS) has recently been reported by the present inventor (Patent Document 1). GUS shows activity by forming a tetramer, but if there is a mutation in the amino acid sequence (for example, mutations in which methionine at position 516 and tyrosine at position 517 of E. coli GUS are replaced by lysine and glutamic acid, respectively) Affinity between the bodies decreases, and dimers are formed, but tetramers do not form under normal conditions. The above-mentioned measurement method utilizes such a property of GUS, and there are two types of fusion proteins, that is, a fusion protein containing an antibody V _H region and a GUS variant and a fusion protein containing an antibody V _L region and a GUS variant. Use a fusion protein. The principle of this measuring method is as follows. If the sample does not exist antigen, since remains weak interaction V _H and V _L domains, the most tetramer dimer in intact variant of GUS connecting the V _H region and the V _L region Don't On the other hand, when the antigen is present in the sample, the interaction between the V _H and V _L regions is strengthened, and this interaction also binds the dimer of the GUS mutant linked to the V _H and V _L regions. Then, it forms a tetramer and becomes active. Therefore, the amount of antigen in the sample can be measured by measuring the activity of GUS.

International Publication No. 2017/130610

The method described in Patent Document 1 is a method capable of detecting an antigen with high sensitivity, but in the use in the medical field such as clinical diagnosis, a detection method with higher sensitivity is required. The present invention has been made under such a background, and an object thereof is to provide a highly sensitive homogeneous immunoassay means.

The present inventor is a biosensor comprising a fusion protein containing a GUS variant into which a mutation that inhibits tetramer formation is introduced and a His tag, and a vesicle composed of a lipid membrane. We have constructed a biosensor in which the His tag is located outside the vesicle and the GUS mutant is located inside the vesicle, which penetrates the lipid membrane of the vesicle, and this biosensor is highly sensitive to the antibody that binds to the His tag. It was found that can be detected by. Also, by replacing the His tag in this biosensor with the Spy tag and connecting the Spy tag and the antibody variable region via the Spy catcher that binds to the Spy tag, the antigen that binds to the antibody variable region can be detected with high sensitivity. Also found.

The present invention has been completed based on the above findings.
That is, the present invention provides the following [1] to [16].

[1] A biosensor for detecting an antibody that binds to a peptide, comprising: 1) a fusion protein containing a variant of an enzyme activated by formation of a multimer, a transmembrane domain, and the peptide, and 2) A) a vesicle composed of a lipid membrane, wherein A) the mutant of the enzyme is a mutant into which a mutation that reduces the binding affinity between monomers is introduced, and B) the transmembrane domain has the small size. Penetrate the lipid membrane of the vesicle, C) a variant of the enzyme that is activated by the formation of the multimer is exposed inside the vesicle, and D) the peptide is exposed outside the vesicle. A biosensor characterized by.

[2] The biosensor according to [1], wherein the mutant of the enzyme activated by the formation of the multimer is a mutant of β-glucuronidase.

[3] A mutant of β-glucuronidase, wherein 51st phenylalanine in the amino acid sequence of Escherichia coli β-glucuronidase is replaced with tyrosine, 64th alanine is replaced with valine, 185th aspartic acid is replaced with asparagine, and 516th position Methionine is replaced with lysine, 525th tyrosine is replaced with phenylalanine, 559th glycine is replaced with serine, 567th lysine is replaced with arginine, 585th glutamine is replaced with histidine, and 601st position. The biosensor according to [2], wherein the glycine is a mutant in which aspartic acid is substituted.

[4] The biosensor according to any one of [1] to [3], wherein the transmembrane domain is a transmembrane domain of epidermal growth factor receptor.

[5] The biosensor according to any one of [1] to [4], wherein the lipid membrane is a lipid membrane containing phospholipid and cholesterol.

[6] The biosensor according to any one of [1] to [5], wherein the peptide is a His tag, Spy tag, Snoop tag, HA tag, myc tag, or FLAG tag.

[7] The method for producing a biosensor according to any one of [1] to [6], which comprises the following steps (1) to (5):
(1) Includes a vector expressing a fusion protein containing a mutant of an enzyme activated by the formation of a multimer, a transmembrane domain and a peptide, a reagent required for cell-free transcription, and a reagent required for cell-free translation Preparing an aqueous solution,
(2) A step of dispersing the aqueous solution prepared in step (1) in an oil phase containing phospholipids and cholesterol to produce a W / O emulsion,
(3) A step of forming a liposome containing the vector and the reagent inside in an aqueous solution by overlaying the W / O emulsion generated in step (2) on the aqueous solution and sedimenting by centrifugation.
(4) a step of collecting the liposome formed in the step (3),
(5) A step of advancing transcription and translation reactions in the liposome recovered in step (4).

[8] A method for detecting an antibody in a sample, comprising the step of contacting the sample with the biosensor according to any one of [1] to [6], and detecting the formation of a multimer by a change in enzyme activity. A method for detecting an antibody, which comprises a step.

[9] A biosensor for detecting an antigen that binds to an antibody variable region, comprising: 1) a first fusion protein containing a variant of an enzyme that is activated by the formation of a multimer, a transmembrane domain, and a peptide. 2) a second fusion protein containing the antibody variable region and a protein having an affinity for the peptide, and 3) a vesicle composed of a lipid membrane, A mutant into which a mutation that reduces binding affinity between the bodies is introduced, B) the transmembrane domain penetrates the lipid membrane of the vesicle, and C) an enzyme that is activated by the formation of the multimer. Is exposed inside the vesicle, D) the peptide is exposed outside the vesicle, and E) the protein having an affinity for the peptide is exposed outside the vesicle. With the peptide Biosensor, characterized in that the coupling.

[10] The biosensor according to [9], wherein the mutant of the enzyme activated by the formation of the multimer is a mutant of β-glucuronidase.

[11] The β-glucuronidase mutant has a configuration in which the 51st phenylalanine in the amino acid sequence of Escherichia coli β-glucuronidase is replaced by tyrosine, the 64th alanine is replaced by valine, the 185th aspartic acid is replaced by asparagine, and the 516th position. Methionine is replaced with lysine, 525th tyrosine is replaced with phenylalanine, 559th glycine is replaced with serine, 567th lysine is replaced with arginine, 585th glutamine is replaced with histidine, and 601st position. The biosensor according to [10], wherein the glycine is a mutant in which aspartic acid is substituted.

[12] The biosensor according to any one of [9] to [11], wherein the transmembrane domain is a transmembrane domain of epidermal growth factor receptor.

[13] The biosensor according to any one of [9] to [12], wherein the lipid membrane is a lipid membrane containing phospholipid and cholesterol.

[14] The peptide according to any one of [9] to [13], wherein the peptide is an Spy tag, a Snoop tag or a derivative thereof, and the protein having an affinity for the peptide is an Spy catcher, a Snoop catcher or a derivative thereof The biosensor described.

[15] The biosensor according to any one of [9] to [14], wherein the antibody variable region is VHH derived from a camelid heavy chain antibody.

[16] A method for detecting an antigen in a sample, which comprises contacting the sample with the biosensor according to any of [9] to [15], and detecting the formation of a multimer by a change in enzyme activity. A method for detecting an antigen, which comprises a step.

The present specification includes the contents described in the specification and / or drawings of the Japanese patent application, Japanese Patent Application No. 2018-207624, which is the basis of the priority right of the present application.

The present invention provides a novel biosensor. Since this biosensor can detect a substance easily and with high sensitivity, it is expected to be used in the medical field such as clinical diagnosis.

Shows the structure of the expression vector His ₆ -GUS_IV5_KY and His ₆ -TM-GUS_IV5_KY. A transmission image (top) and a fluorescence image (bottom) of the liposome 10 minutes after the addition of the enzyme substrate. A transmission image (upper row) and a fluorescence image (lower row) of the liposome 1 hour after the addition of the enzyme substrate. The figure which represented typically the mechanism in which GUS tetramer is formed in presence of anti-His antibody. Transmission and fluorescence images of liposomes 5 to 10 minutes after addition of enzyme substrate. The upper left is an image when expressing His ₆ -GUS_IV5_KY and His ₆ -TM-GUS_IV5_KY vector, and an anti-His antibody is added, and the lower left is expressing His ₆ -GUS_IV5_KY and His ₆ -TM-GUS_IV5_KY vector, and anti-His The image when no antibody was added, the upper right is an image when only the His ₆ -GUS_IV5_KY vector was expressed, and the image when an anti-His antibody was added, the lower right is only the His ₆ -GUS_IV5_KY vector was expressed, and the anti-His It is an image when an antibody is not added.

Hereinafter, the present invention will be described in detail.
(A) Antibody-detecting biosensor The antibody-detecting biosensor of the present invention is a biosensor for detecting an antibody that binds to a peptide, and is 1) a mutant of an enzyme and a transmembrane domain that are activated by the formation of a multimer. And a peptide containing the above-mentioned peptide, and 2) a vesicle composed of a lipid membrane, and A) a mutant of the enzyme, wherein the mutant has a mutation that reduces binding affinity between monomers. B) the transmembrane domain penetrates the lipid membrane of the vesicle, C) the variant of the enzyme activated by the formation of the multimer is exposed inside the vesicle, and ) A biosensor, wherein the peptide is exposed to the outside of the vesicle.

The principle of detecting an antibody in a sample by the biosensor of the present invention is described below. This biosensor contains a fusion protein and a vesicle. The fusion protein penetrates the lipid membrane of the vesicles, the peptide portion that binds the antibody is exposed outside the vesicle, and the enzyme portion is exposed inside the vesicle. When the antibody is not present in the sample, the enzyme does not form a multimer and is not activated because a mutation that reduces the binding affinity between the monomers is introduced. Therefore, even if an enzyme substrate is present, reaction products such as fluorescent substances are scarcely produced. On the other hand, when the antibody is present in the sample, the two peptides exposed on the outside of the vesicle are attracted to the antibody, whereby the enzyme moiety linked to the peptide binds, forms a multimer, and is activated. A reaction product is generated in the vesicle by the activated enzyme, but since this reaction product is concentrated in the vesicle, even a trace amount can be easily detected. Further, since such enzyme activation occurs for each vesicle, vesicles that produce a reaction product and vesicles that do not produce a reaction product occur unless the amount of antibody is very large. Since the number of vesicles that produce a reaction product increases depending on the amount of antibody, the amount of antibody can be grasped as the “number” of vesicles.

“The enzyme that is activated by the formation of a multimer” means an enzyme that exhibits activity or improves activity only when several monomers are bound. The number of monomers constituting the multimer is not particularly limited, and an enzyme that activates any of a dimer, a trimer, a tetramer, a pentamer, a hexamer and the like may be used. The enzyme activated by the formation of the multimer is preferably an enzyme whose activity can be easily detected or measured. For example, an enzyme that can detect or measure a product or a substrate based on the absorbance, fluorescence intensity, and emission intensity. Specific examples of enzymes that are activated by the formation of multimers include those commonly used as reporter enzymes, for example, β-glucuronidase (activated by tetramer), β-galactosidase (activated by tetramer). , Alkaline phosphatase (activated by dimer), malate dehydrogenase (activated by dimer) and the like.

The mutations that reduce the binding affinity between the monomers include the mutations introduced at the binding sites between the monomers. For many enzymes that are activated by the formation of multimers, the amino acid sequence and the binding site between the monomers have been clarified. Understand how affinity can be reduced. The degree of decrease in affinity may be such that the formation of multimers becomes difficult due to the decrease in binding affinity between the monomers, and thus the difference in activity from the wild-type enzyme can be recognized. Mutants in which mutations that reduce the binding affinity between monomers are introduced include those with reduced affinity for all bonds between monomers, as well as the affinity for some bonds between monomers. It also includes the ones that have decreased only. Therefore, a mutant that forms a dimer but does not easily form a tetramer, such as a β-glucuronidase mutant described below, is also introduced with a mutation that reduces the binding affinity between the monomers. Included in the mutant.

As a specific example of the mutant in which the binding affinity between the monomers is reduced, a mutant in which the 516th methionine and / or the 517th tyrosine in the amino acid sequence of Escherichia coli β-glucuronidase is substituted with another amino acid is given. be able to. Examples of the other amino acid substituted with the 516th methionine include lysine, and examples of the other amino acid substituted with the 517th tyrosine include glutamic acid.

A mutation may be introduced into the β-glucuronidase mutant in addition to the above-mentioned mutation that decreases the binding affinity between the monomers. An example of such a mutation is a mutation that improves thermostability. A large number of references (for example, Flores H. et al., J Mol Biol. 2002 Jan 18; 315 (3): 325-37) describe what mutations should be introduced to improve the thermostability of β-glucuronidase. As described, the person skilled in the art can identify the mutations according to those documents. Specific examples of mutations that improve the thermostability of β-glucuronidase include a mutation in which the 27th asparagine in the amino acid sequence of Escherichia coli β-glucuronidase is replaced with tyrosine, a mutation in which the 51st phenylalanine is replaced with tyrosine, and a 64th mutation. Alanine is replaced with valine, 185th aspartic acid is replaced with asparagine, 349th isoleucine is replaced with phenylalanine, 369th asparagine is replaced with serine, 525th tyrosine Is a mutation in which is substituted with phenylalanine, a mutation in which glycine at position 559 is replaced with serine, a mutation in which lysine at position 567 is replaced with arginine, a mutation in which phenylalanine at position 582 is replaced with tyrosine, and a glutamine at position 585 are histidine Placed in Mutation, substitution of 601st glycine with aspartic acid (these mutations are Flores H. et al., J Mol Biol. 2002 Jan 18; 315 (3): 325-37 variant IV -5 is a mutation included in -5). The position of the above-mentioned amino acid mutation indicates the position in the amino acid sequence of β-glucuronidase derived from Escherichia coli, so in the amino acid sequences of β-glucuronidase derived from other organisms, the amino acid corresponding to the above-mentioned position may not exist. .. In such a case, the amino acid sequence is aligned with the amino acid sequence of β-glucuronidase derived from Escherichia coli on the basis of the amino acid sequence identity, thereby identifying the position of the amino acid mutation. The amino acid sequence of wild-type β-glucuronidase derived from Escherichia coli is shown in SEQ ID NO: 1.

Specific examples of suitable β-glucuronidase mutants include a mutant in which the 516th methionine in the amino acid sequence of Escherichia coli β-glucuronidase is replaced with lysine, and the 517th tyrosine is replaced with glutamic acid (see International Publication No. 2017/130610. 51) phenylalanine in the amino acid sequence of Escherichia coli β-glucuronidase is replaced with tyrosine, 64th alanine is replaced with valine, 185th aspartic acid is replaced with asparagine, and 516th methionine. Is replaced with lysine, 525th tyrosine is replaced with phenylalanine, 559th glycine is replaced with serine, 567th lysine is replaced with arginine, 585th glutamine is replaced with histidine, and 601st glycine is replaced. Asus Can be exemplified mutants substituted Ragin acid.

The transmembrane domain in the present invention may be any as long as it allows the fusion protein to penetrate the lipid membrane of vesicles. As the transmembrane domain in the present invention, the whole or a part of the transmembrane domain of a natural membrane protein can be used as it is, but those into which a mutation is introduced may be used. Suitable transmembrane domains can include the transmembrane domain of human epidermal growth factor receptor (EGFR).

The peptide in the present invention is not limited to a particular peptide, but a short peptide is preferable because it is difficult to expose it to the outside of the vesicle when the number of amino acid residues is large. Specifically, the number of amino acid residues in the peptide is preferably 3 to 25, more preferably 5 to 20. Peptides are also protein tags such as His tag, Spy tag 002 (Keeble AH et al., Angew Chem Int Ed Engl. 2017 Dec 22; 56 (52): 16521-16525), Snoop tag (Vegginiani F et al). ., Proc. Natl. Acad. Sci. USA113 (5): 1202-1207, 2016), HA tags, myc tags, and FLAG tags are preferable.

In the fusion protein, the variant of the enzyme activated by the formation of the multimer, the transmembrane domain, and the peptide are arranged in this order, but the variant of the enzyme activated by the formation of the multimer is N-terminal and the variant of the enzyme is also C-terminal. Well, conversely, the variant of the enzyme that is activated by the formation of multimers may be C-terminal and the peptide N-terminal.

The fusion protein may consist of only the mutant enzyme, transmembrane domain, and peptide that are activated by the formation of multimers, but may also contain other peptides or proteins. The fusion protein may also contain a linker between the variant of the enzyme that is activated by the formation of multimers and the transmembrane domain and / or between the transmembrane domain and the peptide. The linker may be any one as long as it can normally function the mutant of the enzyme which is activated by the formation of the multimer, the transmembrane domain, and the peptide. The length of the linker varies depending on the type of enzyme, transmembrane domain, and peptide used, but is usually 10 to 60 Å, preferably 30 to 40 Å. The number of amino acids in the linker may be any number so long as it has the above-mentioned length, but is usually 5 to 50, preferably 15 to 20. The amino acid sequence of the linker may be the same as the amino acid sequence of a general linker used when producing a fusion protein. Specifically, Gly-Gly-Gly-Gly-Ser (G ₄ S) repeat sequence (repetition number is usually 2 to 5), Glu-Ala-Ala-Ala-Lys (EAAAK) repeat sequence, Asp- Asp-Ala-Lys-Lys (DDAKK) repeat sequence and the like can be mentioned.

One mutant of the enzyme that is activated by the formation of the multimer may be contained in the fusion protein, but two or more mutants may be contained in the fusion protein. When two variants of the enzyme are included, they are arranged adjacent to each other via a linker. The linker used at this time may be the same as the above-mentioned linker.

Vesicles composed of lipid membranes may be similar to liposomes used for artificial cells. The component of the lipid membrane may be the same as the component of a general liposome membrane, and examples thereof include phospholipid and cholesterol. Phospholipids include 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1-palmitoyl-2-oleoyl- Mention may be made of sn-glycero-3-phosphocholine (POPC), of which POPC is preferably used. The size of the vesicles may be about the same as that of liposomes used for artificial cells and the like. Vesicles can be prepared in the same manner as general liposomes.

The biosensor of the present invention contains a fusion protein and vesicles, but may contain other substances. For example, when the enzyme activated by the formation of multimers is β-glucuronidase, it is preferable that the vesicle contains a fusion protein having no transmembrane domain. This is for the following reason. β-glucuronidase becomes an active form by forming a tetramer, but even if two fusion proteins come close to each other due to the presence of an antibody, the fusion protein usually contains only one molecule of β-glucuronidase mutant. It is a dimer that forms, and a tetramer does not. At this time, if there are fusion proteins having no transmembrane domain in the vesicles, they can further bind to the above dimer and form a tetramer.

The biosensor of the present invention has the following advantages.
1) Homogeneous measurement is possible, and the antibody can be measured simply and quickly.
2) Since the enzymatic reaction is carried out in a narrow space within the vesicle, the reaction product is not diluted and the antibody can be measured with high sensitivity.
3) The vesicles to which the antibody is bound emit a signal such as fluorescence, and the vesicles to which the antibody is not bound do not emit a signal, so that the signal can be binarized and the influence of measurement error can be reduced.

(B) Method for producing biosensor The method for producing a biosensor of the present invention is a method for producing the above-mentioned antibody detection biosensor, which is characterized by including the following steps (1) to (5). ..

In the step (1), a vector expressing a fusion protein containing a mutant of an enzyme activated by the formation of a multimer, a transmembrane domain and a peptide, a reagent required for cell-free transcription, and a cell-free translation necessary. An aqueous solution containing reagents is prepared.

As the vector expressing the above fusion protein, a commercially available expression vector into which a gene encoding the fusion protein is inserted can be used. As a reagent necessary for cell-free transcription, a reagent used in a general cell-free transcription reaction can be used, and examples thereof include ribonucleotide, RNA polymerase, transcription cofactor and the like. As a reagent required for cell-free translation, a reagent used in a general cell-free translation reaction can be used, and examples thereof include amino acids, ribosomes, and translation cofactors. Since reagents necessary for cell-free transcription and reagents necessary for cell-free translation are commercially available, commercially available products may be used. The concentrations of the vector and the reagent in the aqueous solution are not particularly limited, and may be the same as those in general cell-free transcription reaction and cell-free translation reaction.

In step (2), the aqueous solution prepared in step (1) is dispersed in an oil phase containing phospholipids and cholesterol to form a W / O emulsion.

The amount of the aqueous solution dispersed in the oil phase is not particularly limited as long as it is an amount capable of forming a W / O emulsion. The concentrations of phospholipid and cholesterol in the oil phase are not particularly limited, and may be the same as those in a general method for producing a W / O emulsion.

In the step (3), the W / O emulsion generated in the step (2) is overlaid on the aqueous solution, and then centrifuged to precipitate the liposome, which contains the vector and the reagent therein, in the aqueous solution. ..

The aqueous solution may be any as long as it can form an aqueous phase for the W / O emulsion (oil phase). The conditions of centrifugation are not particularly limited, and may be the same as the conditions in a general method for forming liposomes.

In step (4), the liposomes formed in step (3) are collected. The method for collecting the liposomes is not particularly limited, and for example, when an oil phase is formed in the upper part of the tube and an aqueous phase is formed in the lower part, and centrifugation is performed, the bottom part of the tube may be perforated to collect the liposomes. it can.

In step (5), transcription and translation reactions proceed in the liposomes collected in step (4).

(C) Method for detecting antibody The method for detecting an antibody of the present invention is a method for detecting an antibody in a sample, which comprises contacting the sample with the antibody detection biosensor described above, It is characterized by having a step of detecting by a change.

The sample may be any sample as long as it may contain the antibody to be detected.

The contact method between the sample and the biosensor is not particularly limited, but usually it is carried out by allowing the sample and the biosensor to coexist in a solution. Conditions such as temperature, time, pH of the solution, and amount of the biosensor used in this contacting step may be those generally used for the enzyme contained in the biosensor. For example, when the enzyme contains a β-glucuronidase mutant, the temperature in this contacting step is preferably about 20 to 37 ° C., the contacting time is preferably about 10 to 60 minutes, and the pH of the solution is 6.8 to 7 The concentration of the biosensor in the solution is preferably about 10 to 100 nM.

The formation of multimers can be detected by the change (increase or expression) in the activity of the enzyme mutant contained in the biosensor. The activity of the enzyme variant contained in the biosensor can be measured by an activity measuring method generally used for the enzyme. For example, when the enzyme variant contained in the biosensor is a β-glucuronidase variant, the activity can be measured by adding a chromogenic substrate or a fluorescent substrate and quantifying a substance produced from the substrate. Examples of chromogenic substrates for β-glucuronidase include X-Gluc, 4-nitrophenyl α-glucopyranoside, 4-nitrophenyl β-D-glucuronide, and the like, and fluorescent substrates include 4-methylumbelliferyl-β-D- Examples thereof include glucuronide, fluorescein di-β-D-glucuronide, fluorescein di-β-D-glucuronide and dimethyl ester. The substances produced from these substrates can be quantified by measuring the absorbance at a specific wavelength, the fluorescence intensity and the like. For example, if the substrate is 4-nitrophenyl β-D-glucuronide, the product can be quantified by measuring the absorbance around 405 nm, and if the substrate is 4-methylumbelliferyl-β-D-glucuronide, the product can be 340 The product can be quantified by exciting with fluorescence of nm and measuring the fluorescence intensity around 480 nm. However, if the substrate is membrane-permeable like fluorescein di-β-D-glucuronide and dimethyl ester, and the fluorescent substance of the product is water-soluble like fluorescein, the substrate is added from the outside of the liposome and reacted, It is preferable because the fluorescence of the product in each liposome can be individually detected.

(D) Antigen detection biosensor The antigen detection biosensor of the present invention comprises an antibody variable region and a protein having an affinity for the peptide in the peptide portion exposed to the outside of the vesicle in the antibody detection biosensor of the present invention. Which is a biosensor for detecting an antigen that binds to an antibody variable region, and more specifically, 1) a mutation of an enzyme that is activated by the formation of a multimer. A first fusion protein containing a body, a transmembrane domain and a peptide, 2) a second fusion protein containing the antibody variable region and a protein having an affinity for the peptide, and 3) a lipid membrane A) the mutant of the enzyme is a mutant into which a mutation that reduces the binding affinity between monomers has been introduced, and B) the transmembrane domain. In penetrates the lipid membrane of the vesicle, C) a variant of the enzyme that is activated by the formation of the multimer is exposed inside the vesicle, and D) the peptide is outside the vesicle. The biosensor, which is exposed and which has the affinity with the peptide E), binds to the peptide exposed to the outside of the vesicle.

The principle of detecting an antigen in a sample by the biosensor of the present invention is described below. The biosensor includes a first fusion protein, a second fusion protein, and vesicles. The first fusion protein penetrates the lipid membrane of the vesicle, exposing the peptide portion outside the vesicle and the enzyme portion inside the vesicle. In addition, the protein portion showing affinity for the peptide in the second fusion protein binds to the peptide portion in the first fusion protein, so that the vesicle exposes the antibody variable region to the outside. When the antigen is not present in the sample, the enzyme does not form a multimer and is not activated because the mutation that reduces the binding affinity between the monomers is introduced. Therefore, even if an enzyme substrate is present, reaction products such as fluorescent substances are scarcely produced. On the other hand, when the antigen is present in the sample, the two antibody variable regions exposed outside the vesicle are attracted to the antigen. Since the antibody variable region is indirectly linked to the enzyme part inside the vesicle, the two antibody variable regions are attracted to the antigen, and the enzyme part inside the vesicle binds to form a multimer, Activate. A reaction product is generated in the vesicle by the activated enzyme, but since this reaction product is concentrated in the vesicle, even a trace amount can be easily detected. Further, since such enzyme activation occurs for each vesicle, vesicles that produce reaction products and vesicles that do not produce reaction products occur unless the amount of antigen is very large. Since the number of vesicles that produce a reaction product increases depending on the amount of antigen, it is possible to grasp the amount of antigen as the “number” of vesicles.

As the enzyme mutants, transmembrane domains, peptides, and vesicles that are activated by the formation of multimers, the same biosensors as those of the antibody detection biosensor of the present invention can be used.

The protein having an affinity for the peptide is not particularly limited, and can be appropriately selected according to the type of peptide. An example of a combination of a peptide and a protein having an affinity for the peptide is Spy tag and Spy catcher. When Spy tag and Spy catcher are mixed, they form an isopeptide bond (Keeble AH et al., Angew Chem Int Ed Engl. 2017 Dec 22; 56 (52): 16521-16525). Instead of the Spy tag, a derivative of Spy tag capable of binding to the Spy catcher can be used, and in place of the Spy catcher, a derivative of Spy catcher capable of binding to the Spy tag can be used. Also, a pair of Snoop tag and Snoop catcher that has orthogonality with this (Vegginiani F et al., Proc. Natl. Acad. Sci. USA 113 (5): 1202-1207, 2016) is used for Alternatively or simultaneously, they can be used. Regarding Snoop tags and Snoop catchers, as with Spy tags and Spy catchers, these derivatives can be used instead of Snoop tags and Snoop catchers.

As the antibody variable region, a V _H region or V _L region of an ordinary antibody (IgG), a single chain antibody scFv or Fab region can be used, but a VHH (camel that forms a dimer by antigen binding) Derived H chain antibody) (Chang HJ et al., ACS Synth Biol. 2018 Jan 19; 7 (1): 166-175, Sonneson GJ et al., Biochemistry. 2009 Jul 28; 48 (29): 6693-5. ) Is preferably used. The antibody variable region can select the variable region of any antibody according to the antigen to be detected, and is not limited to the variable region of a specific antibody. Specifically, the variable region of an antibody that specifically binds to an antigen to be detected, which will be described later, can be used.

The second fusion protein may consist of only the antibody variable region and the protein showing affinity for the peptide, but may also contain other peptides or proteins. In addition, the second fusion protein may include a linker between the antibody variable region and the protein membrane showing affinity for the peptide. The linker may be the same as the linker contained in the fusion protein in the antibody detection biosensor described above.

(E) Antigen Detection Method The antigen detection method of the present invention is a method for detecting an antigen in a sample, which comprises the step of contacting the sample with the above biosensor, and the formation of a multimer by changing the enzymatic activity. It is characterized by having a step of detecting.

The antigen to be detected is not particularly limited, and a low molecular weight compound (for example, a compound having a molecular weight of 1000 or less) may be a detection target, and a high molecular compound such as a protein may be a detection target. The detection of high molecular weight proteins can be performed using two single chain antibodies or Fab fragments. Further, since the method of the present invention can be used for diagnosis of diseases, food toxicity test, environmental analysis, etc., it is preferable to target substances related to these. Specifically, neonicotinoid pesticides such as imidacloprid, polychlorinated biphenyls, environmental pollutants such as bisphenol A, toxic substances such as mycotoxin, osteocalcin (effective for diagnosing osteoporosis), corticoid, estradiol, aldosterone, lysozyme (chicken). Biological materials such as egg white lysozyme) and drugs such as digoxin.

The sample may be any sample as long as it may contain the antigen to be detected, such as samples collected from humans (blood, saliva, urine, etc.), contaminated water or Examples thereof include soil, food and raw materials for food.

The method of contacting the sample with the biosensor and the method of detecting the formation of the multimer can be performed in the same manner as in the antibody detection biosensor described above.

Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited to these examples.

(A) Method
(1) Construction of Expression Vector cDNA encoding the human EGFR transmembrane domain (TM) was prepared using two primers (His_TM_Back: TGCACCATCATCATCATCATCATCATATCGCCACTGGGATG (SEQ ID NO: 2), TM_Hind_Forward: CACCGCCACCAAGCTTCATGAAGAGGCCGATCCC (SEQ ID NO: 3)) and RCOiken-EGFR (RCO12-EGFR) as a template. gene bank) and amplified by PCR according to a conventional method. In addition, a DNA encoding His ₆ (CACCATCATCATCATCAT) (SEQ ID NO: 4) was constructed by using two overlapping primers (His_NdeI_Back: AAGGAGACATACATATGCACCATCATCATCATCAT (SEQ ID NO: 5) and His_Hind_Forward: ACCGCCACCAAGCTTATGATGATGATGATGGTGCA (SEQ ID NO: 6)) by thermal cycling. .. The His ₆ -TM fusion sequence was constructed by overlap extension PCR using His_NdeI_Back and TM_Hind_Forward as primers and the His ₆ and TM DNA obtained in the previous step as template.

The His ₆ and His ₆ -TM genes thus constructed were inserted into the NdeI / HindIII digested linear pET32 vector encoding the GUS_IV5_KY gene using the In-Fusion HD cloning kit (Clontech, Takara-Bio). As a result, two types of expression vectors His ₆ -GUS_IV5_KY and His ₆ -TM-GUS_IV5_KY were obtained (Fig. 1). The GUS_IV5_KY gene is a gene encoding a mutant of Escherichia coli GUS containing 13 mutations of N27Y, F51Y, A64V, D185N, I349F, N369S, M516K, Y525F, G559S, K567R, F582Y, Q585H, and G601D.

(2) In vitro transcription / translation reaction His ₆ -GUS_IV5_KY and His ₆ -TM-GUS_IV5_KY vectors (1: 1) (total 0.1 μg), PUREfrex (registered trademark, Gene Frontier) 1.0 (solution I 10 μL, solution II 1 μL and Solution III 1 μL), RNase inhibitor (Wako Pure Chemicals 20 unit / μL x 1 μL), GSSG (3 mM), and sucrose (330 mM) were added Milli-Q water to make the total volume 20 μL.

(3) W / O emulsion
(3.1) Dissolve 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC, NOF) and cholesterol (Wako Pure Chemical Industries) in chloroform (Wako Pure Chemical Industries) at 100 mg / mL each. did.
(3.2) By adding liquid paraffin (Wako Pure Chemical Industries, Ltd.) to the chloroform solution obtained in the final step, POPC and cholesterol were diluted to a final concentration of 5 mg / mL.
(3.3) Heated at 80 ° C for 20 minutes to remove chloroform.
(3.4) POPC and cholesterol were mixed at a weight ratio of 9: 1.
(3.5) The mixture was heated at 80 ° C for 20 minutes to remove residual chloroform.
(3.6) 20 μL of the reaction mixture was mixed with 400 μL of POPC / cholesterol solution by vortexing for 30 seconds to obtain a W / O emulsion.

(4) Preparation of liposome suspension
(4.1) 150 μL of dilution buffer (100 mM HEPES pH 7.6, 280 mM potassium glutamate, 20 mM Mg (OAc) ₂ , NTP (3.75 mM ATP, 2.5 mM GTP, 1.35 mM CTP, 1.35 mM UTP, 20 amino acids (each (Excluding 0.3 mM Tyr and Cys), 15 mM creatine phosphate, 330 mM glucose, 3 mM GSSG, 20 μg / mL bovine pancreatic RNase (Sigma-Aldrich)) were placed in a microtube.
(4.2) The biphasic system was centrifuged at 18,000 g for 30 minutes at 4 ° C to form giant unilamellar liposomes in the aqueous phase (dilution buffer).
(4.3) The aqueous phase (liposome suspension) was collected by piercing the bottom of the tube with a syringe equipped with an 18 G x 1 1/2 inch needle.

(5) Detection of enzyme activity
(5.1) The liposome suspension was incubated at 37 ° C for 2 to 4 hours.
(5.2) Centrifuge at 18,000 g for 30 minutes, discard the supernatant and add 150 μL of dilution buffer to resuspend the liposomes.
(5.3) Add anti-His antibody (0.1 μM, anti-His ₆ Mab28-75, Wako Pure Chemical Industries), 0.1 mg / mL fluorescein di-β-D-glucuronide, dimethyl ester (Marker Gene Technologies) to the liposome suspension. After reacting for about 10 minutes at room temperature, the cells were observed under an inverted fluorescence microscope (Olympus IX71, x10 eyepiece, x60 objective lens, Ex. 460 to 480 nm, Em. 495 to 540 nm).

(B) Results When the His ₆ -GUS_IV5_KY and His ₆ -TM-GUS_IV5_KY vectors were expressed, the liposomes fluoresced in the presence of the anti-His antibody (third from the left in FIGS. 2 and 3), but the anti-His It did not fluoresce in the absence of antibody (second from the left in FIGS. 2 and 3). The fluorescence of the liposomes in the presence of the anti-His antibody was due to the interaction between the anti-His antibody and the His ₆ portion, which brought the two His ₆ -TM-GUS_IV5_KY fusion proteins into close proximity, and further to these two His ₆ -GUS_IV5_KY. It is considered that this is because the fusion proteins were close to each other and active tetrameric GUS was formed (FIG. 4). In order for the liposome to fluoresce, the GUS_IV5_KY portion of the fusion protein must be inside the liposome, and in order for the His ₆ portion of the fusion protein to interact with the anti-His antibody, this portion must be present. Must be outside the liposome. Therefore, the fact that fluorescence was observed only in the presence of the anti-His antibody indicates that the GUS_IV5_KY portion of the fusion protein was inside the liposome and the His ₆ portion was outside the liposome. On the other hand, when the vector is not expressed, fluorescence of the liposome is not observed (first from the left in FIGS. 2 and 3), and when the vector containing the wild-type GUS is expressed, the liposome is not present even in the presence of the anti-His antibody. Fluorescence was observed (fourth from the left in FIGS. 2 and 3).

In order to investigate the function of the transmembrane domain in the fusion protein, only the His ₆ -GUS_IV5_KY vector, which does not contain the sequence encoding the transmembrane domain, was expressed, and it was investigated whether the liposome fluoresces. As shown in the image on the upper right of FIG. 5, when only the His ₆ -GUS_IV5_KY vector was expressed, no fluorescence was observed even when the anti-His antibody was added.

All publications, patents and patent applications cited in this specification shall be incorporated as they are in this specification.

Since the present invention relates to biosensors, it can be used in the industrial field handling such biosensors.

Claims

A biosensor for detecting an antibody that binds to a peptide, comprising: 1) a fusion protein containing a variant of an enzyme activated by formation of a multimer, a transmembrane domain, and the peptide, and 2) a lipid membrane A) the enzyme is a mutant in which a mutation that reduces the binding affinity between monomers is introduced, and B) the transmembrane domain is a lipid of the vesicle. Characterized in that it penetrates the membrane, C) a variant of the enzyme that is activated by the formation of the multimer is exposed inside the vesicle, and D) the peptide is exposed outside the vesicle. Biosensor to do.
The biosensor according to claim 1, wherein the mutant of the enzyme activated by the formation of the multimer is a mutant of β-glucuronidase.
In the mutant β-glucuronidase, the 51st phenylalanine in the amino acid sequence of Escherichia coli β-glucuronidase was replaced with tyrosine, the 64th alanine was replaced with valine, the 185th aspartic acid was replaced with asparagine, and the 516th methionine was replaced with Substituting lysine, 525th tyrosine with phenylalanine, 559th glycine with serine, 567th lysine with arginine, 585th glutamine with histidine, 601st glycine with The biosensor according to claim 2, which is a mutant substituted with aspartic acid.
The biosensor according to any one of claims 1 to 3, wherein the transmembrane domain is a transmembrane domain of epidermal growth factor receptor.
The biosensor according to any one of claims 1 to 4, wherein the lipid membrane is a lipid membrane containing phospholipid and cholesterol.
The biosensor according to any one of claims 1 to 5, wherein the peptide is a His tag, Spy tag, Snoop tag, HA tag, myc tag, or FLAG tag.
7. The method for manufacturing a biosensor according to claim 1, further comprising the following steps (1) to (5):
(1) Includes a vector expressing a fusion protein containing a mutant of an enzyme activated by the formation of a multimer, a transmembrane domain and a peptide, a reagent required for cell-free transcription, and a reagent required for cell-free translation Preparing an aqueous solution,
(2) A step of dispersing the aqueous solution prepared in step (1) in an oil phase containing phospholipids and cholesterol to produce a W / O emulsion,
(3) A step of forming a liposome containing the vector and the reagent inside in an aqueous solution by overlaying the W / O emulsion generated in step (2) on the aqueous solution and sedimenting by centrifugation.
(4) a step of collecting the liposome formed in the step (3),
(5) A step of advancing transcription and translation reactions in the liposome recovered in step (4).
A method for detecting an antibody in a sample, which comprises a step of contacting the sample with the biosensor according to any one of claims 1 to 6, and a step of detecting the formation of a multimer by a change in enzyme activity. A method for detecting an antibody, comprising:
A biosensor for detecting an antigen that binds to an antibody variable region, comprising: 1) a first fusion protein containing a variant of an enzyme activated by the formation of a multimer, a transmembrane domain and a peptide, 2) A second fusion protein containing the antibody variable region and a protein having an affinity for the peptide, and 3) a vesicle composed of a lipid membrane, wherein A) the mutant of the enzyme is between monomers. A variant into which a mutation that reduces binding affinity is introduced, B) the transmembrane domain penetrates the lipid membrane of the vesicle, and C) a variant of an enzyme that is activated by the formation of the multimer. Is exposed inside the vesicle, D) the peptide is exposed outside the vesicle, and E) the protein having an affinity for the peptide is the peptide exposed outside the vesicle. Union Biosensor characterized by Rukoto.
The biosensor according to claim 9, wherein the mutant of the enzyme activated by the formation of the multimer is a mutant of β-glucuronidase.
In the mutant β-glucuronidase, the 51st phenylalanine in the amino acid sequence of Escherichia coli β-glucuronidase was replaced with tyrosine, the 64th alanine was replaced with valine, the 185th aspartic acid was replaced with asparagine, and the 516th methionine was replaced with Substituting lysine, 525th tyrosine with phenylalanine, 559th glycine with serine, 567th lysine with arginine, 585th glutamine with histidine, 601st glycine with The biosensor according to claim 10, wherein the biosensor is a mutant substituted with aspartic acid.
The biosensor according to any one of claims 9 to 11, wherein the transmembrane domain is a transmembrane domain of epidermal growth factor receptor.
The biosensor according to any one of claims 9 to 12, wherein the lipid membrane is a lipid membrane containing phospholipid and cholesterol.
14. The bio according to any one of claims 9 to 13, wherein the peptide is Spy tag, Snoop tag or a derivative thereof, and the protein having an affinity for the peptide is Spy catcher, Snoop catcher or a derivative thereof. sensor.
The biosensor according to any one of claims 9 to 14, wherein the antibody variable region is a VHH derived from a camelid heavy chain antibody.
A method for detecting an antigen in a sample, which comprises a step of bringing the sample into contact with the biosensor according to any one of claims 9 to 15, and a step of detecting the formation of a multimer by a change in enzyme activity. A method for detecting an antigen, comprising: